AMMIRANTE MASSIMO (US)
KURAISHY ALI (US)
KARIN MICHAEL (US)
AMMIRANTE MASSIMO (US)
KURAISHY ALI (US)
CLAIMS We claim: 1. A method for reducing one or more of (a) growth of castration resistant prostate cancer (CaP) cells in a tissue and (b) metastasis of castration resistant prostate cancer (CaP) cells in a tissue, in a mammalian subject in need thereof, comprising administering to said subject a therapeutically effective amount of a compound that reduces one or more of (i) the number of B cells in said tissue, and (ii) the function of B cells in said tissue. 2. The method of Claim 1, further comprising detecting a reduction in one or more of a) growth of said castration resistant prostate cancer (CaP) cells, b) said metastasis of castration resistant prostate cancer (CaP), c) the number of said B cells in said tissue, and d) the function of said B cells in said tissue. 3. The method of Claim 1, wherein said compound reduces the number of B cells in said tissue. 4. The method of Claim 3, wherein said compound comprises antibody that specifically binds to lymphotoxin-β. 5. The method of Claim 3, wherein said compound comprises LT R-Ig. 6. The method of Claim 3, wherein said compound reduces the level of expression of lyrnphotoxin-β. 7. The method of Claim 6, wherein said compound comprises antibody that specifically binds to CXCL13. 8. The method of Claim 6, wherein said compound comprises ML120B. 9. The method of Claim 6, wherein said compound comprises IKK2 VI inhibitor. 10. The method of Claim 3, wherein said compound comprises antibody that specifically binds to CD20. 11. The method of Claim 3, wherein said compound comprises antibody that specifically binds to CD 19. 12. The method of Claim 1, wherein said compound reduces one or more function of B cells. 13. The method of Claim 12, wherein said compound comprises an ΙΚΚβ inhibitor. 14. The method of Claim 13, wherein said ΙΚΚβ inhibitor is selected from the group consisting of ML120B, IKK2 VI inhibitor, PS-1145 dihydrochloride, BMS-345541 and LC- 1. 15. The method of Claim 1, further comprising administering STAT3 to said mammal. 16. The method of Claim 1, wherein said subject is human. 17. The method of Claim 1, wherein prior to said administering, said tissue in said subject has received one or more treatment selected from the group consisting of surgery, radioablation, and treatment with an anti-androgen compound. 18. The method of Claim 1, wherein said administering is prior to detecting a symptom of one or more of (a) said growth of castration resistant prostate cancer (CaP) cells in said tissue, and (b) said metastasis of castration resistant prostate cancer (CaP) cells in a tissue. 19. The method of Claim 1, wherein said administering is after detecting a symptom of one or more of (a) said growth of castration resistant prostate cancer (CaP) cells in said tissue, and (b) said metastasis of castration resistant prostate cancer (CaP) cells in a tissue. 20. A method for reducing androgen-induced growth of prostate epithelial cells in a mammalian subject in need thereof, comprising administering to said subject a therapeutically effective amount of a compound that reduces one or more of (i) the number of B cells in said tissue, and (ii) the function of B cells in said tissue. 21. The method of Claim 20, further comprising detecting a reduction in one or more of a) androgen-induced growth of said prostate epithelial cells, b) the number of B cells in said tissue, and c) the function of B cells in said tissue. |
CROSS-REFERENCE TO OTHER APPLICATIONS
This international application claims priority to co-pending U.S. provisional
Application Serial No. 61/438,052, filed January 31, 2011, the contents of which are incorporated by reference in their entirety.
GOVERNMENT INTEREST
This invention was made with government support under grant No. R01 CA 127923- 01 awarded by National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
The invention provides methods for reducing growth and/or metastasis of androgen- independent (castration resistant) prostate cancer in a tissue in an animal. In one embodiment the method comprises administering to the animal a therapeutically effective amount of a compound that reduces the number of B cells, and/or the function of B cells, in the tissue. In yet another embodiment, the invention provides methods for reducing androgen-induced growth of prostate epithelial cells in prostate tissue in an animal. In one embodiment, the method comprises administering to the animal a therapeutically effective amount of a compound that reduces the number of B cells, and/or the function of B cells, in the tissue.
BACKGROUND OF THE INVENTION
Prostate cancer (CaP) progresses from prostatic
intraepithelial neoplasia through locally invasive
adenocarcinoma to castration resistant (CR) metastatic
carcinoma 1 . Although radical prostatectomy, radiation and androgen ablation are effective therapies for androgen- dependent (AD) CaP, metastatic CR-CaP is a major complication with high mortality 2 . Androgens stimulate growth and survival of prostate epithelium and early CaP. Although most patients initially respond to androgen ablation, many develop CR-CaP within 12-18 months 2 . Despite extensive studies, the mechanisms underlying CR-CaP emergence remain poorly understood and their elucidation is critical for development of improved therapies. Curiously, CR-CaP remains androgen receptor (AR) dependent and potent AR antagonists induce tumor regression in castrated mice 3 . The role of inflammation in CR-CaP has not been
addressed, although it was reported that intrinsic N F- B activation supports its growth 4 . Inflammation is a localized protective reaction to injury or infection, but it also has a pathogenic role in many diseases, including cancer 5 . Whereas acute inflammation is critical for host defense, chronic inflammation contributes to tumorigenesis and metastatic progression. The inflammation-responsive ΙκΒ kinase (IKK) β and its target NF-κΒ have important tumor promoting functions within malignant cells and inflammatory cells 6 . The latter, including macrophages and lymphocytes, are important elements of the tumor microenvironment 7-9 , but the mechanisms underlying their recruitment remain obscure, although thought to depend on chemokine and cytokine production 10 .
Currently, the common way of treating primary non-metastatic prostate cancer entails treatment with anti-androgen drugs (so called chemical castration). In addition, surgical removal or radioablation are also practiced. While these procedures are effective, a major problem is the re-emergence of androgen independent cancer a few years later. Thus, what are needed are methods to reduce (including delay and/or complete inhibition of) the re- emergence of hormone resistant cancer, and/or regeneration of normal tissue. SUMMARY OF THE INVENTION
The invention provides a method for reducing one or more of (a) growth of castration resistant prostate cancer (CaP) cells in a tissue and (b) metastasis of castration resistant prostate cancer (CaP) cells in a tissue, in a mammalian subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound that reduces one or more of (i) the number of B cells in the tissue, and (ii) the function of B cells in the tissue. In one embodiment, the method further comprises detecting a reduction in one or more of a) growth of the castration resistant prostate cancer (CaP) cells, b) the metastasis of castration resistant prostate cancer (CaP), c) the number of the B cells in the tissue, and d) the function of the B cells in the tissue. In another embodiment, the compound reduces the number of B cells in the tissue. In a further embodiment, the compound inhibits specific binding of lymphotoxin (LT) to lymphotoxin (LT) receptor. In an alternative embodiment, the compound comprises antibody that specifically binds to lymphotoxin-β. In a further embodiment, the compound comprises LTpR-Ig. In an alternative embodiment, the compound reduces the level of expression of lymphotoxin- β. In one embodiment, compound comprises ML120B and/or IKK2 VI inhibitor. In yet another embodiment, the compound comprises an antibody that specifically binds to a B cell chemoattractant, exemplified by antibody that specifically binds to CXCL13. In a further embodiment, the compound comprises antibody that specifically binds to CD20 and/or CD 19. In an alternative embodiment, the compound reduces one or more function of B cells, as exemplified by an ΙΚΚβ inhibitor, such as ML120B and/or IKK2 VI inhibitor and/or PS-1145 dihydrochloride and/or BMS-345541 and/or LC-1. In a further embodiment, the method further comprises administering to the subject STAT and/or an IKKcc inhibitor. In a preferred embodiment, the subject is human. In one embodiment, prior to and/or after the step of administering, the tissue in the subject has received one or more treatment selected from the group consisting of surgery, radioablation, and treatment with an anti-androgen compound. In another embodiment, the step of administering is prior to and/or after detecting a symptom of one or more of (a) the growth of castration resistant prostate cancer (CaP) cells in the tissue, and (b) the metastasis of castration resistant prostate cancer (CaP) cells in a tissue.
The invention also provides a method for reducing androgen-induced growth of prostate epithelial cells in a mammalian subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound that reduces one or more of (i) the number of B cells in the tissue, and (ii) the function of B cells in the tissue. In one embodiment, the method further comprises detecting a reduction in one or more of a) androgen-induced growth of the prostate epithelial cells, b) the number of B cells in the tissue, and c) the function of B cells in the tissue. In another embodiment, the compound reduces the number of B cells in the tissue. In a further embodiment, the compound inhibits specific binding of lymphotoxin (LT) to lymphotoxin (LT) receptor. In an alternative embodiment, the compound comprises antibody that specifically binds to lymphotoxhi-β. In a further embodiment, the compound comprises LT^R-Ig. In an alternative embodiment, the compound reduces the level of expression of lymphotoxin- β. In one embodiment, compound comprises ML120B and/or IKK2 VI inhibitor. In yet another embodiment, the compound comprises an antibody that specifically binds to a B cell chemoattractant, exemplified by antibody that specifically binds to CXCL13. In a further embodiment, the compound comprises antibody that specifically binds to CD20 and/or CD 19. In an alternative embodiment, the compound reduces one or more function of B cells, as exemplified by an ΙΚΚβ inhibitor, such as ML120B and/or IKK2 VI inhibitor and/or PS-1145 dihydrochloride and/or BMS-345541 and/or LC-1. In a further embodiment, the method further comprises administering to the subject STAT and/or an IKKa inhibitor. In a preferred embodiment, the subject is human. In one embodiment, prior to and/or after the step of administering, the tissue in the subject has received one or more treatment selected from the group consisting of surgery, radioablation, and treatment with an anti-androgen compound. In another embodiment, the step of administering is prior to and/or after detecting a symptom of one or more of (a) the growth of castration resistant prostate cancer (CaP) cells in the tissue, and (b) the metastasis of castration resistant prostate cancer (CaP) cells in a tissue.
DEFINITIONS
The terms "reduce" and "inhibit" when in reference to the level of any molecule, and/or phenomenon (e.g., cancer, metastasis, disease symptoms, cell growth, cell death, cell apoptosis, cell viability, cell survival, cell number, B cell immune function, level of expression, level of activation of an enzyme such as IKKa and ΙΚΚβ, specific binding of an antigen to its receptor, etc.) in a first sample relative to a second sample, mean that the quantity of molecule and/or phenomenon in the first sample is lower than in the second sample by any amount that is statistically significant using any art-accepted statistical method of analysis. "Reducing" a phenomenon (e.g., cancer, , metastasis, disease symptoms, cell growth, cell death, cell apoptosis, cell viability, cell survival, cell number, B cell immune function, , level of expression, level of activation of an enzyme such as IKKa and ΙΚΚβ, specific binding of an antigen to its receptor, etc.) also, or in the alternative, refers to delaying, palliating, ameliorating, stabilizing, preventing and/or reversing the phenomenon and/or one or more symptoms associated with the phenomenon. In one embodiment, the reduction may be determined subjectively, for example when a patient refers to their subjective perception of disease symptoms, such as pain, nausea, tiredness, etc. In another embodiment, the quantity of molecule, cell, and/or phenomenon in the first sample (or in the first subject) is lower by any numerical percentage from 5% to 100%, such as, but not limited to, from 10% to 100%, from 20% to 100%, from 30% to 100%, from 40% to 100%, from 50% to 100%, from 60% to 100%, from 70% to 100%, from 80% to 100%, and from 90% to 100% lower than the quantity of the same molecule, cell and/or phenomenon in the second sample (or in the second subject). In one embodiment, the first sample (or the first subject) is exemplified by, but not limited to, a sample (or subject) that has been manipulated using the invention's compositions and/or methods. In a further embodiment, the second sample (or the second subject) is exemplified by, but not limited to, a sample (or subject) that has not been manipulated using the invention's compositions and/or methods. In an alternative embodiment, the second sample (or the second subject) is exemplified by, but not limited to, a sample (or subject) that has been manipulated, using the invention's compositions and/or methods, at a different dosage and/or for a different duration and/or via a different route of administration compared to the first subject. In one embodiment, the first and second samples (or subjects) may be the same, such as where the effect of different regimens (e.g., of dosages, duration, route of admimstration, etc.) of the invention's compositions and/or methods is sought to be determined on one sample (or subject). In another embodiment, the first and second samples (or subjects) may be different, such as when comparing the effect of the invention's compositions and/or methods on one sample (subject), for example a patient participating in a clinical trial and another individual in a hospital. As used herein the terms "therapeutically effective amount" and "protective amount" of a composition with respect to prostate cancer refer to, in one embodiment, an amount of the composition that delays, reduces, palliates, ameliorates, stabilizes, prevents and/or reverses one or more symptoms of prostate cancer compared to in the absence of the composition of interest. Examples include, without limitation, primary and/or metastatic tumor size, primary and/or metastatic tumor number, pain, nausea, weight loss, etc. Specific dosages can be readily determined by clinical trials and depend, for example, on the route of admimstration, patient weight (e.g. milligrams of drug per kg body weight). Moreover, the dosage range for anti-B cell compounds, such as rituximab, ocrelizumab and ofatumumab antibodies (for which there is ample clinical trial information) provides a good working dose, from which one of skill in the art may increase or decrease the dose based on effectiveness. The term "delaying" symptoms refers to increasing the time period between exposure to the compound and the onset of one or more symptoms of the disease. The term "eliminating" symptoms refers to 100% reduction of one or more symptoms of the disease.
The term "administering" a compound to an animal includes introducing the compound prophylactically {i.e., before the observation of one or more disease symptoms) and/or therapeutically {i.e., after the observation of one or more disease symptoms).
Administration also may be concomitant with {i.e., at the same time as, or during) manifestation of one or more disease symptoms. Also, the invention's compounds may be administered before, concomitantly with, and/or after administration of another type of drug or therapeutic procedure {e.g., surgery such as castration, chemotherapy, radiotherapy, etc.). Methods of adrninistering the invention's compounds include, without limitation, administration in parenteral, oral, intraperitoneal, intranasal, topical {e.g., rectal), and sublingual forms. Parenteral routes of administration include, for example, subcutaneous, intravenous, intramuscular, intrastemal injection, and infusion routes.
An "anti-B cell" compound is a compound that reduces the number of B cells, the recruitment of B cells, and/or the immune function of B cells.
"Mammalian subject" and "mammalian animal" interchangeably refer to any mammal (e.g., humans, non-human primates, murines, ovines, bovines, ruminants, lagomorphs, porcines, caprines, equines, canines, felines, aves, guinea pig, hamster, ferret, chinchilla, mouse, cotton rat, etc.).
"Castration resistant prostate cancer," "CaP," "androgen-receptor dependent prostate cancer," "androgen-independent prostate cancer," are used interchangeably to refer to prostate cancer in which prostate cancer cells "grow" {i.e., increase in number) in the absence of androgens and/or in the absence of expression of androgen receptors on the cancer cells.
"Metastasis" refers to the processes by which a cancer cell is translocated from a primary cancer site {i.e., a location where the cancer cell initially formed from a normal, hyperplastic or dysplastic cell) to a site other than the primary site, where the translocated cell lodges and proliferates, "metastasis" also refers to the cancer that is located at a site other than the primary cancer site.
"B cell function" refers to the level of expression of lymphotoxin on the cell surface of B cells. Thus, reducing the function of B cells refers to reducing the level of expression of lymphotoxin on the cell surface of B cells.
"B cell chemoattractant" refers to a compound that directs the movement of B cells in the direction of the compound, and is exemplified by CXCL13.
"CXCL13" refers to "C-X-C motif chemokine 13" also known as B lymphocyte chemoattractant (BLC), and is a small cytokine that in humans is encoded by the CXCL13 gene. CXCL13 belongs to the CXC chemokine family, and is selectively chemotactic for B cells belonging to both the B-l and B-2 subsets, and elicits its effects by interacting with chemokine receptor CXCR5.
"Specifically binds" and "specific binding" when made in reference to the binding of antibody to a molecule {e.g., peptide) or binding of a cell {e.g., T-cell) to a peptide, refer to an interaction of the antibody or cell with one or more epitopes on the molecule where the interaction is dependent upon the presence of a particular structure on the molecule. For example, if an antibody is specific for epitope "A" on the molecule, then the presence of a protein containing epitope A (or free, unlabeled A) in a reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody. In one
embodiment, the level of binding of an antibody to a molecule is determined using the "IC50" i.e., "half maximal inhibitory concentration" that refer to the concentration of a substance (e.g., inhibitor, antagonist, etc.) that produces a 50% inhibition of a given biological process, or a component of a process (e.g., an enzyme, antibody, cell, cell receptor, microorganism, etc.). It is commonly used as a measure of an antagonist substance's potency.
"Lymphotoxin" ("LT"), also called tumor necrosis factor-β (TNF- ).is a lymphokine released by antigen-stimulated lymphocytes, particularly cytotoxic T lymphocytes.
"Lymphotoxin receptor," "LT receptor" and "LTpR" interchangeably refer to a receptor that is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LT receptor specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphtoxin-beta).
"LTPR-Ig" is a fusion protein containing lymphotoxin receptor (LTpR) that is known to bind to the ligands LTa/β heterotrimer and LIGHT (homologous to lymphotoxins.
"STAT" and "signal transducer and activator of transcription 3" is also known as "(acute-phase response factor," "APRF, " "APRF Transcription Factor," "DNA-binding protein APRF," "IL6-Response Factor," and "LIF(leukemia inhibitory factor)-Response Factor." STAT is a transcription factor encoded by a family of genes known as the STAT genes.
"ML120B" refers to N-(6-chloro-7-methoxy-9H-p-carbolin-8-yl)-2- methylnicotinamide (ML120B), a β-carboline derivative.
"IKK2 VI inhibitor" refers to (5-Phenyl-2-ureido)thiophene-3-carboxamide.
"PS-1145 dihydrochloride" refers to N-(6-Chloro-9H-pyrido[3,4-b]indol-8-yl)-3- pyridinecarboxamide dihydrochloride, and is commercially available (Sigma- Aldrich).
"BMS-345541" refers to N-(l,8-Dime limidazo[l,2-a]quinoxalin-4-yl)-l,2- Ethanediamine monohydrochloride, and is commercially available (Sigma-Aldrich).
"ΙΚΚβ" is also known as inhibitor of nuclear factor kappa-B kinase subunit beta ("NFKB"). ΙΚΚβ is a kinase of the IKK family. It phosphorylates inhibitors of NFKB, leading to the dissociation of the inhibitor/NFKB complex and ultimately the degradation of the inhibitor. It is preferentially found as a heterodimer with IKKa but also as a homodimer. ΙΚΚβ is an enzyme that serves as a protein subunit of IKB kinase, which is a component of the cytokine-activated intracellular signaling pathway involved in triggering immune responses. ΙΚΚβ is found on the internal side of the plasma membrane, in the cytoplasm, as part of IKB kinase complex, and in the nucleus. ΙΚΚβ functions include protein
serine/threonine kinase activity, protein binding activity, IKB kinase activity, nucleotide binding activity, ATP binding activity, and protein kinase activity. ΙΚΚβ protein in humans is encoded by the IKBKB (inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta) gene.
"ΙΚΚβ inhibitor" refers to a compound that reduces one or more ΙΚΚβ function (e.g., protein serine/threonine kinase activity, protein binding activity, IKB kinase activity, nucleotide binding activity, ATP binding activity, and protein kinase activity.
"Activation of ΙΚΚβ" refers to phosphorylation, e.g., by a kinase, of one or more ΙΚΚβ serine residues within the ΙΚΚβ activation loop.
'ΊΚΚ " is a kinase of the IKK family. It phosphorylates inhibitors of NFKB, leading to their dissociation from NFKB and ultimately to their degradation. It is located on the internal side of plasma membrane, on intracellular membrane-bound organelles, in the cytoplasm, nucleolus, and as part of IKB kinase complex. IKKa functions in protein binding, has IKB kinase activity, nucleotide binding activity, ATP binding activity, and protein kinase activity. ΙΚΚα is encoded by the CHUK gene.
"IKKa inhibitor" refers to a compound that reduces one or more ΙΚΚα function (e.g., protein binding, IKB kinase activity, nucleotide binding activity, ATP binding activity, and protein kinase activity.
"Activation of IKKa" refers to phosphorylation, e.g., by a kinase, of one or more IKKa serine residues within the IKKa activation loop.
"CD20" and "B-lymphocyte antigen CD20" interchangeably refer to an activated- glycosylated phosphoprotein expressed on the surface of B-cells beginning at the pro-B phase (CD45R+, CD1 17+) and progressively increasing in concentration until maturity. In humans CD20 is encoded by the MS4A1 gene.
"Anti-androgen," "antiandrogen" and "androgen antagonist" interchangeably refer to compounds that prevent androgens from expressing their biological effects on responsive tissues, by blocking the appropriate receptors, competing for binding sites on the cell's surface, and/or affecting androgen production. Antiandrogens are prescribed to treat an array of diseases, such as prostate cancer, and are exemplified by the drugs fiutamide (brand name Eulexin™), nilutamide (brand names Anandron iM and Nilandron™), bicalutamide (brand name Casodex ) , finasteride (brand names Proscar and Propecia ), dutasteride (brand name Avodart™), bexlosteride, izonsteride, turosteride, and epristeride.
"Radioablation" is a medical procedure where part of the electrical conduction system of a tissue (e.g., tumor, heart, or other dysfunctional tissue) is ablated using the heat generated from the low frequency AC, pulses of DC, or high frequency alternating cun-ent to treat a medical disorder. Radio frequency ablation (RFA) uses high frequency alternating current and has the advantage over previously used low frequency AC or pulses of DC in that it does not directly stimulate nerves or heart muscle and can therefore often be used without the need for general anesthetic.
DESCRIPTION OF THE DRAWINGS
Figure 1. Androgen ablation induces tumor inflammatory infiltration. Six week old FVB males (n=10) were inoculated with myc-CaP cells. When tumors reached 1000 mm , mice were left untreated, castrated or sham operated. Tumors were collected when indicated for analysis. A. Paraffin-embedded tumor sections were TUNEL stained to determine apoptotic cell frequency (results are averages, n=3). B. Total RNA was isolated from tumor samples and expression of indicated cell marker mRNAs was quantitated and normalized to that of cyclophilin A (norm= normal, CI, 2,3= mice analyzed 1,2,3 weeks after castration, sham= sham-operated). Results are averages + s.d. (n=10). C. Frozen human prostate sections (normal tissue (n=3), prostatic hyperplasia (n=3), and malignant CaP with Gleason scores 6-8 (n=10)) were stained with CD4, CD8 and CD20 antibodies and DAPI and analyzed by immunofluorescent microscopy. The histogram denotes average frequencies of mdicated cell types (n=3 per sample). P values were determined and are depicted as insignificant (ns), significant (*), very significant (**) or highly significant (***).
Figure 2. Role of B cells and ΙΚΚβ in STAT3 activation and CR-CaP emergence.
A. Myc-CaP tumors were established in WT mice reconstituted with BM from Ragl ~ ' ~ males (n=10) or in RagF 1' males. When tumors reached 1000 mm 3 , mice were castrated. Three days before castration, RagF 1' mice (n=10 per group) received via the tail vein purified splenic B or T cells. Tumor volume was measured. Results are averages + s.e.m.. P values were determined and are indicated as above. B. Tumors were removed from radiation chimeras reconstituted with Ikk/f , Μβ^ Α , or Ragl ~ ' ~ BM, one week after castration. STAT3 phosphorylation was analyzed by immrinohistochemistry. C. Tumor-bearing RagF f~ males were injected with WT splenocytes (Ragl + WT), or purified splenic B (Ragl + B) or T U 2012/023383
(Ragl + T) lymphocytes. One day later, mice were castrated and after one week, tumors were removed and analyzed for STAT3 phosphorylation.
Figure 3. Role of IKKa in emergence of CR-CaP. Tumor-bearing mice were castrated or sham operated as above. A. Tumors were analyzed one week later for nuclear IK a by immunohistochemistry. B. Tumors removed at indicated times were divided into cytosolic (C) and nuclear (N) fractions and IKKa and histone H3 distribution was determined. C. Tumors were established using myc-CaP cells transduced with lentiviruses expressing scrambled siRNA (sc) or ΙΚΚα-specific siRNA. Mice were castrated as above and tumor volume was measured. Results are averages + s.e.m. (n=10). P values were determined and are indicated as above. D. Tumors were established in lethally irradiated FVB males reconstituted with Ikk^ or Ikkff^ BM or in Ragl 1 males reconstituted with either B or T cells. Ikkjf /F and Ikkf^^ chimeras were i.p. injected three times with poly(IC) (250 ^ig) prior to castration to delete ΙΚΚβ. One week after castration, tumor samples were analyzed for IKKa distribution by immunohistochemistry. Nuclear IKKa results in punctuate staining, while cytoplasmic IKKa results in diffuse staining.
Figure 4. ΙΚΚβ-dependent lymphotoxin production by tumor-infiltrating B cells stimulates ΙΚΚα-dependent androgen-free survival. A. RNA from splenic B cells of mice was analyzed for LTa and LTp expression as above. Results are averages + s.d. (n=3). B. Lethally irradiated FVB males were reconstituted with BM from B- mice (n=6 per group). After 8 weeks, myc-CaP tumors were established, mice were castrated and tumor volume was measured as above. Results are averages + s.e.m.. C. FVB mice (n=6 each group) bearing myc-CaP tumors were castrated and given hlgG or LTPR-Ig (100 μg) every 5 days, starting 4 days before castration. Tumor volume was measured as above. Results are averages + s.e.m.. D. Tumors were established using myc- CaP cells transduced with lentiviruses expressing scrambled (sc) siRNA or LTp-specific siRNA. Mice were castrated and tumor volume was measured. Results are averages + s.e.m. (n=10). E. Myc-CaP cells (previously infected with lentiviruses expressing scrambled or IKKa siRNAs) were plated at 40% confluency. After 6 hrs, the cells were cultured with or without flutamide (10 μΜ) in the absence or presence of LT 2 i, and cell number was determined. F. Myc-CaP cells were plated at 60% confluency. After 12 hrs, cells were stimulated for 1 hr with LTa 2 Pi, collected, divided into cytosolic (C) and nuclear (N) fractions and IKKa and histone H3 distribution was determined. In A, B, C, D and E, P values were determined and are indicated as above.
Figure 5. ΙΚΚβ in prostate epithelial cells has no effect on CaP progression and metastasis. A. The deletion efficiency of ΙΚΚβ in lkkfi ! ITRAMP and \kk I !TRAMP/PB-Cre4 (// / /3 Apro ) mice was analyzed. Primary prostate epithelial cells were isolated, cultured and stimulated with TNF- (10 ng/ml). After 0, 15 and 30 min, cytoplasmic and nuclear extracts were prepared and analyzed for ΙΚΚβ expression (1 ,2,3 refer to different mice) or NF-κΒ and Oct-1 DNA binding activities. B. Survival of lkk F,F /TRAMP (n=2 ) and lkkfi Apro /TRAMP (n=16) mice were compared by Kaplan-Meier analysis. P values were determined and are depicted as insignificant (ns), significant (*), very significant (**) or highly significant (** * ). C. Incidence of lymph node, liver and lung metastases in \kk !F /TRAMP and lkkfi Apm /TRAMP mice at time of death. D. Histological analysis of primary CaP and liver metastasis in lkk(f I /TRAMP and lkkβ Apr °/TRAMP mice.
Figure 6. ΙΚΚβ in prostate epithelial cells has no effect on emergence of
CR-CaP. A. Twenty-week old ^ Apm /TRAMP (n=12) and Ikk^/TRAMP (n=13) males were castrated. After 5 months, mice were sacrificed and incidence of lymph node, lung and liver metastases was determined. B. Histological analysis of primary prostate tumors from castrated lkkfi pro /TRAMP and ikk0 z ' /TRAMP mice.
Figure 7. Silencing of ΙΚΚβ in CaP cells has no effect on emergence of
CR-CaP. Male FVB mice were injected with myc-CaP cells, previously infected with lentiviruses expressing control (scrambled, sc) or ΙΚΚβ specific siRNAs. When tumors reached 900 mm 3 , mice (n=10 per group) were castrated. A. Tumor size was measured every 2-3 days. Results are averages + s.e.m. P value was determined and depicted as above. B. Myc-CaP cells were used for inoculation and the resulting tumors, collected at the end of the experiment, were analyzed for ΙΚΚβ expression.
Figure 8. ΙΚΚβ deletion in BMDC retards CR-CaP appearance and metastasis. A. Twenty week old lkkjf IF /TRAMP/Mx1-Cre (Ikk^TRAMP) and lkkff IF ITRAMP males (n=15-17) were injected three times with poly(IC) and castrated 3 days after last injection. Five months later, mice were sacrificed and prostate tumor weight and incidence of lymph node, lung and liver metastases were determined. B. Six week old FVB males were lethally irradiated and transplanted with BM of male Ikkff^ ox lkkff /F /Mx-1Cre mice (n=10 each group). After 8 weeks, 3383
mice received 2 x 10 6 myc-CaP cells subcutaneously. When tumors reached 900 mm 3 , mice were thrice injected with poly(IC) to delete ΙΚΚβ in BMDC and castrated 3 days later. ΙΚΚβ deletion was examined by immunoblot analysis of peripheral leukocytes. C. Tumor volume in above mice was measured every 2-3 days. Results are averages + s.e.m. (n=10). D. Six week old FVB mice (n=6 each group) were inoculated with myc-CaP cells and when tumors reached 1000 mm 3 , were castrated and injected twice daily with vehicle or ΙΚΚβ inhibitor, ML120B. Tumor volume was measured as above. Results are averages + s.e.m. P values were determined and depicted as above.
Figure 9. Distribution of B cells in tumors. Myc-CaP tumors were established in 6 weeks old FVB mice. When tumors reached 1000 mm 3 , mice were left untreated (normal) or castrated. A,B. tumors were collected either 3 days or 1 , 2 or 3 weeks later. Frozen sections were stained with anti-B220 antibody or a combination of anti-CD4 and anti-CD8 antibodies, counterstained with DAPI or hematoxylin and analyzed by immunofluorescent microscopy. C. Myc-CaP tumors were established as above. When tumors reached 1000 mm 3 , mice were sham operated or castrated. Tumor samples were collected, digested with collagenase, stained with the indicated cell marker antibodies and analyzed by flow cytometry.
Figure 10. Castration-induced regression of CaP results in induction of inflammatory chemokines in tumor remnants. A. Myc-CaP tumors were established in 6 week old FVB mice (n=10). When tumors reached 1000 mm 3 , mice were left untreated (normal), sham operated or castrated and tumors were collected 1 , 2 or 3 weeks later. Total RNA was isolated and expression of the indicated chemokine and AR mRNAs was quantitated by Q-PCR and normalized to the amount of cyclophilin A mRNA. Results are averages + s.d. (n=3). P values for the difference in mRNA amounts between sham operated and castrated mice at week 1 were determined and depicted as above. B. Myc-CaP tumors were established as described above. Three days before castration mice were injected i.p. with 200 μg of CXCL13 neutralizing antibody or vehicle (PBS). Tumor samples were collected one week after castration. Total RNA was isolated and expression of the indicated cellular marker mRNAs was quantitated by Q-PCR and normalized to the amount of cyclophilin A mRNA. Results are averages + s.d.. P values were determined and depicted as above. C. Frozen sections of SC tumors were stained with anti-B220, counterstained with DAPI and analyzed by immunofluorescent microscopy.
Figure 11. Castration-induced regression of CaP results in induction of inflammatory cytokines in tumor remnants. A. Total RNA was isolated from tumor samples starting 1 week after castration of the mice described above (Fig. 10) and analyzed for expression of the indicated cytokines or prostate stem cell antigen (PSCA) mRNAs as above. B. Total RNA was isolated from the samples described in Fig. 9B and analyzed for expression of the indicated cytokine mRNAs (n=3). P values were determined and depicted as above.
Figure 12. AR localization during the emergence of CR-CaP. Myc-Cap tumors were established in FVB male mice. Tumor samples were collected at the indicated time points after castration and analyzed for AR localization by
immunofluorescent microscopy. Nuclear AR is seen in tumors from non-castrated mice (0 d) and 30 days after castration.
Figure 13. STAT3 is phosphorylated after castration. Myc-CaP tumors were established as described above. Tumor samples were collected at the indicated time points after castration or sham operation. Paraffin-embedded sections were analyzed for STAT3 phosphorylation by staining with phospho-STAT3 antibody.
Figure 14. STAT3 activation and its role in CR-CaP emergence. A,B WT +
Ikkf 1 and WT + lk ^ A radiation chimeras (n=10 each group) bearing myc-CaP allografts were established as above and injected with poly(IC) to delete ΙΚΚβϋ in BMDC before castration or sham operation. After one month, mice were sacrificed for analysis. A. Lymphocytes were isolated from indicated tissues and analyzed for ΙΚΚβ expression. B. Tumor samples were immunoblotted to determine expression and phosphorylation of indicated signaling proteins. C,D FVB mice bearing myc-CaP tumors were castrated. Starting one day before castration, the mice (n=10 per group) were injected twice daily with vehicle or AG490, an inhibitor of STAT3
phosphorylation. C. One week after castration, tumors were collected, paraffin- embedded, sectioned and stained with phospho-STAT3 antibody. D. Tumor volume was measured every 2-3 days as above. Results are averages + s.e.m.. P values were determined and are indicated as above. Figure 15. Selectivity of ΙΚΚβ and STAT3 phosphorylation inhibitors. A.
Myc-CaP cells were cultured to 60% confluency and pre-treated for 1 hr with AG490 (100 μΜ) or ML120B (20 μΜ), followed by stimulation with PMA (10 ng/ml) for 10 min. Cells were collected and ΙκΒ phosphorylation was analyzed. B. Myc-CaP cells were pre-treated with AG490 or ML120B and after 1 hr, were stimulated with IL-6 (20 ng/ml) for 30 min. Cells were collected and STAT3 phosphorylation was analyzed by immunoblotting.
Figure 16. Deletion of ΙΚΚβ in bone marrow derivatives has no effect on infiltration of leukocytes into androgen-deprived tumors. Myc-CaP tumors were established in lethally irradiated FVB males that were reconstituted with lkkff /F or lkk/f A BM. lkk/f' F and lkkff A chimeras were injected with poly(IC) as described above prior to castration. A. One week after castration, tumor samples were collected and total RNA was isolated and expression of indicated cell marker and chemokine receptor mRNAs was quantitated by Q-PCR and normalized to that of cyclophilin A mRNA. Results are averages + s.d. (n=6). B. Tumor samples were collected as above from non-operated (norm), sham operated and castrated mice and expression of B220 mRNA was quantitated as above. Results are averages + s.d. (n=5).
Figure 17. Castration-induced regression of AD-CaP induces expression of cytokines in an ΙΚΚβ-dependent manner. Myc-CaP tumors were established in WT + IkkjF and WT + radiation chimeras. When tumors reached 1000 mm 3 , mice were castrated and one week later, tumor samples were collected. Expression of the indicated cytokine mRNAs was analyzed by Q-PCR and normalized to cyclophilin A mRNA. Results are averages + s.d. (n=5). P values were determined and depicted as above.
Figure 18. Lymphocytes are not required for primary CaP growth but B cells rather than T cells accelerate appearance of CR-CaP. A. Lethally irradiated FVB male mice (n=10 per group) were reconstituted with WT or RagT 1' BM. After 8 weeks, myc-CaP cells were implanted and their growth monitored. B. Lethally irradiated FVB male mice (n= 0 per group) were reconstituted with BM of WT (WT + WT) or T cell deficient Tcr^' ~ /5 ~ ' ^ mice (WT + Tcr^' ~ ^' ~ ). After 8 weeks, myc-CaP tumors were established and the mice were castrated when tumors reached 1000 mm 3 . Tumor volume was measured as above. C. Lethally irradiated FVB male mice (n=10 per group) were reconstituted with BM of WT (WT + WT) or B cell deficient JH ' ~ (WT + H 1' ) mice. After 8 weeks, myc-CaP tumors were established and the mice were castrated when tumors reached 1000 mm 3 . Tumor volume was monitored as above. P values were determined and depicted as above. D. FVB mice (n=5 each group) were inoculated with myc-CaP cells, castrated as above and were given by i.p. injection lgG2a or anti-CD20 (200 μg) every 5 days, starting 4 days before castration. Tumor volume was measured as above. Results are averages + s.e.m..
Figure 19. siRNA-mediated IKKa and LTpR silencing. A. Myc-CaP cells infected with lentiviruses encoding scrambled (sc) or IKKa siRNA were analyzed before implantation or after generation of tumor allografts for IKKa expression. B. LTpR mRNA was analyzed by Q-PCR and normalized to cyclophilin A in myc-CaP cells infected with lentiviruses encoding scrambled (sc) or LTpR siRNA before implantation or after generation of tumor allografts.
Figure 20. LT production in tumors is significantly reduced in the absence of lymphocytes and is localized mainly to B cells. A. Lethally irradiated FVB males were reconstituted with BM from Rag1 ~ ' ~ as described above. Tumors were established, collected 1 week after castration and total RNA was isolated. Expression of LTa and Ι_Τβ mRNAs was quantitated by Q-PCR and normalized to that of cyclophilin A mRNA. Results are averages + s.d. (n=5). B. Myc-CaP tumors were established in FVB mice. One week after castration the tumors were removed, treated with collagenase and single cell suspension stained with LTpR-lg fusion protein and either B220 or TCRp antibodies and analyzed by flow cytometry.
Figure 21. Characterization of tumor infiltrating B cells. Subcutaneous myc-CaP tumors were isolated one week after castration and digested with collagenase to prepare a single cell suspension that was filtered through a cell strainer. The cells were then stained with fluorescently-labeled antibodies to CD45, B220, CD19, IgD, IgM, CD1 1 b, MHC class II and CD5 as well as LTpR-lg fusion protein followed by anti-human Ig-PE antibody (Jackson Immunoresearch) and Aqua LIVE/DEAD dye (Molecular Probes). The stained cells were analyzed by flow cytometry on a BD LSRII instrument. Live hematopoietic cells were gated as CD45 + Aqua " . Shown are representative dot plots from one typical tumor.
Figure 22. B cell-specific Ι_Τβ knockout abolishes Ι_Τβ expression in tumors but has no effect on B cell and macrophage infiltration. Lethally irradiated FVB males were reconstituted with BM from B-LfyT mice as described above. Tumors were established and collected at the indicated times after castration. Total RNA was isolated and expression of the indicated mRNAs was quantitated by Q-PCR and normalized to that of cyclophilin A mRNA. Results are averages + s.d. (n=5). P values were determined and depicted as above.
Figure 23. 1_Τβ is required for IKKa nuclear localization and STAT3 phosphorylation. Mice carrying Myc-CaP tumors were castrated and treated with vehicle or LTpR-lg as described above. Paraffin-embedded sections were analyzed for IKKa nuclear localization and STAT3 phosphorylation.
Figure 24. A model explaining how therapy-induced inflammation promotes emergence of CR-CaP. Androgen withdrawal causes death of primary AD-CaP cells, which release inflammatory mediators that lead to chemokine induction and recruitment of inflammatory cells, including B cells, into the tumor remnant. ΙΚΚβ activation in B cells results in NF- B-dependent production of LT and other factors that activate IKKa and STAT3 in surviving CaP cells. This results in survival and re-growth of CR-CaP.
Figure 25: IKKa is required for growth of castration-resistant tumors and BMI1 Induction. A) Histological analysis (H & E staining of paraffin-embedded sections;
magnification-40x) of prostates from 24 weeks old Ikk( A/+ /Ύ ΑΜΐ and Ikkc^^/TRAMP mice that were castrated at 12 weeks of age. B) Impact of castration on GU weight in the mice described in A. C) Prostate RNA from 24 weeks old Ikka AA/+ ' /TRAMP mice (castrated or sham operated at 12 weeks) was analyzed for expression of PcG genes and DNMTl. D) Prostate RNA from 24 weeks old mice of indicated genotypes castrated at 12 weeks of age, was analyzed foiBmil gene expression. E) RNA from s.c. myc-CaP tumors collected 4 days after castration or sham operation was analyzed for Bmil expression. F) RNA from s.c. myc- CaP tumors formed by mock (Scr.) or ΙΚΚα-silenced cells was collected 2 weeks after castration and analyzed for Bmil expression. G) Protein extracts from mock- (Scr) or IKKa- silenced tumors were analyzed by immunoblotting for Bmil expression 2 weeks after castration or sham operation. In panels B-F, the values represent means ± SD (n=3).
Figure 26: IKKa controls BMI1 expression in prostate cancer. A) Paraffin- embedded prostate sections representing normal tissue (n=9), benign prostatic hyperplasia (n=8), and prostate cancer (n=13) were analyzed by immunohistochemistry for BMI1. The BMI1 staining index was quantitated by Adobe Photoshop and is indicated on the right (p- value is <0.001 for the malignant samples). B) Prostate cancer specimens from A with low and high BMI1 staining indices were evaluated for IKKcc expression (n=4 for each group). The correlation coefficient is indicated on the left. C) RNA collected from myc-CaP tumors established in Ikk /F /Mxl-CRE and Ikk /F mice 2 weeks after castration and analyzed for Bmil expression. To induce CRE expression, host mice were injected withpolyTC 2 days before castration. D) RNAs collected from myc-CaP tumors grown in mice that were given hlgG or LTpR-Ig (100 ug) every 5 days, starting 4 days before castration, were analyzed for Bmil expression 2 weeks after castration. E) RNA samples from myc-CaP cells collected after stable infection with lentiviruses harboring different IKKa constructs (AA = inactivateable, EE-NLS = constitutively active and unable to translocate to the nucleus, EE = constitutively active) were analyzed for Bmil gene expression. F) Lysates of myc-CaP cells collected after stable infection with the above viruses were analyzed for BMI1 expression by immunoblotting. G) ChIP analysis of IKKa recruitment to the Bmil promoter. Chromatin isolated from myc-CaP cells stably infected with lentiviruses harboring a GFP or an
IKKa(EE) insert was formaldehyde crosslinked, sheared and immunoprecipitated with IKKa or HA antibodies and analyzed by qPCR with primers to the Bmil promoter or an intergenic region of chromosome 8. % input was calculated by determining the ratio of
immunoprecipitated DNA with each antibody to a 10% input sample. In panels C-E and G, the values represent means ± SD (n=3).
Figure 27: IKKa interacts with E2F1 and controls its recruitment to the Bmil promoter. A) Chromatin was isolated from myc-CaP tumors established by mock (Scr.)- or ΙΚΚα-silenced cells 2 weeks after sham operation or castration. After crosslinking and shearing, chromatin was immunoprecipitated with antibodies to E2F1 or control IgG and the content of Bmil promoter DNA was determined by qPCR as in 2G. B) Nuclear extracts were prepared from the myc-CaP tumors described above and the presence of E2F DNA binding activity was analyzed by electrophoretic mobility shift assay using the putative Bmil E2F1 binding site as a probe. For competition experiments, 100-fold excess of non-radioactive competitor oligonucleotides representing the Bmil E2F1 site or consensus binding sites of the indicated transcription factors were added to the reactions 10 min. before addition of the radioactive probe. C) Binding of E2F1 and IKKa to the putative Bmil E2F1 binding site was analyzed by UV crosslinking. Extracts from 293T cells transfected with HA-tagged E2F1 or IKKa expression constructs were immunoprecipitated with HA antibody and incubated with the Bmil E2F site probe described in B. The samples were then UV-crosslinked, separated by SDS-PAGE and autoradiographed. D) IKKa mediates recruitment of CBP to E2F1. 293T cells were transfected with GFP or IKKa(EE) vectors. After 48 hrs, the cells were lysed and immunoprecipitated with an E2F1 or Ig control antibodies. Immunoblotting was then performed using the indicated antibodies. E, F) Chromatin was harvested from the myc-CaP tumors described in A and subjected to ChlP analysis as above with antibodies to CBP (E) or Ac-H3 (F). Relative % input was determined as above. In panels A, E and F, the values represent means ± SD (n=3).
Figure 28: BMI1 controls castration resistant tumor growth. A) Myc-CaP cells that were infected with lentiviruses expressing siRNA to GFP (siGFP) or Bmil (siBMIl-1 and -2) were analyzed for BMI1 expression by immunoblotting after 2 weeks in culture or 4 weeks after s.c. tumor growth. B) Sizes of tumors formed by s.c. injection of myc-CaP cells described in A, were determined 4 weeks after inoculation. C) Protein extracts from s.c. myc- CaP tumors formed by mock (Scr.), ΙΚΚα-silenced or ΙΚΚα-silenced+BMIl lentiviral transduction were analyzed for BMI1 expression 2 weeks after castration. D) myc-CaP tumors were established in wild-type mice using cells from C. When tumors reached 500 mm 3 , the mice were castrated. Tumor volume was then measured at the indicated time points. E) RNA from s.c. myc-CaP tumors formed by mock (Scr.) or ΙΚΚα-silenced cells was collected 2 or 3 weeks after castration and analyzed for Bmil expression. In panels B, D and E, the values represent means ± SD (n=3).
Figure 29 BMI1 controls pl6 and pl9 expression in prostate cancer. A) RNAs from s.c. myc-CaP tumors formed by mock (Scr.), ΙΚΚα-silenced, or IKKa-silenced+BMIl transduced cells were analyzed for pl6 and pi 9 expression 2 weeks after castration. B) RNAs collected from myc-CaP tumors described in Figure 26D were analyzed for pi 6 and pl9 expression 2 weeks after castration. (C, D) Chromatin isolated from s.c. myc-CaP tumors formed by mock (Scr.) or ΙΚΚα-silenced cells 2 weeks after sham operation or castration was subjected to ChlP analysis using antibodies to BMI1 (C), ubi-H2A (D) or control IgG.
Presence of Ink4a/Arf sequences was examined by PCR using the primer pairs depicted in Figure 35 or the intergenic region from Ch-8. Relative % input was determined by calculating the ratio of % input of immunoprecipitation with either BMI1 or ubi-H2A antibodies relative to IgG control immunoprecipitations. E) s.c. myc-CaP tumors formed by mock (Scr.) or
ΙΚΚα-silenced cells were isolated 2 weeks after sham operation or castration and analyzed by irnmuno stochemistry for ubi-H2A content. F) Prostates of Ikk(/ A/+ /TRAMP and
Ikka AA/AA /TRAMP mice were collected 12 weeks after sham operation or castration and analyzed by imrnunohistocliemistry for ubi-H2A content. G) Paraffin-embedded prostate sections corresponding to normal tissue (n=9), benign prostatic hyperplasia (n=8) or prostate cancer (n=13) were analyzed by immunohistochemistry for ubi-H2A content. The ubi-H2A staining index was quantitated by Adobe Photoshop and is indicated at the bottom (p-value is <0.001 for the malignant samples). In panels A-D, the values represent means ± SD (n=3).
Figure 30: Nuclear IKK is present in cells that express markers of PCa progenitors and is required for their upregulation. A) Sequential paraffin-embedded sections from s.c. myc-CaP tumors collected 2 weeks after sham operation or castration were analyzed by immunohistochemistry for CD 133 and IKKa. Arrowheads indicate CD133 + cells. B) Quantification of IKKa and CD133 co-staining in 5 fields as in A per tumor, with 3 tumors analyzed for each condition. C) Single-cell suspensions from s.c. myc-CaP tumors formed by mock (Scr.) or IKKcc-silenced cells that were collected 2 weeks after sham operation or castration were analyzed by flow cytometry for CD 133 expression. D) Single- cell suspensions from s.c. myc-CaP tumors formed by ΙΚΚα-silenced and IKKa- silenced+BMIl transduced cells isolated 1 week after castration were analyzed by flow cytometry for CD133 expression. E) RNA samples from s.c. myc-CaP tumors formed by mock (Scr.) or ΙΚΚα-silenced cells collected 2 weeks after sham operation or castration were analyzed for SOX2, Nanog and CD 133 expression. F) Quantification of p63 + cells. Three s.c. myc-CaP tumors collected 2 weeks after sham operation or castration were stained for p63 and the numbers of p63 + cells were determined in 5 fields per tumor. G) Quantification of p63 and IKKa co-expression in the tumors described above. Note that even in tumors from sham operated mice, most p63 + cells contain nuclear IKKa. In panels B-G, the values represent means ± SD (n=3).
Figure 31: IKKa controls androgen-induced regrowth of the normal prostate. A) Outline of prostate regeneration experiments. B) Prostates of Ikkc^ N+ mice were collected at indicated times after castration and analyzed by immunohistochemistry for IKKa nuclear translocation. Percentages of cells with nuclear IKKa staining are indicated below each panel and were determined by analysis of 5 sections per prostate with a total of 3 prostates per condition. C) Prostates oilkkc^* and Ikkaf^^ mice were weighted 17 days after castration and androgen replacement. D) RNAs extracted from prostates (genotype indicated) 17 days after sham operation or castration and subsequent androgen replacement were analyzed for Bmil expression. E) Prostates of WT OX JH ' mice were weighted 17 days after castration and androgen replacement. F,G) RNAs extracted from prostates of WT J ' mice 17 days after T U 2012/023383
sham operation or castration and subsequent androgen replacement were analyzed for Bmil(F) or B220 (G) expression. In panels C-G, the values represent means ± SD (n=3).
Figure 32: Role of I Ka in castration resistance and BMI1 expression. A) myc- CaP tumors were generated by s.c. transplantation of mock (Scr.) or IKKa-silenced cells into wild-type mice. When tumors reached 500 mm 3 in size, the mice were castrated. Tumor volume was then measured at the indicated time points. B) GU weights of 24 weeks old sham operated m« AA + /TRAMP and mice. C) Experimental design of producing CR-PCa in TRAMP mice. All castrations were performed at 12 weeks of age and the prostates were analyzed at 24 weeks. D) Paraffin sections of prostates collected 12 weeks after sham operation or castration from Ikk AAI+ /TRAMP mice were analyzed by
immunohistochemistry for IKKa expression. E) Lysates of s.c. myc-CaP tumors collected 2 weeks after castration or sham operation were analyzed for Bmil expression by
immunoblotting. F) s.c. myc-CaP tumors formed from mock (Scr.) or IKKa-silenced cells 2 weeks after castration were enriched for epithelial cells. RNA was then collected and analyzed for Bmil expression. In panels B and F, the values represent means ± SD (n=3).
Figure 33: Bmil induction requires IKKa activation and nuclear translocation A) Sequential paraffin-embedded sections of human PCa were analyzed by
immunohistochemistry for IKKa and BMIl. B) DU145 human PCa cells were transduced with lentiviruses harboring different IKKa constructs. After 2 weeks in culture, RNA was collected and analyzed for Bmil expression. C) Myc-CaP tumors collected 2 weeks after sham operation or castration were subjected to ChIP analysis using an IKKa antibody and primers to the Bmil promoter or an intergenic region of Ch-8. % input was calculated by determining the ratio of immunoprecipitated DNA to a 10% Input sample. D) s.c. myc-CaP tumors generated by s.c. transplanted mock (Scr.)- or IKKa-silenced cells were collected 2 weeks after castration or sham operation and subjected to ChIP analysis using IKKa antibody or control IgG and primers to the Bmil promoter or an intergenic region of Ch-8. % input was calculated as above. In panels B-D, the values represent means ± SD (n=3).
Figure 34: IKKa activity is required for E2F1 recruitment to the Bmil and Ccne promoters. A) Protein extracts from mock- (Scr.) or IKKa-silenced tumors were analyzed by immunoblotting for E2F1 expression 2 weeks after castration or sham operation. B) myc-CaP tumors collected 2 weeks after sham operation or castration were subjected to ChIP analysis using c-myc antibody or control IgG and primers to the Bmil promoter. C) 293T cells were transfected with GFP, IKKa(EE) or IKKa(AA) vectors. After 48 hrs, the cells were lysed and E2F1 was immunoprecipitated. After gel separation, immunoblotting was performed with the indicated antibodies. D) Mock- or ΙΚΚα-silenced myc-CaP cells were transduced with either an E2F1 or an empty expression vector. After 48 hrs, RNA was collected and Bmil expression was analyzed. E) myc-CaP tumors generated by s.c. transplantation of mock- or ΙΚΚα-silenced cells were collected 2 weeks after sham operation or castration and subjected to Chip analysis with either E2F1 antibody or control IgG and CCNE promoter primers. F) myc-CaP tumors formed by mock (Scr.)- or ΙΚΚα-silenced cells were collected 2 weeks after castration or sham operation. RNAs were extracted and analyzed for CCNE1 expression. In panels B and D-F, the values represent means ± SD (n=3).
Figure 35. Depiction of the mouse Ink4a/Arflocus. The arrows indicate the primer sets used for PCR in ChlP analysis.
Figure 36: B cell depletion with anti-CD20 attenuates androgen-induced regrowth of the normal prostate. A) RNA collected from prostates 17 days after castration and subsequent androgen replacement of mice injected with 250 ug of anti-CD20 or PBS control every 4 days following castration were analyzed for B220 expression. B) Prostate weights of the mice described above. C) RNAs described above were analyzed for Bmil expression. All values represent means s ± SD (n=3).
BRIEF DESCRIPTION OF THE INVENTION
The invention provides methods for reducing growth and/or metastasis of androgen- independent (castration resistant) prostate cancer in a tissue in an animal. In one embodiment the method comprises administering to the animal a therapeutically effective amount of a compound that reduces the number of B cells, and/or the function of B cells, in the tissue. In yet another embodiment, the invention provides methods for reducing androgen-induced growth of prostate epithelial cells in prostate tissue in an animal. In one embodiment, the method comprises administering to the animal a therapeutically effective amount of a compound that reduces the number of B cells, and/or the function of B cells, in the tissue.
The invention provides the unexpected discovery that B cells are needed for the regrowth of castration resistant prostate cancer and for androgen-induced regeneration of normal prostate cells. Data herein demonstrate that interventions that block B cell recruitment into the tumors and/or cause B cell ablation and/or loss of B cell function can inhibit growth of castration resistant cancer. For example, data herein demonstrate that genetic ablation of B cells, B cell ablation with anti-CD20 antibody, and inhibition of B cell recruitment into tumors, inhibit the growth of castration resistant cancer and prevent androgen-induced regeneration of the prostate. Thus, the invention provides a new B cell-targeted approach to the prevention and/or treatment of castration resistant prostate cancer, the second leading cause of cancer deaths in American men.
The invention prevents or significantly delays the re-emergence of androgen - resistant prostate cancer after treatment with anti- androgens or surgical removal or radioablation of primary prostate cancer.
Currently, the common way of treating primary non-metastatic prostate cancer entails treatment with anti-androgen drugs (so called chemical castration). In addition, surgical removal or radioablation are also practiced. While these procedures are effective, a major problem is the re-emergence of androgen independent cancer a few years later. The invention delays the re-emergence of hormone resistant cancer. Several anti-B cells drugs that have been approved for clinical use may be used in the invention's methods. As prostate cancer is normally found in old men, even delay of several years in disease re-emergence is significant.
The invention is further described under (A)Reducing growth and/or metastasis of castration resistant prostate cancer (CaP), and (B) Regeneration of normal prostate tissue.
A. Reducing growth and/or metastasis of castration resistant prostate cancer (CaP)
CR-CaP is a major complication that limits the success of androgen ablation therapy and is responsible for most prostate cancer mortality 2 . Data herein in Examples 1-8 show that CaP progression is associated with inflammatory infiltration and activation of IKKa, which stimulates metastasis by an NF-KB - independent, cell autonomous, mechanism 11 . Data herein in
Examples 1-8 also show that androgen ablation causes
infiltration of regressing AD tumors with leukocytes,
including B cells, in which ΙΚΚβ activation results in
production of cytokines that activate IKKa and S A 3 in CaP cells to enhance hormone-free survival.
Thus, in one embodiment, the invention provides a method for reducing one or more of (a) growth of castration resistant prostate cancer (CaP) cells in a tissue and (b) metastasis of castration resistant prostate cancer (CaP) cells in a tissue, in a mammalian subject in need 12 023383
thereof, comprising administering to the subject a therapeutically effective amount of a compound that reduces one or more of (i) the number of B cells in the tissue, and (ii) the function of B cells in the tissue (Examples 1-8). In one embodiment, the method further comprising detecting a reduction in one or more of a) growth of the castration resistant prostate cancer (CaP) cells, b) the metastasis of castration resistant prostate cancer (CaP), c) the number of the B cells in the tissue, and d) the function of the B cells in the tissue.
In one embodiment, the compound reduces the number of B cells in the tissue, such as by B cell ablation. In a particular embodiment, the compound inhibits specific binding of lymphotoxin (LT) to lymphotoxin (LT) receptor. Preferably, the compound comprises antibody that specifically binds to lymphotoxin- β. In one embodiment, the compound comprises LTpR-Ig.
In a further embodiment, compound that reduces the number of B cells in the tissue, functions in reducing the level of expression of lymphotoxin-β. In a further embodiment, the compound that reduces the number of B cells in the tissue comprises an antibody that specifically binds to a B cell chemoattractant, exemplified by antibody that specifically binds to CXCL13.
In a further embodiment, the compound that reduces the number of B cells in the tissue comprises and antibody. Antibodies that are useful in the invention, such as antibodies that specifically bind to CD20 and/or specifically bind to lympho toxin- β, and/or specifically bind to a B cell chemoattractant (such as CXCL13), include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, recombinant antibodies, humanized antibodies, and antibodies displayed upon the surface of a phage. Also contemplated are antibody fragments that contain the idiotype ("antigen-binding fragment") of the antibody molecule. Examples of such fragments include, but are not limited to, the Fab region, F(ab')2 fragment, Fc' fragment, and Fab' fragments.
In a particular embodiment, the antibody specifically binds to CD20, as exemplified by rituximab antibody (sold under the trade names Rituxan™ and MabThera™ and is a chimeric monoclonal anti-CD20 antibody, that is found primarily on the surface of B cells), ocrelizumab antibody (which is a humanized anti-CD20 monoclonal antibody), and
Ofatumumab (also known as (HuMax-CD20) and is a fully human anti-CD20 antibody).
Antibody treatment of human beings with cancer is known in the art, for example in U.S. Pat. Nos. 5,736,137; 6,333,410; 5,475,092; 5,585,499; 5,846,545; 7,202,346; 6,340,701; 6,372,738; 7,202,346; 5,846,545; 5,585,499; 5,475,092; 7,202,346; 7,662,387; 7,662,387; 6,429,295; 7,666,425; 5,057,313. antibodies may be administered with pharmaceutically acceptable carriers, diluents, and/or excipients. Examples of suitable carriers, diluents and/or excipients include Dulbecco's phosphate buffered saline, pH about 7.4, containing about 1 mg/ml to 25 mg/ml human serum albumin, (2) 0.9% saline (0.9% w/v NaCl), and (3) 5% (w/v) dextrose.
In one embodiment, the invention's compositions comprise a lipid for delivery as liposomes. Methods for generating such compositions are known in the art (Borghouts et al. (2005). J Pept Sci II, 713-726; Chang et al. (2009) PLoS One 4, e4171 ; Faisal et al. (2009) Vaccine 27, 6537-6545; Huwyleret al. (2008) Int J Nanomedicine 3, 21-29; Song et al. (2008) Int J Pharm 363, 155-161; Voinea et al. J Cell Mol Med 6, 465-474).
The invention's compositions are administered in a "therapeutic amount." The terms
"therapeutic amount," "pharmaceutically effective amount," "therapeutically effective amount," "biologically effective amount," and "protective amount" are used interchangeably herein to refer to an amount that is sufficient to achieve a desired result, whether quantitative and/or qualitative. In particular, a therapeutic amount is that amount that delays, reduces, palliates, ameliorates, stabilizes, prevents and/or reverses one or more symptoms of the disease (e.g., prostate cancer, prostate cancer metastasis, etc.) compared to in the absence of the composition of interest. Examples include, without limitation, tumor size and/or tumor number in cancer disease, biochemical tissue function tests, etc.
Specific "dosages" of a ""therapeutic amount" will depend on the route of administration, the type of subject being treated, and the physical characteristics of the specific subject under consideration. These factors and their relationship to determining this amount are well known to skilled practitioners in the medical, veterinary, and other related arts. This amount and the method of administration can be tailored to achieve optimal efficacy but will depend on such factors as weight, diet, concurrent medication and other factors, which those skilled in the art will recognize. The dosage amount and frequency are selected to create an effective level of the compound without substantially harmful effects.
For example, in therapeutic antibody applications, when present in an aqueous dosage form, rather than being lyophilized, the antibody typically will be formulated at a
concentration of about 0.1 mg/ml to 100 mg/ml. Depending on the type and severity of the disease, about 0.015 to 15 mg of antibody/kg of patient weight is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate
administrations, or by continuous infusion. For repeated administrations over several days or longer, depending on the condition, the treatment is repeated until a desired suppression of disease symptoms occurs. 2012/023383
In one embodiment, the compound reduces one or more function of B cells, as exemplified by ΙΚΚβ inhibitors ML120B and IKK2 VI inhibitor, as well as by non-steroidal anti-inflammatory drugs (nSAIDs) or TNF inhibitors such as curcumin or cannabis.
In some embodiments, the invetnion's methods further comprise administering STAT3 and/or an IKKa inhibitor to the mammal.
In some embodiments, prior to and/or after administering to the subject a compound that reduces the number of B cells in the tissue, and/or the function of B cells in the tissue, it may be desirable to for the subject to receive one or more treatment such as surgery, radioablation, and treatment with an anti-androgen compound.
In some embodiments, the subject is treated with the compound that reduces the number of B cells in the tissue and/or the function of B cells, prior to and/or after detecting a symptom of growth of castration resistant prostate cancer (CaP) cells in the tissue, and/or detecting metastasis of castration resistant prostate cancer (CaP) cells in a tissue.
The invention's compositions and methods are also useful for a subject "in need of reducing one or more symptoms of a disease includes a subject that exhibits and/or is at risk of exhibiting one or more symptoms of the disease. For Example, subjects may be at risk based on family history, genetic factors, environmental factors, etc. This term includes animal models of the disease. Thus, administering a composition (which reduces a disease and/or which reduces one or more symptoms of a disease) to a subject in need of reducmg the disease and/or of reducing one or more symptoms of the disease includes prophylactic administration of the composition (i.e., before the disease and/or one or more symptoms of the disease are detectable) and/or therapeutic administration of the composition (i.e., after the disease and/or one or more symptoms of the disease are detectable). The invention's compositions and methods are also useful for a subject "at risk" for disease refers to a subject that is predisposed to contracting and/or expressing one or more symptoms of the disease. Tins predisposition may be genetic (e.g., a particular genetic tendency to expressing one or more symptoms of the disease, such as heritable disorders, etc.), or due to other factors (e.g., environmental conditions, exposures to detrimental compounds, including carcinogens, present in the environment, etc.). The term subject "at risk" includes subjects "suffering from disease," i.e., a subject that is experiencing one or more symptoms of the disease. It is not intended that the present invention be limited to any particular signs or symptoms. Thus, it is intended that the present invention encompass subjects that are experiencing any range of disease, from sub-clinical symptoms to full-blown disease, wherein the subject exhibits at least one of the indicia (e.g., signs and symptoms) associated with the disease. The invention also provides a method for reducing growth and/or metastasis of castration resistant prostate cancer (CaP) cells in a tissue in a mammalian subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound that reduces the level of activation of IKKa.
B. Regeneration of normal prostate tissue
Inflammation triggered by tissue injury may cause epigenetic changes that promote regeneration or tumor development, but mechanistic links between these processes are missing from the prior art.
A link between inflammation and cancer was proposed (Balkwill and Mantovani,
2001). In the past decade, studies using mouse models of human cancer have illustrated several key mechanisms that link inflammation to tumor development and progression (Grivennikov et al., 2011). Quite frequently, inflammatory signals, mainly cytokines, produced by immune cells within the tumor microenvironment lead to paracrine activation of transcription factors, such as NF-κΒ and STAT3, within pre-malignant cells, thereby enhancing survival and proliferation of cancer progenitors. Usually, this crosstalk does not involve irreversible genetic changes, although oncogenic mutations can result in upregulation of chemokine gene expression in malignant cells, thus promoting establishment of a pro- tumorigenic inflammatory microenvironment (Karin, 2005). Nonetheless, chronic inflammation may also enhance tumor initiation and/or malignant progression through induction of oncogenic mutations, chromosomal instability and epigenetic changes (Hussain and Harris, 2007). The mechanisms and pathways through which inflammation elicits epigenetic changes that contribute to tumor development and progression are unknown. Inflammation is also of importance in wound repair and tissue regeneration and it has been pointed out that tumors are analogous to wounds that do not heal (Dvorak, 1986).
Furthermore, signaling pathways that play a major role in tissue regeneration and stem cell renewal, namely the Wnt and Hedgehog pathways, are also key players in tumorigenesis (Beachy et al., 2004). However, it is unknown whether and how Wnt and Hedgehog signaling are activated in response to inflammatory signals generated by tissue injury. It is also not clear how tissue injury leads to stem cell activation.
Another signaling pathway involved in inflammation, tissue repair and cancer is the NF-KB pathway (Ben-Neriah and Karin, 2011). To study roles of NF-κΒ transcription factors in cancer, we have focused our studies on components of the ΙκΒ kinase (IKK) complex, namely the IKKa and ΙΚΚβ catalytic subunits (Karin, 2009). While both kinases can activate NF-KB-mediated transcription, IKKa also has NF-KB-independent functions in development (Descargues et al., 2008; Hu et al., 1999; Hu et al., 2001) and tumorigenesis (Ammirante et al., 2010; Luo et al., 2007; Marinari et al., 2008). NF-KB-independent activities of IKKa are particularly evident in prostate cancer (PCa), the most common non- skin cancer in men. Currently, PCa results in over 30,000 deaths each year in the US - making it the second leading cause of cancer deaths in men (American Cancer Society, 2010). This is due to the fact that while androgen ablation or chemical castration therapy, the standard of care for PCa, is effective in the short term, the cancer will inevitably switch to a more aggressive, metastatic and eventually fatal form termed castration-resistant (CR) PCa (Gulley et al., 2003). The genesis of CR-PCa depends on emergence of PCa stem-like cells that either do not require androgen signaling for growth and survival or are highly sensitive to castrate levels of androgens (Maitland and Collins, 2008). Data herein in Examples 1-8 show that androgen ablation results in an inflammatory response, characterized by lymphocyte infiltration and production of cytokines that activate IKKa in surviving PCa cells, which accelerates the emergence of CR-PCa (Ammirante et al., 2010).
While not intending to limit the invention to a particular mechanism, in one embodiment, this castration-induced inflammatory response may be triggered by the death of androgen-deprived PCa cells, which causes the release of signals that induce expression of inflammatory chemokines by components of the tumor stroma. This leads to recruitment of a heterogeneous collection of immune cells, of which B lymphocytes are particularly important as they serve as the main source of lymphotoxin (LT), a heterodimeric member of the TNF family that activates IKKa (Ammirante et al., 2010). Data herein (Example 3) shows that ablation of B cells or inhibition of their recruitment into the regressing tumors by
neutralization of the B cell chemoattractant CXCL13 prevents IKKa activation and delays CR-PCa regrowth. LT signaling leads to nuclear accumulation of IKKa, previously found to occur in human and mouse PCa, where it is required for metastatic spread but not for primary tumor growth (Luo et al., 2007). However, the molecular mechanisms by which nuclear IKKa enhances the survival and proliferation of progenitor cells that give rise to metastases and CR-PCa are not clear, although it was found that nuclear IKKa promotes metastasis through repression of the SBP5 gene, which codes for the metastasis inhibitor maspin (Luo et al., 2007). Previous studies suggested that nuclear IKKa acts as a histone H3 kinase (Anest et al., 2003; Yamamoto et al., 2003), whereas other reports have described an interaction P T/US2012/023383
between ΙΚΚα and the histone acetylase (HAT) CBP/p300 that results in phosphorylation of the latter (Huang et al., 2007). IKK was also reported to regulate expression and activity of transcription factor E2F1 (Tu et al., 2006) and counteract SMRT repressor activity leading to acetylation of p65 RelA by p300 (Hoberg et al., 2006).
Data herein in Examples 9-16 demonstrate that IKKa, which accumulates in nuclei of mouse and human prostate cancer (PCa) cells, associates with E2F1 in response to inflammatory signals generated upon androgen ablation to induce transcription of the
Polycomb-group gene Bmil. Increased BMI1 expression results in histone 2A ubiquitination and repression οΐρΐό^^ and pl^, leading to enhanced proliferation of PCa progenitors responsible for development of castration resistance, a severe complication of failed androgen ablation therapy. Furthermore, IKKa activation by B lymphocyte inflammatory signals is required for androgen-induced normal prostate regeneration. These findings chart a pathway that links inflammation caused by tissue injury to epigenetic changes that are critical for activation of cancer and adult tissue stem cells. Interference with this pathway augments the outcome of androgen ablation and blocks tissue regeneration.
Data herein provides the discovery of the control of CR-PCa genesis by IKKa.
Specifically, in an NF-KB-independent manner, IKKa activates E2F1 -driven transcription of the Bmil gene, coding for the polycomb group protein BMIl which possesses histone 2A (H2A) ubiquitin ligase activity when part of Polycomb repressive complex 1 (PRC1) (Wang et al, 2004). BMIl, in turn, drives CR-PCa emergence by silencing the tumor suppressor genes pl6 to 4a and pl9 Arf to stimulate self-renewal of putative PCa progenitors/stem cells. Recent studies highlight a role for BMIl in proliferation of normal prostate stem cells (Lukacs et al., 2010). Data herein also identified a critical requirement for IKKa in androgen-induced regeneration of the normal prostate, which we demonstrate to be highly dependent on an injury-triggered inflammatory response similar to the one that drives CR- PCa. These results indicate that IKKa is a critical link between inflammation and PRC1- dependent epigenetic mechanisms that control the proliferation of both cancer and normal tissue stem cells. Data herein also shows a strong correlation between nuclear IKKa, BMIl expression and presence of ubiquitinated (ubi-) H2A in human PCa specimens. These findings suggest that interference with IKKa activation would be an adjuvant to androgen ablation therapy.
Thus in one embodiment, the invention provides a method for reducing androgen- induced growth of prostate epithelial cells (including non-cancerous, normal cells) in a mammalian subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound that reduces one or more of (a) the number of B cells in the tissue, (b) the function of B cells in the tissue, and (c) the level of activation of IKKa. In some embodiments, the method further comprises detecting a reduction in one or more of a) androgen-induced growth of the prostate epithelial cells, b) the number of B cells in the tissue, c) the function of B cells in the tissue, and d) the level of activation of IKKa.
EXPERIMENTAL
The following serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
EXAMPLE 1
METHODS USED IN EXAMPLES 2-7
Mice were handled according to institutional and NIH guidelines. Tumors were grown in FVB mice. Where indicated, lethally irradiated FVB mice were reconstituted with BM from different strains that were backcrossed into the FVB background for at least two generations. Σίβ knockout strains were, however, in the BL6 background which does not elicit a graft vs. host response in FVB mice. Human material was obtained from the
Cooperative Human Tissue Network (CHTN) along with pathology reports. Histology, gene expression and cell signaling were analyzed as described 11, 25 .
Mice and cell culture
Ikkfi 1 * (BL6) mice were crossed to TRAMP (BL6xl29) mice 31 and PB-Cre4 (BL6) 32 or Mxl-Cre (BL6) mice 33 to generate TRAMP + ' ~ /Ikk^ /¥ /PB-Cre4 +l~ and TRAMP +I~ fIkk^ /F /PB-Cre4 +/+ or TRAMP +l~ IIkkB* IMxl-Cre +l~ and TRAMP +/~ /Ikk^/Mxl-Cre +/+ progeny that were intercrossed with TRAMP mice for six generations. After that, TRAMP +/" IIkk0 rW IPB-Cre4 - and TRAMP +/ -/IkkB +/F /PB-Cre4 +/+ or TRAMP^II ^ IMxl-Cre^ and TRAMP^ ' ilkk^ I Mxl-Cre mice were intercrossed to generate TRAMP^IIkk^ IPB- Cre4 + '-, TRAMP +/~ /Ikk/f /F /PB-Cre4 +/+ , TRAMP* !~ ITkkff IY IMxl-Cre^ and TRAMP ~
Hkk^lMxlCre^ mice. Only male littermates were used. FVB, Tcr^ ' S^ (BL6), Mxl-Cre and RagF' ~ (BL6xl29) mice were from the Jackson Laboratory. mice (FVB) were kindly provided by L. Coussens (Cancer Research Institute and Anatomic Pathology, UCSF, San Francisco, CA). Bone marrow from -LtB ~l~ or Ύ-Τίβ μ mice 21 was kindly provided by C.F. Ware (La Jolla Institute for Allergy and Immunology, La Jolla, CA). PB-Cre4 and TRAMP mice were from MMHCC (Mouse Models of Human Cancer Consortium). Mice were maintained under specific pathogen-free conditions, and experimental protocols were approved by the UCSD Animal Care Program, following IH guidelines. Radiation chimeras were generated as In general, irradiated FVB mice were reconstituted with bone marrow from different strains that have been backcrossed to the FVB background for at least 2 generations. However, in the case ofB-ZfyS^ and T-Zi/r 7 - mice, bone marrow donors were of the BL6 background, whose bone marrow did not lead to a graft vs. host response in irradiated FVB mice. Myc-CaP cells derived from the FVB background were provided by C. Sawyers (UCLA and Memorial Sloan Kettering Cancer Center) 35 and were cultured under standard conditions and confirmed to be mycoplasma free. Myc-CaP cells were injected subcutaneously into the flank of male FVB mice as described 35 . Tumor growth was measured with a caliper. Surgical procedures were as described 35 .
Human specimens
Anonymous human prostate, benign prostatic hyperplasia and prostate cancer frozen sections were provided by the Cooperative Human Tissue Network (CHTN).
Pathology reports were provided by CHTN for each sample.
CXCL13 and B cell depletion and LT inhibition
CXCL13 neutralizing antibody was purchased from R&D and administered i.p. at 200 mg/mouse as described 36 . Anti-CD20 was kindly provided by Genentech (Oceanside, CA) and was administered i.p. at 250 μg/mouse. LTpR-Ig fusion protein was a kind gift from
99
Yang-Xin Fu (University of Chicago, Chicago, IL) and was administered as described . hlgG and mouse IgG2a were purchased from Sigma-Aldrich and were used as controls.
ΙΚΚβ inhibitors
ML 120 was provided by Millem ' um Inc. and administered orally as described . ΙΚΚβ
Inhibitor IV was purchased from Calbiochem and was tail vein injected as described 14 .
Histological procedures
Mouse prostate and CaP tissues and dissected metastatic tumors were immersed in 10% neutral buffered formalin before sectioning and paraffin embedding. Sections were stained and processed as described 11 , using H&E stain, TUNEL assay kit or antibodies for
IKKa (Imgenex), phospho-STAT3 (Cell Signaling) and CD 19 (eBioscience) as described 38. Frozen sections of human and mouse origins were fixed in acetone and processed as described 11 , using antibodies for AR (Santa Cruz), B220 (BD),CD20 (BD), CD4 (BD) and CD8 (BD).
Analysis of RNA and protein expression
Total tissue RNA was prepared using RNAeasy (Qiagen). Quantitative PCR was performed as described 38 . Cells and tumors were lysed and analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting with antibodies to histone H3, a-tubulin, STAT3 (Santa Cruz Biotechnology), ERK, phospho-ERK, AKT, phospho-AKT, phospho-STAT3 (Cell Signaling). Nuclear extracts were prepared and analyzed for NF- Β DNA-binding as described 39 .
Lentiviral and retroviral transduction
siRNAs to mouse ΙΚΚα, ΙΚΚβ and LTp mRNAs were cloned into pLSLPw, provided by I. Verma (The Salk Institute), and lentivirus stocks were prepared as described 1 1 . Virus-containing supematants were added to myc-CaP cells for 2 days with polybrene, and transduced cells were selected in 5 μg ml "1 puromycin (Invitrogen).
Leukocytes purification and flow cytometry
Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation on a double-layered Histopaque-Ficoll (GE Lifescience) gradient. Splenic B and T lymphocytes were isolated by magnetic cell sorting (MACS) with CD4, CD8 or CD 19 antibodies conjugated to magnetic beads. Tumor infiltrating leukocytes were stained with CD45, B220, LTpR-Ig, TCR , Grl, CD4 and CD8 fluorescent antibodies, as well as Aqua LIVE/DEAD dye (Molecular Probes) and analyzed on a flow cytometer (Accuri C6 or Becton Dickinson LSR II).
Statistical analyses
Results are expressed as means + s.e.m. or s.d. Data were analyzed by Student's t-test and Kaplan-Meier survival analysis using GraphPad Prism statistical program. Error bars depict s.e.m. or s.d. P values >0.05 were considered insignificant (ns), 0.01 to 0.05 were considered significant (*), 0.001 to 0.01 were considered very significant (**) and < 0.001 were considered as highly significant (***).
References in Example 1 :
1 Greenberg, N. M. et al. Prostate cancer in a transgenic mouse. Proceedings of the National Academy of Sciences of the United States of America 92, 3439-3443, (1995).
2 Wu, X. et al. Generation of a prostate epithelial cell-specific Cre transgenic mouse model for tissue-specific gene ablation. Mechanisms of development 101, 61-69, (2001). Kuhn, R., Schwenk, F., Aguet, M. & Rajewsky, K. Inducible gene targeting in mice. Science 269, 1427-1429, (1995).
4 Tumanov, A. V. ei al. Dissecting the role of lymphotoxin in lymphoid organs by conditional targeting. Immunol Rev 195, 106-116, (2003).
5 Kim, S. et al. Carcinoma-produced factors activate myeloid cells through TLR2 to stimulate metastasis. Nature 457, 102-106, (2009).
6 Watson, P. A. et al. Context-dependent hormone-refractory progression revealed through characterization of a novel murine prostate cancer cell line. Cancer research 65, 11565-11571, (2005).
7 Zheng, B. et al. CXCL13 neutralization reduces the severity of collagen-induced arthritis. Arthritis and rheumatism 52, 620-626, (2005).
8 Lee, Y. et al. Recruitment and activation of naive T cells in the islets by lymphotoxin beta receptor-dependent tertiary lymphoid structure. Immunity 25, 499-509, (2006).
9 Izmailova, E . S. et al. Use of molecular imaging to quantify response to IKK-2 inhibitor treatment in murine arthritis. Arthritis and rheumatism 56, 117-128, (2007).
10 Park, B. K. et al. NF-kappaB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF. Nature medicine 13, 62-69, (2007).
11 Luo, J. L. et al. Nuclear cytokine activated IKKa controls prostate cancer metastasis by repressing maspin. Nature 446, 690-694, (2007).
1 2 Luo, J. L., Maeda, S., Hsu, L. C, Yagita, H. & Karin, M. Inhibition of NF-κΒ in cancer cells converts inflammation- induced tumor growth mediated by TNFa to TRAIL- mediated tumor regression. Cancer cell 6, 297-305, (2004).
13 Senftleben, U. et al Activation by IKKa of a second, evolutionary conserved, NF-KB signaling pathway. Science 293, 1495-1499, (2001).
14. Park, B.K. et al. NF-kappaB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF. Nature Med 13, 62-69 (2007).
21. Tumanov, A.V. et al. Dissecting the role of lymphotoxin in lymphoid organs by conditional targeting. Immunol Rev 195, 106-1 16 (2003).
22. Lee, Y. et al. Recruitment and activation of naive T cells in the islets by lymphotoxin beta receptor-dependent tertiary lymphoid structure. Immunity 25, 499-509 (2006).
31. Greenberg, N.M. el al. Prostate cancer in a transgenic mouse. Proc Natl Acad Sci USA 92, 3439-3443 (1995). 32. Wu, X. et al. Generation of a prostate epithelial cell-specific Cre transgenic mouse model for tissue-specific gene ablation. Mech Dev 101, 61-69 (2001).
33. Kuhn, R., Schwenk, F., Aguet, M. & Rajewsky, K. Inducible gene targeting in mice. Science 269, 1427-1429 (1995).
34. Kim, S. et al. Carcinoma-produced factors activate myeloid cells through TLR2 to stimulate metastasis. Nature 457, 102-106 (2009).
35. Watson, P. A. et al. Context-dependent hormone-refractory progression revealed through characterization of a novel murine prostate cancer cell line. Cancer Res 65, 11565- 11571 (2005).
36. Zheng, B. et al. CXCL13 neutralization reduces the severity of collagen-induced arthritis. Arthritis Rheum 52, 620-626 (2005).
37. Izmailova, E.S. et al. Use of molecular imaging to quantify response to IKK-2 inhibitor treatment in murine arthritis. Arthritis Rheum 56, 117-128 (2007).
38. Luo, J.L., Maeda, S., Hsu, L.C., Yagita, H. & Karin, M. Inhibition of NF-κΒ in cancer cells converts inflammation- induced tumor growth mediated by TNFa to TRAIL-mediated tumor regression. Cancer Cell 6, 297-305 (2004).
39. Senftleben, U. et al. Activation by IKKa of a second, evolutionary conserved, NF-KB signaling pathway. Science 293, 1495-1499 (2001). EXAMPLE 2
To detennine whether ΓΚΚβ -driven NF-κΒ participates in development of CR-CaP, we conditionally deleted the Ώ ζβ gene in prostate epithelial cells of TRAMP mice, in which CaP is induced by prostate specific expression of SV40 T antigen 12 . Counter to previous expectations 4 , ΙΚΚβ ablation in prostate epithelial cells had no effect on genesis and progression of AD-CaP (Fig. 5) or development of CR-CaP after castration (Fig. 6). To facilitate mechanistic analysis of CR-CaP development we used subcutaneous (SC) allografts of the mouse AD-CaP cell line myc-CaP, which is derived from the FVB genetic
background 13 . Silencing of ΙΚΚβ in myc-CaP cells did not affect primary tumor growth or CR-CaP re-growth in castrated FVB mice (Fig. 7).
By contrast, deletion of ΓΚΚβ in interferon-responsive cells upon induction of Mxl-
Cre expression prevented castration-induced metastatic spread in TRAMPIIkkfF /Mxl-Cre mice (Fig. 8A). To narrow down the role of ΙΚΚβ to bone marrow (BM)-derived cells (BMDCs), we reconstituted irradiated FVB mice with BM from Ikk/ ' v and lkkj A mice (Ikk/f 11 ΊΜχΙ-Cre mice injected with poly(IC) to induce Mxl-Cre) and inoculated the resulting chimeras (Fig. 8B) with myc-CaP cells. Absence of ΙΚΚβ in BMDC had no impact on primary tumor growth, but delayed CR-CaP emergence after castration (Fig. 8C). A similar delay in CR-CaP growth was seen in castrated tumor-bearing mice treated with specific ΙΚΚβ inhibitors 14, 15 (Fig. 8D and data not shown).
EXAMPLE 3
Dependence of CR-CaP emergence on ΙΚΚβ in BMDC, suggested that androgen deprivation elicits a tumor-associated inflammatory response. Castration of mice bearing myc-CaP tumors resulted in CaP cell death, peaking within one week (Fig. 1A).
Concurrently, the regressing tumors were infiltrated with T and B lymphocytes, NK cells and myeloid cell types (Fig. IB; Fig. 9). Infiltration was transient, declining by 2 weeks after castration. B and T lymphocyte infiltration was also detected in 100% of human CaP samples (untreated patients with Gleason scores of 6-8), but B cells were undetectable in normal prostate or benign prostatic hyperplasia (Fig. 1C). The mRNAs for many inflammatory chemokines were also upregulated in the myc-CaP allografts, but no changes in AR mRNA expression were found (Fig. 10A). These chemokines may recruit lymphoid and myeloid cells into the regressing tumor. Indeed, antibody mediated inhibition of CXCL13, a B cell chemoattractant 16 , prevented castration-induced B cell recruitment (Fig. 10B,C).
Inflammatory cytokine mRNAs, including IL-6, IL-12, TNF-a and lymphotoxin (LT), were also upregulated in the regressing myc-CaP allograft, but only LT expression was reduced upon CXCL13 inhibition (Fig. 11). Castration resulted in nuclear export of AR, but after 3 weeks AR was nuclear again (Fig. 12), suggesting it is activated at late phases of CR-CaP growth despite androgen depletion.
EXAMPLE 4
STAT3 was proposed to promote activation of unliganded AR 17 . Indeed, STAT3 was activated during CR-CaP emergence, faster than AR was (Fig. 13). MxJ-Cre-mediated ΓΚΚβ deletion, which was nearly complete in mature B and T lymphocytes (Fig. 14A), prevented STAT3 activation in regressing tumors, but did not affect ERK and AKT activation (Fig. 14B). Immunohistochemical analysis confirmed STAT3 activation in CaP cells, inhibitable by A490 (Fig. 14C), an inhibitor of STAT3 phosphorylation 18 that delayed appearance of CR-CaP (Fig. 14D) but did not inhibit IKK activation (Fig. 15A). Conversely, ML120B did not inhibit STAT3 activation (Fig. 15B).
EXAMPLE 5
Ablation of BMDC ΙΚΚβ did not prevent leukocyte recruitment into regressing tumors (Fig. 16) but did inhibit cytokine induction (Fig. 17). To further investigate the role of lymphocytes, we used chimeric mice generated by transplantation of BM from lymphocyte- deficient RagF 1' mice. Although primary tumor growth was identical in mice receiving WT or RagF !~ BM (Fig. 18A), CR-CaP growth was significantly delayed in mice receiving RagF ;~ BM (Fig. 2A), but not in mice reconstituted with BM from TcrfiT 1 Ιδ ~! mice (Fig. 18B), which lack only mature T lymphocytes. CR-CaP growth was delayed in mice reconstituted with BM from J H ~ ' ~ mice (Fig. 18C), which lack mature B cells, or upon B cell depletion with CD20 antibody 19 (Fig. 18D). Reconstitution oiRagF 1' FVB mice with splenic B cells, but not T cells of FVB mice, restored rapid CR-CaP re-growth (Fig. 2A). Primary tumors, isolated from RagF 1' chimeric mice one week after castration, did not show STAT3 activation (Fig. 2B), but reconstitution with B cells, rather than T cells, restored castration-induced STAT3 phosphorylation (Fig. 2C).
EXAMPLE 6
CaP allografts from castrated, but not sham-operated, mice exhibited IKKa nuclear translocation (Fig. 3A,B). Silencing of IKKa in myc-CaP cells using siRNA (Fig. 19A) had little effect on primary tumor growth, but delayed CR-CaP emergence (Fig. 3C). Nuclear translocation of IKKa was dependent on ΙΚΚβ in BMDC and on B cells, but not on T cells (Fig. 3D). IKKa nuclear translocation parallels progression of human and murine CaP and coincides with primary tumor infiltration with cells expressing ΙΚΚα-activating cytokines,
RANK ligand (RANKL) and LTa 11 . Castration induced LTa and LTp in regressing myc-CaP allografts, but did not alter RANKL expression (Fig. 11). LT expression in regressing tumors was absent in RagF 1" mice (Fig. 20A) and flow cytometry localized it to tumor infiltrating B cells (TIBC; Fig. 20B). We characterized TIBC by 7-color flow cytometry with several markers and a LTpR-Ig fusion protein to detect LT. The typical TIBC was a conventional, mature B2 cell that expressed LT on its surface and was negative for Bl markers (Fig. 21). ΙΚΚβ deletion abolished LT expression by B cells (Fig. 4A), supporting the previously suggested 20 role of NF-κΒ in LTa/β induction. EXAMPLE 7
To examine whether LT production by tumor-infiltrating lymphocytes stimulates CR- CaP growth, we transplanted BM from Β-Ιίβ ~ ' ~ οτ T-Ltp ~ ' ~ mice, which lack LT in either B or T cells 21 , into lethally irradiated mice. LTp ablation in B cells, but not in T cells, delayed growth of CR-CaP (Fig. 4B) and abolished LTP expression within tumors but did not prevent B cell or macrophage infiltration (Fig. 22). Treatment of mice with the LTpR-Ig decoy 22 was as effective as B cell-specific LTp ablation in delaying CR-CaP growth (Fig. 4C) and prevented IKKa and STAT3 activation (Fig. 23). Silencing of LTpR in Myc-CaP cells (Fig. 19B) also delayed CR-CaP growth (Fig. 4D). Exogenous LT maintained myc-CaP growth in the presence of flutamide, a clinically used AR antagonist 5 , in a manner dependent on IKKa (Fig. 4E), whose nuclear translocation was LT inducible (Fig. 4F).
EXAMPLE 8
Discussion of Examples 1-7
Data herein in Examples 1-8 demonstrate that an inflammatory response triggered by death of androgen-deprived primary cancer is another important contributor to emergence of CR-CaP. In addition to dying CaP cells, critical participants in this response are tumor infiltrating B cells, which produce LTa:P heterotrimers that stimulate LTpR on CaP cells to induce IKKa nuclear translocation and STAT3 activation, thereby enhancing androgen- independent growth (Fig. 24). Interference with any component of this response results in a significant and reproducible 3-4 week delay in appearance of CR-CaP.
Extrapolation from "mouse time" to "human time" suggests that interventions that prevent LT production or signaling may delay appearance of CR-CaP in patients undergoing androgen ablation therapy by 2.3 to 3.1 years.
Importantly, our results suggest that, at least for CaP, the inflammatory response elicited by the dying primary tumor, contributes to the failure rather than the previously proposed success of anti-cancer therapy 2 ^. Without limiting the invention to a particular mechanism, in one embodiment, necrotic cell death releases mediators, such as HMGB1 24 and IL-la 25 , that activate ΙΚΚβ and NF-κΒ and stimulate production of chemokines, one of which, CXCL13, recruits B cells into the regressing tumor. Notably, TIBC were detected not only in androgen-deprived mouse CaP, but also in human CaP. Although B cells were reported to promote progression of skin carcinomas 9 and exert immunosuppressive effects through activation of inhibitory Fc receptors on myeloid cells , the critical tumor promoting B cell function in our experimental model is production of LT, an IKKa-activating cytokine 27 , which promotes survival of androgen-deprived CaP. Another important function of TIBC is activation of STAT3, an anti-apoptotic and pro-tumorigenic transcription factor 28 . Without limiting the invention to a particular mechanism, although the STAT3 -activating cytokine in this system is not identified, in one embodiment, castration induces expression of ST AT3 -activating IL-6 and IL-12 family members. Furthermore, CaP cells use autocrine IL- 6 to stimulate their progression 29 and activated STAT3 promotes ligand-independent AR activation 29 . LT is also involved in the etiology of human CaP. An epidemiological study revealed that reduced CaP risk due to consumption of non-steroidal anti-inflammatory drugs, such as aspirin, is limited to men who express a common polymorphic LTa allele that specifies high LT production 30 . Data herein in Examples 1-7 demonstrate that individuals who are nigh LT producers are more likely to develop CR-CaP and thus would beneficit from anti-LT therapy.
EXAMPLE 9
METHODS USED IN EXAMPLES 10-16
Mice
Mice were maintained under specific pathogen-free conditions, and experimental protocols were approved by the University of California, San Diego Animal Care Program, following National Institutes of Health (NIH) guidelines. TRAMP mice (Gingrich et al, 1996) were intercrossed with Ikkd WAA mice (Cao et al., 2001) for six generations to generate and Ma AA/+ /TRAMP mice that were of the FVB background. Males were allowed to reach 12 weeks of age when they were castrated or sham operated as described (Watson et al., 2005). Tumors were harvested 12 weeks later. For myc-CaP tumor growth, 3X10 6 cells were s.c. injected into 6 weeks old FVB mice (Watson et al., 2005). Tumors were allowed to reach 500-1000 mm 3 before mice were castrated. Tumors were then harvested at the indicated times. For prostate regeneration studies, 6 weeks old FVB mice (Ikkc^*, Ikkc^ 1 ^, JH ~ or WT) were castrated. After 7 days, the mice received 3 s.c.
injections of 5 ug of testosterone propionate once every 4 days.
Human specimens Anonymous human prostate, benign prostatic hyperplasia and prostate cancer frozen sections accompanied by pathology reports were provided by the Cooperative Human Tissue Network.
Histological procedures
Tumors and prostates were immersed in 10% neutral buffered formalin before sectioning and paraffin embedding. Sections were stained and processed as described (Luo et al., 2007), using haematoxylin and eosin (H&E), or antibodies for IKKa (Imgenex), BMI1 (Millipore) CD133 and p63 (Santa Cruz Biotechnologies), and ubi-H2A ( illipore) as described. The density of nuclear staining was determined using Adobe Photoshop as described (Lehr et al., 1997).
Analysis of RNA and protein expression
Total tissue RNA was prepared using RNAeasy (Qiagen). Quantitative PCR was performed as described (Luo et al., 2004). Cells and tissues were lysed and analysed by SDS- PAGE and immunoblotting with antibodies to BM I1 (Millipore), β-tubulin (Sigma), IKKa (Imgenex), E2F1 (Sc-251), CBP (A-22) or HA (Roche). Nuclear extracts were prepared and analyzed for DNA binding as described (Ammirante et al., 2010).
Lentiviral transduction
siRNAs to mouse I KKa and BMI1 were cloned into pLSLPw, provided by I. Verma (the Salk Institute), and lentivirus stocks were prepared as described (Luo et al., 2007). Virus- containing supernatants were added to myc-CaP cells for 2 days with polybrene, and transduced cells were selected in 5 μg ml 1 puromycin (Invitrogen).
Statistical analyses
Results are expressed as means + s.e.m. or s.d. Data were analyzed by Student's t- test using the GraphPad Prism statistical program. Error bars depict s.e.m. or s.d. P values > 0.05 were considered insignificant, 0.01-0.05 were considered significant, 0.001-0.01 were considered very significant and <0.001 were considered highly significant.
Chromatin Immunoprecipitation
Chromatin immunoprecipitation was performed as described (Kuraishy et al., 2007). Briefly, fresh tumors were harvested, minced using razor blades, and cross-linked with 10% formaldehyde for 10 min. The reactions were then quenched using glycine and the tumors were digested with collagenase for 3 hrs. Single cell suspensions were used to prepare chromatin that was immunoprecipitated with antibodies to ΙΚΚα, BMI1, acetylated-H3, and Ubi-H2A (Millipore), and E2F1 and CBP (Santa Cruz Biotechnologies). The primers used were as follows:
Bmil promoter forward - 5' AA AG G C AG AG ATCG G G AG AG A 3'
Bmil promoter reverse - 5'G G CCG AG CCGTATTATTCTG C 3'
Intergenic Chr. 8 forward - 5' TTGGTGGGC C A ATTTCTTCTG TG G 3'
Intergenic Chr. 8 reverse - 5' TCCTCCTCAG GCTCAAATG C ATG A 3'
lnk4A/Arf LOCUS #1 forward - 5' G AGTACAG C AG CG G G AG CAT 3'
lnk4A/Arf LOCUS #1 reverse - 5' GAACTTCACCAAGAAAACCCT 3'
lnk4A/Arf LOCUS #2 forward - 5' GTCCG ATCCTTTAG CG CTGTT 3'
lnk4A/Arf LOCUS #2 reverse - 5' AGCCCGGACTACAGAAGAGAT 3'
lnk4A/Arf LOCUS #3 forward - 5' CCG GAG CC ACCC ATTAAACTA 3'
lnk4A/Arf LOCUS #3 reverse - 5' CAAGACTTCTCAAAAATAAGA 3'
EMSA
Nuclear extracts were prepared from tumors by incubation with Buffer A (25 mM HEPES pH 7.6, 0.1 mM EDTA, 10% glycerol, ImM DTT, 0.1 mM PMSF), homogenization, passing through an insulin syringe 5 times and spinning down nuclei. The resulting pellets were resuspended in Buffer B (Buffer A + 450 m M KCI) for 1 hr. 293T cell proteins were immunoprecipitated 48 hrs after transfection with anti-HA (Roche) and washed 3 times in RIPA lysis buffer. Immunecomplexes were eluted using an HA-peptide (Sigma) and added to EMSA binding buffer (10 mM HEPES, 1.5 mM MgCI 2 , 1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 10 mM KCI and 10% glycerol), with 1 ug poly dl:dC and 1 ug of BSA. Nuclear extracts were added to same buffer. Probes were added and the mixtures incubated for 20 min in room temperature and gel separated at 4°C. For UV crosslinking experiments, probes and proteins were co-incubated and placed in a UV Stratalinker 2400 (Stratagene) for 10 min. The complexes were then immunoprecipitated with anti-HA, separated by SDS-PAGE and visualized by autoradiography.
EXAMPLE 10
Castration-induced inflammation controls BMI1 expression via IKKce
Using subcutaneous (s.c.) allografts of the mouse androgen-dependent myc-CaP cell line (Ellwood-Yen et al, 2003), we demonstrated that RNAi-mediated IKKa silencing retards the growth of CR-PCa (Ammirante et al., 2010; Figure 32A). However, myc-CaP tumors are extremely aggressive and we have not succeeded in delaying their regrowth by more than 3-4 weeks upon IKKa silencing, B cell ablation, CXCL13 neutralization or LT antagonism (Ammirante et al., 2010). We therefore examined whether IKKa inhibition affects growth of CR-PCa in TRAMP mice, which develop prostate adenocarcinoma within 12 weeks of age due to expression of SV40 T antigen from the prostate-specific probasin (PB) promoter (Greenberg et al., 1995). Castration of TRAMP mice leads to temporary tumor regression followed by emergence of CR-PCa that is more aggressive and more metastatic than the initial tumor (Hurwitz et al., 2001). We crossed TRAMP mice to Ikkd^ mice, in which the activation loop serines whose phosphorylation is required for IKKa activation are replaced with alanines (Cao et al., 2001). As shown previously (Luo et al., 2007), homozygocity for the Ikko ^ allele results in only a small retardation in primary tumor growth (Figure 32B). At 12 weeks of age, TRAMP males that were either heterozygous or homozygous for the ffi allele were castrated to mimic androgen withdrawal (Figure 32C). After 12 additional weeks, prostates of these mice were subjected to histological analysis by hemotoxylin and eosin (H & E) staining which revealed striking differences between tissues, with the heterozygous glands exhibiting a much higher degree of cellularity and loss of prostatic architecture due to tumor growth compared to prostates of homozygous mice (Figure 25A). Castrated Ikk ^^/TRAMP mice also exhibited a considerable reduction in genitourital (g.u.) weight at 24 weeks of age relative to Ikkot^ 1 " /TRAMP mice (Figure 25B). Castration also induced nuclear
translocation of IKKa in PCa of Ikka AA/+ /TRAM? mice (Fig. 32D).
The role of IKKa in CR-PCa formation is unlikely to be exerted via NF-κΒ, as deletion of ΙΚΚβ, the primary NF-κΒ activator in prostate epithelial cells of TRAMP mice or in myc-CaP tumors, had no effect on CR-PCa (Ammirante et al., 2010). Because other studies have suggested an NF- Β -independent role for nuclear IKKa in regulating histone modifications and chromatin structure (Anest et al., 2003; Yamamoto et al., 2003), we examined whether IKKa controls expression of polycomb group (PcG) proteins during CR- PCa development. PcG proteins are histone modifying enzymes whose expression has been implicated in PCa progression, stage and clinical outcome (Berezovska et al., 2006;
Varambally et al., 2002; Yu et al., 2007). While expression of the PcG genes Ezhl, Ezh2, Suzl2 and the DNA methyltransferase Dnmtl was not affected by castration of TRAMP mice, expression of Bmil, encoding a critical component of the histone-ubiquitinating PRC1 complex (Konuma et al., 2010; Wang et al., 2004), was significantly elevated in castrated mice (Figure 25C). This increase was not seen after castration of Ikka^^/TRAMP mice indicating a dependency on IKKa activation (Figure 25D). An effect of castration on BMIl expression was also observed in myc-CaP allografts, and was also IKKa dependent (Figures 25E-G, 32E). Because we have previously reported immune infiltration into PCa of castrated mice (Ammirante et al., 2010) and Bmil expression is high in some immune cell subsets (Konuma et al., 2010), we isolated epithelial cells from the tumors and confirmed that IKKa- dependent upregulation of Bmil mR A took place within these cells (Figure 32F). EXAMPLE 11
Nuclear IKKa stimulates Bmil transcription
Adding further significance to our findings, BMIl upregulation was seen inhuman PCa but not in benign prostatic hyperplasia (Figure 26A). We also found a correlation between nuclear ΓΚΚα and high BMIl expression in human PCa (Figure 26B), and staining of sequential PCa sections revealed high BMIl expression in cells with nuclear IKKa (Figure 33A).
To examine the role of IKKa activation by inflammatory signals and Bmil expression, we inhibited IKKa activation in mice bearing myc-CaP tumors either by ΙΚΚβ ablation in bone marrow derived cells or by injection of a LTpR-Fc fusion protein, which inhibit CR-PCa formation and IKKa nuclear translocation (Ammirante et al., 2010). Both treatments inhibited Bmil mRNA expression in tumors of castrated mice (Figure 26C,D). To examine the role of IKKa nuclear translocation in Bmil transcription more directly, we infected myc-CaP cells with lentiviral expression vectors encoding different isoforms of HA- tagged IKKa and examined effects on BMIl expression. Constitutively active IKKa (IKK (EE)), in which the activation loop serines were replaced with phosphomimetic glutamate residues (Senftleben et al., 2001), increased BMIl mRNA and protein amounts (Figure 26E,F). However, the inactivateable IKKa(AA) construct was ineffective and an IKKa(EE) construct with a defective nuclear localization signal (NLS) (IKKa(EE-NLS)) (Sil et al., 2004) was also a poor inducer of BMIl expression. Ruling out the possibility that this phenomenon was murine-specific, similar results were obtained in the human PCa cell line DU145 (Figure 33B). These data strongly suggest that active IKKa that can enter the nucleus upregulates Bmil transcription. Nuclear ΙΚΚα can associate with certain genes and modulate their expression (Anest et al., 2003; Luo et al., 2007; Yamamoto et al., 2003). We therefore performed chromatin immunoprecipitation (ChIP) experiments to examine whether IK a is recruited to the Bmil promoter. In HA-IKKa(EE) expressing myc-CaP cells, ChIP with either IKKa or HA antibodies revealed an association between active IKKa and the Bmil promoter (Figure
26G). Furthermore, using chromatin from myc-CaP allograft tumors, an association between endogenous IKKa and the BMI1 promoter was seen 2 weeks after castration but not in sham operated mice (Figure 33C) Indicating specificity, this association was not seen in castrated mice inoculated with myc-CaP cells whose endogenous IKKa was silenced (Figure 33D).
EXAMPLE 12
IKKa interacts with the Bmil promoter via E2F1
As IKKa has no recognizable DNA-binding domain and is unlikely to bind DNA directly, we hypothesized that IKKa is recruited to the Bmil promoter through an interaction with a sequence-specific transcription factor. After ruling out involvement of NF-κΒ in IKKa recruitment (data not shown), we examined whether IKKa interacts with E2F1, as the latter was reported to bind and activate the Bmil promoter (Nowak et al., 2006) and recruit IKKa to certain target genes (Tu et al., 2006). ChIP experiments with an E2F1 antibody demonstrated that like IKKa, E2F1 bound to the Bmil promoter only after castration and in an ΙΚΚα-dependent manner (Figure 27A). To confirm the ΙΚΚα-dependence of E2F1 binding to the BMI1 promoter, we performed electophoretic mobility shift assays (EMSAs) with nuclear extracts from myc-CaP tumors and a 30 bp oligonucleotide representing the E2F1 binding site from the Bmil promoter. This experiment supported the ChIP results as it revealed E2F-specific protein-DNA complexes only in lysates of ΙΚΚα-expressing myc-CaP tumors isolated 2 weeks after castration (Figure 27B). These differences are not due to any effects of IKKa or castration on E2F1 expression (Figure 34A). c-Myc is another Bmil transcriptional activator (Guo et al., 2007), but its association with the Bmil promoter in myc-CaP cells was not affected by castration (Figure 34B). To further confirm the IKKa- dependency of E2F1 binding to the Bmil promoter, we immunoprecipitated HA-tagged IKKa(EE) and E2F1 from transiently transfected 293T cells and performed UV-crosslinking experiments to determine which protein directly contacts the Bmil E2F1 binding site. This analysis revealed a radiolabeled band at approximately 60 kDa (the molecular weight of E2F1) and a very faint band around 85 kDa (the molecular weight of IKKcc); both bands appeared only if E2F1 was co-expressed with activated IKKa (Figure 27C). Neither E2F1 nor IKKa(EE) alone exhibited detectable interaction with the BMIl E2F1 binding site.
Co-immunoprecipitation experiments in 293T cells revealed an interaction between E2F1 and activated IKKa (Figure 27D and 34C). We also examined whether IKKa regulates E2F1 activity via CBP, which acetylates E2F1 to increase its stability and DNA binding activity (Galbiati et al., 2005; Ianari et al., 2004; Trouche and Kouzarides, 1996; Tu et al.,
2006) and can be recruited to certain promoters via IKKa (Hoberg et al., 2006; Huang et al.,
2007) . Co-immunoprecipitation revealed an interaction between E2F1 and CBP, but only in the presence of IKKa (Figure 27D). ChIP experiments supported these results by revealing
ΙΚΚα-dependent recruitment of CBP to the Bmil promoter after castration (Figure 27E). These experiments suggest that IKKa recruits CBP to E2F1 resulting in E2F1 acetylation and stabilization. E2F1 then recruits the complex containing IKKa and CBP to the Bmil promoter. This model is further supported by ΙΚΚα-dependent and castration-induced H3 acetylation at the Bmil promoter in myc-CaP tumors (Figure 27F). In additional experiments, we found that transient transfection of an E2F1 expression vector into myc-CaP cells led to 3- fold increase in Bmil mRNA expression that was ΓΚΚα-dependent (Figure 34D).
Collectively, these results suggest that IKKa stimulates Bmil transcription through its interaction with E2F1 (or a closely related factor) and CBP (or p300).
To determine if the functional cooperation between IKKa and E2F1 was unique to the
Bmil gene, we examined binding of E2F1 to the Ccne (cyclin E) promoter, a well- documented E2F1 target (Ohtani et al., 1995). Similar to the Bmil promoter, E2F1 was recruited to the Ccne promoter only after castration and in an ΙΚΚα-dependent manner (Figure 34E). Furthermore, castration-induced expression of cyclin E was IKKa-dependent (Figure 34F). Thus, IKKa activation is important for the transcriptional induction of several E2F1 targets during castration,
EXAMPLE 13
BMIl is required for castration-resistant tumor growth
To determine if BMIl is needed for CR-PCa regrowth, we used RNAi to deplete BMIl in myc-CaP cells. Using two different siRNAs, we were able to achieve a considerable reduction in BMIl protein amounts (Figure 28A). However, after 4 weeks of s.c. tumor growth, BMIl expression was restored. Noneineiess, jsiviii silencing iea xo a signmcani reduction in primary tumor growth (Figure 28B). We ectopically expressed BMIl in myc- CaP cells whose IKKcc expression was silenced with siRNA (Figure 28C). Unlike BMI1- silenced cells, ΙΚΚα,-deficient myc-CaP cells retained IKK silencing after s.c. growth, which was ΙΚΚα-independent prior to castration (Ammirante et al., 2010). IKKa silencing delayed the regrowth of CR-PCa by about 3 weeks, but ectopic expression of BMIl in IKKa- silenced cells strongly enhanced their regrowth in castrated mice (Figure 28D). In fact, BMIl transduced cells re-grew faster than the parental myc-CaP cells after castration. Curiously, 3 weeks after castration ΙΚΚα-silenced myc-CaP cells have managed to regain BMIl expression (Figure 28E), thus explaining the temporary nature of the delay in tumor regrowth caused by IKKa silencing in myc-CaP cells.
BMIl was suggested to promote cell proliferation and inhibit senescence through epigenetic silencing of the pl ^ pl^ locus (Jacobs et al., 1999). Consistent with this notion, tumors formed by ΙΚΚα-silenced myc-CaP cells exhibited elevated pi 6 and pl9 expression, but ectopic expression of BMI 1 in ΙΚΚα-silenced myc-CaP tumors reduced p 16 and pl9 expression to their basal levels (Figure 29A). Interference with LT signaling also resulted in elevated pl6 and pl9 expression inmyc-CaP tumors of castrated mice (Figure 29B). BMIl and other PRC1 components silence the Ink4a/Arflocus through direct binding and H2A ubiquitination (Wang et al., 2004). To examine BMIl recruitment to the Ink4a/Arf locus in response to castration and IKKa activation, we designed three primer pairs adjacent to the pl9 Mi and j pi6 Ink4a promoters (Figure 35). ChIP experiments indicated that castration increased BMIl recruitment to all 3 sites and that this increase was ΙΚΚα-dependent, with recruitment to sites 1 and 2 being statistically significant (Figure 29C). Furthermore, the presence of ubi-H2A at the ρΐό^ 4 promoter (sites 2 and 3) was considerably increased after castration and the increase was ΙΚΚα-dependent (Figure 29D). There was also a significant increase in total ubi-H2A within PCa cells after castration in both the myc-CaP and TRAMP models that was ΙΚΚα-dependent (Figure 29E,F). We also found significantly increased uhi- H2A staining in human PCa specimens relative to normal prostatic tissue or benign prostatic hyperplasia (Figure 29G), as well as a significant correlation coefficient of 0.94 between BMIl and ubi-H2A staining of these samples.
EXAMPLE 14
IKKa and BMIl accumulate in CD133 + cells and control their abundance BMI1 acts within PCa stem cells to control their self-renewal and abundance (Lukacs et al., 2010). We examined whether ΓΚΚα accumulates within CD133 + cells, a population reported to include PCa stem cells (Richardson et al., 2004). Castration augmented the abundance of CD133 + cells within myc-CaP tumors and increased the fraction of CD133 + cells with nuclear IKKa by 6-7-fold (Figure 30A,B). ΙΚΚα-silencing in myc-CaP cells inhibited the castration-induced increase in the frequency of CD133 + cells, but expression of ectopic BMI1 in ΙΚΚα-silenced myc-CaP cells strongly increased CD133 + cell abundance (Figure 30C,D), supporting previous reports which implicate BMI1 in self-renewal and activation of cancer stem cells/progenitors (Lobo et al, 2007). Although increased CD133 expression may reflect infiltration of CD133 + hematopoietic cells into the tumors, we have not seen differences in hematopoietic cell infiltration between mock and ΓΚΚα-silenced tumors (data not shown). The effect of castration and IKKa is not unique to CD133, as expression of other prostate cancer stem cells/progenitor markers (SOX2 and Nanog) had also increased after castration, in an ΙΚΚα-dependent manner (Figure 30E). The
preponderance of another prostate cancer stem cell marker, p63, also increased after castration and correlated with nuclear IKKa (Figure 30F,G).
EXAMPLE 15
Inflammatory activation of IKKa is required for androgen-induced regrowth of the normal prostate
The ability of prostate tumors to regenerate after androgen ablation is likely to be due to activation of prostate cancer stem cells (Maitland and Collins, 2008), a process that is BMIl-dependent (Lukacs et al, 2010). BMI1 is also involved in renewal of normal tissue stem cells (Lobo et al., 2007), including prostate stem cells (Lukacs et al., 2010). We therefore examined whether IKKa activation is required for androgen-induced growth of the involuted prostate of castrated mice, which is initiated by stem cells/progenitors (English et al, 1987; Karhadkar et al., 2004). We castrated Ikka^ and Ikka^^ mice and after 7 days injected them three times with testosterone to induce prostate regrowth (Figure 31 A).
Immunohistochemistry revealed nuclear translocation of IKKa within 14 days after castration in J5 ta AA + mice (Figure 3 IB). In these mice, androgen supplementation induced prostate regrowth, but this response was abrogated m lkkc ^^ mice (Figure 31C). In addition, castration induced Bmil mRNA accumulation in the normal prostate, as it did in tumors, and the increase was ΙΚΚα-dependent (Figure 3 ID). We also examined whether B cells, which were found to infiltrate the prostate after castration (Figure 36A) are required for androgen- induced prostate regrowth, similar to their role in CR-PCa (Ammirante et al., 2010). We performed a castration-regeneration experiment on B cell deficient Jh ~ ' ~ mice (Chen et al., 1993). Indeed, the B cell deficiency severely attenuated androgen-induced prostate regrowth (Figure 3 IE) and compromised Bmil induction (Figure 3 IF). No B cells were detected in the involuted prostates oiJh ~ ' ~ mice (Figure 31G). Similar, but more modest, attenuation of prostate regeneration was seen in mice treated with the B cell-depleting CD20 antibody (Figure 36A-C). EXAMPLE 16
Discussion of Examples 9-15
The results described above in Examples 9-15 demonstrate the critical role played by an inflammatory response in tissue regeneration following injury. The importance of inflammation in tissue repair and wound healing has been well appreciated (Singer and Clark, 1999), but it has been thought that the reparative functions of inflammation are largely limited to clearance of dead cells, deposition of extracellular matrix and stimulation of fibroblast proliferation (Velnar et al., 2009). Furthermore, the mechanisms by which tissue injury and tumor debulking lead to activation of signaling pathways and transcription factors that are involved in tissue regeneration and tumor recurrence, namely the Wnt and Hedgehog pathways (Beachy et al., 2004), are unknown.
Data herein in Examples 9-15 show that androgen-induced regrowth of the involuted prostate of castrated mice is highly dependent on an inflammatory response, most likely triggered by the death of androgen-deprived prostate epithelial cells, that is also responsible for rapid emergence of CR-PCa. This inflammatory response results in IKKa activation within residual prostate cells, presumably the stem cells that survive androgen ablation and drive prostate regeneration and CR-PCa emergence (Maitland and Collins, 2008). Activated IKKa is needed for upregulation of BMI1, a critical component of the histone-ubiquitinating PRC1 complex, whose role in stem cell self-renewal is well established (Lobo et al., 2007). The same inflammation-driven pathway, consisting of B cells, LT, IKKa and BMI1, that is needed for prostate regeneration, is also required for development of CR-PCa in two different mouse PCa models - the transplantable androgen-dependent myc-CaP cell line (Watson et al., 2005) and the TRAMP mouse (Gingrich et al, 1997). While androgen deprivation therapy is a frequently used treatment for PCa, it only leads to temporary tumor regression and facilitates emergence of CR-PCa, which is often incurable and lethal (Gulley et al, 2003). Although newly developed androgen receptor (AR) antagonists are likely to reduce occurrence of CR-PCa (Tran et al., 2009), there is certainly a need for new measures to counteract this major cause of cancer deaths in men (American Cancer Society, 2010). Data herein in Examples 9-15 shows that interference with the ΙΚΚα-dependent pathway of BMI1 induction in androgen-deprived PCa stem cells, represents a valid therapeutic approach to be used as an adjuvant for androgen-ablation.
IKK , inflammation, stem cell activation and tissue regeneration
Tissue regeneration is likely to depend on activation of resident stem cells following injury. A key question, however, is how adult tissue stem cells sense injury and undergo activation and proliferation. Inflammation, which accompanies tissue injury, was recently implicated in stem cell activation through increased production of reactive oxygen species (Ito et al, 2004) and cytokines (Audet et al., 2001; Widera et al, 2006). However, the mechanisms by which these inflammatory manifestations trigger stem cell activation are not entirely clear. While not intending to limit the invention to a particular mechanism, in one embodiment, inflammation-responsive transcription factors, such as STAT3 and NF- Β, may be involved. It is also unclear whether the mechanisms of stem cell activation during normal tissue regeneration also account for cancer recurrence after therapy, though the latter may also be associated with inflammation (Vakkila and Lotze, 2004; Zong and Thompson, 2006). Data herein in Examples 1-15 illustrate a mechanism applicable to both normal tissue regeneration and cancer recurrence after therapy and demonstrate that contrary to prior expectations neither process is cell autonomous. In both cases, the trigger for the
inflammatory response is androgen deprivation, which results in death of the normal prostate epithelium and androgen-dependent PCa cells. Cell death results in release of mediators that induce expression of chemokines that cause infiltration of immune cells into the injured tumor (Ammirante et al., 2010) or the prostate. Amongst the different cell types recruited by these chemokines, a critical role is played by B cells. As discussed above in Examples 1-8, we found that B cells accelerate development of CR-PCa by serving as a critical source of LT, a TNF family member that activates IKKa in PCa cells that survive androgen deprivation. The present results in Examples 9-15 identify B cells as critical stimulators of androgen-induced prostate regrowth, presumably by the same mechanism. While much research has been built upon the assumption that the major driver of CR-PCa is dysregulated AR activation through AR overexpression (Visakorpi et al., 1995), AR mutations (Taplin et al., 1995), or increased intratumoral androgen production (Holzbeierlein et al., 2004), our results demonstrate that this process (Examples 1-8), along with regeneration of the normal prostate (Examples 9-15), is also dependent on B lymphocytes and IKKa signaling.
While not limiting the invention to a particular mechanism, in one embodiment, IKKa stimulates proliferation of the putative stem cells/progenitors responsible for emergence of CR-PCa and androgen-induced prostate regeneration presumably through induction of BMIl. The role of BMIl in both of these processes is previously addressed (Lobo et al., 2007; Lukacs et al, 2010). Data herein in Examples 9-15, however, show that IKKa activity, presumably via BMIl, is required for elevated expression of a number of PCa stem cell markers, including CD133, p63, Nanog, and Sox2 in androgen-deprived PCa tumors. Most importantly, data herein in Examples 9-15 provide a clear demonstration that tissue regeneration is not an entirely cell autonomous process. Furthermore, a requirement for B cells in prostate regeneration has never been reported.
IKKa couples inflammation to epigenetic chromatin modifications
Alterations of chromatin modifications and structure are a common occurrence in cancer, consistent with the participation of epigenetic mechanisms in tumorigenesis (Jones and Baylin, 2007). Quite often, epigenetic alterations in cancer lead to silencing of tumor suppressor loci. However, the microenvironmental signals and pathways that trigger these epigenetic modifications are poorly understood. Our results in Examples 1-15 demonstrate that at least during development of CR-PCa, ΓΚΚα activation leads to H2A ubiquitination and eventual repression of the tumor suppressor ρΐδ^^/ρΐ^ locus, presumably through BMIl . Notably, a correlation between nuclear accumulation of IKKa, elevated BMIl expression and enhanced H2A ubiquitination was seen in both mouse and human PCa, suggesting that this epigenetic function of IKKa may be conserved.
While not limiting the invention to a particular mechanism, in one embodiment, the ability of IKKa to induce Bmil transcription is mediated through its interaction with E2F1 which results in E2F1 recruitment to the Bmil promoter. Based on our present results and previous studies indicating that CBP potentiates E2F1 DNA binding and activity (Trouche and Kouzarides, 1996; Tu et al, 2006), a likely mechanism may involve IKKa-mediated recruitment of CBP (or the related molecule p300) to E2F1 and enhancement of E2F1 DNA binding by CBP-mediated acetylation. IKKa may mediate this recruitment by
phosphorylation of CBP, which can also modulate CBP activity (Huang et al., 2007). E2F1 activity is also subject to negative regulation through an interaction with Rb (DeGregori and Johnson, 2006). Without limiting the invention to a particular mechanism, the inventors believe that it is rather unlikely that IK a controls E2F1 activity via Rb because IKKcc- mediated Bmil induction is seen both in myc-CaP tumors and in TRAMP mice, but the latter express SV40 T antigen in their PCa cells which should sequester Rb away from E2F1 (DeCaprio et aL, 1988).
IKKa may modulate chromatin structure and affect expression of tumor suppressors through BMI1 -independent mechanisms, as it was reported to promote H3 phosphorylation (Anest et al. s 2003; Yamamoto et al., 2003) and SMRT derepression (Hoberg et al., 2006). Through effects on NF- Β, IKKa may also promote expression of the histone demethylase Jmjd3 (De Santa et al., 2007).
Translational implications
The requirement for IKKa activation in BMI1 induction and tumor and tissue regeneration was seen in three different scenarios: the myc-CaP and TRAMP models for PCa and androgen-induced regeneration of the normal prostate. Thus, this requirement is not model specific and should not be affected by the limitations of either PCa model.
Furthermore, data herein in Examples 9-15 show a strong correlation between presence of nuclear (i.e. activated) IKKa and BMI1 expression and between BMI1 expression and the total content of ubi-H2A in human PCa specimens. While not limiting the invention to a particular mechanism responsible for ΓΚΚα activation/nuclear accumulation in human PCa, in one embodiment, the injury-induced mechanism of IKKa activation which depends on B lymphocytes and LT signaling is likely to be evolutionary conserved and not restricted to the mouse. Indeed, elevated expression of the B cell chemoattractant CXCL13 was observed in human PCa and found to correlate with clinical grade (Singh et al., 2009). In addition, a common genetic polymorphism that affects LT expression correlates with the effect of non- steroidal anti-inflammatory drugs (NSAIDs) on PCa incidence (Liu et al., 2006). Data herein in Examples 9-15 suggests that B cell-depleting drugs, such as anti-CD20 (Rituximab) and inhibitors of LT signaling, such as the LTpR-Fc fusion protein, are efficacious adjuvants to standard androgen ablation therapy. Based on our mouse studies, we predict that such combinations should reduce one or both the occurrence of castration resistance and metastatic spread, the major causes of death in PCa.
REFERENCES IN EXAMPLES 2-8: 1. Isaacs, J.T. The biology of hormone refractory prostate cancer. Why does it develop? Urol Clin North Am 26, 263-273 (1999).
2. Gulley, J., Figg, W.D. & Dahut, W.L. Treatment options for androgen-independent prostate cancer. Clin Adv Hematol Oncol 1, 49-57 (2003).
3. Tran, C. et al. Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science 324, 787-790 (2009).
4. Jin, R.J. et al. The nuclear factor-kappaB pathway controls the progression of prostate cancer to androgen-independent growth. Cancer Res 68, 6762-6769 (2008).
5. Karin, M., Lawrence, T. & Nizet, V. Innate immunity gone awry: linking microbial infections to chronic inflammation and cancer. Cell 124, 823-835 (2006).
6. Karin, M. Nuclear factor-kappaB in cancer development and progression. Nature 441, 431-436 (2006).
7. Balkwill, F., Charles, K.A. & Mantovani, A. Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell 7, 211-217 (2005).
8. Coussens, L.M. & Werb, Z. Inflammation and cancer. Nature 420, 860-867 (2002).
9. de Visser, K.E., Korets, L.V. & Coussens, L.M. De novo carcinogenesis promoted by chronic inflammation is B lymphocyte dependent. Cancer Cell 7, 411-423 (2005).
10. Mantovani, A., Allavena, P., Sica, A. & Balkwill, F. Cancer-related inflammation. Nature 454, 436-444 (2008).
11. Luo, J.L. et al. Nuclear cytokine activated IKKa controls prostate cancer metastasis by repressing maspin. Nature 446, 690-694 (2007).
12. Bai, A., Higham, E., Eisen, H.N., Wittrup, K.D. & Chen, J. Rapid tolerization of virus-activated tumor-specific CD8+ T cells in prostate tumors of TRAMP mice. Proc Natl Acad Sci USA 105, 13003-13008 (2008).
13. Ell wood- Yen, K. et al. Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell 4, 223-238 (2003).
14. Park, B.K. et al. NF-kappaB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF. Nat Med 13, 62-69 (2007).
15. Wen, D. et al. A selective small molecule IkappaB Kinase beta inhibitor blocks nuclear factor kappaB-mediated inflammatory responses in human fibroblast-like synoviocytes, chondrocytes, and mast cells. J Pharmacol Exp Ther 317, 989-1001 (2006). 16. Legler, D.F. et al. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXC 5. J Exp Med 187, 655-660 (1998).
17. Chen, T., Wang, L.H. & Farrar, W.L. Interleukin 6 activates androgen receptor- mediated gene expression through a signal transducer and activator of transcription 3- dependent pathway in LNCaP prostate cancer cells. Cancer Res 60, 2132-2135 (2000).
18. Eriksen, K.W. et al. Constitutive STAT3 -activation in Sezary syndrome: tyrphostin AG490 inhibits STAT3 -activation, interleukin-2 receptor expression and growth of leukemic Sezary cells. Leukemia 15, 787-793 (2001).
19. Hamel, K. et al. Suppression of proteoglycan-induced arthritis by anti-CD20 B Cell depletion therapy is mediated by reduction in autoantibodies and CD4+ T cell reactivity. J Immunol 180, 4994-5003 (2008).
20. Worm, M.M., Tsytsykova, A. & Geha, R.S. CD40 ligation and IL-4 use different mechanisms of transcriptional activation of the human lymphotoxin alpha promoter in B cells. Eur J Immunol 28, 901-906 (1998).
21. Tumanov, A.V. et al. Dissecting the role of lymphotoxin in lymphoid organs by conditional targeting. Immunol Rev 195, 106-116 (2003).
22. Lee, Y. et al. Recruitment and activation of naive T cells in the islets by lymphotoxin beta receptor-dependent tertiary lymphoid structure. Immunity 25, 499-509 (2006).
23. Ghiringhelli, F. et al. Activation of the NLRP3 inflammasome in dendritic cells induces IL-lbeta-dependent adaptive immunity against tumors. Nat Med, 15, 1170-1178 (2009).
24. Scaffidi, P., Misteli, T. & Bianchi, M.E. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature 418, 191-195 (2002).
25. Sakurai, T. et al. Hepatocyte necrosis induced by oxidative stress and IL-1 alpha release mediate carcinogen-induced compensatory proliferation and liver tumorigenesis. Cancer Cell 14, 156-165 (2008).
26. Nimmerjahn, F. & Ravetch, J.V. Fc-receptors as regulators of immunity. Adv Immunol 96, 179-204 (2007).
27. Bonizzi, G. et al. Activation of IKKa target genes depends on recognition of specific KB binding sites by RelB:p52 dimers. Embo J " 23, 4202-4210 (2004).
28. Kortylewski, M. & Yu, H. Stat3 as a potential target for cancer immunotherapy. J Immunother 30, 131-139 (2007). 29. Smith, P.C., Hobisch, A, Lin, D.L., Culig, Z. & Keller, E.T. Interleukin-6 and prostate cancer progression. Cytokine Growth Factor Rev 12, 33-40 (2001).
30. Liu, X., Plummer, S.J., Nock, N ., Casey, G. & Witte, J.S. Nonsteroidal antiinflammatory drugs and decreased risk of advanced prostate cancer: modification by lymphotoxin alpha. Am J Epidemiol 164, 984-989 (2006).
REFERENCES IN EXAMPLES 9-16
• American Cancer Society, Cancer Facts & Figures 2007. Atlanta: American Cancer Society, 2007.
· Ben-Neriah, Y., Karin, M. (2011). Inflammation meets cancer, with NF-κΒ as the matchmaker. Nat. Immunol. In Press.
• Ammirante, M., Luo, J. L., Grivennikov, S., Nedospasov, S., and Karin, M. (2010). B-cell-derived lymphotoxin promotes castration-resistant prostate cancer. Nature 464, 302- 305.
· Anest, V., Hanson, J. L., Cogswell, P. C, Steinbrecher, K. A., Strahl, B. D., and Baldwin, A. S. (2003). A nucleosomal function for IkappaB kinase-alpha in NF-kappaB- dependent gene expression. Nature 423, 659-663.
• Audet, J., Miller, C. L., Rose-John, S., Piret, J. M., and Eaves, C. J. (2001). Distinct role of gpl30 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc Natl Acad Sci U S A 98, 1757-1762.
• Balkwill, F., and Mantovani, A. (2001). Inflammation and cancer: back to Virchow? Lancet 357, 539-545.
• Beachy, P. A., Karhadkar, S. S., and Berman, D. M. (2004). Tissue repair and stem cell renewal in carcinogenesis. Nature 432, 324-331.
· Berezovska, O. P., Glinskii, A. B., Yang, Z., Li, X. M., Hoffman, R. M., and Glinsky, G. V. (2006). Essential role for activation of the Polycomb group (PcG) protein chromatin silencing pathway in metastatic prostate cancer. Cell Cycle 5, 1886-1901.
• Cao, Y., Bonizzi, G., Seagroves, T. N., Greten, F. R., Johnson, R., Schmidt, E. V., and Karin, M. (2001). IKKalpha provides an essential link between RANK signaling and cyclin Dl expression during mammary gland development. Cell 107, 763-775.
• Chen, J., Trounstine, M., Alt, F. W., Young, F., Kurahara, C, Loring, J. F., and Huszar, D. (1993). Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int Immunol 5, 647-656. • De Santa, F., Totaro, M. G., Prosperini, E., Notarbartolo, S., Testa, G., and Natoli, G. (2007). The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell 130, 1083-1094.
• DeCaprio, J. A., Ludlow, J. W., Figge, J., Shew, J. Y., Huang, C. M., Lee, W. H., Marsilio, E., Paucha, E., and Livingston, D. M. (1988). SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 54, 275-283.
• DeGregori, J., and Johnson, D. G. (2006). Distinct and Overlapping Roles for E2F Family Members in Transcription, Proliferation and Apoptosis. Curr Mol Med 6, 739-748.
• Descargues, P., Sil, A. K., Sano, Y., Korchynskyi, O., Han, G., Owens, P., Wang, X. J., and Karin, M. (2008). IKKalpha is a critical coregulator of a Smad4-independent
TGFbeta-Smad2/3 signaling pathway that controls keratinocyte differentiation. Proc Natl Acad Sci U S A 105, 2487-2492.
• Dvorak, H. F. (1986). Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. N Engl J Med 315, 1650-1659.
· Ellwood-Yen, K., Graeber, T. G., Wongvipat, J., Iruela-Arispe, M. L., Zhang, J.,
Matusik, R., Thomas, G. V., and Sawyers, C. L. (2003). Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell 4, 223-238.
• English, H. F., Santen, R. J., and Isaacs, J. T. (1987). Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. Prostate 11, 229-242.
• Galbiati, L., Mendoza-Maldonado, R., Gutierrez, M. I., and Giacca, M. (2005).
Regulation of E2F-1 after DNA damage by p300-mediated acetylation and ubiquitination. Cell Cycle 4, 930-939.
• Gingrich, J. R., Barrios, R. J., Kattan, M. W., Nahm, H. S., Finegold, M. J., and Greenberg, N. M. (1997). Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res 57, 4687-4691.
• Gingrich, J. R., Barrios, R. J., Morton, R. A., Boyce, B. F., DeMayo, F. J., Finegold, M. J., Angelopoulou, R., Rosen, J. M., and Greenberg, N. M. (1996). Metastatic prostate cancer in a transgenic mouse. Cancer Res 56, 4096-4102.
· Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen, J. M. (1995). Prostate cancer in a transgenic mouse. Proc Natl Acad Sci U S A 92, 3439-3443. • Grivennikov, S. I., Greten, F. R., and Karin, M. (2011). Immunity, inflammation, and cancer. Cell 140, 883-899.
• Gulley, J., Figg, W. D., and Dahut, W. L. (2003). Treatment options for androgen- independent prostate cancer. Clin Adv Hematol Oncol 1, 49-57.
· Guo, W. J., Datta, S., Band, V., and Dimri, G. P. (2007). Mel-18, a polycomb group protein, regulates cell proliferation and senescence via transcriptional repression of Bmi-1 and c-Myc oncoproteins. Mol Biol Cell 75, 536-546.
• Hoberg, J. E., Popko, A. E., Ramsey, C. S., and Mayo, M. W. (2006). IkappaB kinase alpha-mediated derepression of SMRT potentiates aeetylation of RelA p65 by p300. Mol Cell Biol 26, 457-471.
• Holzbeierlein, J., Lai, P., LaTulippe, E., Smith, A., Satagopan, J., Zhang, L., Ryan, C, Smith, S., Scher, H., Scardino, P., et al. (2004). Gene expression analysis of human prostate carcinoma during hormonal therapy identifies androgen-responsive genes and mechanisms of therapy resistance. Am J Pathol 164, 217-227.
· Hu, Y., Baud, V., Delhase, M., Zhang, P., Deerinck, T., Ellisman, M., Johnson, R., and Karin, M. (1999). Abnormal morphogenesis but intact IKK activation in mice lacking the IKKalpha subunit of IkappaB kinase. Science 284, 316-320.
• Hu, Y., Baud, V., Oga, T., Kim, K. L, Yoshida, K., and Karin, M. (2001). IKKalpha controls formation of the epidermis independently of NF-kappaB. Nature 410, 710-714. · Huang, W. C, Ju, T. K., Hung, M. C, and Chen, C, C. (2007). Phosphorylation of CBP by IKKalpha promotes cell growth by switching the binding preference of CBP from p53 to NF-kappaB. Mol Cell 26, 75-87.
• Hurwitz, A. A., Foster, B. A., Allison, J. P., Greenberg, N. M., and Kwon, E. D. (2001). The TRAMP mouse as a model for prostate cancer. Curr Protoc Immunol Chapter 20, Unit 20 25.
• Hussain, S. P., and Harris, C. C. (2007). Inflammation and cancer: an ancient link with novel potentials. Int J Cancer 121, 2373-2380.
• Ianari, A., Gallo, R., Palma, M., Alesse, E., and Gulino, A. (2004). Specific role for p300/CREB -binding protein-associated factor activity in E2F1 stabilization in response to DNA damage, J Biol Chem 279, 30830-30835.
• Ito, K., Hirao, A., Arai, F., Matsuoka, S., Takubo, K., Hamaguchi, I., Nomiyarna, K., Hosokawa, K., Sakurada, K., Nakagata, N., et al (2004). Regulation of oxidative stress by ATM is required for self-renewal of haematopoietic stem cells. Nature 431, 997-1002. • Jacobs, J. J., Scheijen, B., Voncken, J. W., Kieboom, K., Berns, A., and van
Lohuizen, M. (1999). Bmi-1 collaborates with c-Myc in tumorigenesis by inhibiting c-Myc- induced apoptosis via INK4a/ARF. Genes Dev 13, 2678-2690.
• Jones, P. A., and Baylin, S. B. (2007). The epigenomics of cancer. Cell 128, 683-692. · Karhadkar, S. S., Bova, G. S., Abdallah, N., Dhara, S., Gardner, D., Maitra, A.,
Isaacs, J. T., Berman, D. M., and Beachy, P. A. (2004). Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 431, 707-712.
• Karin, M. (2005). Inflammation and cancer: the long reach of Ras. Nat Med 11, 20- 21.
· Karin, M. (2009). NF-kappaB as a critical link between inflammation and cancer. Cold Spring Harb Perspect Biol 1, a000141.
• Konuma, T., Oguro, H., and Iwama, A. (2010). Role of the polycomb group proteins in hematopoietic stem cells. Dev Growth Differ 52, 505-516.
• Kuraishy, A. I., French, S. W., Sherman, M., Herling, M., Jones, D., Wall, R., and Teitell, M. A. (2007). TORC2 regulates germinal center repression of the TCL1 oncoprotein to promote B cell development and inhibit transformation. Proc Natl Acad Sci U S A 104, 10175-10180.
• Lehr, H. A., Mankoff, D. A., Corwin, D., Santeusanio, G., and Gown, A. M. (1997). Application of photo shop-based image analysis to quantification of hormone receptor expression in breast cancer. J Histochem Cytochem 45, 1559-1565.
• Liu, X., Plummer, S. J., Nock, N. L., Casey, G., and Witte, J. S. (2006). Nonsteroidal antiinflammatory drugs and decreased risk of advanced prostate cancer: modification by lymphotoxin alpha. Am J Epidemiol 164, 984-989.
• Lobo, N. A., Shimono, Y., Qian, D., and Clarke, M. F. (2007). The biology of cancer stem cells. Armu Rev Cell Dev Biol 23, 675-699.
• Lukacs, R. U., Memarzadeh, S., Wu, H., and Witte, O. N. (2010). Bmi-1 is a crucial regulator of prostate stem cell self-renewal and malignant transformation. Cell Stem Cell 7, 682-693.
• Luo, J. L., Maeda, S., Hsu, L. C, Yagita, H., and Karin, M. (2004). Inhibition of NF- kappaB in cancer cells converts inflammation- induced tumor growth mediated by TNFalpha to TRAIL-mediated tumor regression. Cancer Cell 6, 297-305. • Luo, J. L., Tan, W., Ricono, J. M., Korchynskyi, O., Zhang, M., Gonias, S. L., Cheresh, D. A., and Karin, M. (2007). Nuclear cytokine-activated IKKalpha controls prostate cancer metastasis by repressing Maspin. Nature 446, 690-694.
• Maitland, N. J., and Collins, A. T. (2008). Prostate cancer stem cells: a new target for therapy. J Clin Oncol 26, 2862-2870.
• Marinari, B., Moretti, F., Botti, E., Giustizieri, M. L., Descargues, P., Giunta, A., Stolfi, C, Ballaro, C, Papoutsaki, M., Alema, S., et al. (2008). The tumor suppressor activity of IKKalpha in stratified epithelia is exerted in part via the TGF-beta antiproliferative pathway. Proc Natl Acad Sci U S A 105, 17091-17096.
· Nowak, K., Kerl, K., Fehr, D., Kramps, C, Gessner, C, Killmer, K., Samans, B.,
Berwanger, B., Christiansen, H., and Lutz, W. (2006). BMI1 is a target gene of E2F-1 and is strongly expressed in primary neuroblastomas. Nucleic Acids Res 34, 1745-1754.
• Ohtani, K., DeGregori, J., and Nevins, J. R. (1995). Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A 92, 12146-12150.
· Richardson, G. D., Robson, C. N., Lang, S. H., Neal, D. E., Maitland, N. J., and
Collins. A. T. (2004). CD133, a novel marker for human prostatic epithelial stem cells. J Cell Sci /J 7, 3539-3545.
• Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C, and Karin, M. (2001). Activation by IKKalpha of a second, evolutionary conserved, NF-kappa B signaling pathway. Science 293, 1495-1499.
• Sil, A, K., Maeda, S., Sano, Y., Roop, D. R., and Karin, M. (2004). IkappaB kinase- alpha acts in the epidermis to control skeletal and craniofacial morphogenesis. Nature 428, 660-664.
• Singer, A. J., and Clark, R. A. (1999). Cutaneous wound healing. N Engl J Med 341, 738-746.
• Singh, S., Singh, R, Sharma, P. K., Singh, U. P., Rai, S. N., Chung, L. W., Cooper, C. R., Novakovic, K. R., Grizzle, W. E., and Lillard, J. W., Jr. (2009). Serum CXCL13 positively correlates with prostatic disease, prostate-specific antigen and mediates prostate cancer cell invasion, integrin clustering and cell adhesion. Cancer Lett 283, 29-35.
· Taplin, M. E., Bubley, G. J., Shuster, T. D., Frantz, M. E., Spooner, A. E., Ogata, G. K., Keer, H. N., and Balk, S. P. (1995). Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332, 1393-1398. • Tran, C, Ouk, S., Clegg, N. J., Chen, Y., Watson, P. A., Arora, V., Wongvipat, J., Smith-Jones, P. M., Yoo, D., Kwon, A., et al. (2009). Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science 324, 787-790.
• Trouche, D., and Kouzarides, T. (1996). E2F1 and E1A(12S) have a homologous activation domain regulated by RB and CBP. Proc Natl Acad Sci U S A 93, 1439-1442.
• Tu, Z., Prajapati, S., Park, K. J., Kelly, N. J., Yamamoto, Y., and Gaynor, R. B. (2006). IKK alpha regulates estrogen-induced cell cycle progression by modulating E2F1 expression. J Biol Chem 281, 6699-6706.
• Vakkila, J., and Lotze, M. T. (2004). Inflammation and necrosis promote tumour growth. Nat Rev Immunol 4, 641 -648.
• Varambally, S., Dhanasekaran, S. M., Zhou, M., Barrette, T. R., Kumar-Sinha, C, Sanda, M. G., Ghosh, D., Pienta, K. J., Sewalt, R. G., Otte, A. P., et al. (2002). The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature 419, 624-629.
• Velnar, T., Bailey, T., and Smrkolj, V. (2009). The wound healing process: an overview of the cellular and molecular mechanisms. J Int Med Res 37, 1528-1542.
• Visakorpi, T., Hyytinen, E., Koivisto, P., Tanner, M., Keinanen, R., Palmberg, C, Palotie, A., Tammela, T., Isola, J., and Kallioniemi, O. P. (1995). In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet 9, 401-406.
• Wang, H., Wang, L., Erdjument-Bromage, H., Vidal, M., Tempst, P., Jones, R. S., and Zhang, Y. (2004). Role of histone H2A ubiquitination in Polycomb silencing. Nature 431,
873-878.
• Watson, P. A., Ellwood-Yen, K., King, J. C, Wongvipat, J., Lebeau, M. M., and Sawyers, C. L. (2005). Context-dependent hormone-refractory progression revealed through characterization of a novel murine prostate cancer cell line. Cancer Res 65, 11565-11571. · Widera, D., Mikenberg, I., Elvers, M., Kaltschmidt, C, and Kaltschmidt, B. (2006). Tumor necrosis factor alpha triggers proliferation of adult neural stem cells via IKK/NF- kappaB signaling. BMC Neurosci 7, 64.
• Yamamoto, Y., Verma, U. N., Prajapati, S., Kwak, Y. T., and Gaynor, R. B. (2003). Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 423, 655-659.
• Yu, J., Rhodes, D. R., Tomlins, S. A., Cao, X., Chen, G., Mehra, R., Wang, X., Ghosh, D., Shah, R. B., Varambally, S., et al. (2007). A polycomb repression signature in metastatic prostate cancer predicts cancer outcome. Cancer Res 67, 10657-10663. Zong, W. X., and Thompson, C. B. (2006). Necrotic death as a cell fate. Genes Dev, 1-15.