Background of the Invention Von Recklinghausen neurofibromatosis or neurofibromatosis type 1 (NF1) is one of the most common autosomal dominant genetic disorders with an incidence of 1 in 3000 in all ethnic groups. NF1 is characterized by cafe au lait spots, cutaneous neurofibromas, axillary freckling and Lisch nodules of the iris [Riccardi VM, 2nd ed. Baltimore: John Hopkins University Press <BR> <BR> (1992) ]. Individuals with NF1 are at increased risk (10%) of malignant tumors of the nervous system, such as Malignant Peripheral Nerve Sheath Tumor (MPNST-also previously was known as neurofibrosarcoma), optic nerve glioma, and phaeochromocytoma [Huson SM, Hughes RAC : The neurofibromatosis : A clinical and pathogenetic overview, London: Chapman and Hall (1994) ]. In children the most frequent malignancies include typical leukemias (juvenile CML), neuroblastoma, rhabdomyosarcoma, Wilms'tumor and optic gliomas [Sorensen SA, et al., J. Med. , 314: 1010- 1015 (1986)].

The mutation rate in the NF1 gene is one of the highest reported in any human disease (1 in 104 germ cells) and approximately half of all cases are caused by new mutations. These patients are sporadic and have no family history of the disease [Riccardi VM, ibid. (1992)].

The disease is caused by mutations of the NF1 gene located on chromosome 17qll. 2. The gene is one of the largest genes in the genome, it spans 350 kb of genomic DNA [Viskochil D, et al. Cell, 62: 187-192 (1990); Cawthon RM, et al. Cell, 62: 193- 201 (1990); Wallace MR, et al. Science, 249: 181-186 (1990) ], contains 60 exons and the full length transcript is approximately 13 kb [Li Y, et al. Genomics, 25: 9-18 (1995)].

The NF1 gene product, neurofibromin, is widely expressed in most tissues [Daston MM, et at. Neuron, 8: 415-419 (1992) ]. One region of neurofibromin (corresponding to exons 21-27b) is structurally and functionally homologous to GTPase-activating protein (GAP) for p21raS. This GAP related domain (also termed as GRD) accelerates the hydrolysis of p2lras-GTP to p21raS- GDP [Xu G, et al., Cell, 62: 599-608 (1990)].

NF1 is considered a tumor suppressor gene because of the observed loss of the wild type NF1 allele in different tumors that develop in NF1 patients [Xu W, et al., Gene. Chrom. Cancer, 4: 337-342 (1992); Shannon KM, et al., N. Engl. J. Med. , 330: 597-601 (1994); Legius E, et al. Nature Genetics, 3: 122-126 (1993); Glover TW, et al. Genes Chrom. Cancer 3: 62-70 (1991)] and in sporadic tumors or cell lines prepared from them [Andersen LB, et al. Nat. Genet. 3: 118-121 (1993); Murthy AE, et al. Nat. Genet. 3: 62-66 (1993) ]. The loss of function of neurofibromin in inactivating the proto- oncogene paras results in high levels of activated Ras.

Examination of the intron-exon organization of the NF1 gene revealed the presence of four alternatively-spliced exons. The first alternatively spliced exon-exon 23a is located within the GAP-related domain (GRD) and inserts 63 nucleotides into NF1 mRNA [Marchuk DA, et al. Genomics, 11: 931-940 (1991) ]. This isoform is expressed in all of the tissues analyzed, and produces a protein with GAP activity, but its ability to down-regulate ras is significantly reduced [Andersen LB, et al. Mol. Cell. Biol., 13: 487-495 (1993)].

The second-exon 48a-is located in the extreme carboxy terminus of the NF1 gene and inserts 54 nucleotides in the NF1 mRNA. This isoform was originally detected in a fetal brain cDNA library but is highly expressed in cardiac muscle, skeletal muscle and smooth muscle. Trace levels are detected in brain and nerve [Gutman DH, et al. Hum. Mol. Genet. 2: 989- 992 (1993)].

The third-replaces exon 11, thereby generating a very truncated transcript of 2.9 kb, is devoid of the GAP-related domain and its function remains to be elucidated [Suzuki H, et al. Biochem. Biophys. Res. Commun.

187: 984-990 (1992)].

The fourth-exon 9br, is located in the 5'part of the gene and inserts 30 nucleotides between exons 9 and 10. This isoform is highly expressed in the central nervous system and is not expressed in any of the other normal tissues tested. Analysis of brain tumors indicated a reduced expression in brain tumors (medulloblastoma and oligodendrogliomas). None of the tumors that developed in the peripheral nervous system expressed 9br [Danglot G, et al. Hum. Mol. Genet. 4: 915-920 (1995)].

Four neurofibromin isoforms encoded by the first two alternatively spliced exons, are currently known. Type 1 isoform lacking both 23a and 48a. This isoform has been shown to be an excellent negative regulator of p21 Ras and functions in-vitro and in-vivo as a GTPase-activating protein (GAP).

Type 2 isoform, containing only the 23a, has been shown as a 10-fold less efficient negative regulator of p21-Ras. Type 3 isoform, contains only 48a and was identified in rat heart and muscle and not in liver, brain, kidney or spleen [Gutmann DH, et al., Developmental Dynamics 202: 302-311 (1995)].

Type 4 contains both 23a and 48a and has been demonstrated in rat heart muscle tissues [Gutmann DH, et al., Cell Growth & Differentiation 6: 315- 323 (1995)].

Type 1 and type 2 neurofibromin have been demonstrated as performing different functional properties relative to microtubule association and GTPase activity. Examination of the normal pattern of expression of these NF1 isoforms in adult tissue and during development indicated that both isoforms are expressed at varying levels in adult tissue and are developmentally regulated during embryogenesis. Neurons in the central nervous system express predominantly type 1 NF1, while type 2 has been shown to be predominantly expressed in glial cells [Gutmann DH, et al., Cell Growth & Differentiation. ibid. (1995)].

During embryogenesis neurofibromin has been found to be expressed as early as embryonic day 8. At day 11 an increase of NF1 transcripts occurred and it was expressed in all tissues. Type 1 and 2 showed a different time course of expression and tissue localization, supporting distinct functional roles for both types in Ras-mediated cell proliferation and differentiation during mouse fetal development [Huynh DP, et al. Developmental Biology, 161: 538-551 (1994) ]. Therefore, differential expression of the two isoforms type 1 and 2 might be involved in mediating the developmental regulation of Ras proteins.

Moreover, type 1 was predominantly expressed in undifferentiated cells, whereas type 2 predominates in differentiated cells. Furthermore, the expression pattern of both types changes in neuroblastoma cell line after neuronal differentiation was induced by retinoic acid treatment. This suggests that the differential expression of type 1 and type 2 NF1-GRD transcripts might be an"on/off"switch that regulates the catalytic activity of the NF1 gene product which plays an important role in the regulation of neuronal differentiation [Nish T, et al. Oncogene, 6: 1555-1559 (1991)].

Since the NF1 gene encodes the GRD (GAP related domain), it has been proposed that this domain may act as a tumor-suppressor gene. According to this model, loss of function of the NF1-GRD might have the same tumor promoting effect on cells as point mutations of the Ras genes, leading to a permanent stimulation of the Ras signal transduction pathways. This hypothesis has been supported by the observation that mice carrying a germ line mutation in the murine homologue of the NF1 gene frequently develop neural-crest-derived tumors [Jacks T, et al., Nature Genet. , 7: 353-<BR> 361 (1994) ]. In human, abnormal regulation of p21 Ras or NF1 gene mutations have been found in NFl-associated tumors [Xu W, et al., Genes Chrom. Cancer, 4: 337-342 (1992)].

However, examination of the preferred expression of one of the two main NF1 isoforms type 1 or type 2 in different tumors revealed contradicting results.

Some groups reported a predominance of the type 1 isoform in different tumors.

Measurements of the relative expression of the two isoforms of NF1 in cultured normal and malignant human ovarian surface epithelial cells (HOSE) and in invasive and borderline ovarian tumor tissue, revealed significant decrease in type 2 isoform and increase in type 1 isoform expression in ovarian cancer cells and tumor tissue [Iyengar, et al., Oncogene 18 (1) : 257-262 (1999)].

In another study, analysis of the differential expression of both NF1 isoforms was performed in human gastric cancer cell lines. This study reveled that both isoforms were equally expressed in most cell lines examined. However, type 2 isoform was predominantly expressed in normal stomach mucosa [Uchida, et al., Biochem. Biophys. Res. Commun.

187 (1) : 322-329 (1993)].

In contrast to these findings, other research groups demonstrated predominant expression of the type 2 isoform in different tumors. For example, Ogata et al., [Cancer Lett. , 172 (2): 159-164 (2001) ], showed the absence of expression of type 1 isoform in different breast cancer cell lines (MB-231 and MDA-MB-231). Elevated expression of the type 2 isoform as well as decrease in type 1 expression has been also shown in urinary bladder transitional cell carcinoma (TCC) [Aaltonen, et al., Am. J. Pathol.

154 (3): 755-765 (1999)]. Another group reported predominant expression of the type 1 isoform in human brain, whereas type 2 isoform was found to be preferably expressed in primary brain tumors that were analyzed (13/16) [Suzuki, et al. Biochem. Biophys. Res. Commun. 181 (3): 955-961 (1991)].

In another study, the expression pattern of the two isoforms was studied in 34 childhood brain tumors of different origins and degrees of malignancy and 5 extraneural embryonal tumors. Tumors exhibiting type 2 predominant expression included astrocytomas (11/12), ependymoma (5), Wilms'tumor (5), ganglioglioma (1), ganglioneuroma (1), neuroepithelioma (1), Plexus carcinoma (1), osteosarcoma (1), rhabdomyosarcoma (1) and clear cell sarcoma (1). In contrast, type 1 was expressed in 10 medulloblastoma, predominantly [Scheurlen WG, et al., Int. J. Can. (Pred.

Oncol. ), 64: 234-238 (1995)].

Predominant expression of the type 2 isoform was also found in 16 human astrocytic tumors that were analyzed [Tokuyama T, et al. Neuroscience Letters, 196: 189-192 (1995)].

To clarify this seemingly contradiction, the present inventors have analyzed the differential expression of both NF1 isoforms in different tumors, by using a sensitive RT-PCR method. A significant predominance of the type 2 isoform expression has been demonstrated in most tumors examined. These results indicate the possible involvement of the type 2 isoform in genesis of tumors.

Ras proteins Ras family proto-oncogenes proteins function as a molecular switch in a large network of signaling pathways, mainly controlling the differentiation or proliferation of cells. Ras is a membrane-bound G protein that cycles between an active state in which it is bound to guanosine triphosphate (Ras-GTP) and an inactive state in which it is bound to guanosine diphosphate (Ras-GDP). The Ras family consists of three genes: H-Ras, K- Ras, and N-Ras.

Ras proteins mediate the activation of the MEK/MAP kinase pathway, increasing levels of cyclin D1 that promotes the progression through the G1 checkpoint and into S phase leading to proliferation. Normally, these Ras- signaling cascades are only transiently activated because each normal Ras molecule has low intrinsic guanine triphosphate (GTPase) activity that gradually inactivates its own signaling function by hydrolyzing the bound GTP. More importantly, several distinct cytoplasmic GTPase-activating proteins (GAPs) stimulate the intrinsic GTPase activity of Ras, rapidly converting Ras from the active GTP form to the inactive GDP form. In this sense, the GAPs are attenuators of normal Ras. This GAP activity is catalyzed by pl20-GAP and neurofibromin (NF-1). However, oncogenic mutations of Ras not only reduce the intrinsic GTPAse activity, but also completely abolish the GAP-induced GTPase activation. Activated GTP-bound Ras is a potent activator of intracellular signaling pathways, and its vital role is exemplified by the presence of oncogenic Ras mutations in approximately 30% of human malignancies [Bos JL, Cancer Res. , 49: 4682-4689 (1989) ]. Ras mutations occur in codons 12,13 or 61 in one of the three genes (H-Ras, K-Ras, and N-Ras). Ras mutations have been reported in a variety of tumor types, although the incidence varies. The highest incidences are found in adenocarcinoma of the pancreas (90%), colon (50%), lung (30%), thyroid tumors (50%) and in myeloid leukemia (30%) [Bos JL, et al., Cancer Res. , 49: 4682-4689 (1989)].

Oncogenic Ras mutations have been implicated in tumor metastasis and angiogenesis by the elevated expression of metalloproteinases that are involved in tumor metastasis. In addition, there is an increase in the levels of expression of the angiogenic growth factor VEGF after transformation with K-Ras and H-Ras.

Since mutations in Ras are most prevalent in human tumors, the Ras- signaling pathway has been a major focus of new drug development efforts [Adjei AA. et al., J. Natl. Cancer Inst. , 93: 1062-1074 (2001) ]. These efforts are mainly focused on inhibition of Ras protein expression through ribozymes, antisense oligonucleotides or RNAs, prevention of membrane localization of Ras and inhibition of different downstream effectors of Ras function.

The prognostic relevance of Ras mutations was studied in many reports.

The results obtained have been conflicting. In some studies on colon cancer, no correlation between outcome and mutation could be identified. However, other studies have demonstrated that the K-Ras mutations are poor prognostic factors. Since mutations in Ras are not sufficient as a prognostic tool for evaluating potential responsiveness of a specific patient to a drug targeted to any stage of the Ras signaling pathway, there is need for better diagnostic tools for evaluation of responsiveness to Ras-affecting drugs even in the absence of Ras mutations.

It is therefore an object of the invention to establish a method for identifying and determining potential responsiveness of a subject suffering from a pathologic disorder, to a treatment with drugs affecting Ras signaling pathway, by detecting elevated expression of the NF1 type 2 isoform. Thus, the invention provides a sensitive predictive marker indicating the potential responsiveness of a subject to any drug targeted to Ras signaling pathway.

Summary of the Invention The present invention relates to a prognostic method of determining potential responsiveness of a subject to treatment of a pathologic disorder with a drug which affects at least one step in the p21Ras signal transduction pathway. The method of the invention comprises the steps of : (a) obtaining a biological sample from said subject; and (b) determining the expression pattern of NF1 isoforms in said sample. More particularly, determining the expression of NF1 type 1 and NF1 type 2 isoforms.

Predominant expression of the NF1 type 2 isoform is indicative of potential responsiveness of the tested subject to said drug. Thus, these subjects will be able to be treated with said drug. However, subjects exhibiting predominant expression of the type 1 isoform or more or less equal expression of both isoforms, may not be suitable candidates for treatment with a drug affecting at least one step in the p21Ras signal transduction pathway.

Potential responsiveness of a subject to the drug may be reflected by amelioration of symptoms of a pathologic disorder in the subject suffering from this disorder in response to treatment by the drug. According to one embodiment, the method of the invention is intended for evaluating and predicting the prognosis of a potential responsive subject suffering from any hyperplastic disorder, preferably, a malignant disorder.

Such malignant disorder may be any one of carcinoma, melanoma, lymphoma, sarcoma and leukemia. More specifically, the screened subject may suffer from any one of Rhabdomyosarcoma, Ewing sarcoma, Wilms' tumor, Neuroblastoma, Acute myeloid leukemia (AML) in children and adults, B-lineage acute lymphoblastic leukemia (ALL), ependymoma, choriod plexus carcinoma and glioma.

The biological sample used in the screening method of the invention may be selected from the group consisting of body fluids, tissue specimens, tissue extracts, cells, cell extracts and cell lysates. More preferably, the analyzed sample is a hyperplastic sample obtained from malignant tumor tissue, malignant cell or malignant body fluid.

The expression pattern of NF1 isoforms may be determined by any suitable means, such as protein-based or nucleic acid-based detection assays.

Protein-based detection assay that may be used for determining the expression pattern of NF1 type 2 isoform may be, for example, any one of immunohistochemical staining, Western blot analysis, immuno- precipitation, flow cytometry, ELISA and any competition assay. Nucleic acid-based detection assay used by the method of the invention may be, as non-limiting example, any one of in-situ hybridization, RT-PCR, modified SSCP, SSCP, nucleic acid based ELISA and Northern blot analysis.

In a specifically preferred embodiment, determination of the expression pattern of NF1 type 2 isoform is performed by nucleic acid based detection assay that may be an RT-PCR assay, preferably semi-quantitative or quantitative RT-PCR assay.

Where RT-PCR assay is used as a means for determining the expression of NF1 type 2 isoform, the method of the invention comprises the steps of : (a) obtaining an hyperplastic biological sample from a subject suffering from a hyperplastic disorder; (b) isolating nucleic acids from said sample; (c) performing RT-PCR assay on the isolated nucleic acids; and (d) determining the expression pattern of NF1 isoforms (particularly, type 1 and type 2) in the examined sample. Predominant expression of the NF1 type 2 isoform is indicative of potential responsiveness of the examined subject to an anti p2lRas signal transduction pathway drug, whereas predominant expression of type 1 isoform or substantially equal expression of both isoforms is indicative of potential non-responsiveness of said subject to an anti p2lRas signal transduction pathway drug.

In a preferred embodiment, the prognostic method of the invention is intended for predicting potential responsiveness of a subject suffering from a pathologic disorder to a drug targeted to any of the p2lRas signal transduction pathway. According to this embodiment, the potential responsiveness to any drug targeted against any steps in the p2lRas signaling pathway may be evaluated by the method of the invention. As a non limiting example, the drug affect any one of membrane localization of p2lRas, acceleration of Ras intrinsic GTPase activity by any one of pl20Ras-GAP and neurofibromin and activation of any down stream signaling molecule participating in the Ras signaling pathways.

According to a specifically preferred embodiment, the method of the invention is intended for evaluating the responsiveness of a subject to a drug that affects, particularly inhibits, the membrane localization of p2lRas. Since membrane localization of p2lRas is essential for recruiting and activating down stream signaling molecules, prevention of such localization results in the desired inhibition of this pathway. Membrane localization of p2lRas involves its Prenylation (farnesylation by farnesyl transferase or geranylgeranylation by protein geranylgeranyl transferase type I (GGT-I) and protein geranylgeranyl transferase type II (GGT-II).

Therefore, according to a preferred embodiment the drug is a farnesyl transferase inhibitor (FTI).

In yet another embodiment, the drug may be an inhibitor of any one of geranylgeranyl transferase type I (GGT-I) and protein geranylgeranyl transferase type II (GGT-II).

The screening method of the invention is used for predicting and assessing the response of a subject to a drug. According to a preferred embodiment the subject may be a mammalian subject. Most preferably, the mammalian subject may be a human.

The invention further provides a kit for determining the potential responsiveness of a subject, to treatment of any oncogene related disorder with a drug which affects at least one step in the p2lRas signal transduction pathway. According to a preferred embodiment, the kit of the invention comprises: (a) means for obtaining a biological sample from said subject; (b) means for determining the expression pattern of NF1 isoforms in said sample; (c) instructions for carrying out the detection of the NF1 type 1 and NF1 type 2 isoforms expression; and (d) instructions for determining predominant expression of the NF1 type 2 isoform.

Brief Description of the Figures Figure 1: Over expression of NF1 type 2 transcript RT-PCR samples performed in samples obtained from Rhabdomyosarcoma patients and normal donors were separated on 3% agarose gel followed by EtBr (Ethidium bromide) staining of this gel. Over-expression of NF1 type 2 (473 bp) is detected in all tumors samples obtained from different Rhabdomyosarcoma patients (lanes 1-6). In all normal tissues (PBL obtained from normal donors lanes 7-10) equal expression of both types, 1 and 2, is identified. Abbreviations: T=tumor, N= normal.

Detailed Description of the Invention Interruption of the Ras-signaling pathway has been a major focus of new drug development efforts, due to the high percentage of human tumors harboring oncogenic Ras mutants. Ras gene mutations are rare in cancers of the breast, ovary, stomach, esophagus, and prostate; however, they are present almost all adenocarcinomas of the pancreas and in 50% of colon and thyroid cancers. Mutations in colon and pancreatic cancer are found only in the K-Ras gene. In cancers of the urinary testis and bladder, mutations are primarily in the H-Ras gene; mutations are in the N-Ras gene in leukemia. Thyroid carcinomas are unique in having mutations in all three Ras genes [Bos JL, et al., Nature, 327: 293-297 (1987); Visvanathan KV et al., Oncogene Res. 3: 77-86 (1988) ]. Over all, approximately 30% of all human neoplasms harbor a mutation in a Ras gene.

Numerous studies have been performed evaluating the prognostic value of oncogenic Ras mutations in human tumors. These studies have focused predominantly on hematological malignancies (leukemia and multiple myeloma) and pancreatic, non-small-cell lung, and colorectal cancers.

Results to date have been conflicting [Beaupre DM, et al., J. Clin. Oncol. 17: 1071-1079 (1999); Field JK et al., Anticancer Res. 10: 1-22 (1990) ]. In colon cancer, some studies failed to show any correlation between K-Ras mutation and patient diagnosis [Morrin M, et al., Gut, 35: 1127-1131 (1994)]. However, other studies including the largest study to date with 1413 individuals, demonstrated that the presence of K-Ras mutations is a poor prognostic indicator [Samowitz WS, et al., Cancer Epidemiol.

Biomarkers Prev. 9: 1193-1197 (2000) ]. Likewise, in non-small-cell lung cancer, while some studies are negative or equivocal [Graziano SL, et al., J.

Clin. Oncol. 17: 668-675 (1999); Keohavong P, et al., Clin. Cancer Res.

2: 411-418 (1996) ], the preponderance of data favors Ras mutations as being a negative prognostic factor [Nelson HH, et al. J. Natl. Cancer Inst.

91: 2032-2038 (1999); Pajkos G, et al., Anticancr Res. 20: 1695-1701 (2000)].

The known involvement of neurofibromin in Ras signaling pathway and the type 2 isoform over-expression in malignant tissues shown by the present inventors indicated the possible use of type 2 predominant expression as a specific marker for evaluating responsiveness of a subject suffering of any malignant disorder to treatment with any drug targeted against p2lRas signal transduction pathway even in the absence of mutation in Ras.

Thus, as a first aspect, the present invention relates to a prognostic method of assessing and determining of potential responsiveness of a subject to treatment of pathologic disorder with a drug which affects to at least one step in the p2lRas signal transduction pathway. The method of the invention comprises the steps of : (a) obtaining a biological sample from said subject; and (b) determining the expression pattern of NF1 isoforms, particularly, type 1 and type 2 isoforms, in said sample by a suitable means.

The invention further relates to a prognostic method for determining the potential responsiveness of a subject to treatment of pathologic disorder with a drug which affects at least one step in the p21Ras signal transduction pathway. The method of the invention comprises the step of determining the expression pattern of NF1 isoforms in a biological sample.

"Expression pattern", as used herein, refers to quantitative differential expression of both NF1 isoforms, type 1 and type 2. Whereby, predominant expression of the NF1 type 2 isoform is indicative of potential responsiveness of the tested subject to said drug. Thus, subjects performing predominant expression of the NF1 type 2 isoform are suitable candidates for treatment with said drug. However, subjects demonstrating predominant expression of the type 1 isoform or even an equal expression of both isoforms, are not suitable candidates for treatment with such drug which affects at least one step in the p21Ras signal transduction pathway.

By"Predominant expression"is meant, quantitatively, over 50% expression of the type 2 isoform, preferably, over 75% expression of the type 2 isoform and most preferably, over 90% expression of the type 2 isoform.

Potential responsiveness of a subject to the drug may be reflected by the amelioration of symptoms of the oncogenic-related disorder in a subject suffering from this disorder, following treatment with said drug.

The evaluating method of the invention would enable the design of therapy for each individual patient. Potential responsive patients (exhibiting predominant expression of type 2 isoform) will be treated with the proposed drug, while alternative therapy will have to be considered for non- responsive patients (exhibiting predominant expression of type 1 isoform or even an equal expression of both isoforms), since in any case it is not expected that the drug would result in any amelioration of the disease. As the proposed drug may have side effects, non-responsive patients will not have to receive an unnecessary treatment and thus any unnecessary adverse effects and cost of treatment would be avoided.

Another advantage of the method of the invention may be during evaluation of new Ras-pathway targeted drugs. Selection of potential responsive subjects as tested individuals enables efficient, specific and more rapid evaluation of a tested drug during clinical phase trials.

It is to be appreciated that"a pathologic disorder"as used herein encompasses immune-related disorders, viral or bacterial infections and most preferably, hyperplastic disorders. These disorders includes any one of chromosomal abnormalities, degenerative growth and developmental disorders, mitogenic agents, ultraviolet radiation (UV), viral infections, inappropriate tissue gene expression, alterations in gene expression, oncogenic related disorders and carcinogenic agents.

According to a particular embodiment, the method of the invention is intended for evaluating the prognosis of a potential responsive subject suffering from any hyperplastic disorder and most preferably, a malignant disorder.

"Hyperplastic disorder"or"Hyperplasia"is used herein to describe tissue performing aberrant proliferation rate. Hyperplasia may indicate a malignant as well as benign tumor tissue. In a preferred embodiment the hyperplastic disorder is a malignant disorder.

As used herein to describe the present invention, "malignant disorder" "cancer"and"tumor"all relate equivalently to a hyperplasia of a tissue or organ. If the tissue is a part of the lymphatic or immune systems, malignant cells may include non-solid tumors of circulating cells.

Malignancies of other tissues or organs may produce solid tumors. In general, the method of the present invention as well as kit of the present invention, may be used in the prognostic screening for potential responsiveness of a subject suffering from non-solid or solid tumors. Such malignant disorder may be any one of carcinoma, melanoma, lymphoma, sarcoma and leukemia. More specifically, the screened subject may suffer from any one of Rhabdomyosarcoma, Ewing sarcoma, Wilms'tumor, Neuroblastoma, Acute myeloid leukemia (AML) in children and adults, B- lineage acute lymphoblastic leukemia (ALL) and brain tumors including: glioma, ependymoma and choriod plexus carcinoma.

The biological sample used in the screening method of the invention may be selected from the group consisting of body fluids, tissue specimens such as paraffin embedded blocks or frozen tissue samples, tissue extracts, cells, cell extracts and cell lysates. More preferably, the analyzed sample is a sample obtained from hyperplastic tissue, hyperplastic cell or malignant body fluid. Exemplary samples for body fluids can include blood, bone marrow, CSF (Cerebro-Spinal Fluid), urine, faeces, semen, ascites, pleural effusions and amniotic fluid. However, it is to be appreciated that the examined samples may be also non-malignant samples, for example, urine or blood.

Methods for obtaining such samples are well known to the skilled workers in the fields of oncology and surgery. They include sampling blood or other body fluids in well-known ways, or obtaining biopsies from the bone marrow or other tissue or organ.

The expression pattern of NF1 isoforms may be determined by any suitable means, such as protein-based or nucleic acid-based detection assays.

Protein-based detection assay that may be used for determining the expression pattern of NF1 type 2 isoform can be for example, any one of immunohistochemical staining, Western blot analysis, immuno- precipitation, flow cytometry ELISA and any competition assay. Nucleic acid-based detection assay used by the method of the invention may be, as non-limiting example, any one of in-situ hybridization, RT-PCR, modified SSCP, SSCP, nucleic acid based ELISA and Northern blot analysis.

Nucleic acid based ELISA may be performed by coating ELISA plates with antisense nucleic acid sequence of the 23a exon, incubating tagged or labeled RT-PCR products obtained from the examined sample with the plates and quantitating the bound nucleic acid sequence. Tag's suitable for such purpose may be for example avidin/biotin, GFP, myc, FLAG and the like.

In a specifically preferred embodiment, determination of the expression pattern of NF1 type 2 isoform is performed by nucleic acid based detection assay that may be a RT-PCR assay. More preferably, the expression is determined by a semi-quantitative RT-PCR or quantitative RT-PCR, most preferably, a semi-quantitative RT-PCR.

As used herein"RT-PCR"refers to a process of reverse transcription of mRNA into cDNA which is subsequently subjected to PCR reaction. PCR (Polymerase Chain Reaction) involves amplifying one or more specific nucleic acid sequences by repeated rounds of synthesis and denaturing under appropriate conditions.

PCR requires two primers that are capable of hybridization with a single- strand of a double-stranded target nucleic acid sequence which is to be amplified under appropriate hybridization conditions. In PCR, this double- stranded target sequence is denatured and one primer is annealed to each single-strand of the denatured target. The primers anneal to the target nucleic acid at sites removed (downstream or upstream) from one another and in orientations such that the extension product of one primer, when separated from its complement, can hybridize to the extension product generated from the other primer and target strand. Once a given primer hybridizes to the target sequence, the primer is extended by the action of a DNA polymerase. DNA polymerase which is heat stable is generally utilized so that new polymerase need not be added after each denaturation step. Such thermo-stable DNA polymerase is known to one of ordinary skill in the art, e. g. Taq polymerase. The extension product is then denatured from the target sequence, and the process is repeated.

In a specifically preferred embodiment, the primer extension or PCR product may be un-labeled. In this case, the gel-banding pattern of the resulting fragments may be visualized by ethidium bromide (EtBr), as described in the Examples, or by silver staining. Alternatively, the primer extension or PCR product may be body-labeled, by using labeled nucleotide during the PCR reaction. The term'label"as used herein refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein.

Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like.

According to this particular embodiment, where RT-PCR assay is used as means for determining the expression of NF1 type 1 and NF1 type 2 isoforms, the method of the invention comprises the steps of : (a) obtaining a biological sample from a subject suffering from a hyperplastic disorder; (b) isolating nucleic acids from said sample; (c) performing RT-PCR assay on the isolated nucleic acids; and (d) determining the expression pattern of both NF1 isoforms in the examined sample. Predominant expression of the NF1 type 2 isoform is indicative of potential responsiveness of the examined subject to an anti p21Ras signal transduction pathway drug.

As used herein, the term"nucleic acid"refers to polymer of nucleotides, which may be either single-or double-stranded, which is a polynucleotide such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. The term DNA used herein also encompasses cDNA, i. e. complementary or copy DNA produced from an RNA template by the action of reverse transcriptase (RNA-dependent DNA polymerase).

It is to be appreciated that the invention further relates to a method comprising the steps of subjecting a biological sample to isolation of nucleic acids, performing RT-PCR assay on the isolated nucleic acids and determining the expression pattern of NF1 isoform in the examined sample. Predominant expression of the NF1 type 2 isoform is indicative of potential responsiveness of the examined subject to an anti p21Ras signal transduction pathway drug.

In a preferred embodiment, the prognostic method of the invention is intended for predicting potential responsiveness of a subject suffering from a malignant disorder to a drug affecting any step of the p21Ras signal transduction pathway. Thus, the potential responsiveness to any drug targeted against any step in the p2lRas signaling pathway may be evaluated by the method of the invention.

The Ras-mediated signal transduction pathways initiates by binding of an external ligand such as epidermal growth factor (EGF) to its receptor tyrosine kinase is activated. This is followed by autophosphorylation of specific tyrosine residues on the intracellular portion of the receptor. These phosphorylated tyrosine residues then bind the sequence homology 2 (SH2) domains of adaptor proteins such as Grb2. These adaptor proteins contain not only an SH2 domain (s) but also an SH3 domain (s) that binds proline- rich motifs of other proteins, such as son of sevenless (SOS), a guanine dissociation stimulator (GDS) of Ras. The key adaptor molecule for Ras is Grb-2 that consists solely of one SH2 and two SH3 domains and links the activated EGF receptor to SOS. Such a complex formation recruits SOS, a cytosolic protein, into close proximity to Ras on the plasma membrane. The binding of SOS to Ras causes a change in the Ras conformation and leads to the dissociation of GDP, which allows Ras to bind GTP and become active.

Molecules such as SOS, which cause the dissociation of Ras from GDP and binding to GTP, are also called guanine nucleotide exchange factors (GNEFs). Ras must be in the plasma membrane not only for its SOS- mediated activation, but also for the Ras-mediated activation of its downstream effectors. Activated Ras activates several distinct effectors, such as the serine-threonine kinase Raf-1 which leads to activation of the MAPK pathway, phosphoinositude 3'-kinase (PI3'K), and RalGDS. These downstream effectors (also termed herein as down stream signaling molecules) activate several distinct signaling cascades, leading to either activation of certain genes, such as those encoding growth factors transforming growth factor-a and vascular endothelial growth factor (VEFG), or changes in actin cytoskeleton by activating Rho family G proteins.

Mitogen-activated protein (MAP) kinase cascades lie in a three-kinase- signaling module involved in transmitting membrane signals to the cell nucleus. A MAPK module consists of MAP kinase or extracellular signal- regulated kinase (ERK) activated by a MAP/ERK kinase (MEK or MAPKK) which in turn, is activated by a MEK kinase (MEKK or MAPKK. One such MEKK, which is the most well-characterized downstream effector of Ras, is the serine-threonine kinase Raf-1. This protein is recruited by Ras- GTP to the plasma membrane, where Raf is activated by an as yet unknown factor [Marshall CJ et al., Nature 383: 127-128 (1996)].

Localization of Raf to the plasma membrane is essential for its activation.

Once activated, Raf phosphorylates MEK, which, in turn, phosphorylates ERK. MAPK activation results in phosphorylation and activation of ribosomal S6 kinase and transcription factors, such as c-Jun, c-Myc, and c- Fos, resulting in the switching on of a number of genes associated with proliferation [Khosravi-Far R et al., Adv. Cancer Res. 72: 57-107 (1998)].

The critical nuclear target of the Ras/Raf/MEK/MAP kinase pathway is the transcription factor Fos. The Fos protein forms heterodimer with Jun to yield the active AP1 complex. The protein is activated through phosphorylation of its amino terminal serine residues by JNK (Jun kinase).

The G proteins Rac and Rho cycle between GDP-and GTP-bound forms and are regulated by factors analogous to GNEFs and GAPs. These two proteins have been shown to be activated by Ras-GTP [Qiu RG, et al., Nature 374: 457-459 (1995); Ridley AJ, et al., Cell 70: 389-399 (1992)].

Through their regulation of processes, such as formation of focal adhesions, filopodia, stress fibers, and membrane ruffling. All of these processes that can be activated by oncogenic Ras are important for the invasive phenotype of transformed cells [Rodriguez-Viciana P, et al., Nature 370: 527-532 (1994)].

Another Ras effector is PI3'K, a complex of two distinct sub-units, the catalytic subunit of 110 kd (pi 10) and the regulatory subunit of 85 kd (p85).

Ras-GTP binds the catalytic pll0. This interaction leads to a modest increase in PI3'K activity, increasing the concentration of 3'- phosphorylated inositol lipids [Rodriguez-Viciana P, et al. Cell 89: 457-467 (1997) ]. One of the PI3'K products, phosphatidyl inositol 3,4, 5-triphosphate (PIP3), activates Rac. Rac, in turn, induces the production of phosphatidyl 4,5-biphosphate (PIP2) by activating PI4/PI5 kinases, leading to uncapping of actin filaments at the plus-end and eventually induces membrane ruffling [Ridley AJ, et al., Cell 70: 401-410 (1992) ]. Both P13'k and Rac are required for Ras transformation.

As a non-limiting example, the drug to be evaluated by the present method may affect any one of membrane localization of p2lRas, acceleration of Ras intrinsic GTPase activity by any one of pl20Ras-GAP and neurofibromin, Raf kinase activation, MAPK's activation, P13'K activation Rac activation or activation of any other down stream signaling molecules. The term "activation"as used herein shall represent any alteration of a signaling pathway or biological response including, for example, increases above basal levels, restoration to basal levels from an inhibited state, and stimulation of the pathway above basal levels.

The major approaches taken for interrupting Ras signaling pathways were inhibition of Ras protein expression through ribozymes, antisense oligonucleotides, or RNAs, prevention of membrane localization of Ras and inhibition of downstream effectors of Ras function.

Antisense approach involves blocking translation of the Ras RNA message into protein by hybridization of oligonucleotides that are complementary to the mRNA to them.

In one study with K-Ras antisense RNA incorporated in an adenovirus vector, a significant activity was shown with 89% of treated mice being tumor free as compared to 10% of the untreated mice. A major problem with the antisense approach is the inability to deliver the antisense agents into the tumor cells. Recently, it has been shown that phosphorothioate oligodeoxynucleotides undergo endocytosis after intravenous administration, which allows for systemic administration. One example, entering clinical trials in ISIS 2503, is an antisense oligonucleotide designed to hybridize to the 5'untranslated region of H-Ras [Gordon MS, et al., Proc. ASCO, 18: 604 (1999) ]. Activity was observed in pancreatic cancer cells bearing K-Ras mutations and in colon cells harboring wild type Ras, thus, antitumor effects are independent of Ras gene status. The method of the present invention may serve as predictive tool for assessing responsiveness to such drugs.

Drugs targeted against the c-Raf kinase, which acts downstream of Ras in the MAP kinase pathway, may also be evaluated by the screening method of the invention. Example for such drug is a 20-mer phosphorothioate antisense oligonucleotide designated ISIS 5132, which inhibits c-Raf kinase [Monia BP, et al., Nat. Med. 2: 668-675 (1996)].

Molecules such as MEK are also potential targets for cancer therapy. Sebolt Leopold et al [Nat. Med. 5: 810-816 (1999) ] reported the discovery of PD 184322, a highly potent and selective inhibitor of the upstream kinase MEK, that is orally active. Tumor growth was inhibited by as much as 80% in mice implanted with colon 26 and HT 29 colon carcinomas after treatment with this inhibitor. Efficacy was achieved with a wide range of doses with no signs of toxicity, and correlated with reduction in the levels of activated MAP kinase in excised tumors. These data indicate that MEK inhibitors represent promising, noncytotoxic candidates for cancer therapy by the interruption of the Ras/MAP kinase pathway [Leopold et al ibid., (1999)].

Drugs such as the SCH51344 and cytochalasin K that block Rac-induced membrane ruffling or the PIP2-sequestering SH3 protein HS1 reverse Ras transformation [Walsh AB et al Oncogene 15: 2553-2560 (1997)], are also applicable. Thus, the predictive method of the invention may evaluate the potential responsiveness of a subject to any of the above-mentioned Ras signaling pathway targeted drugs.

According to a specifically preferred embodiment, the method of the invention is intended for evaluating the responsiveness of a subject to a drug that affects against the membrane localization of p2lRas. Since membrane localization of p2lRas is essential for recruiting and activating downstream signaling molecules, prevention of such localization results in the desired inhibition of this pathway. Thus, the effect of the drug is preferably an inhibitory effect.

Membrane localization of p2lRas involves its farnesylation by farnesyl transferase. Prenylation (covalent addition of farnesyl or geranylgeranyl groups to carboxy-terminal cystine residues of certain proteins) is required for membrane interaction for a number of proteins, including Ras.

Prenylation is catalyzed by three enzymes: protein farnesyl transferase (FT), protein geranylgeranyl transferase type I (GGT-I) and protein geranylgeranyl transferase type II (GGT-II).

In one specific embodiment, the drug may be an inhibitor of any one of protein geranylgeranyl transferase type I (GGT-I) and protein geranylgeranyl transferase type II (GGT-II).

FT transfers a farnesyl group to the terminal cysteine at the carboxy end of a target protein. It has been shown that farnesylation is critical for oncogenic Ras signaling. Therefore, according to a preferred embodiment the drug is a farnesyl transferase inhibitor (FTI).

Specific FT inhibitors (FTIs) can act as promising anticancer agents.

Currently, four FTIs are in clinical trials world wide. Two, R115777 and SCH66336 are orally active and are in phase II studies. Two others, L778, 123 and BMS-214662 are administered intravenously and are in phase I trials.

Preliminary results of phase II study of R115777 in patients with metastatic breast cancer confirmed partial response in soft tissue disease in 12%, and another 35% had stable disease for at least 3 months. In 34 patients with refractory leukemia, a 29% response was reported, including 2 complete remissions. None of the patients harbored an N-Ras mutation [Karp JE, et al. Blood, 97: 3361-336928 (2001)].

Therefore, the invention provides a further sensitive marker in addition to Ras mutations, for estimating potential responsiveness of a specific subject to Ras signaling pathway targeted drugs. Such sensitive method is particularly useful where although Ras is involved in said pathological disorder, no Ras mutations can be detected.

The invention further provides a kit for determining the potential responsiveness of a subject, to treatment of any oncogene related disorder with a drug which affects at least one step in the p2lRas signal transduction pathway. According to a preferred embodiment, the kit of the invention comprises : (a) means for obtaining a biological sample from said subject; (b) means for determining the expression pattern of NF1 isoforms in said sample; (c) instructions for carrying out the detection of the NF1 type 1 and NF1 type 2 isoforms expression; and (d) instructions for determining predominant expression of the NF1 type 2 isoform. According to a preferred embodiment, where detection of the predominant expression of the NF1 type 2 isoform is preformed by a RT-PCR reaction, the kit of the invention comprises as means for detection reverse transcriptase, random hexamer primers or specific primers and buffers suitable for reverse transcription of mRNA into cDNA, that otherwise are commercially available, as well as DNA polymerase and buffers for PCR.

The PCR mixture included in the kit provided by the present invention, may contain the control target DNA, the DNA primer pairs, four deoxyribonucleoside triphosphates (A, T, C, G), MgCl2, DNA polymerase (thermo-stable), and conventional buffers.

By primer is meant a polynucleotide, whether purified from a nucleic acid restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product complementary to a template nucleic acid strand is induced, i. e. , in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, reverse transcriptase and the like, under suitable temperature and pH reaction conditions.

The primer is preferably single-stranded for maximum efficiency, but may alternatively be in double-stranded form. If double-stranded, the primer is first treated to separate it from its complementary strand before being used to prepare extension products. Preferably, the primer is a polydeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agents for polymerization. The exact lengths of the primers will depend on many factors, including temperature and the source of primer. For example, depending on the complexity of the target sequence, a polynucleotide primer typically contains 15 to 25 or more nucleotides, although it can contain fewer nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with template.

The choice of a primer's nucleotide sequence depends on factors such as the distance on the nucleic acid from the hybridization point to the region coding for the mutation to be detected, its hybridization site on the nucleic acid relative to any second primer to be used, and the like.

Preferred primers according to the invention are sequences flanking the 23a exon sequence. Specific primers used are described in the following Examples. It is to be appreciated that may additionally comprise nucleic acid sequences encoding tagged sequences (e. g. GFP, FLAG, myc, His6 and the like) or any other tagging or labeling moieties.

Disclosed and described, it is to be understood that this invention is not limited to the particular examples, process steps, and materials disclosed herein as such process steps and materials may vary somewhat. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only and not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word"comprise", and variations such as "comprises"and"comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

It must be noted that, as used in this specification and the appended claims, the singular forms"a","an"and"the"include plural referents unless the content clearly dictates otherwise.

The following Examples are representative of techniques employed by the inventors in carrying out aspects of the present invention. It should be appreciated that while these techniques are exemplary of preferred embodiments for the practice of the invention, those of skill in the art, in light of the present disclosure, will recognize that numerous modifications can be made without departing from the spirit and intended scope of the invention.

Examples Experimental procedures Patients Patients were diagnosed with the following malignancies: Rhabdomyosarcoma, Ewing sarcoma, Wilms'tumor, Neuroblastoma, Acute myeloid leukemia (AML) in children and adults, B-lineage acute lymphoblastic leukemia (ALL), ependymoma, glioma, and choriod plexus carcinoma.

Samples were obtained from tumors that were frozen immediately after surgery in-70°C or paraffin-embedded blocks. Mononuclear cells were obtained from Bone Marrow and Peripheral blood cells, and frozen in 10% DMSO+FCS in-70°C.

RNA preparation RNA was prepared using the RNA/DNA/Protein isolation reagent. Tri- Reagent according to the manufacturer's protocol. Reagent was purchased from Molecular Research Center, INC.

RT-PCR RT-PCR was performed using the Ready-To-Go, RT-PCR Beads, according to the manufacturer's protocol. Beads were purchased from Amersham Pharmacia Biotech.

Primers Forward 5'TCAACTTCGAAGTGTGTGCC 3', also denoted by SEQ ID No. 1.

Reverse 5'TTT TCT CCT GAT TGT TCC AGA G 3'. also denoted by SEQ ID No. 2.

Forward: 5'AGA GCC TTG AGG AAA ACC AG 3'also denoted by SEQ ID No. 3.

Reverse 5'CTG GCT AAC CAT GAT TTT TTG 3 also denoted by SEQ ID No. 4.

Semi-Quantitative RT-PCR After the RT stage, PCR was performed for only 25 cycles-before the reaction reaches the plateau. Annealing temperature was 58°C.

The primers used for the Semi-Quantitative RT-PCR procedure were of SEQ ID No. 1 and 2. The RT-PCR product was 412 or 475 base pairs for the allele without or with the 23a. The product was separated on a 3% agarose gel and stained with ethidium bromide (EtBr).

Quantitative RT-PCR using Real time RT-PCR (Lightcycler) After the RT stage, rapid cycle amplification was continuously monitored by fluorescence using double-strand specific dye SYBER Green.

The primers used for the Quantitative RT-PCR procedure were of SEQ ID No. 3 and 4. RT-PCR reaction using these primers resulted in a 273 base pairs product.

Alternative ways of monitoring fluorescence in the Real time RT-PCR are by using specific probes: 1. Decrease in fluorescence quenching by rhodamine after exonuclease cleavage of a dual-labeled hydrolysis probe (Taqman probe).

2. Resonance energy transfer of fluorescein to Cy5 by adjacent hybridization probes.

Example 1 NF1 type 2 isoform is predominantly expressed in various solid tumors The differential expression pattern of the two main NF1 isoforms type 1 and type 2 has been studied in variety of pediatric malignancies such as Rhabdomyosarcoma, Wilms'tumor and Ewing's sarcoma, as well as in non- solid tumors such as AML in children and adults.

Rhabdomyosarcoma (RMS) is the third most common extracranial solid tumors of childhood neoplasm after neuroblastoma and Wilms'tumor. RMS is thought to arise from immature mesenchymal cells that are committed to skeletal muscle lineage, but can arise in tissues in which striated muscles are not normally found, such as in the urinary bladder.

Development of RMS has been associated with certain genetic familial syndromes such as Neurofibromatosis type 1 (NF1) and Li-Fraumeni Syndrome (LFS). As shown by Table 1, in 16 out of 24 (67%) RMS patients that were examined, a predominant over-expression of exon 23a (type 2 isoform) was observed. In contrast, only in 1 out of 23 neuroblastoma tumors (childhood tumor that is associated with NF1) that were screened for predominant expression of type 2 isoform, this isoform was found to be predominantly expressed (about 4%). Figure 1 is an example for the semi- quantitative RT-PCR analysis performed in six different rhabdomyosarcoma patients. The figure shows an EtBr staining of the samples separated on gel, indicating the predominant expression of the type 2 isoform (upper band). It is to be noted that all four normal samples examined exhibited an equal expression of both isoforms (and in some cases such as lane 7 and 10, even a predominant expression of the type 1 isoform).

Ewing Family of tumors are part of small round cell tumors which affect the bone and the soft tissue in children and adolescence. 30% of patients are characterized by micrometastases at the time of diagnosis and are associated with poor prognosis.

Wilms'tumor is the most common intraabdominal solid tumor of childhood.

In the majority of cases the tumor has favorable histology in association with good prognosis. Wilms'tumor occurs in both a common sporadic and a rare hereditary form.

Over-expression of the type 2 isoform was also observed in marked percentage in Ewing's sarcoma (69%), Wilms'tumor (88%) and in AML in adults (20%) (see Table 1). In contrast, predominant expression of type 2 was observed in only 7% of the AML childhood patients.

No over-expression of type 2 isoform was detected in B-lineage leukemia.

In none of the normal tissues, PBL or tissues obtained from the same origin as the malignant tissues examined, type 2 was found to be predominantly expressed. Thus, the type 2 over-expression is characterized in specific tumor cells.

The identification of hot spots associated with a known clinical feature has great potential. It will enable to screen large populations for the specific expression pattern and thus identify, using a simple analysis as the present method provides potential subjects which are able to respond to drugs affecting any stage in the Ras signal transduction pathway.

Table 1-predominant expression of the NFI type 2 isoform Cell type Overexpression No. tumors % of Type II studied Solid Tumors: Ewing's sarcoma 11 16 69 Wilms'tumor 15 17 88 Rabdomyosarcoma 16 24 67 Neuroblastoma 1 23 4 Brain tumors: Ependymoma 4 5 80 Glioma 9 9 100 Choroid plexus 1 1 100 carcinoma Leukemia AML (childhood) 1 15 7 AML (adults) 1 5 20 B lineage 0 16 none Normal: PBL 0 18 none Tissue (kidney, brain, 0 6 none bone)