RELATED APPLICATIONS The present application claims priority to U.S.

Provisional application Serial No. 60/021,668, filed July 5, 1996. The teachings of the prior application are incorporated herein in their entirety.

GOVERNMENT SUPPORT Work described herein was supported by Grant Nos.

AI31371 and AI33815 from the National Institutes of Health The U.S. Government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Due to the infectious nature of the agent (HIV) which causes the fatal disease AIDS, a massive research effort has centered upon the development of a vaccine that would prevent HIV infection. In order to design an optimal vaccine, it is necessary to understand the pathobiology of

HIV in general, and the host immune response to the various subunit proteins of HIV in particular. Of primary concern is the role which the multiple immune responses against HIV play in immunopathogenesis and whether those immune responses which classically provide protective functions in preventing viral infections will be adequate against primary HIV infection, or whether immune responses which enhance viral infectivity can effectively abrogate protective responses (1) . Antibodies that enhance viral infectivity have been described for a number of viruses (12-26) . The most frequently cited example involves enhancement of dengue virus infection (12-15) . Results indicate that non- neutralizing antibodies can actually increase the number ot infectious virions in vi tro by binding virus to Fc receptors on monocytes and macrophages (18) . In dengue infection, the degree of enhancing antibody present roughly correlates with disease severity (13) . In addition to this Fc receptor-mediated mechanism, it has been shown that enhancement of infection by a flavivirus, West Nile virus, can be mediated by complement and complement receptors on cells (19) . Enhancement has been demonstrated in vitro for a number of viruses including flaviviruses (16-22) , alphaviruses (23) , rabies virus (24) , Sindbis virus (25) , and coronavirus (26) . There is some evidence for in vivo enhancement of several other viruses where ineffective vaccination results in increased severity of disease. Although other mechanisms have been suggested, the adverse effect m children immunized against respiratory syncytial virus (RSV) (27-30) and Chlamydia trachoma ti s (31) are consistent with the phenomenon of antibody-dependent enhancement (ADE) . Similar disease enhancement of RSV was observed in Cotton rats receiving RSV killed whole virus vaccine (32) . More recently, a baculovirus-derived recombinant envelope of the lentivirus, equine infectious

anemia virus (EIAV) , resulted in rapid disease progression and death in horses receiving the vaccine (33) . Gardner et al . (123) reported that passive immunization of rhesus macaques by serum from SIV-infected rhesus macaques led to an apparently enhanced course of disease, with five of six such animals dying within 6 months of challenge. In that study, there was a direct correlation between failure of passive immunization and higher antibody levels against the amino acid 603-622 peptide by ELISA (124) . These data differ from passive immunization experiments reported by Putkonen et al . (125) for SIV and in the feline immunodeficiency (FIV) model (126) , although investigators have reported enhanced infections for FIV in vitro (127) and similar passive immunization failure for SIVmac (128) in vivo . It is therefore prudent to consider the potential for enhancement in all vaccine preparations, as it may mean the difference between success and failure in the protection of vaccine recipients.

SUMMARY OF THE INVENTION The present invention relates to the discovery that alterations in an antibody-dependent enhancing domain of HIV can prevent or reduce the induction of enhancing antibodies, while maintaining the capacity to induce or bind protective or neutralizing antibodies. This discovery allows for the production of an improved vaccine or immunogenic composition which exhibits reduction in the induction of enhancing antibodies, while retaining the capacity to induce or bind protective or neutralizing antibodies . The present invention provides HIV virus having an alteration which inhibits induction of enhancing antibody to HIV. In a particular embodiment, the invention relates to HIV gp!60 mutants in which an antibody-dependent enhancing domain in gp41 includes alteration of at least

one ammo acid, e.g , substitution, addition or deletion of at least one ammo acid Specific examples of the contemplated mutations are illustrated the Examples, the exemplified mutations are presented for illustrative purposes only and are not intended to be limiting in anv way The antibody enhancing domains are also shown m the Examples, and it is clear that other mutations can be made to these regions and tested as described herein to determine their effect on the induction of enhancing antibodies and their retention of ability to bind neutralizing antibodies; such mutations are also within the scope of the present invention. The desired mutation can prevent or reduce the induction of enhancing antibodies, while maintaining the capacity to induce or bind protective antibodies Thus, the mutant gpl60 is an improved immunogen for use m a killed virus, genetic or recombmant subunit HIV vaccine

The invention relates to nucleic acid molecules encoding a protein or polypeptide in which an antibody- dependent enhancing domain contains at least one ammo acid alteration, and to proteins or polypeptides encoded by the described nucleic acids The invention also relates to DNA constructs comprising the nucleic acid molecules desciibec above operatively linked to a regulatory sequence, and to recombmant host cells, such as bacterial cells, fungal cells, plant cells, insect cells and mammalian cells, comprising the nucleic acid molecules described above operatively linked to a regulatory sequence

Thus, the invention also provides a method of inducing a mucosal immune response in a vertebrate, comprising administering to the mucosa of the subject an amount of DNA encoding a gpl60 enhancing domain mutant described herein effective to induce a mucosal immune response, complexed to a transfection-facilitating cationic lipid In a preferred embodiment, the cationic lipid is dioctylglycylspermine

(DOGS) . The invention also provides a method of inducing a mucosal immune response in a sub ect, comprising systemically administering to the subject an amount of DNA encoding a gpl60 enhancing domain mutant effective to induce a mucosal immune response, complexed to a transfection-facilitating cationic lipid, and an amount of l,25(OH) ₂ D3 effective to produce a mucosal response.

Similarly, the gpl60 enhancing domain mutants described herein as a genetic immunogen, recombmant antigen or in a whole virus can be used to stimulate a superior systemic immune response, since the problem of enhancement of infection is reduced. The invention also pertains to an immunogenic composition comprising an HIV gpl60 mutant m which an antibody-dependent enhancing domain m gp41 includes at least one amino acid alteration, e.g., substitution, addition or deletion of at least one ammo acid. These compositions are useful assaying the immune response thereto and n evaluating compounds which effect this response. In accordance with the enhancing domain mutants described herein, the invention further provides a method of inducing a mucosal immune response in a subject, comprising administering to the ucosa of the subject an amount of recombinant gpl60 enhancing domain mutant antigen effective to induce a mucosal immune response. Similarly, a whole HIV virus containing a mutation to the antibody- dependent enhancing domain of gpl60 can be the immunogen of the present immunization methods. Whether as a genetic immunogen, recombinant antigen or in a whole virus, the mutant gpl60 is superior as a vaccine because of the reduction the induction of enhancing antibodies.

BRIEF DESCRIPTION OF THE FIGURES

The f le of this patent contains at least one drawing executed color. Copies of this patent with color

drawings (s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

Figure 1 is a model of antibody-dependent enhancement (ADE) of HIV-1 infection in vi tro . The numeral 1 indicates Fc receptor mediated ADE, where the la route represents the CD4 receptor/Fc receptor cooperative mechanism and the lb route represents a Fc receptor mechanism which does not require CD4 receptor; the numeral II indicates complement receptor mediated ADE which requires a CD4 receptor/complement receptor mechanism. ( ) , IgG; (_ ) ,

C3 convertase; ( ) , complement component C3 ; ( ) , C3a;

( ) , C3 ^b (C3d,g) ; (c) , CD4 receptor;_ , complement receptor (CR2) ; ( ) , Fc receptor; ( ) , gpl2C of HIV.

Figures 2A-2D are illustrations of visualization of gpl60 binding to mucosal surfaces following a single genetic immunization with pCMV-gpl60 DNA complexed with dioctylglycylspermine (DOGS) . Binding of gpl60-bιotm detected with strepavidin- galactosidase mediated enzymatic product precipitation (azure blue marking on mucosal surface counter stained by Fast Red) . Figure 2A shows binding to the jejunum; note surface marking extending into crypts. Figure 2B shows binding to adjacent section of jejunum in which biotin probe was omitted. Figure 2C shows binding to the cervical os with vaginal (small arrow) and uterine mucosa (heavy arrow) marked by precipitate Figure 2D shows binding to the uterus from naive control animal . Similar marking for gpl60 binding to mucosa was observed in the lung (not shown) .

Figure 3 shows the linear relationship between HIV and SIV enhancing domains and site-directed HIV mutations within the principle enhancing domain and an adjacent sequence external to the enhancing domain. The shaded area indicates the principle enhancing domain. Underlined single residues indicate point mutations, while multiple

residues indicate deletions further identified by Δ and the number of residues deleted.

Tigures 4A-4D show the ELISA results for binding of four human enhancing mAbs to wild type (•-• and mutant gpl60s (S/A 599, ▼-▼; Ml, M2, W/Y 596, T/A 605, A-A) Detection by antl-human biotin-labeled second antibody followed by strepavid alkaline phosphatase with liberation of soluble enzymatic product at 405 nm (± SEM) 200 ng gpl60 adsorbed per well at pH 9.5 Error bars which are not illustrated lie within the symbols Figure 4A depicts binding of mAb 86; Figure 4B depicts binding of mAb 240D, Figure 4C depicts binding of mAb 50-69, and Figure 4D depicts binding of mAb 246D tiguie 5 shows the principal enhancing domain for complement-dependent enhancement of HIV infection The shaded area indicates the epitope of vanous enhancing human mAbs as indicated. Tryptophan 596 is common to all three, as well as enhancing human mAb 86 whose exact epitope is unknown The indicated epitope of mAb 50-69 is the minimal sequence. It may be extended several residues to either the N or C terminus of the enhancing domain

Figures 6A-6D illustrate a molecular mode] of gp41 Figure 6A shows the topographic relationship between the primary (ammo acids 593-604) and secondary (ammo acids 609-625) immunodominant domains containing enhancing epitopes along the peptide backbone The primary domain is indicated m pink, the secondary in green Glycosyl residues are indicated by a space-filling representation (white) The fusogenic peptide (amino acids 512-539) is indicated m red, and the peptide backbone is indicated m yellow Figure 6B shows solvent-accessible surface of gp41 associated with C-terminal gpl20 represented by the peptide backbone Figure 6C shows the association of wildtype gp41 with gpl20 Figure 6D shows the association of W/Y 596

utant with gpl20. For Figures 6C and 6D, yellow is gp41 588-606; cyan is the C5 region on gpl20 from residues 484- 499; white is disulfide bond forming the secondary loop aa 598-604 on gp41; green is Y486 on gpl20; red is W/Y 596 on gp41; and pink is W610 on gp41.

Figures 7A-7E show the alignments of multiple clades of HIV-l. The W two residues amino-terminal to the first cysteine forming the disulfide loop is common to all clades and all isolates sequenced to date in the Los Alamos Database on Human Retroviruses and AIDS. Capital letters in the consensus sequence indicate conservation of the amino acid at that position; lower case letters indicate the consensus amino acid at that position.

DETAILED DESCRIPTION OF THE INVENTION The primary antigenic domain responsible for complement-mediated antibody-dependent enhancement (C -ADE) of HIV and SIV resides in the principle immunodominant sequence of the transmembrane (TM) protein. It was therefore important to identify whether there are amino acid residues common to the epitopes of known enhancing human monoclonal antibodies (mAbs) , and to provide a structural model for this functional region present on the HIV envelope. The model described herein predicts that this region is involved in the association of gpl20 with gp41, and this association was monitored for each mutant. The binding of enhancing human mAbs to point and deletion mutations within the enhancing domain was analyzed by two methods. The first method analyzed binding to mutants expressed in COS cells. Expression of gpl60 in each COS transfectant was demonstrated with polyclonal

HIVIG antisera versus binding of enhancing human mAb 50-69. Retention of gpl20 association to gp41 on processed gpl60 was monitored for each mutant by the binding of the V3 loop mouse mAb 5F7. The second method of analysis quantitated

the binding of four enhancing human mAbs to each mutant gpl60 versus wild type control in an ELISA format.

All available enhancing human mAbs known to bind to the principle lmmunodommant region oi gp4l were unable to bind to deletions involving the disulfide loop, which, the molecular model, provides the primary association site between gpl20 and gp41. Point mutants in the disulfide loop blocked this association but had quantitatively smaller effect on the binding of the enhancing human mAbs. A conservative tryptophan (W) to tyrosme (Y) mutation at residue 596 (W/Y 596; previously referred to as W/Y 559) completely blocked the binding of all the human mAbs, but had no effect on gpl20/gp41 association These results make available vaccines which the primary enhancing epitope is disarmed to prevent the subsequent induction of an amnestic response that could lead to viral enhancement of infection The retention of gpl20/gp41 association should yield an immunogen similar to natural infection for both subunit and genetic vaccines. The present invention relates to the discovery that alterations an antibody-dependent enhancing domain of HIV can prevent or reduce the induction of enhancing antibodies, while maintaining the capacity to induce or bind protective or neutralizing antibodies. This discovery allows for the production of an improved vaccine or lmmunogenic composition which exhibits reduction in the induction of enhancing antibodies, while retaining the capacity to induce or bind protective or neutralizing antibodies Thus, this invention relates to an HIV virus or portion thereof having an alteration which inhibits, e.g , prevents or reduces, the induction of enhancing antibodies, preferably, the HIV virus or portion thereof maintains the ability to induce or bind protective or neutralizing antibody. In one embodiment, the portion of

HIV is an envelope glycoprotein of HIV, such as gpl60 and gpl20/gp41.

Accordingly, the present invention provides HIV gpi60 mutants in which an antibody-dependent enhancing domain in gp41 contains at least one amino acid alteration, e.g. , substitution, addition or deletion of at least one amino acid. The term "alteration" used herein means that the amino acid is altered as compared with the amino acid present in the wild type or naturally-occurring polypeptide. Specific examples of the contemplated mutations are illustrated in the Examples; the exemplified mutations are presented for illustrative purposes only and are not intended to be limiting in any way. The antibody enhancing domains are also shown in the Examples, and it is clear that other mutations can be made to these regions and tested as described herein to determine their effect on the induction of enhancing antibodies and their retention of ability to bind neutralizing antibodies; such mutations are also within the scope of the present invention. For example, in addition to the specific mutations described herein, the identified amino acid residues can be replaced with other amino acids in addition to the specific replacements demonstrated herein. That is, if the exemplified mutation is, for example, a tryptophan to tyrosine mutation at a particular position, it will be apparent to the skilled artisan that tryptophan can also be mutated to another amino acid, e.g., serine or alanine. The mutations can be conservative or non- conservative . Non-conservative mutations, including deletions, will require mutation of the gpl60 cleavage site in order to retain the full immunogenicity of the gpl20 product. Furthermore, it will be apparent to the skilled artisan that amino acid residues other than those specifically mutated as described herein, particularly amino acid residues within an antibody-enhancing domain of HIV, can be

altered by the presently disclosed techniques, and the effects of such mutations can be tested as described ne ein to determine their effect on the induction of enhancing antibodies and their retention of ability to bind neutralizing antibodies. Ammo acids which are particularly likely mutation targets are those which are conserved between two or more epitopes of various ennancmg human mAbs. The desired mutation will inhibit, e.g , prevent or reduce, the induction of enhancing antibodies, while maintaining the capacity to elicit, e.g , induce or bind, protective antibodies. That is, desired mutations will block the binding of enhancing human mAbs but retain gpl20/gp41 association Thus, the mutant gpl60 is ar improved genetic immunogen for use n an HIV vaccine oi lmmunogemc composition.

Once a determination is made as to the particular am o acid residue to be mutated, and as to the alteration to be made, the skilled artisan can use techniques \ _cn are routine in the art to make the mutation, either oy substitution, deletion or addition. For example, in the case of substitution mutations, site directed mutage-esis techniques described herein can be used to change the nucleotiαe sequence of the polypeptide from t » coαc corresponding to the wild type ammo acid to a codon corresponding to the ammo acid to be substituted The resulting nucleotide sequence can be expressed, e g , E. coli , to produce the mutant polypeptide. Similarly, techniques for making addition or deletion mutations are known m the art The gpl60 enhancing domain mutants described he.ein as a genetic immunogen, recombinant antigen or a who__e virus can be used to stimulate a superior systemic immune response, since the problem of enhancement of infection is reduced The invention also pertains to an lmmunogemc composition comprising an HIV gpl60 mutant m which εn

antibody-dependent enhancing domain in gp41 includes at least one amino acid alteration, e.g. , substitution, addition or deletion of at least one amino acid. These compositions are useful in assaying the immune response thereto and in evaluating compounds which effect this response .

The invention relates to nucleic acid molecules encoding a protein or polypeptide in which an antibody- dependent enhancing domain contains at least one amino acid alteration, and to proteins or polypeptides encoded by the described nucleic acids . The invention also relates to DNA constructs comprising the nucleic acid molecules described above operatively linked to a regulatory sequence, and to recombinant host cells, such as bacterial cells, fungal cells, plant cells, insect cells and mammalian cells, comprising the nucleic acid molecules described above operatively linked to a regulatory sequence.

Accordingly, the invention pertains to a nucleotide sequence encoding the gpl60 HIV mutants described herein. As appropriate, nucleic acid molecules of the present invention can be RNA, for example, mRNA, or DNA, such as cDNA and genomic DNA. DNA molecules can be double-stranded or single-stranded; single stranded RNA or DNA can be either the coding, or sense, strand or the non-coding, or antisense, strand. Preferably, the nucleic acid molecule comprises at least about 25 nucleotideε, more preferably at least about 50 nucleotides, and even more preferably at least about 200 nucleotides. The nucleotide sequence can be only that which encodes at least a fragment of the amino acid sequence of an HIV protein having an antibody- dependent enhancing domain, provided that the encoded fragment contains the portion of the domain having an alteration as described herein; alternatively, the nucleotide sequence can include at least a fragment of the amino acid coding sequence along with additional non-coding

sequences such as introns and non-coding 3' and 5' sequences (including regulatory sequences, for example) Additionally, the nucleotide sequence can be fused to a marker sequence, for example, a sequence which encodes a polypeptide to assist isolation or purification of the polypeptide. Such sequences include, but are not limited to, those which encode a glutathione-S-transferase (GST) fusion protein and those which encode a hemaglutm A (HA) peptide marker from influenza. The nucleotide or nucleic acid sequences described herein can be a nucleotide sequence which is not flanked by nucleotide sequences which normally (m nature) flank the gene or nucleotide sequence (as in genom c sequences) and/oi has been completely or partially purified from other transcribed sequences (as in a cDNA or RNA library) . Thus, the nucleotide sequence can include a gene or nucleotide sequence which is synthesized chemically or by recomb ant means. Thus, recombinant DNA contained m a vector are included the definition of "isolated" as used herein. Also, isolated nucleotide sequences include recombinant DNA molecules in heterologous host cells, as well as partially or substantially purified DNA molecules solution. In VΛ and in vi tro RNA transcripts of the DNA molecules of the present invention are also encompassed herein. Such nucleotide sequences are useful in the manufacture of the encoded protein or polypeptide, as probes for isolating homologous sequences (e.g., from other mammalian species) , for gene mapping (e.g. , by in si tu hybridization with chromosomes) , or for detecting expression of the gene m tissue (e.g. , human tissue) , such as by Northern blot

The present invention also pertains to nucleotide sequences which are not necessarily found in nature but wnich do, in fact, encode an antibody-dependent enhancing domain of HIV Thus, DNA molecules which comprise a

sequence which is different from the naturally-occurring nucleotide sequence but which, due to the degeneracy of the genetic code, encode the polypeptides of the present invention are the subject of this invention The invention also encompasses variations of the nucleotide sequences of the invention, such as those encoding portions, analogues or derivatives of the protein. Such variations can be naturally-occurring, such as in the case of allelic variation, or non-naturally-occurring, such as those induced by various mutagens and mutagenic processes. Included variations include, but are not limited to, addition, deletion and substitution of one or more nucleotides which can result in conservative or non- conservative ammo acid changes, including additions and deletions. Preferably, the nucleotide or amino acid variations are silent.

The invention also pertains to proteins or polypeptides encoded by the nucleic acid sequences described herein. Proteins or polypeptides of the invention can be chemically synthesized or recombinantly produced, and can be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using art-recognized methods.

The invention also provides expression vectors containing a nucleic acid sequence encoding a polypeptide described herein, optionally linked to at least one regulatory sequence. Many such vectors are commercially available, and other suitable vectors can be readily prepared by the skilled artisan. "Operably linked" is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleic acid sequence. Regulatory sequences are ar -recognized and are selected to produce the desired polypeptide. Accordingly, the term "regulatory sequence" includes promoters, enhancers, and other expression control

elements which are described in Goeddel, Gene Expression Technology : Methods in Enzymology 185 , Academic Press, San Diego, CA (1990) . For example, the native regulatory sequences or regulatory sequences native to the transformed host cell can be employed. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. For instance, the polypeptides of the present invention can be produced by ligating the cloned gene, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells or both (see, for example, Broach, et al . , Experimen tal Manipula tion of Gene Expression , ed. M. Inouye (Academic Press, 1983) p. 83; Molecular Cloning : A Labora tory Manual , 2nd Ed., ed. Sambrook et al . (Cold

Spring Harbor Laboratory Press, 1989) Chapters 16 and 17) . Typically, expression constructs will contain one or more selectable markers, including, but not limited to, the gene that encodes dihydrofolate reductase and the genes that confer resistance to neomycin, tetracycline, ampicillin, chlora phenicol, kana ycin and streptomycin resistance.

Prokaryotic and eukaryotic host cells transfected by the described vectors are also provided by this invention. For instance, cells which can be transfected with the vectors of the present invention include, but are not limited to, bacterial cells such as E. coli (e.g., E. coli K12 strains, Streptomyces , Pseudomonas , Serra tia marcescens and Salmonella typhimurium, insect cells (baculovirus) , including Drosophila , fungal cells, such as yeast cells, plant cells and mammalian cells, such as Chinese hamster ovary cells (CHO) , and COS cells.

Thus, a nucleotide sequence described herein can be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes. Ligating the polynucleotide sequence into a gene construct, such as an

expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect, plant or mammalian) or prokaryotic (bacterial cells) , are standard procedures used in producing other well known proteins. Similar procedures, or modifications thereoi, can be employed to prepare recombinant proteins according to the present invention by microbial means or tissue-culture technology. Accordingly, the invention pertains to the production of described proteins or polypeptides by recombinant technology.

The proteins and polypeptides of the present invention can be isolated or purified (e.g., to homogeneity) from recombinant cell culture by a variety of processes. These include, but are not limited to, anion or cation exchange chromatography, ethanol precipitation, affinity chromatography and high performance liquid chromatography (HPLC) . The particular method used will depend upon the properties of the polypeptide and the selectic of the host cell; appropriate methods will be readily apparent to those skilled in the art.

The present invention also relates to antibodies which bind a polypeptide of the present invention For instance, polyclonal and monoclonal antibodies, including non-human and human antibodies, humanized antibodies, chimenc antibodies and antigen-binding fragments thereof (Current Protocols in Immunology, John Wiley & Sons, N.Y. (1994) ; EP Application 173,494 (Morrison) ; International Patent Application WO86/01533 (Neuberger) ; and U.S. Patent No. 5,225,539 (Winters) ) which bind to the described proteins or polypeptides are within the scope of the invention. A mammal, such as a mouse, rat, hamster or rabbit, can be immunized with an lmmunogemc form oi the polypeptide (e.g. , a polypeptide comprising an antigenic fragment which is capable of eliciting an antibody response) . Tecnniques for conferring immunogenicity on a protein or oept de

mclude conjugation to carriers or other techniques well known in the art The protein or polypeptide can be administered in the presence of an adjuvant. The progress of immunization can be monitored by detection of antibody titers plasma or serum. Standard ELISA or other lmmunoassays can be used with the immunogen as antigen to assess the levels of antibody. The antibodies of the present invention can be used as assay reagents to analyze the presence or absence of the polypeptide (s) to which they bind by known techniques.

The invention also pertains to an HIV vaccine comprising HIV gpl60 mutants m which an antibody-dependent enhancing domain in gp41 includes at least one ammo acid alteration, e g , substitution, addition or deletion of at least one am o acid The vaccine can be a subunit vaccine or a genetic vaccine, i.e., the vaccine can contain a genetic immunogen, recombinant antigen or a whole HIV virus which has been mutated as described herein The described vaccines have the advantage of being unable to induce an amnestic response that could lead to viral enhancement of infection, as the primary enhancing epitope of gp41 has been altered to prevent such a response

The vaccine formulation of the present invention comprises an HIV virus or portion thereof m which an antibody-dependent enhancing domain contains at least one ammo acid alteration. Preferably, the alteration results m inhibition of the induction of enhancing antibody, and, more preferably, also maintains the capacity of the vaccine to elicit neutralizing antibody. The vaccine can comprise a whole HIV virus which has been altered in accordance with these teachings, alternatively, the vaccine can comprise one or more portions of the HIV virus, such as the glycoprote s gpl60 and gpl20/gp41.

The recombinant subunit, genetic or killed virus vaccines of this invention can be formulated with various

adjuvants readily known to the skilled artisan . The vaccine composition can also comprise a physiologically acceptable vehicle, including, but not limited to, water, buffered saline, polyols (e.g. , glycerol, propylene glycol, liquid polyethylene glycol) , Ringer's solutions, isotonic sodium chloride solutions and dextrose solutions. The optimum concentration of the active ingredient (s) in the chosen medium can be determined empirically, according to procedures well known in the art, and will depend on the ultimate pharmaceutical formulation desired. Methods of introduction of include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, oral and intranasal . Other suitable methods of introduction can also include rechargeable or biodegradable devices and slow release polymeric devices. The vaccines of this invention can also be administered as part of a combinatorial therapy with other agents.

The invention also relates to a vaccine comprising DNA encoding a portion of HIV virus, e.g., an envelope glycoprotein, in which an antibody-dependent enhancing domain contains at least one amino acid alteration and a physiologically acceptable vehicle. Such a vaccine is useful for the genetic immunization of vertebrates.

The term, "genetic immunization", as used herein, refers to inoculation of a vertebrate, particularly a mammal, with a nucleic acid vaccine directed against a pathogenic agent, particularly HIV or an envelope glycoprotein thereof, resulting in protection of the vertebrate against HIV. Representative vertebrates include mice, dogs, cats, chickens, sheep, goats, cows, horses, pigs, non-human primates, and humans. A "nucleic acid vaccine" or "DNA vaccine" as used herein, is a nucleic acid construct comprising a polynucleotide encoding a polypeptide antigen, particularly an envelope glycoprotein of HIV comprising an antibody-dependent enhancing domain

having an alteration in at least one amino acid. The nucleic acid construct can also include transcriptional promoter elements, enhancer elements, splicing signals, termination and polyadenylation signals, and other nucleic acid sequences .

"Protection against HIV" as used herein refers to generation of an immune response in the vertebrate, the immune response being protective (partially or totally) against manifestations of the disease caused by the HIV virus. A vertebrate that is protected against disease caused by the HIV virus may be infected with HIV, but to a lesser degree than would occur without immunization; may be infected with HIV, but does not exhibit disease symptoms; or may be infected with HIV, but exhibits fewer disease symptoms than would occur without immunization.

Alternatively, the vertebrate that is protected against disease caused by HIV may not become infected with the HIV virus at all, despite exposure to the virus.

The nucleic acid vaccine can be produced by standard methods. For example, using known methods, a nucleic acid encoding polypeptide antigen of interest, e.g. , DNA encoding a polypeptide comprising an antibody-dependent enhancing domain in which at least one ammo acid is altered, can be inserted into an expression vector to construct a nucleic acid vaccine (see Maniatis et al . ,

Molecular Cloning, A Labora tory Manual , 2nd edition, Cold Spring Harbor Laboratory Press (1989) ) .

The individual vertebrate is inoculated with the nucleic acid vaccine (i.e., the nucleic acid vaccine is administered) , using standard methods. The vertebrate can be inoculated subcutaneously, intravenously, intraperitoneally, intradermally, intramuscularly, topically, orally, rectally, nasally, buccally, vaginally, by inhalation spray, or via an implanted reservoir in dosage formulations containing conventional non-toxic,

physiologically acceptable carriers or vehicles Alternatively, in a preferred embodiment, the vertebrate is inoculated with the nucleic acid vaccine through the use of a particle acceleration instrument (a "gene gun") The form m which it is administered (e g , capsule, tablet, solution, emulsion) will depend part on the route by which it is administered. For example, for mucosal administration, via nose drops, inhalants or suppositories can be used The nucleic acid vaccine can be administered in conjunction with known adjuvants The adjuvant is administered in a sufficient amount, which is that amount that is sufficient to generate an enhanced immune response to the nucleic acid vaccine. The adjuvant can be administered prior to (e.g., 1 or more days before) inoculation with the nucleic acid vaccine, concurrently with (e g , within 24 hours of) inoculation with the nucleic acid vaccine, contemporaneously 'simultaneously) with the nucleic acid vaccine (e.g , the adjuvant is mixed with the nucleic acid vaccine, and the mixture is administered to the vertebrate) , or afte (e g , 1 or more days after) inoculation with the nucleic acid vaccine The adjuvant can also be administered at moie * an one time (e g , prior to inoculation with the nucleic acid vaccine and also after inoculation with the nucleic acid vaccine) As used herein, the term "in conjunction with" encompasses any time period, including those specifically described herein and combinations of the time periods specifically described herein, during which the adjuvant can be administered so as to generate an enhanced immune response to the nucleic acid vaccine (e g , an increased antibody titer to the antigen encoded by the nucleic acid vaccine, or an increased antibody titer to HIV) The adjuvant and the nucleic acid vaccine can be administered at approximately the same location on the vertebrate, for

example, both the adjuvant and the nucleic acid vaccine are administered at a marked site on a limb of the vertebrate.

In a particular embodiment, the nucleic acid construct is co-administered with a transfection-facilitating cationic lipid. In a preferred embodiment, the cationic lipid is dioctylglycylspermine (DOGS) (U.S. patent application Serial Nos. 08/372,429 and 08/544,575, PCT application Serial No. PCT/US96/16845 and published PCT application publication no. WO 96/21356) . In a particular embodiment, the nucleic acid construct is co-administered with a transfection-facilitating cationic lipid and an amount of l,25(OH) ₂ D3 effective to produce a mucosal response. In a preferred embodiment, the nucleic acid construct is complexed with a transfect on-facilitating cationic lipid.

The invention also provides a method of inducing a mucosal immune response in a subject, comprising administering to the mucosa of the subject an amount of antigen-encoding DNA (e.g., gpl60 enhancing domain mutant) effective to induce a mucosal immune response, complexed to a transfection-facilitating cationic lipid. In a preferred embodiment, the cationic lipid is dioctylglycylspermine (DOGS) (U.S. patent application Serial Nos. 08/372,429 and 08/544,575, PCT application Serial No. PCT/US96/16845 and published PCT application publication no. WO 96/21356) .

The invention also provides a method of inducing a mucosal immune response in a subject, comprising systemically administering to the subject an amount of antigen-encoding DNA (e.g. , gpl60 enhancing domain mutant) effective to induce a mucosal immune response, complexed to a transfection-facilitating cationic lipid, and an amount of 1, 25 (OH) -J_)3 effective to produce a mucosal response. Similarly, the gpl60 enhancing domain mutants described herein as a genetic immunogen, recombinant antigen or in a whole virus can be used to stimulate a superior systemic

immune response, since the problem of enhancement of infection is reduced.

In accordance with the enhancing domain mutants described herein, the invention further provides a method of inducing a mucosal immune response in a subject, comprising administering to the mucosa of the subject an amount of recombinant gpl60 enhancing domain mutant antigen effective to induce a mucosal immune response. Similarly, a whole HIV virus containing a mutation to the antibody- dependent enhancing domain of gpl60 can be the immunogen of the present immunization methods. Whether as a genetic immunogen, recombinant antigen or in a whole virus, the mutant gpl60 is superior as a vaccine because of the reduction in the induction of enhancing antibodies. The invention relates to a series of mutations in the enhancing domain that is consistent with this observation and which block binding of human mAb to the enhancement region. Moreover, the data shows that a single conservative mutation at tryptophan 596 to tyrosine can block binding of the four existent human enhancing monoclonal antibodies (mAbs) without effecting binding of gpl20 to gp4l while all other mutations in the loop or immediately C- erminal to the second loop cysteine inhibit gpl20 association with gp4l. Figure 3 illustrates the point and deletion mutations which have been made with comparison to the SIV consensus sequence.

Various deletions were made as described herein; amino acid numbering used herein refers to the amino acid sequence of the HIV 3B strain HXB as set forth in the Los Alamos Database for Human Retroviruses and AIDS (Los

Alamos, NM; accession No. REHIVHXB K03455) . A five amino acid (amino acid 605 (T) to 609 (P) , inclusive) inframe deletion was produced beginning at the second cysteine by leaving the disulfide loop sequence intact, and a separate thirteen amino acid (amino acid 597 (G) to 609 (P) ,

inclusive) inframe deletion was produced that contained the previous 5 amino acid deletion plus the disulfide loop residues. Mutants containing these deletions are referred to herein as Ml and M2 mutants, respectively. Two point mutations were made on either side of the disulfide loop. The first is a conservative tryptophan to tyrosine mutation at amino acid 596 (W/Y 596; previously referred to as W/Y 559) . The second involves the first threonine adjacent to the second cysteine residue in a threonine to alanine mutation (T/A 605; previously referred to as T/A 568) . Two point mutations were made within the disulfide loop. The first was a serine to alanine mutation (S/A 599; previously referred to as S/A 562) and the second was a lysine to alanine mutation (K/A 601; previously referred to as K/A 564) . A conservative tryptophan to tyrosine mutation was made outside the enhancing domain at residue 614 (W/Y 614; previously referred to as W/Y 576) .

ENHANCEMENT OF HIV AND SIV IN VITRO a) Enhancement of HIV-1 Infection Via Fc Receptors Antibodies that enhance HIV-1 infection via Fc receptors (Fc receptor-mediated, antibody-dependent enhancement; FCR-ADE) were first described by Homsy et al . (36) . Several reports rapidly followed that supported the findings that subneutralizing amounts of patient serum could enhance HIV-1 infection in vi tro (37,45) . Two schools of thought have arisen: one believes that CD4 is required in addition to Fc receptors, and one believes that Fc receptors alone can enhance HIV-1 infection in vi tro .

Using U937, a monocyte-like cell line, several groups have shown that either soluble CD4 or the CD4 blocking monoclonal antibody, OKT4a, could completely block FCR-ADE of HIV-l infection in vi tro (38-42) . It appears that any of the three Fc receptors recognized by monoclonal antibodies (FcR-I, II, or III) can mediate such

enhanceraent . Several other groups have also demonstrated that primary monocyte cultures can mediate FCR-ADE (36,37,43-45) . Enhancement of both BWIAB and monocyte- tropic isolates of HIV have been reported (36,48-45) . The second mechanism described utilizes Fc receptors without requiring CD4 on the cell surface (37,45) . It has been shown that subneutralizmg amounts of sera containing anti-HIV antibody could enhance HIV-1 infection in primary monocyte/macrophage cultures the presence of either OKT4a or soluble CD4 (45) . Furthermore, enhancement was blocked by IgG aggregates and antibodies to FcR-III and not monoclonal antibodies against FcR-I or FcR-II. The lack of a requirement for CD4 was subsequently confirmed m a report by McKeat g et al . (46) m which Fc receptors on fibroblasts could bind and internalize HIV-1 m the presence of subneutralizing amounts of antibody to HIV Expression of Fc receptors was induced by infection of HEL- 299 human fibroblasts with CMV (47-50) . Once the FcR was present, HEL-299 cells were challenged with HIV-1 the presence or absence of HIV-1 antibody positive serum. HIV- 1 could only infect CMV infected fibroblasts if HIV-1 was first opsonized with antibody to HIV-1 and not normal serum. HTV-1 could not infect HEL 299 cells that had not been infected with CMV. Infection by HIV-1 was detected by polymerase chain reaction and by co-cultivation of the HEL- 299 cells with CD4+ lymphocytes (46) .

A fundamental theoretical problem with FcR mediated ADE of HIV is the inability to demonstrate enhancement under conditions which are physiologically relevant. FcR mediated enhancement can only be demonstrated in anti-HIV sera at high dilutions. At high antibody concentrations, neutralizing antibodies dominate the phenotypic response This phenomenon has been observed at least one human monoclonal antibody to the V3 loop (51) . At high concentration, the antibody neutralizes HIV, while upon

- 25 - dilution enhancement is observed. This ambiguous activity by the FcR mechanism is not observed in complement mediated (C ) ADE, where C'-ADE from numerous HIV subjects can be demonstrated to abrogate humoral immunity to HIV (3,52) . For this reason, it appears that C -ADE is the more relevant enhancing response with regard to pathogenesis of HIV infection.

b) Enhancement of HIV-1 Infection Via CR2

Enhancing human antibodies against the HIV-1 envelope glycoprotein were first described in 1987 (2,3) . It was shown that several human mAbs against the HIV-l envelope glycoproteins could enhance HIV-l infection but did not neutralize HIV-l in vi tro (6) . Early reports of enhancement of HIV-l infection in vi tro demonstrated that antibodies against the envelope glycoprotein could activate complement and infections could be enhanced in vi tro (3,51,53) . This mechanism of enhancement has been called complement-mediated, antibody-dependent enhancement (C'- ADE) of HIV-l infection. In addition to enhancing HIV-l. infection, complement also reduced or abrogated HIV neutralizing activity in homologous sera (3) . It was later shown that the HIV target cells used, MT-2, a T-- lymphoblastoid cell line, expressed high levels of both CD4 and CR2 but not complement receptor type 1 or 3 (34) . It was demonstrated that a CR2 blocking antibody, OKB7, could block enhancement of HIV-l infection but had no effect on the infectivity of HIV-l in the absence of C'-ADE (35) . In addition, OKT4a but not OKT4f could block both HIV-l infection and C'-ADE of HIV-l infection in vi tro (35) . Therefore, both CD4 and CR2 are required for C'-ADE of HIV- 1 infection in vi tro . These data have been confirmed by several laboratories (53-57) . The monocyte-like line, U937, can also bind opsonized HIV via CD4 and complement receptors (54,57) resulting in enhanced infection. One

report has also demonstrated that Epstem-Barr Virus (EBV) transformed B lymphocytes which express CR2 (58,59) can exhibit C'-ADE of HIV-l infection (55,56) To date, studies in which CD4 and complement receptor were not both required for C'-ADE of HIV-l infection have been reported by two laboratories (60,61) .

The exact mechanism of enhancement on a molecular level is unknown for both C'-ADE and FCR-ADE For C'-ADE, it is known that the HIV envelope glycoprotems can activate complement, and that antibody to HIV leads to increased fixation of complement component C3 on HIV or HIV-infected cells (62,63) This complement can bind HIV to CR2 and act to increase the amount of HIV in proximity to CD44 cell surfaces (64,65) , resulting a greater likelihood that the gpl20 would interact with t he CD4 receptor which mediates the entrance of HIV into the cell. Spear and his colleagues have directly shown that C -ADE results in increased HIV binding to target cells and an increased integrated proviral copy number (66) Moreover, this group has demonstrated that a substantial fraction (30%) of CD4 cells m the peripheral blood carry CR2 receptors and that these CD4/CR2 bearing cells are the first to decline in HIV infection (/l) This is analogous to the recent arguments of Zolla-Pazner and Sharpe (72) to explain the differential sensitivity of their resting cell versus activated HIV neutralization assay Lectm- stimulated PBMCs express increased levels of cell adhesion and MHC molecules that act as secondary facilit ators of HIV binding to CD4 target cells In the case of C -ADE, however, the process is specific via CR2 and more directed towards viral binding

With the production of human monoclonal antibodies (huMAbs) against the HIV-l envelope glycoprotein, it became possible to separate virus neutralization from enhancement It was shown that several huMAbs against the HIV-l envelope

glycoproteins could enhance HIV-l infection but did not neutralize HIV-l in vi tro (6) . The ability of the huMAbs to enhance infection was not determined by the ability of the huMAbs to activate complement nor by the IgG subclass of the huMAbs (6,7) . These enhancing huMAbs have been mapped to linear domains in the HIV-l gp41 transmembrane glycoprotein. Of six enhancing huMAb identified to date, five map to amino acid residues 579-613 (7,8) , the primary immunodominant domain of gp41 (67-69) . One of the six maps to another immunodominant domain (6,8) . No evidence for conformational enhancing epitopes exists other than the effects of disulfide reduction on the binding affinity of one enhancing mAb (70) .

GENETIC IMMUNIZATION The ability to simulate viral replication by transfection of non-replicating, transcription/translation permissive viral DNA encoding viral proteins essential for a protective immune response by the host provides the advantages of an attenuated, live vaccine without the potential for reversion to virulence. Two methods of transfection in vivo have been reported previously to achieve genetic immunization. The more common approach follows the observation that mouse muscle is a unique target for transfection with naked DNA (73) and that muscle of a variety of species is particularly susceptible to transfection by naked DNA (74-81) . Moreover, plasmid DNA has been shown to be superior to viral vectors for transfer to mouse muscle (82) . Protection against lethal challenge in mice by influenza A virus following genetic IM immununiza ion with a nucleoprotein gene and/or hemagglutinin gene has been reported by a number of investigators (83-85) . Induction of cytotoxic lymphocytes and neutralizing antibodies has been demonstrated for influenza A virus (83-86) , and HIV (87,88) . Despite the

lmpress ve induction of protective immune responses, relatively massive quantities of DNA are required Typically, three IM injections of 100-200 μg plasmid DNA carrying the viral gene under a eukaroytic promotei is required, despite efforts to increase muscle cell permeability by pretreatment of muscle with hypertonic sucrose or cardiotoxin (89,90) Although unreported as a toxic side effect to date, this requirement for large quantities of DNA may limit this method due to the potential for antibody response to DNA itself and the generation of a self-sustaining lupus-like syndrome.

The less common approach to genetic immunization using holistic transfection overcomes the problem of DNA quantity but requires instrumentation not widely available Typically, nanogram quantities of DNA complexed to gold or tungsten particles are physically propelled through the plasma membrane by micropro ectile bombardment Both methods elicit cellular (91,92) and humoral responses (92 94) The use of the cationic lipid, dioctylglycylspermine (DOGS) , n m vivo immunization has lowered the amount of DNA required for genetic immunization by IM or airway routes of transfection to practical levels and rivals this advantage of bolistic transfection without the need oi specialized equipment (U.S patent application Serial Nos 08/372,429 and 08/544,575, PCT application Serial No

PCT/US96/16845 and published PCT application publication no WO 96/21356, the teachings of which are mcorpo ated herein by reference m their entirety) .

THE MUCOSAL IMMUNE SYSTEM Mucosal surfaces represent the major route of entry for most systemic pathogens with subsequent mucosal immunity usually providing long-term protection against reinfection (95) The traditional parenteral approach to vaccination does not induce mucosal immunity and generally

exhibits limited protective immunity against mucosally acquired pathogens (96) . Examples include the life-long immunity produced by the Sabm oral poliovirus vaccine versus the Salk parenteral vaccine (48) , which required multiple boosters to maintain systemic immunity, and the single dose oral cholera vaccine with its improved safety profile versus the older multi-dose parenteral cholera vaccine (97) . Although mucosal immune responses can be induced by a variety of delivery systems such as liposome- or microparticle-containing antigens and antigen conjugated to gut epithelial binding proteins such as the B subunit of cholera toxin, the best long-term mucosal and systemic protection against infection is provided by live, attenuated pathogens which simulate infection of the naive host but which are incapable of inducing disease (98) . Despite the current capacity to produce attenuating mutations in cloned microorganisms, the concern over potential reversion to virulence or host virulence determinants has effectively inhibited development of these most potent inducers of mucosal immunity for human use (99) .

Epidemiological data clearly indicate that 70-80% of all AIDS cases are the result of heterosexual transmission of HIV (100-108) . Heterosexual transmission is the fastest growing route of transmission in the United States, with women being at significantly greater risk of infection by HIV than males (109,110) . Infection of Langernans cells, mucosal macrophages, T cells, and even epithelial cells from cell-associated HIV or free HIV in semen of the genital tract is a powerful argument that the induction of mucosal responses is at least as important as systemic responses m the development of a vaccine against HIV infection (105-107,111) . Although systemic immunization rarely induces mucosal immunity, mucosal immunization frequently provides systemic responses as well (112) . This

is demonstrated by the genital SIV infection of systemically vaccinated rhesus macaques resistant to intravenous SIV infection (106,111,113) . In contrast animals immunized sequentially by vaginal, rectal, and oral exposure to a recombinant SIV antigen elicited both mucosal and systemic antibodies to SIV (114,115) . Oral or intratracheal exposure to SIV incorporated into microspheres following a systemic primary immunization has been reported to provide protection against vaginal SIV challenge (116) .

Although IgG can be found on mucosal surfaces following mucosal immunizations, IgA is the predominant Ig in mucosal immunity. This is secondary to the presence of an Ig receptor with greatest affinity for polymeric IgA (plgA) . This receptor is expressed on the surface of mucosal epithelial cells and actively transports plgA to the mucosal surface (117-119) through mucosal epithelial cells .

Significant indirect evidence indicates the presence of a common mucosal immune system (47,50) . Induction of mucosal immunity in bronchus-associated lymphoid tissues usually yields evidence of immunity in gut-associated lymphoid tissues. Induction of mucosal responses via airway transfection of an HIV genetic immunogen or by IM inoculation in the presence of l,25(OH) ₂ D3 has provided direct evidence for a common mucosal response (U.S. patent application Serial Nos. 08/372,429 and 08/544,575) . The common element is the generation of mobile IgA-secreting plasma cells with an affinity for mucosal-associated lymphoid tissues of various types.

The present invention provides a substantial improvement in efficacy and safety of any HIV vaccine candidate or SIV model vaccine by the elimination of enhancing epitopes. The effect of enhancement on neutralizing titers of patient sera has been reported (3) ,

and the capacity of serum from patients infected with HIV to neutralize HIV is clearly inhibited by complement and antibody. Thus, it appears that neutralization is an important element in protective immune responses to pathogenic viruses. Any element of a vaccine which can negatively effect neutralization responses should be avoided if possible. The previous identification of the abrogation of neutralization and the dependence on the alternative complement pathway (3) , as well as. the role of complement receptor 2 (CR2) in facilitating HIV infection by increased adhesion to the target cell (35) , has been most recently verified by Lund et al . (120) with the development of a mathematical model that defines the interactions of the major components of the process.

ADMINISTRATION

In the method of inducing a mucosal immune response by direct application to the cells of the mucosa, the antigen- encoding DNA (encoding gpl60 HIV mutants described herein) in complex with a cationic lipid is delivered to the mucosa of the subject. The administration can be directly to the mucosa, including nasal, oral, rectal and vaginal mucosa. Nasal administration can be by nasal lavage spray (see Examples) or nebulizer among well practiced methods. Rectal, vaginal, vulvar or perineal administration can be by a variety of methods, including, but not limited to, lavage (douches, enemas, etc.) , contraceptive formulation, suppositories, lubricants, creams and gels.

Systemic administration can also be used to elicit specific immune responses in the mucosa of the subject. Particularly effective is intramuscular injection of vitamin D3 with the DNA and other components of the vaccine formula as described in detail in the Examples .

Depending on the intended mode of administration, the compounds of the present invention can be in pharmaceutical

compositions in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, suspensions, lotions, creams, gels, foams, or the like, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions can include, as noted above, an effective amount of the DNA and, in addition, may include other pharmaceutically acceptable medicinal agents, pharmaceutical agents, carriers, adjuvants, diluents, etc. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with the antigen-encoding DNA without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

For oral administration, large doses of complexed DNA with vitamin D3 can be given. The form of the composition can be fine powders or granules, and the composition may contain diluting, dispersing, and/or .surface active agents. The composition- may be presented in solution in water or in a syrup, or in a nonaqueous solution or suspension wherein suspending agents may be included, or in capsules, sachets or tablets wherein binders and lubricants may be included. Where desirable or necessary, flavoring, preserving, suspending, thickening, or emulsifying agents may be included. Tablets and granules are preferred oral administration forms, and these may be coated. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art for example, see Remington ' s Pharmaceu tical Sciences (Martin, E.W. (ed.) , latest edition Mack Publishing Co. , Easton, PA.) .

In one example of the present method, the DNA is complexed to a cationic lipid and is administered to the subject as a single primary vaccination, and may be

followed by one or more booster vaccinations at three-week to three-month intervals. The booster vaccination can be by the same or by a different mode as the primary vaccination. For example, a primary intramuscular administration with activated vitamin D3 can be followed by mucosal administration of the booster with or without vitamin D3. Optimization of the primary/booster administration regimen can be made using widely known and routine optimization procedures, and additional protocols will be apparent from the Examples.

The exact amount of DNA required can vary from subject to subject, depending on the age, weight and general condition of the subject, the particular formulation used, its mode of administration, and the like. Thus, it is not possible to specify an exact amount. However, an effective amount may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. Thus, the amount of DNA administered can be any effective amount. There is no reason to expect more than minor differences in a human immunizing dose versus mouse dose, as there is no reason to expect that human cells are more or less susceptible to transfection than mouse cells. Typically, the preferred amount of DNA required ior effective transfection is from about 10 ng to 10 μg. Variations in the transfection efficiency between humans and mice can be accommodated by routine adjustments in the dosage. For example, the amount can range from 1.0 ng to 1 mg,- however, doses over 10 μg DNA become logistically difficult to handle and increase the risk of toxicity and. The amount of 1,25 (OH) D3 typically will range from 10 ng to 10 μg and administered IM with the cationic lipid/DNA comple .

The molecular model derived by molecular dynamics is consistent with the experimental observations herein. The primary immunodominant region of gp41, which contains the

principle enhancing domain, has a single disulfide loop which has been implicated as the site of noncovalent association of the SU and TM proteins of all retroviruses (139) . Each retrovirus has a unique fit between the TM disulfide loop and the C-terminus of SU. Mutations in C5 of gpl20 inhibit association of gpl20 with gp41. The model described herein is in agreement, in that the disulfide loop on gp41 binds to a pocket of the carboxyl terminus of gpl20 (Figure 6B) , with a reduction in ΔEi of the complex. This region is surrounded by N-glycosyl structures which may serve as sites for the covalent attachment of the C3d,g peptide required of C'-ADE. The second immunodominant domain lies directly adjacent to the single disulfide loop. Since one enhancing huMAb has been described for this region, the accessibility of the carbohydrate residues for C3d,g derivatization is consistent with this antigenic participation in C'-ADE.

The following Examples are offered for the purpose of illustrating the present invention and are not to be construed to limit the scope of this invention. The teachings of all references cited herein are hereby incorporated herein by reference .

EXAMPLES INDUCTION OF ENHANCING ANTIBODIES

The hypothesis that a substantial improvement can be made in the efficacy and safety of any HIV vaccine candidate or SIV model vaccine by the elimination of enhancing epitopes can be confirmed by an animal model in which antibodies to the principal enhancing domain decrease the known protective effect of a vaccine. The first demonstration of this effect was that an SIV.. _ac2;; .. peptide (residues 603-622) homologous to the primary enhancing domain of HIV could induce within 4 weeks a dramatic C -ADE titer response in SIV-positive rhesus macaques without a

parallel increase in SIV ELISA titers or against an immunogenic p27 peptide from SIV. With this information that this SIV-enhancing domain peptide could induce a significant amnestic enhancing response, rhesus macaques were immunized in two initial groups. One group received vaccinia virus expressing gpl60 (W rgpl60) , and a second group received wild type vaccinia virus (WWT) . Immunization with W rgpl60 followed by a subunit rgpl60 boost mounted potent immune responses that protected Macaca fascicularis from subsequent SIVmne challenge (121) . In this study, animals receiving W rgpl60 were boosted with the enhancing peptide or a p27 peptide (control) , while the WWT control was boosted with the enhancing peptide. Two weeks following the peptide boost, each animal received 10 animal ID ₅₀ doses of SIV _raac251 .

The group immunized with W rgpl60/peptide 603-622 demonstrated a clinical course consistent with disease enhancement (mean time to death in the test group was 246 days compared to > 407 days in the 2 control groups) . Using a log rank test, the P value between the groups was < 0.05. Moreover, there was a strong correlation between the presence of antibodies against amino acids 603-622 at. challenge, and persistent detectable p27 antigen at 2 weeks post-SIV challenge, suggesting increased viral load in the W rgpl60/amino acid 603-622 group. There was a clear correlation between immunization with the enhancing peptide, antibody titers against amino acids 603-622, enhancing titer, persistent viremia at 2 weeks post-SIV challenge, and early death. This study further demonstrates that ADE can overwhelm weak protective effects of a recombinant vaccinia virus against SIV _mac challenge. Although statistical power was low due to the small number of animals (n = 8) , the adverse effects of enhancing antibodies on disease progression (p < 0. 05 ) were demonstrated.

gpl60 MUTANTS

The principle enhancing domain of HIV and SIV occurs in a highly conserved region of gp41. Based on moleculai modeling studies, the reasons for this conservation of ammo acid sequence is due to essential docking interactions (i.e., association) between gpl20 and gp41 following proteolytic cleavage of gpl60. The primary docking site for gp41 is the disulfide loop at ammo acids 561-567 (HIV-l consensus sequence numbering) . Thus, the invention provides a series of mutations in the enhancing domain that is consistent with this observation and which block binding of human mAb to the enhancement region Moreover, the data shows that a single conservative mutation at tryptophan 596 to tyrosme can block binding of the four existent human enhancing monoclonal antibodies (mAbs) without effecting binding of gpl20 to gp41, while all other mutations in the loop or immediately C-termmal to the second loop cysteine inhibit gpl20 association with gp41. Figure 3 illustrates the point and deletion mutations which have been made with comparison to the SIV consensus sequence (see Experimental Methodology for details of mutagenesis) . Each mutant was verified by DNA sequence analysis, and all vector transfers weie verified for accuracy by DNA sequence analysis. Two mframe deletions were made. A five ammo acid deletion beginning at the second cysteine by leaving the disulfide loop sequence intact, and a thirteen ammo acid deletion that contained the original 5 ammo acid deletion plus the disulfide loop residues These are referred to as Ml and M2 mutants, respectively Two point mutations were also made on either side of the disulfide loop The first is a conservative tryptophan to tyrosine mutat LOΠ at ammo acid 596 (W/Y 596, previously referred to as W/Y 559) The second involves the first threonine adjacent to the second cysteine residue in a threonine to alanine mutation (T/A

605; previously referred to as T/A 568) . Two point mutations were made within the disulfide loop. The first was a serine to alanine mutation (S/A 599; previously referred to as S/A 562) , and the second was a lysme to alanine mutation (K/A 601; previously referred to as K/A 564) . A conservative tryptophan to tyrosine mutation was made outside the enhancing domain at residue 614 (W/Y 614; previously referred to as W/Y 576) .

Analysis of the functional effects of these DNA- sequence-verified mutations was achieved by two independent methods. Each uses humAbs that enhance HIV infection. In the first, mAb 50-69 was used m a histochemical probe of gpl60 wild type and mutant expression in COS cells The second utilized a panel of four enhancing human mAb to evaluate binding to wild type and mutant HIV envelope expressed m E . coli and used in an ELISA format Monoclonal antibodies used herein (50-69, 240D, 246D, gp4I mAb 86, and V3 loop mAb 5F7) can be obtained from the AIDS Research and Reference Reagent Program Each mutant gpl60 and the wild type gpl60 was placed in a eukaryotic expression vector under the control of the CMV early promoter gene (this is the same vector used for genetic immunization) Each mutant and wild type was transfected into COS cells using dioctyglycylspermme (DOGS) facilitated transfection m vi tro and analyzed on day 2 for expression of the HIV envelope sequence. Detection of expression was provided by histocr.em cal analysis of polyclonal HIVIG and the human mAb 50-69. The latter was chosen because of its dependence on oxidation of the disulfide bond of the enhancing domain as well as its uncertain epitope identification Histochemical visualization was provided by a anti-human IgG tagged with biot followed by strepavιdm-0-galactosιdase and deposition of insoluble product at the site of binding. The use of β-galactosidase minimizes the problem of

endogenous tissue enzyme activity due to the vast differences in the optimal pH of reaction for mammalian (pH 2.5) and bacterial (pH 7.0) enzyme. The results are summarized in Table 1. Binding of HIVIG was demonstrated in all transfectants but was absent in vector transfected COS cells as well as in naive COS cells (Table 1) . The deletions Ml and M2 failed to bind enhancing humAb 50-69. Similarly, point mutations W/Y 596 and T/A 605 failed to bind mAb 50-69. Conversely, point mutants K/A 601, S/A 599 and W/Y 614 expressed in COS cells bound mAb 50-69 in a manner aualitatively similar to that seen for wild type gpl60.

Table 1: Binding inhibition of human mAb 50-69 which mediates C -ADE by deletion and point mutations within the primary enhancing domain of gpl60 of HIV-l expressed in transfected COS cells.

The second method of analysis used recombinant wild type and mutant env polyprotein produced in E. col i and carrying a polyhistidine amino terminal sequence for isolation by Ni-chelate chromatography and a solubility sequence which can be eliminated by enterokmase hydrolysis if desired. The wild type and mutant gpl60 sequences with the common solubility sequence were plated on Immunlon 4 plates at 200 ng per well and used in standard ELISA format (see Experimental Methodology) . Using HIVIG detection the

mutant gpl60 sequences were indistinguishable from the mutant gpl60 sequences (not shown) . Each human enhancing mAb bound to wild type but failed to bind to gpl60 mutants carrying deletions or the W/Y 596 or T/A 605 point mutations (Figure 4) . The S/A 599 immediately adjacent to the C-terminal side of the first cysteine of the disulfide loop bound all four human enhancing mAbs approximately 5- 20% that of wild type. Since mAb 50-60 binds to this mutant quiet well in the histochemical assay, the reasons for the partial loss of binding is unclear. It could be a function of conformational changes in the ELISA format that inhibit binding. Alternatively, since the histochemical assay is a qualitative assay, a partial, although a major decrease, loss of binding affinity cannot be detected. Since the partial loss of binding is seen in mAb 240D and 246D whose known epitope does not include the disulfide loop (132) , the mechanism is most likely due to conformational effects induced by the ELISA format.

Table 2 summarizes the known epitope sequence data for four human enhancing mAb and the effect of a W/Y 596 mutation on binding. It is reasonable to extrapolate from this data that HIV vaccines utilizing this HIV envelope mutation, although immunogenic, will not arm the immune system for an amnestic immune response that can mediate C - ADE on subsequent exposure to HIV. Moreover, the demonstration of binding of the V3 mmAb 5F7 (Table 1) provides proof of the retention of gpl20 association with gp41 following gpl60 cleavage. Figure 5 illustrates the common W596 element in the primary enhancing domain for HIV.

Table 2. Summary of Epitopes for Human Enhancing Antibodies

¹ C-C indicates epitope includes disulfide bond but not ammo acids of the secondary disulfide loop formed by the disulfide bond

MUTANT HIV

By directional cloning, wild type (wt) gpl60 of pNL4-3 has been replaced with four of the mutants described herein within the ADE domain. pNL4-3 and each envelope notation within a plasmid vector was doubly digested with Sail and BamHI restriction endonucleases . PNL4-3 yielded a 9kb fiagmenf and each mutant yielded a 2 7 ab fragment The 9kb and 2 7 kb fragments were purified m agarose . Each 2.7 kb fragment was directionally cloned into the _ kb PNL4-3 derivative and ligated with T4 DNA ligase The derivative infectious DNA was propagated m E . col - , and used to transfect MT-2 cells using the cationic lipid, dioctylclycylsperm e (DOGS) to establish infection which is then self-propagating . These consist of the 13 ammo acid deletion mutation (M2) , the W/Y 596, the T/A 605, and K/A 601 point mutations Transfection of MT-2 cel_s with wild type and the W/Y 596 mutant yielded infectious HIV with approximately equivalent infectious titers The M2 ,

T/A 605, and K/A 601 mutants failed to yield infectious virus. This is in agreement with molecular modeling studies. From these studies, it was predicted that mutations in the gp41 disulfide bonded loop would be incompatible with infectious virus, since this appears to be the major docking site of gp41 with gpl20. The T/A 605 mutation destroys a hydrogen bond with gpl20 which would decrease the binding affinity in the relatively unstable association of the wild type. The W/Y 596 mutation, however, is a conservative mutation that does not alter the chain conformation of gp41 or a hydrophobic bonding interaction with gpl20. Infectious HIV has now been sequenced, and the W/Y 596 mutation has been confirmed. No HIV reported to date carries a W/Y mutation in this highly conserved region of the viral envelope. The availability of this mutant HIV bearing a point mutation that blocks binding of all known human enhancing mAb available for testing provides a valuable tool to demonstrate that the mutation has not altered function and presumably neutralizing antigenic sites. Other mutations can be made and tested in this manner to establish their efficacy as genetic immunogens or recombinant antigen im unogens .

FAILURE OF MUTANTS TO INDUCE ENHANCING ANTIBODIES Human mAb derived from patients with AIDS reflect the in vivo immune repertoire to natural infection with HIV. There are six known human mAb that mediate C' -ADE. Of these, five bind to the primary enhancing domain in gp41. Four of the five are available for analysis, and the binding of these four to gpl60 is blocked by mutations that delete a sequence containing tryptophan 596. Similarly, a conservative point mutation to tyrosine at this position blocks binding of each of the four human mAb that mediate enhancement in a functional assay. The clustering of most of the human mAb that mediate enhancement to a single

limited domain on gp41 suggests that the capacity to induce enhancing antibodies is limited largely to this constant region of gp41. Thus, mutations in the principal C' -ADE domain which block binding of enhancing human mAbs reciprocally are expected to be incompetent to induce significant levels of enhancing antibodies. This allows retention of gp41 sequences which have been shown to be important in group specific neutralization of primary isolates in addition to the previously recognized importance of the CD4 binding region of gpl20 (132) .

MODEL OF THE PRINCIPLE ENHANCING DOMAIN

GP41 Conformation: A stable, low-energy, nonglycosylated structure was obtained after 400 psec . of molecular dynamics calculations . Analysis of the model revealed separate domains for the extracellular (512-677) , transmembrane (678-705) , and intracellular (706-856) domains predicted for the TM protein. Three known immunogenic sites (1) , including the gρ41 primary immunodominant region (593-604) , the gp41 second immunodominant region (609-625) , and the gp41 post membrane span (728-745) , which contains a neutralization epitope, were all exposed on the surface of the gp41 model. Tne primary immunodominant region containing the principle enhancing domain (7) lies immediately adjacent to a second immunodominant domain which contains a minor enhancing domain (8) . Both domains are enclosed by glycosyl residues one or more of which likely serve as covalent attachment sites for the C3d,g peptide which must bind to CR2 for mediation of C -ADE (34) . Since the alternate C pathway is implicated as the primary mediator (3) , attachment to a glycosyl residue is likely. Figure 6A illustrates the topographic relationship between these structural and functional landmarks of gp41 and the N-terminal fusogenic peptide.

GP120/41 Association: Figure 6B is a representation of the solvent accessible surface of gp41. The disulfide loop forms a surface knob which fits a ring receptor region of the carboxyl terminus of gpl20 represented m the figure by peptide backbone and Cor residues. Optimal noncovalent contacts are made so that there is a reduction in the internal free energy of the complex versus the sum of the free energy of the components of the complex. Figures 6C and 6D demonstrate several side-cham: side-chain interactions either within the gp41 immunodominant region from K588 to T606 or between this region and the C5 domain of gpl20 (residues 484-499) which serve to explain and correlate the mutagenesis results presented above The lack of an effect on the binding gp41 to gpl20 resulting from the mutagenesis of the aromatic residues W596 to Y596 correlates with the base stacking interactions observed in the model between gp41 residue W596 (red and Y486 (green) located on gpl20 (Figure 6D) The three mutations, at residues S599, K601, and T605 of gp41, which inhibited the binding of gp41 to gpl20, each involved mutation of the wildtype residue to alanine. The present model suggests that the hydroxyl group of S599 (gp41) is withm hydrogen bonding distance of the guanid e group of R503 located on gpl20 (not shown) . Inhibition of gp41 binding to gpl20 resulting from mutagenesis of S599 to A599, suggests that this hydrogen bond is important for the binding interaction. As can be seen in Figure 6C, the single disulfide loop of gp41 formed from residues 598-604 (yellow) directly interacts with the C5 domain (cyan) of gpl20 with no alteration induced by the W/Y 596 mutation Within the constraints of this molecular model, the structure of this disulfide loop, and therefore the binding interaction between gp41 and gpl20, appears to be stabilized by a network of hydrogen bonds connecting the e- ammo group of K601 with the hydroxyl group of T605 through

hydrogen bonds involving the guanidine and carboxylate groups of gpl20 residues R122 and E123, respectively. Disruption of this network through mutagenesis results in an inhibition of association between gpl20 and gp4l. Using wild type and mutant gpl60 DNA constructs described herein under a CMV early promoter, rabbits, guinea pigs and primates will be immunized by genetic immunization. The dose of genetic immunogen should be similar to that used previously in mice, although each species will be screened for dose response prior to final dose selection. The neutralization and enhancement titers will be quantitated by standard procedures, and responses in individual animals will be compared between wild type and mutants lacking enhancement epitopes. The focus of attention will be on the W/Y 596 mutation since it is part of the binding epitope of all four human mAb which mediate enhancement. The IgG, IgM, and IgA responses to gpl20 and gp41 will also be quantitated in an ELISA format. The inability of infectious rNL4-3 HIV with mutations in the common enhancement epitope to support enhancement mediated by human enhancing mAbs, patient serum, or HIVIG will also be analyzed.

It is expected that animals immunized IM with the wild type genetic immunogen will produce a vigorous immune response with both neutralization and enhancement functional activity. It is further expected that either deletion mutation (Ml or M2) or the W/Y 596 mutation will yield immune responses devoid of enhancing activity. Since it is believed that the disulfide loop of the enhancing domain is involved in gpl20 binding to gp41, its elimination could affect neutralization responses; this is routinely determined. Preliminary studies suggest that the W/Y 596 mutation does not affect this binding function. It is expected that the W/Y596 mutation in rNL4-3 will be infectious and not subject to enhanced mutations by either

hu an m/Abs, individual enhancing serum from patients, or by HIVIG.

COMPARISON OF GENETIC IMMUNOGEN AND RECOMBINANT ANTIGEN Genetic immunogens (129) are believed to present antigen in a manner resembling natural infection while rgpl60 requires adjuvant and the antigen may not reflect conformation found in the native pathogen. Direct comparisons of the two using a common immunogen lacking enhancing epitope will be instructive with regard to the quality and quantity of the immune response, as well as the ease of immunogen manufacture and administration.

Based on positive results from the study of induction of enhancing antibodies, a single genetic immunogen lacking enhancement induction will be selected and responses to direct genetic immunization will be compared versus rgpl60 produced in COS cells transfected with the same vector. Since the transfection response is vigorous in COS cells and has been used in the production of pseudovirions of HIV (131) , good production of rgpl60 is expected. Stable transfectants will be established by co-transfection with the genetic immunogen plus a neomycin selection plasmid using a 10:1 ratio of genetic immunogen to the neomycin selection plasmid. Cloning of COS cells selected in neomycin and producing gpl60 will allow a stable source of protein immunogen. rgpl60 will be isolated from culture media by affinity chromatography using gpl60 specific Abs as ligand.

It is expected that each immunogen will induce a vigorous immune response. The genetic immunogen, however, is easier to produce, and it is anticipated that the genetic immunogen will prove superior in all aspects. The presence of the membrane anchor in one pCMV-160 env constructs may result in low yields of gpl60. If this proves to be the case, the affinity for the plasma membrane

will be destroyed by site-directed mutagenesis. Similarly, it may be necessary to remove the gpl20/gp4l proteolysis site.

INDUCTION OF ANTIBODIES IN PRIMARY ISOLATES VERSUS ACTIVATED PBMC

It is well recognized that it is more difficult to neutralize HIV-l infectivity with antibody in activated human PBMC than in continuous cell culture. The use of PBMC assay has now become the standard in evaluating neutralizing responses to HIV-l vaccines. Zolla-Pazner and Sharpe (72) have suggested using non-activated PBMCs as target for HIV-l infection and antibody neutralization. The genetic immunogen lacking enhancing induction capacity to neutralize primary isolates of HIV-l will be evaluated in both lectin activated and non-activated human PBMCS. Standard culture conditions and primary isolates obtained from the WHO via the NIH AIDS Reference Reagent Program will be utilized. Viruses from all available classes will also be utilized. Evaluation at day 7 will be by p24 antigen or RT levels in culture media.

It is expected that the non-activated PBMC assay will be more sensitive than lectin activated PBMC assay. The demonstration of neutralizing activity against clade B primary isolates and against a broad range of classes is also anticipated.

MUCOSAL IMMUNE RESPONSES

Genetic immunogens administered with l,25(OH) ₂ D3 induce not only systemic immune responses but a common mucosal response as well. Since the vast majority of HIV is transmitted via mucosal surfaces, it is reasonable to believe that protective responses at the level of the mucosa are particularly valuable.

To determine the capacity of HIV immunogens lacking the enhancing epitope to induce mucosal responses by hormonal immunomodulation, animals will be immunized as previously detailed (U.S. Serial No. 08/544,575) with inclusion of l,25(OH) ₂ D3 (obtained from Hoffman-LaRoche, Nutley, NJ) in the immunization cocktail. Parotid secretions obtained at Stenson's duct under piiocarpine stimulation of anesthetized animals will be analyzed for IgA and IgG titers as well as neutralization and enhancing functional activities. Similarly, rectal and vaginal secretions will be collected on Polytronics absorption wicks placed in the rectum and vagina for five minutes and subsequently eluted for analysis.

A common mucosal response to antigen using the secosteroid immunomodulator l,25(OH) ₂ D3 is expected. Relative high levels of IgA to IgG will indicate a secretary IgA response.

SHIV MODEL With results that demonstrate good neutralization response to primary isolates in primates with one or more of the described mutant constructs lacking enhancement induction epitopes, efficacy experiments will be conducted in a SHIV model system. The ability to infect non-human primates with a laboratory construct consisting of a SIV core and a HIV envelope provides a direct model for efficacy in humans. Previous SHIV constructs, although infectious in non-human primates, did not cause disease. More recently, SHIV constructs which cause rapid CD4 loss in infected cynomologous monkeys have been made. This SHIV infection/ disease model system appears to be ideal in the evaluation of efficacy of envelope based vaccines. With the successful production of immunogens lacking enhancing epitopes an efficacy trial in non-human primates will be used to confirm these results in a primate model.

EXPERIMENTAL METHODOLOGY a) Genetic Immunization Dioctadecyla idoglycylspermine (DOGS) obtained from

Promega as Transfectam ^® is solubilized in 100% ethanol and complexed to vector DNA in H ₂ 0 at a 5:1 molar cationic charge excess and diluted in Tris-saline to the immunization dose based on DNA concentration and administered immediately following formulation. Ten to 0. 1 μg DNA in 100 μl is administered intramuscularly to Balb/c mice of six weeks or six months age. Mucosal responses are obtained by inclusion of 1 μg l,25.(OH) ₂ D3 in the vaccine preparation. Animals are randomized into groups of five. Preimmunization blood is obtained by retroorbital bleeding. Parotid secretions are obtained under anesthesia (ketamine/+xylazine) and pilocarpine stimulation. As many as two boosters will be administered every two to four weeks following primary vaccination. Similar protocols will be followed for guinea pigs, rabbits, and non-human primates. DNA dosage can be varied depending on species response compared to mouse.

b) rgpl60 Immunization

Culture media of COS cells transfected with wild type or mutant gpl60 with will be harvested for rgpl60 and purified by anti-HIV Ab chromatography with salt elution. Primary immunization IM will use 25 μg in rabbits and guinea pigs, 100 μg in nonhuman primates, and 10 μg in mice with alum adjuvant. l,25(OH) ₂ D3 will be evaluated for the induction of mucosal responses. In order to increase gpl60 secretion and stability into culture media, it may be necessary to mutagenize the gp4l membrane anchor and the gpl20/gp41 proteolysis site, respectively.

c) Site-Directed Mutagenesis

The Altered Sites'" method was for the introduction of mutations at specific sites on gpl60. A Sall/EchoRI agarose purified restriction fragment of pHenv (135) containing the HIV _NL4 . ₃ envelope sequence was cloned into the p-A ter vector. This vector contains a mutant ampicillin resistance gene and a tetracycline resistance gene for selection during multiple rounds of additive mutagenesis. JM109 E . coli transformed with p-Alter _H1Venv were induced to produce single strand (ss) DNA using helper phage DNA. Three mutational primers were hybridized at room temperature to the ssDNA (ampicillin resistance repair primer, tetracyline resistance inactivation primer, and a mutational primer of the gene under analysis) . The hybridized DNA is filled in with T7 polymerase and mutant repair E . coli (MutS-Blue, Promega, Madison, Wisconsin) used for transformation and mutagenized plasmid recovery on antibiotic selection plates.

The critical factors concern the purity of phage DNA and the use of MutS-Blue E. col i lacking all DNA repair systems. The reverse sequence will be used to construct infectious HIV from cloned rHIV _{NL4 3} . The altered site vector containing sequence verified mutation at an enhancing site will be cut with Sall/EchoRI and directionally cloned into agarose purified and linearized pNL4-3. Transfection into HeLa allows expression of mutated virus which can be used in standard enhancement infection assays on MT2 cells.

d) Mutant Protein Expression in E . col i

The pET ^® expression system was used to produce wild type and mutant gpl60s. Wild type and mutant gpl60 DNAs were produced with PCR (Vent polymerase) using NCOI and NOTI extensions for directional cloning into the 32a plasmid which expresses a polyhistidine and solubility

peptide upstream to the cloned sequence. E. coli strain AD494 was used for expression with cellular lysis provided by a French Pressure Cell at 1200 pounds per square inch on the cellular pellet. The lysate was affinity purified on a Ni ligand column. Elution was provided with 1 M imidazole .

e) COS Cell Transfection

Wildtype and mutant gpl60s were directionally PCR cloned from their respective p-Alterl vectors using Vent ^® polymerase into pCMV-Blue at Notl/Mlul in the vector MCS using NotI and Mlul extension primers. Agarose-purified dsDNA containing the new restriction sites were double cut with NotI and Mlul and ligated to the homologous double digested MCS of pCMV-Blue. Wildtype and mutant gpl60s under control of the CMV promoter were produced in transformed JM109, purified with Wizard ^® DNA isolation columns and used for transfection of COS cells using Transfectam ^® at a 5:1 charge ratio to facilitate transfection. Binding of enhancing huMAb 50-69 to COS cells was analyzed on day 2 following transfection by linked immunoassay using -galactosidase. COS cells on glass slides were blocked with PBS/BSA at room temperature for 1 hour, washed 3 times with PBS, incubated with 1:100 dilution of enhancing human mAb 50-69 for 1 hour at room temperature, washed 3 times with PBS, and incubated with an anti-human IgG mAb conjugated with biotin for 1 hour at room temperature. Following washing in PBS (x3) , binding site-specific color was developed with incubation with substrate for strepavidin//3-galactosidase, and further washing with PBS (x3) , control demonstration of expression in each transfectant was provided by HIVIG binding to gpl60. The demonstration of retention of gpl20 binding to gp41 was provided by the V3 mAb 5F7 (136) .

f ) PCR Primers

1) Mutagenic primers for gpl60 (complementary strand) -

M1(Δ5) : CCAACTAGCA TTCCAGCAAA TGAGTTTTCC (SEQ ID NO: 1)

M2(Δ13) : CCAACTAGCA TTCCACCAAA TCCCCAGGAG (SEQ ID K : 2)

W/Y 596: GTTTTCCAGA GCAACCGTAA ATCCCCAGGA GCTG t _. SEQ ID NO: 3) S/A 599: GCAAATGAGT TTTCCAGCGC AACCCCAAAT CCC (SEQ ID NO: 4)

K/A 601: GCAGTGGTGC AAATGAGTGC TCCAGAGCAA CCCC ..SEQ ID NO: 5)

T/A 605: CCAAGGCACA GCAGTGGCGC AAATGAGTTT TCC SΞQ ID NO: 6)

W/Y 614: ACTCCAACTA GCATTATAAG GCACAGCAGT GGT (SEQ ID NO: 7)

2) Introduction of unique restriction sites- NOTI (coding strand) : GGGGATATCG CGGCCGCATG AGAGTGAAGG

AGAAGTATCA GC (SEQ ID NO: 8) MLUI (complementary strand) : AAGCGTTAAC ACGCGTTTAT AGCAAAATCC TTTCCAAGCC C (SEQ ID NO: 9)

NCOI (coding Strand) : TCTGCCATGG CTACAGAAAA ATTGTGGGTC ACAGTC (SEQ ID NO: 10)

NOTI (complementary strand) : GGGGATATCG CGGCCGCTCA TAGCAAAATC CTTTCCAAGC CC (SEQ ID NO: 11)

g) Systemic Antibody Analysis 1) Ig Titers: Serum titers of antibodies against tne env proteins of HIV-l are quantitated with an ELISA procedure using baculovirus derived rgpl60 as the plate immobilized ligand. Ten ng rgpl60 (AMAC, Inc.) in 5G [tl coating buffer (0. 1 M Na carbonate, pH 9.5) . is immobilized on each well of a 96 well Immulon 4 micrciiter

plate for hour at 37°C. The plate is washed with PBS-0. 15% Tween20 x3 and is then blocked with PBS-L% BSA-0.15% Tween20 at 300 μl per well for 1 hour at RT and then washed x3 with PBS-0.15% Tween20. Serum or mucosal secretions are serially diluted in PBS in triplicate in a separate plate and 50 RI of each well transferred to corresponding wells of a gpl60 ligand plate and the following sequence is followed. Incubate at 37°C for 1 hour using a parafilm cover. Wash with PBS-L% FCS-0.05% NaN ₃ x5. Incubate each well with a predetermined dilution of biotin conjugated anti-mouse IgG, IgA, or IgM. Incubate at 37°C for 1 hour with cover. Wash with PBS-L% FCS-0.05% NaN ₃ x5. Follow with 50 μl strepavidin-alkaline phosphatase conjugate (1:200 in PBS-I% BSA-0.15% Tween20) for 1 hr at 37°C with cover. Wash x5 with PBS-I% FCSO.05% NaN ₃ . Color is developed with p-nitrophenyl phosphate in glycine buffer at pH 9.6. The color yield is measured on a Flow microliter calorimeter using a 405 nm filter. Background is routinely < 0.23 with a reproducibility < ± 0.005) . End point titer is the highest dilution of serum or secretion yielding a color yield _> 150 over background (n = 3) .

2) Western blot: Western blots are prepared by SDS- PAGE of HIV- _1IIB infected H9 cell lysates with transfer to nitrocellulose achieved with a four-day passive diffusion transfer. Albumin blocked strips are prepared from nitrocellulose sheets and incubated 1 hour with 200 [tl of a 1:40 dilution of mouse serum. Detection is achieved with an alkaline phosphatase conjugated anti-mouse antibody and developed with 5-bromo4-chloro-3 ' -indolyphosphate p- toluidine/nitro-blue tetrazolium chloride (BCIP/NBT, Pierce Chemical Company) . HIVIG obtained from Fred Prince at the New York Blood Center is used as a positive control with an anti-human alkaline phosphatase detection system.

3) Radioimmunoprecipitation analysis (RIPA) : H9/IIIB or U937/IIIB cells are labeled with ³⁵ S-cysteine in a cysteine-free medium for 4 hours at 1 mCi/ml containing 1 x 106 cells. The cells are washed x3 in PBS lysed in RIPA buffer (see 4a above) . The goal is to achieve 20 x 10 ^c cpm with 2 x 10 ⁵ cpm/μl. Sera to be tested are incubated with 100 ml of a diluted Protein A agarose (or Protein A/rabbit anti-mouse IgA complex for IgA RIPA) for 1 hour at 4°C. Lysate is added at an equivalence of 0.5 to 1 x 10 ⁶ cells. The serum antibodies and lysate antigens are incubated overnight at 4°C, washed in RIPA wash buffer (i.e. , RIPA lysis buffer minus deoxycholate and phenyl methylsulfonyl fluoride) . The immune complex-Protein A beads are centrifuged at lOOOg, washed x3 with 4 ml RIPA wash buffer, denatured at 100°C for 2 minutes and run on SDS- PAGE in 10% resolving gels. After electrophoresis the gel is fixed in 30% methanol, 10% acetic acid, 60 ddH ₂ 0 or equivalent and radioactive bands visualized with a Molecular Dynamics Phospholmager .

4) Neutralization/Enhancing Assays

(i) Standard Microliter Neutralization Assay: Neutralizing antibody activities are measured in microliter infection assays as originally described from this lab (185) . Briefly, heat-inactivated (60°C, 30 minutes) serum samples are two-fold serially diluted in triplicate into RPMI 1640 growth medium containing 12% FCS . Virus is added (5-10xl0 ⁵ infectious units) and incubated at 37°C for one hour. Next, 2-5 x 10 ⁵ MT-2 cells in 100 μl of growth media is added to each well and the plates incubated for 2-3 days at 37°C in 5% C0 _? /95% air. Cells are monitored by phase contrast microscopy for syncytia formation and assayed when virus control wells (no mouse serum) show extensive cytopathic effect. This usually is at 3 1/2 days when MOI≥l is used. Cells are transferred to poly-L-lysine

coated plates and incubated with Finter's neutral red dye for 1 hr. Adherent cells are washed with phosphate- buffered saline (PBS) and vital dye liberated with acid alcohol. Plates will be analyzed on a Flow Titertek icrocolorimeter at 540 nm for viable cells. Viability is determined relative to the cell control wells (n = 4) . Neutralizing titer is defined as the highest dilution yielding ≥50% cell viability compared to cell control, (ii) Enhancing Assay: This is a modification of a neutralizing assay in which cell cytotoxicity is measured as a function of serum dilution that occurs prior to virus control lysis. Endpoint dilution is that dilution which yields lysis 1 SD > control lysis.

(iii) Primary Isolate Neutralization: The gold standard for neutralization is the ability to neutralize the ability of a panel of primary isolates to infect human PBMC. The latter are freshly isolated on Hypaque-Ficol . 5 x 10 ^β cells in 10 μl of undiluted primary isolate HIV (i.e. , always propagated on PBMCS) are incubated in triplicate in serial 5 fold dilutions of mouse serum for 1 hour at 4°C and then added to 1 ml RPMl/12% FCS containing biological derived IL2. Supernatants at 7 days are assayed for RT and/or p24 levels versus control cultures. The highest dilution to yield > _. 50% inhibition is reported as the neutralization titer. Lectin stimulated versus non- stimulated PBMCs will be directly compared for neutralization sensitivity.

h) Mucosal Antibody Analysis 1) Parotid secretion IgA/IgG titers-. Titers will be monitored weekly for short term immunization schedules and monthly on long term schedules. Parotid secretion in anesthetized (IM ketamine/xylazine) Balb/c mice will be induced with pilocarpine (20 μg/mouse) and saliva collected on specified days with a 100 μl capillary tube. Analysis

of 5 fold serial dilutions are determined by an ELISA described under 4a above using anti-mouse IgA or IgG antibodies conjugated with biotin.

2) Analysis of jejunal, colonic, and uterine/vaginal secretions for IgA/lgG: Secretions are collected on

Polyfiltronics absorbent wick filters as described recently by the Neutra lab (188) . IgA and IgGs are eluted from the wicks and assayed by ELISA procedure .

3) Immununocytochemistry: rgpl60 conjugated with biotin (A AC, Inc) was used as a specific probe for tissue bound antibodies/receptors generated by genetic immunization procedures. The procedure can be used for either frozen or formalin fixed tissues. Thin sections are incubated with 250 μl of the biotinylated 1igand (10 ng/ml) for 1/2 hour at RT, washed x2 with PBS. 250 μl of strepavidin-jS galactosidase (Kirkegaard & Perry Labs) in 100 mM Tris, pH 7.4 is applied to the section for 1/2 hour at RT, washed x2 with PBS. Color is developed at pH 7.6 using X-Gal (5-bromo-4-chloro-3 indoyl -β) -galactopyranoside as substrate (Histomark kit from K&P Labs) which yields an azure blue precipitate at the site of bound enzyme . An adjacent, non-ligand exposed section is typically used as a control for non-specific product deposition as well as sections from a naive animal exposed to ligand.

i) Persistence of Transfected DNAenv in Tissues Primary transfection site tissues will be harvested as a function of time following transfection and aliquots lysed in 1 % Triton X-100, 10 mM Tris, pH 7.0, and 1 mM EDTA, centrifuged at 1000 x g to remove insoluble debris, and the supernatant removed and heated to 100°C for 5 minutes. Analysis for DNAenv will use PCR amplification of the V3-V5 regions using ED5 (5' -ATGGGATCAAAGCCTAAAGCCA TGTG; SEQ ID NO: 12) and ED12 (5'- AGTGCT' FCCTGCTGCTCCCAAGAACCCAAG; SEQ ID NO: 13) primers

which yields a 1200 bp DNA product corresponding to ~ bp 6160-7358. Standard conditions for this gene product in a 50 μl volume is 35 cycles with 1 second ramp times between steps of 94°C for 60 seconds, 55°C for 60 seconds and 72°C for 120 seconds with cycling initiated following a 5-minute incubation at 95°C and wax bead "hot start." The PCR reaction used 0.2 μM of each primer in 50 M KC1, 10 M Tris-HCl (pH 8.3) , 200 μM of each dNTP, 2.5 U Taq DNA polymerase and 1.5 mM MgCl . Two to ten μl of the cell lysate is used as template. Amplified DNA is separated and identified by electrophoresis in 1.2% agarose or 6% polyacryla ide gels run in TBE buffer (88 M Tris-borate, 89 M boric acid, 2 mM EDTA) at 120 volts for 1 hour. DNA bands are identified by ethidium bromide staining and UV light detection. Primer specificity is verified by using pNLA-3 plasmid-derived DNA and total genomic obtained from ACH-2 cells (positive control) .

j) Toxicity of in vivo Transfecting DNA Although the facilitated DNA transfection methods use small amounts of DNA, it is possible that toxicity will occur to DNA, DOGS, or DNA/DOGS complexes. The most likely chronic toxicity is the development of antibodies to DNA. Mice, guinea pigs, rabbits and non-human primates will be monitored for the development of antibodies to plasmid vector DNA using an ELISA format in which DNA is adher.ed to Immunolon plates as previously described for peptide antigens and albumin blocked wells exposed to serum from transfected animals. Antibodies binding to DNA will be detected by anti-mouse (or rat, guinea pig, or rabbit) Ig conjugated to alkaline phosphatase. Quantitation will be based on enzyme yields minus control animal enzyme yields under conditions of substrate excess (i.e., to yield zero order kinetics) . Persistence of vector or its transfer to distant sites will be monitored by PCR (see above) .

Mice will be the primary animal for safety evaluation. Depending on FDA advice, another species will be chosen as a second toxicity testing target. Weights during HIPGV and standard gross and histopathology at the conclusion of the experimental protocol will be conducted on all the mice. In addition PCR amplification for the HIV-envelope immunogens will be performed on lung, spleen, liver, and gonadal tissues. This procedure is well established with reproducible amplification of a 1200 bp sequence. Identification is made by standard agarose electrophoresis and ethidium bromide staining of the amplified DNA plus base-ladder size markers. An FDA approved anti-fos gene therapy Phase I study in metastatic breast carcinoma of Holt can be used as a model .

k) Molecular Dynamics

All computations were performed on either a Silicon Graphics Personal Iris 4D/35 workstation or a Power Series III mainframe. Molecular models were constructed as previously described (137, 138) using the all atom DREIDING II force field and Biograf software (Biosym/Molecular Simulations, San Diego, CA) . Briefly, the modeling procedure included secondary structure prediction, initial model construction based on the predicted secondary structure elements obtained, and construction of appropriate disulfide bonds, followed by an interative process of molecular dynamics calculations and energy minimization until a stable, low energy tertiary structure was obtained. The sequence modeled was that for the BH10 isolate (GenBank accession no. P03375) of the HIV envelope glycoprotein gpl60 which encodes the amino acid sequences for both gpl20 (residues 1-511) and gp4l (residues 512- 856) . The gp41 protein contains a single disulfide bond loop (598-604) and four extracellular glycosylation sites at asparagine residues 611, 616, 625, and 674. The total

amount of elapsed time for molecular dynamics calculations was 400 psec . for constructing the model of gp41. A model of the high mannose core oligosaccharide identical to that used for construction of the gpl20 model (137) was then attached to each of the extracellular glycosylation sites once the low energy, nonglycosylated structure was obtained. The resulting glycosylated model was then refined by further molecular dynamics calculations. Using the docking routine contained within the Biograf program, it was possible to dock the model of gp41 with the previously obtained model of gpl20 by orienting the single disulfide loop (598-604) of gp41 with respect to the C5 region of gpl20 (484-499) . The resulting binary protein complex was then subjected to molecular dynamics calculations (total elapsed time 250 psec.) in order to refine the orientation and interactions between the two proteins, gp41 and gpl20, in the model of the complex.

1) Additional Mutants

To construct additional HIV-envelope mutants, the methods described herein can be applied. Two additional conserved regions of the envelope may contain enhancing sequences (Tables 3-6 and Figures 7A and 7B) . Domain 2 contains a conserved immunodominant sequence (67) in which an enhancing human mAb has been isolated (6,7,134) . Domain 3 is a conserved region of the C-terminus of gpl20 which, by molecular modeling studies, is in close proximity to enhancing Domain 1. Using recombinant HIV containing the W/Y 596 mutation, the contribution of these domains (or other domains) can be evaluated by titer of enhancement support of wild type virus versus mutant. If significant enhancement remains, each domain will be mutated in a manner similar to the approach described herein for Domain 1 approach (i.e., small and large deletions of

do ains/point mutations with particular attention to charged amino acids and sequences able to be N- glycosylated) .

TABLE 3: Immunodominant domains subject to genetic analysis for enhancing antibody induction capacity

'Los Alamos Retroviral Sequence Database numbering system ^Envelope Sequence derived from LAV(BRU) .

Table 4: Domain 1 (AA579-613

HXB2 R i L A V E R Y K D Q Q L L G I G C S G K L I C T T A V P W N A S (SEQ

_BRU _ _ _ _ . . _ _ - - - _ - - - - - - - - - - - - - - - - - - - - - - - (SEQ

_M N _ _v . _ _ -. _ . - - . - -. . - - F - - - - - - - - - - - T - - - - - - (SEQ

BRVA - V - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - (SEQ

SC - v - - - . R . - - - - - - - - - - - - - - - - - - - - - T - (SEQ

C H3 - - - - ( _SE Q

Oϊ CDC4 _ - . . _ - - - - - - - - - - - F - - - - - - - - - - - - - - - - - - (SEQ

2 OYI - V - - . - . - _ - - - - - - - - - - - - - - - T - - - - - - (SEQ

ZJ SF2 _ _V _ _ _ _ _ _ _ _R - - - - - - - - - - - - - - - - - - - - - - - - - (SEQ

C HAN - V - - - - - - - R - - - - - - - - - - - - - - - - - - T - - - - - - (SEQ

H JKL - V - - Q . - - - - - - - - - - - - - - - - - T (SEQ ^m WMJ22 - V - - - - - - - R - - - - - - - - - - - - - - - - - - T - - - - - - (SEQ

2 RF - V - - - - - - - R - - - - - - - - - - - - - - - - - - T (SEQ fπ ELI - - - - - - - - - - - - - - - - - - - - - - - H - - - - N - - - - S - (SEQ

ITj _Z2 . - . . _ . . - _ - - - - - - - - - - - - - - - - - - - T - - - - S - (SEQ

JH NDK - V - - - - - - - R - - - - - - - - - - - - R H - - - - N - - - - S - (SEQ j3 JYI - V - - - - S - - - - - - - - - - - - - - - - H - - - - T - - - - S - (SEQ f= MAL - V - - - - - - - Q - - R - - - M - - - - - - H - - - - F - - - - S - (SEQ m Z231 - - - - - - - - - - - - - - - - - - - - - - - I - - P - - - - - S - (SEQ to

CD

Table 5: Domain 2 (AA644-663

HXB2 S L I E E S Q N Q Q E K N E Q E L L E L (SEQ ID 15)

BRU _ - -. - - - - _ - - - - - - - - - _ - - (SEQ ID 35

W MN - - L - K - - T - - - - - - - - - - - - (SEQ ID 36) m BRVA - - - - D - - I - - - - - - K - - - - - (SEQ ID 37)

W SC _τ - - - - - - - - - - - - - - - - - - - (SEQ ID 38)

H JH3 T - - - - - - - - - - - - - - - - - G - (SEQ ID 39) f-j CDC4 T - - - - - - - - - - - - Q - - - - Q - (SEQ ID 40) m OYI T - - - - - - - - - - - - - - - - - - - (SEQ ID 41)

W SF2 _ - - - - - - - - - - - - - - - - - - (SEQ ID 42) en ro m HAN _τ . Q - - - - - - - - - - - - - - - - _ (SEQ ID 43) I

Oj JKL T - - - - - - - - - - - - - L - - - - - (SEQ ID 44)

3 WMJ22 - - - - - - - - - - G - - - - - - - - - (SEQ ID 45)

C RF N - L - - - - - - - - - - - - - - - - - (SEQ ID 46) fπ ELI - - - - - - - T - - - - - - K - - - - - (SEQ ID 47)

M Z2 R - - - - - - T - - - - - - - - - - - - (SEQ ID 48)

— NDK - - - - - - - I - - - - - - K - - - - - (SEQ ID 49)

JYI - - - - N - - I - - - - - - - D - - Q - (SEQ ID 50)

MAL N - - - - - - I - - - - - - K - - - - - (SEQ ID 51)

Z231 N - - - - - - T - - - I - - R D - - A - (SEQ ID 52)

Table 6: Domain 6 (AA488-510;

HXB2 V V K I E P L G V A P T K A K R V Q R E K (SEQ ID 16)

W BRU - - - - - - - - - - - - - - - - - - - - - (SEQ ID 53)

C DO MN - - T - - - - - - - - - - - - - - - - - - (SEQ ID 54)

Ϊ2 BRVA - - - - - - - - - - - - - - - - - - - - - (SEQ ID 55)

=2 SC - - - - - - - - - - - - - - - - - - - - - (SEQ ID 56)

C JH3 - - - - - L - - - - - - - - - - - - - - - (SEQ ID 57) m CDC4 - - - - - - - - - - - - - - - - - - - - - (SEQ ID 58)

W OYI _ _ - - - - ^' - - _ - - - - - R - - - - - - (SEQ ID 59) ft SF2 _ j. - - - - - i. - - - - - - - - - - - - - (SEQ ID 60) ^ ϋj HAN - - - - - - - - - - - - - - - - - - - - - (SEQ ID 61) ω

-= JKL - - - - - - - - - - - - - - - - - - - K - (SEQ ID 62)

_C WMJ22 _ - R _ - - - - - - - - - - - - - - - - - (SEQ ID 63)

£ RF - - R - - - - - - - - - R - - - - - - - - (SEQ ID 64)

M ELI _ _ Q - - - _ -. - - _ - R - - ^. - - E - - - (SEQ ID 65)

^■ 2 Z2 _ _ _ - - - - - - - _ - R - _ _ _ E - - - (SEQ ID 66)

NDK - - - - - - I - - - - - - - R - - E - - - (SEQ ID 67)

JYI _ - _R _ - - - - i - - - R - - - - E - - - (SEQ ID 68)

MAL - - R - - - - - - - - - - - - - - E - - - (SEQ ID 69)

_Z 23i _ _ _ _ _ _ - - _ - - - - - - - _ A - - - (SEQ ID 70)

The goal is to produce recombinant and/or genetic HIV vaccines which do not induce the formation of enhancing antibodies. Since the most broadly neutralizing antibodies are conformational, attempts were made to preserve conformation for the HIV envelope bearing mutations which inactivate enhancement. Proof of retention of conformation is provided by generation of infectious HIV bearing the mutations and the inactivation of mutant HIV with conformation-dependent neutralizing antibodies. If mutants which are incapable of generating infectious HIV are produced, the ability of envelope proteins bearing the mutations to compete with wild type HIV for conformation- dependent antibody neutralization is examined. Using these methods, it is routine to produce and examine mutations for the desired characteristics.

Throughout this application various publications are referenced by numbers within parentheses. Full citations for these publications are as follows. The disclosures cf these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.

REFERENCES

1. Robinson WE Jr, Mitchell WM Neutralizing and enhancement of in vi tro and in vi vo HIV and simian immunodeficiency virus mefctions AIDS 1990,

4 (suppl 1) :S151-S162.

2. Robinson WE Jr, Montefiori DC, Mitchell WM. A human immunodeficiency virus type 1 (HIV-l) infection- enhancing factor in seropositive sera. Biochem Biophys Res Commun 1987, 149:693-699.

3 Robinson WE Jr, Montefiori DC, Mitchell W . Antibody-dependent enhancement of human mununodeflciency virus type 1 infection Lancet 1988, 1.790-794.

4 Robinson WE Jr, Montefiori DC, Mitchell WM, et al Antibody-dependent enhancement of human immunodeficiency virus type 1 (HIV-l) infection m vi tro by serum from HIV-l-infected and passively immunized chimpanzees. Proc Natl Acad Sci USA 1989, 86.4710-4714.

5. Montefiori DC, Robinson WE Jr, Hirsch V ,

Modliszewski A, Mitchell WM, Johnson PR Antibody- depenαent enhancement of simian immunodeficiency virus (SIV) infection vitro by plasma from SIV- mfected rhesus macaques. J Virol 1990, 64.113-119.

6 Robinson WE Jr, Kawamura T, Gorny MK, et al Human monoclonal antibodies to the human immunodeficiency virus type 1 (HIV-l) transmembrane glycoprotein gp41 enhance HIV-l infection vitro. Proc Natl Acad Sci USA 1990, 87:3185-3189

7 Robinson WE Jr, Kawamura T, Lake D, Masuho Y, Mitchell WM, Hersh EM. Antibodies to the primary mununodommant domain of human immunodeficiency virus type 1 (HW-1) glycoprotein 41 enhance HIV1 infection in vi tro . J Virol 1990, 64-5301-5305

8. Robinson WE Jr, Gomy MK, Xu J-Y, Mitchel WM, Zolla Pazner S. Two immunodominant domains of gp41 bind antibodies which enhance HIV-3 infection in vi tro . J Virol 1991, 65:4169-4176.

9. Mitchell WM, Torres J, Johnson PR, Hirsch V, Yilma T, Gardner NM, Robinson WE Jr. Antibodies to the putative SIV infection-enhancing domain diminish beneficial effects of an SIV gp 160 vaccine in rhesus macaques. AIDS 1995, 9:27-34.

10. Montefiori DC, Graham BS, Kliks S, Wright PF, NIAID AIDS Vaccine Clinical Trials Network. Serum antibodies to HIV-l in recombinant vaccinia virus recipients boosted with purified recombinant gpl60. J Clin Immunol 1992,12:429-439.

11. Dolan R, Graham BS, Greenberg SB, Tacket CO, Belshe RB, Midthun K, Clements ML, Gorse GJ, Horgan BW, Atmar RL, Karzon DT, Bonnez W, Fe ie BF, Montefiori DC, Stabelin DM, Smith GE, Koff WC, the NIAID Vaccine Clinical Trials Network. The safety and immunogenicity of a human immunodeficiency virus type I (HIV-l) recombinant gpl60 candidate vaccine in humans. Ann Intern Med 1991, 114:119-127.

12. Porterfield JS. Antibody-dependent enhancement of viral infectivity. Adv Virus Res 1986, 31:335-355.

13. Halstead SB. Pathogenesis of dengue: challenges to molecular biology. Science 1988, 239:476-48 1.

14. Halstead SB, O'Rourke EJ. Antibody-enhanced dengue virus infection in primary leukocytes. Nature 1977, 265 :739-741.

15. Kliks SC, Nisalak A, Brandt @, Wahl L, Burke DS . Antibody-dependent enhancement of dengue virus growth in human monocytes as a risk factor for dengue hemorrhagic fever. Am J Trop Med Hyg 1989, 40 :444-451.

16. Hawkes RA. Enhancement of the infectivity of arboviruses by specific antisera produced in domestic fowls. Aust J Exp Biol Med Sci 1964, 42 :465-482.

17. Cecilia D, Gadkari DA, Kedarnath N, Ghosh S . Epitope mapping of Japanese encephalitis virus envelope protein using monoclonal antibodies against an Indian strain. J Gen Virol 1988, 69:2741-2747.

18. Peiris JSM, Porterfield JS. Antibody-mediated enhancement of Flavivirus replication in macrophage- like cell lines. Nature 1979, 282:509-51 1.

19. Cardosa MJ, Porterfield JS, Gordon S. Complement receptor mediates enhanced flavivir-us replication in acrophages. J Exp Med 1983, 158:258-263.

20. Schlesinger JJ, Brandriss MW. Growth of 17D yellow fever virus in a macrophage-like cell line, U937: role of Fc and viral receptors in antibody-mediated infection. J Immunol 1981, 127:659-665.

21. Barrett ADT, Gould EA. Antibody-mediated early death in vivo after infection with yellow fever virus. J Gen Virol 1986, 67:2539-2542.

22. Phillpotts RJ, Stephenson JR, Porterfield JS. Antibody-mediated enhancement of tick-borne encephalitis virus infectivity. J Gen Virol 1985, 66 :1831-1837.

23. Peiris JSM, Porterfield JS. Antibody-dependent plaque enhancement: its antigenic specificity in relation to Togaviridae. J Gen Virol ,-982, 58:291- 296.

24. King AA, Sands JJ, Porterfield JS . Antibody- mediated enhancement of rabies virus infection in a mouse macrophage cell line (P388D1) . J Gen Virol 1984, 65:1091-1093.

25. Chanas AC, Gould EA, Clegg JCS, Varma MGR. Monoclonal antibodies to Sindbis virus glycoprotein

El can neutralize, enhance mfectvity, and independently inhibit haemagglutination or haemolysis J Gen Virol 1982, 58.37-46

26 Vennema h, degroot RJ , Harbour DA, et al Eaπy death after feline infectious peritonitis virus challenge due to recombinant vaccinia virus immunization. J Virol 1990, 64:1407-1409

27. Fulgimti VA, Eller JJ, Downie AW, Kempe CH

Altered reactivity to measles virus: atypical measles in children previously immunized with inactivated measles virus vaccines J Am Med Assoc 1967, 202.10751080.

27 Chin J, Magoffm RL, Shearer LA, Schieble JH, Lennette EH. Field evaluation of a respiratory syncytial virus vaccine and a tπvalent paramfluenza virus vaccine in a pediatric population Am J Epidemol 1969, 89 449-463

28 Fulgimti VA, Eller JJ, Sieber OF, Joyner JW, Mmamitani M, Meiklejohn G Respiratory virus immunization 1, a field trial of two inactivated respiratory virus vaccines, an aqueous trivalent paramfluenza virus vaccine and an alum-precipitated respiratory syncytial virus vaccine Am J LpidemioJ 1969, 89 435-448.

29 Kim HW, Canchola JG, Brandt CD, et al Respiratory syncutial virus disease in infants despite prior administration of antigemc inactivated vaccine Am J Epidemol 1969, 89-422-434.

30 Kapikian AZ, Mitchell RH, Chanock RM, Shvedoff RA, Stewart CL An epiden-nologic study of altered clinical reactivity to respiratory syncytial (RS) virus infection m children previously vaccinated with an inactivated RS virus vaccine Am J Epidemiol 1969, 89 405-421

31. Shachfer J, Dawson CR. Human Chla ydial Infection. PSG Publishing Co, 1978, pp 63-96.

32. Prince GA, Jenson AB, Henu-ning VG, et al . Enhancement of respiratory syncytial virus pulmonary pathology in cotton rats by prior intramuscular inoculation of formalin-inactivated virus. J Vircl 1986, 57:721-728.

33. Wang SZ, Rushlow KE, Issel CJ, Cook RF, Cook SJ, Raabe ML, Chong Y-H, Costa L, and Montelaro RC. Enhancement of EIAV replication and disease by immunization with a baculovirus-expressed recombinant envelope surface glycoprotein. Virology 1994, 199:2347-2351.

34. Robinson WE Jr, Montefiori DC, Gillespie DH, Mitchell W . Complement-mediated, antibodydependent enhancement of HIV-l infection in vi ro is characterized by increased protein and RNA synthesis and infectious virus release. J Acq Imm Def Syn 1989, 2:33-42.

35. Robinson WE Jr, Montefiori DC, Mitchell WM. Complement-mediated antibody-dependent enhancement of HIV-l infection requires CD4 and complement receptors. Virology 1990, 175:600-604.

36. Homsy J, Tateno M, Levy JA. Antibody-dependent enhancement of HIV infection. Lancet 1988, i:1285-- 1286.

37. Homsy J, Meyer M, Levy JA. Serum enhancement of human immunodeficiency virus (HIV) infection correlates with disease in BlV-infected individuals. J Virol 1990, 64:1437-1440.

38. Takeda A, Tuazon CU, Ennis FA. Antibody-enhanced infection by EffV-1 via Fc receptor-mediated entry. Science 1988; 242:580-583.

39. Takeda A, Ennis FA, Tuazon CU. Immune enhancement of HIV-l infection: Possible mechanism of Fc

receptor-mediated infection enhancement. In, Vaccines 89 Modem Approach to New Vaccines Including Prevention of AIDS. Lerner RA, Ginsberg H, Chanock RM, Brown F, editors, Cold Spring Harbor Laboratory,

1989, 149-153.

40. Jouault T, Chapuis F, Olivier R, Parravicmi C, Bahraoui E, Gluckman J-C. HIV infection of monocytic cells: role of antibody-mediated virus binding to Fc-gamma receptors. AIDS 1989, 3:125- 133.

41. Matsuda S, Gidlund M, Chiodi F, et al . Enhancement of human immunodeficiency virus (HIV) replication in human monocytes by low titres of anti-HIV antibodies in vi tro . Scand J Immunol 1989, 30:425-434

42. Zeira M, By RA, Groopman JE . Inhibition of serum- enhanced HIV-l infection of U937 monocytoid cells by recombinant soluble CD4 and antι-CD4 monoclonal antibody, AIDS Res Human Retrovirus 1990, n press

43. Pemo C-F, Baseler MW, Broder S, Yarchoan R. Infection of monocytes by human immunodeficiency virus type 1 blocked by inhibitors of CD4-gpl20 binding even m the presence of enhancing antibodies. J Exp Med 1990, 171:1043-1056

44. Grangette C, Ameisen JC, Maniez M, et al Anti-HIV enhancing antibodies do not allow infection of a CD4 -negative IgG Fc receptor-positive monocytic cell line. VI Intl Conf on AIDS, San Francisco, CA,

1990, #Th.A.70.

45 Homsy J, Meyer M, Tateio M, Clarkson S, Levy JA.

The Fc and not CD4 receptor mediates antibody enhancement of HIV infection in humans cells.

Science 1989, 244:1357-1360. 46. McKeatmg JA, Griffiths PD, Weiss RA. HIV susceptibility conferred to human fibroblasts by

cytomegalovir-us-induced Fc receptor. Nature 1990, 343 : 659-661.

47. Furukawa T, Hornberger E, Sakuma S, Plotkin SA. Demonstration of im unoglobulin G receptors induced by human cytomegalovirus . J Clin Microbiol 1975,

2 : 332-336.

48. Keller R, Peitchel R, Goldman JN, Goldman M. An IgG- Fc receptor induced by cytomegalovirus-infected human fibroblasts. J Immunol 1976, 116:772-777.

49. Westmoreland D, St Jeor S, Rapp F. The development by cytomegalovirus-infected cells of binding affinity for human immunoglobulin. J Immunol 1976, 116 :1566-1570.

50. Frey J, Einsfelder B. Induction of surface IgG receptors in cytomegalovirus-infected human fibroblasts. Eur J Biochem 1984, 138:213-216.

51. .Robinson WE Jr, Montefiori DC, Mitchell WM. Will antibody-dependent enhancement of HIV-l infection be a problem with AIDS vaccines? Lancet 1988, i:830- 831.

52. Toth FD, Szab6 B, Ujhelyi E, Pdl6czi K, Horvath A, Fiist G, Kiss J, Bdnhegyi D, Holldn SR. Neutralizing and complement-dependent enhancing antibodies in different stages of HIV infection. AIDS 1991, 5:263-268.

53. Gras G, Strub T, Dormont D. Antibody-dependent enhancement of HIV infection. Lancet 1988, i: 1285.

54. Soelder BM, Reisinger EC, Koefler D, Bitterlich G, Wachter H, Dierich MP. Complement receptors: another port of entry for HIV. Lancet 1989, ii: 271- 272.

55. Tremblay M, Meloche S, Sekaly R-P, Wainberg MA. Complement receptor 2 mediates enhancement of human immunodeficiency virus 1 infection in Epstein-Barr

virus-carrying B cells. J Exp Med 1990, 171:1791- 1796.

56. Gras G, Dormont D. Antibody-dependent, complement- mediated enhancement of HIV infection (C -ADE) in s human, EBV-transformed B-cell line. VI Ir.tϊ Conf cn AIDS, San Francisco, CA, 1990, # 108 1.

57. Reisinger EC, Vogetseder W, Solder BM, et al . The role of complement in HIV-1-infection of the myeloblastoid cell line U937. VI Intl Conf on AIDS, San Francisco, CA, 1990, F.A.279.

58. Lambris JD, Ganu VS, Hirani S, Miiller-Eberhard HJ. Mapping of the C3d receptor (CR2 ) -binding site and neoantigenic site in the C3d domain of the third component of complement. Proc Natl Acad Sci USA, 1985, 82:4235-4239.

59. Nemerow GR, Houghten RA, Moore MD, Cooper NR. Identification of an epitope in the major envelope protein of Epstein-Barr virus that mediates viral binding to the B lymphocyte EBV receptor (CR2) . Cell 1989, 56:369-377.

60. Boyer V, Desgranges C, Trabaud MA, Fischer K, Kazatchkine MD. Complement mediates human immunodeficiency virus type 1 infection of a human T cell line in a CD4- and antibody-independent fashion. J Exp Med 1991, 173:1151-1156.

61. Dierich MP, Ebenbichier CF, Marchang P, Fust G, Thielens NM, Arlaud GJ . HIV and human complement: mechanisms of interaction and biological implication. Immunol Today 1993, 14:435-440.

62. Hidvegi T, Nagy K, Gyapay G, et al . Immune complexes (IC) containing a HIV gpl20 peptide and human polyclonal anti-HIV IgG activate the alternative pathway (AP) of complement (C) . VI Intl Conf on AIDS, San Francisco, CA, 1990, #S.A.301.

63. Paul DB, Sullivan BL, Landay AL, Spear GT . Peripheral blood mononuclear cells infected vitro with HIV activate complement by an antibody dependent pathway. VI Intl Conf on AIDS, San Francisco, CA, 1990, #S.A.296.

64. June RA, Schade S, Bankowslci M, et al The mechanism of complement enhanced HIV-l infection. VI Intl Conf on AIDS, San Francisco, CA, 1990, #F.A.278.

65. Bakker LJ, Nottet HS, devos NM, Van Stnjp JAG, Visser MR, Verhoef J. Uptake of fluorescem-labeled HIV-l by human monocytes is enhanced by antibodies and complement. VI Intl Conf on AIDS, San Francisco, CA, 1990, #F.A.31 1

66. June RA, Schade SZ, Bankowski MJ, Kuhns M, McNamara A, Lint TF, Landay AL, Spear GT. Complement and antibody mediate enhancement of HIV infection by increasing virus binding and provirus formation. AIDS, 1991, 5:269-274.

67. Klasse PJ, Pipkorn R, Blo berg J Presence of antibodies to a putatively immunosuppressive part of human immunodeficiency virus (HIV) envelope glycoprotein gp41 is strongly associated w th health among HIV-positive subjects. Proc Natl Acad Sci USA 1988, 85:5225-5229.

68. Gnann JW JR, Nelson JA, Oldstone MBA. Fine mapping of an immunodominant domain in the transmembrane glycoprotein of human immunodeficiency virus J Virol 1987, 61:2639-2641.

69 Ch odi FA, Gegerfeldt J, Albert EM, et al Site directed ELISA with synthetic peptides representing the HIV transmembrane glycoprotein J Med Virol 1987, 23-1-9.

70. Xu J-Y, Gorny M, Palker T, Karwowska S, Zolla-Pazner S Epitope mapping of two immunodominant domains of

gp41, the transmembrane protein of Human Immunodeficiency Virus Type 1, using ten human monoclonal antibodies. J Virol 1995, 65:4832-4838.

71. June RA, Landay AL, Stefanik K, Lint TF, Spear GT Phenotypic analysis or complement receptor 2+ T lymphocytes; reduced expression on CD4+ cells in HlV- fected persons. Immunology 1992, 75:59-65.

72. Zolla-Pazner S, Sharpe S. A resting cell assay for improved detection of antibody-mediated neutralization of HIV Type I primary isolates. AIDS Res Hum Retroviruses 1995, 11:14499-1458.

73. Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, and Feigner PL. Direct gene transfer into mouse muscle m vi vo . Science 1990, 247 1465-1468

74. Lin H, Parmacek MS, Morle G, Boiling S, and Leiden JM. Expression of recombinant genes in myocardium m vi vo after direct injection of DNA. Circulation

1990, 82.2217-2221.

75. Acsadi G, Jiao S, Jam A, Duke D, Williams P, Chong W, and Wolff JA. Direct gene transfer and expression into rat heart m vi vo . New B.ologist

1991, 3 : 71-8 1.

76. Kitsis RN, Buttrick PM, McNal y EM, Kaplan ML, and Lemwald LA Hormonal modulation of ; a gene injected into rat heart m vi vo . Proc Natl Acad Sci USA 1991, 88:4138-4142.

77. Hansen E, Fernandes K, Goldspmk G, Butterworth P, U eda PK, and Chang K-C. Strong expression of foreign genes following direct injection nto f sh muscles. FEBS Lett 1991, 290:73-76.

78. VonHarsdorf R, Schott RJ, Shen YT, Vatner SF, Mahdavi V, and Nadalgmard B. Gene inject- on into canine myocardium as a useful model for studying gene-expression in the heart of large animals. Circ Res 1993, 72:688-695.

79. Gal D, Weir L, LeClerc G, Pickering JG, Hogan J, and Isner JM. Direct myocardial transfection in 2 animals models: evaluation of parameters affecting gene-expression and percutaneous gene delivery. Lab Invest 1993, 68:18-25.

80. Cox GJM, Zamb TJ, and Babiuk LA. Bovine herpesvirus 1: immune responses in mice and cattle injected with plasmid DNA. J Virol 1993, 67:5664-5667.

81. Jiao S, Williams P, Berg RK, Hodgeman BA, Liu L, Repetto G, and Wolff JA. Direct gene transfer into nonhuman primate myofibers in vi vo . Hum Gene Ther

1992, 3:21-33.

82. Davis HL, De eneix BA, Quantin B, Coulombe J, and Whalen RG . Plasmid DNA is superior to viral vectors for direct gene transfer into adult mouse skeletal muscle. Hum Gene Ther 1993, 4:733-740.

83. Ulmer JB, Donnelly JJ, Parker SE, Rhodes GH, Feigner PL, Dwarki VJ, Gron-lkowski SH, Deck RR, DeWitt CM, Friedman A, Hawe LA, Leander KR, Martinez D, Perry HC, Shiver JW, Montgomery DL, and Liu MA. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science

1993, 259:1745-1749.

84. Yankauckas MA, Morrow JE, Parker SE, Abai A, Rhodes GH, Dwarki VJ, and Gro kowski SH. Longterm anti- nucleoprotein cellular and humoral immunity is induced by intramuscular injection of plasmid DNA containing NP gene. DNA Cell Biol 1993, 12:771-776.

85. Montgomery DL, Shiver JW, Leander KR, Perry HC, Friedman A, Martinez D, Ulmer JB, Donnelly JJ, and liu MA. Heterologous and homologous protection against influenza A by DNA vaccination: optimization of DNA vectors. DNA Cell Biol 1993, 12:777-783.

86 Fynan EF, Robinson HL, and Webster RG. Use of DNA encoding influenza hemagglutinin as an avian influenza vaccine. DNA Cell Biol 1993, 12-785 789

87 Wang B, Ugen KE, Srikantan V, Agadjanyan MG, Lang K, Refaeli Y, Sato Al, Boyer J, Williams VN, and Wemer DB- Gene inoculation generates immune responses against human immunodeficiency virus type 1 Proc Natl Acad Sci USA 1993, 90:4156-4160.

88. Wang B, Boyer J, Srikantan V, Coney 1, Carrano R, Phan C, Merva M, Dang K, Agad anan M, Gilbert L, Ugen KE, Williams WV, and Werner DB. DNA inoculation induces neutraliza g immune responses against human immunodeficiency virus type 1 m mice and nonhuman primates DNA Cell Biol 1993, 12 /99- 805.

89 Davis HL, Michel M-L, and Whalen RG. DNA-based immunization induces continuous secretion of hepatitis B surface antigen and high levels of circulating antibody. Hum Mol Genet 1993, 2.1847- 185 1.

90 Davis HL, Whalen RG, and Demeneix BA. Direct gene transfer into skeletal muscle m vi vo : factors affecting efficiency of transfer and staoility expression. Hum Gene Ther 1993, 4:151-159.

91. Hui KM, Sabapathy TK, Oei AA, and Chia TF

Generation of allo-reactive cytotoxic T lymphocytes by particle bombardment-mediated gene transfer J Immunol Methods 1993, 171:147-155

92 Haynes JR, Fuller DH, Eisenbraun MD, Ford MJ, and Pertner TM Accell ^® particle-mediated DNA immunization elicits humoral, cytotoxic, and protective immune responses AIDS Res Human Retroviruses 1994, 10:543-545

93 Eisenbraun MD, Fuller DH, and Haynes JR. Examination of parameters affecting the elicitat-on

of humoral immune responses by particle bombardment- mediated genetic immunization. DNA Cell Biol 1993, 12 :791-797.

94. Tang D-C, DeVit M, and Johnston SA. Genetic immunization is a simple method for eliciting an immune response. Nature 1992, 356:152-154.

95. O'Hagan DT. Oral mu-nunization and the common mucosal inunune system. In Novel Delivery Systems for Oral Vaccines , Derek T. O'Hagan, ed. CRC Press, Cleveland, Ohio, 1994, pp. 1-24.

96. Service RF. Triggering the first line of defense. Science 1994, 265:1522-1524.

97 Suharyona, Simanjuntak C, Witha N, Punjabi N,

Heppner DG, Losonsky G, Totosudirjo H, Rifai AR, Clemens J, Lim YL, Burr D, Wasserman SS, Kaper J, Sorenson K, Cryz S, and Levme MM. Safety and immunogenicity of s gle-dose oral cholera vaccine CVD 103-HgR in 5-9 year old children. Lancet 1992, 340:689-694.

98. Desrosiers RC. HIV with multiple gene deletions as a live attenuated vaccine for AIDS. AIDS Res Hum Retrovir 1992, 8:411-421.

99. Cohen J. AIDS Vaccines. At conference, hope for success is further attenuated. Science 1994, 266:1154.

100. Padian NS. Heterosexual transmission of acquired immune deficiency syndrome: international perspective and national projections. Rev infect Dis 1987; 9:947-960

101. Plot P, Plummer F, Mhalu FS, Lamboray JL, Chin J, and Mann JM. AIDS: an international perspective Sicence 1988, 239:573-579.

102 Johnson AM. Heterosexual transmission of human immunodeficiency virus. Brit Med J 1988, 296:1017- 1029

103. Hospedales J. Heterosexual spread of HIV infection. Rev Infect Dis 1989, 11:663-665. 04. deschryver A, and Meheus A. Epidemiology of sexually transmitted diseases: the global picture. Bull WHO 1990, 68:639-654.

105. Alexander NJ. Sexual transmission of human immunodeficiency virus : virus entry into the male and female genital tract. Fertil Steril 1990, 54:1- 18.

106. Miller C, and Gardner N . AIDS and mucosal mununity: usefulness of the SIV macaque model of genital mucosal transmission J AIDS 1991, 4:1169- 1172.

10/. McGhee JR, and Mestecky J. The mucosal immune system m HIV infection and prospects for mucosae immunity to AIDS. AIDS Res Rev 1992, 2:289-312. 108 Forrest BD. The need for consideration of mucosal immunity vaccine approaches to AIDS. Vaccine Res

1992, 1:137. 109. Padian ND, Shiboski SC, and Jewell NP . Female to male transmission of human immunodeficiency virus.

J Amer Med Assoc 1991, 266:1664-1667. 110 Forrest BD. Women, HIV, and mucosal immunity.

Lancet 1991, 337:835-836.

111. Miller CJ, McGhee JR, and Gardner MB Mucosal immunity, HIV transmission and AIDS. Lab Invest 1992, 68:129-145.

112. Mestesky J, Kutteh WH, and Jackson S. Mucosal mununity the female genital tract: relevance to vaccination efforts against the Human

Immunodeficiency Virus. AIDS Res Human Retroviruses 1994, 10:511-520.

113. Miller CJ, Alexander NJ, Sut ipto S, ackner AA, Hendrickx AG, Lowenstme LJ, Jennings M, and Marx PA Genital musocal transmission ol simian

lmmunodeficiency virus: animal model for heterosexual transmission of human immunodeficiency virus. J Virol 1989, 63:4277-4284.

114. Lehner T, Bergmeier LA, Panagiotidi C, Tao L, Brookes R, Klavmskis LS, Walker P, Walker J, Ward RG, and Hussain L: Induction of mucosal and systemic immunity to a recombinant simian immunodeficiency viral protein. Science 1992, 258:1365-1369.

115. Lehner T, Brookes R, Panagiotid C, Tao L., Klavmskis LS, Walker J, Walker P, Ward R, Hussain L, Gearing AJH, Adams SE, and Bergmeier LA. T- and B-cell functions and epitope expression in nonhuman primates immunized with simian immunodeficiency virus antigen by the rectal route. Proc Natl Acad Sci USA 1993, 90:8638-8642.

116. Marx PA, Compans RW, Gettie A, Staas JK, Gilley RM, Mulligan MJ, Yamschikov GV, Chen D, and Eldridge JH. Protection against vaginal SIV transmission! with microencapsulated vaccine. Science 1993, 260:1323- 1327.

117. Mestecky J, and McGhee JR. h-nmunoglobulm A (IgA) : molecular and cellular interactions involved IgA biosynthesis and immune response Adv Immunol 1987, 40 :153-245.

118. Melnick JL. Enteroviruses : Polioviruses, Coxsackiviruses, Echoviruses, and newer Enteroviruses. In, Virology . Bernard N. Fields and David M. Knipe, eds in chief. Raven Press, New York, NY, 1990, 549-605.

119. Mestecky J, Lue C, and Russell M . Selective transport of IgA: cellular and molecular aspects. Gastroenterol Clin North Amer 1991, 20:441-47 1.

120. Lund 0, Hansen J, Sorensen AM, Mosekilde E, Nielsen ■JO, Jansen J-ES. Increased adhesion as a mechanism of antibody-dependent and antibody-independent

comple ent-mediated enhancement of Human Immunodeficiency Virus infection. J Virol 1995, 69 :2393-2400.

121. Hu SL, Abra s K, Barber GN. Protection of macaques against SIV infection by subunit vaccines of SIV envelope glycoprotein gpl60. Science 1992, 255:456- 459.

122. Kliks S, Nisalak A, Brandt WE, Wahl L, Burke DS. Antibody-dependent enhancement of dengue virus growth in human monocytes as a risk factor for dengue hemorrhagic fever. Am J Trop Med Hyg 1989, 40:444-451.

123. Gardner MB, Rosenthal A, Jennings M, Yee J, Antipa L, and MacKenzie M. Passive immunization of macaques against SIV infection. J Med Primatol 1994, in press .

124. Robinson J WE, Torres JV, and Gardner M. Antibodies to amino acid 603-622 of simian immunodeficiency virus (SIV) transmembrane glycoprotein apparently enhance SIV infection in rhesus macaques. Firs t Na tional Conference on Human Retroviruses and Rela ted Infecti ons . Washington, DC, December 1993, abstract 79.

125. Putkonen P, Thor-tensson R, Ghavamzadeh L, Albert J, Hild K, Biberfeld G, and Norrby E. Prevention of HIV-2 and SIVsm infection by passive immunization in cynomolgus monkeys. Nature 1991, 352:436-438.

126. Hohdatsu, T., Pu R, Torres BA, Trujillo S, Gardner MB, and Yamamoto JC. Passive antibody protection of cats against feline immunodeficiency virus infection. J Virol 1993, 67:2344-2348.

127. Hosie MJ, Osborne R, Reid G, Neil JC, and Jarrett 0. Enhancement after feline immunodeficiency virus vaccination. Vet Immunol Immunopathol 1992, 35:191- 197.

128. Kent KA, Kitchin P, Mills KHG, Page M, Taffs F, Corcoran T, Silvera P, Flanagan B, Powell C, Rose J, Ling C, Aubertin AM, and Stott EJ. Passive immunization of cynomolgus macaques with immune sera or a pool of neutralizing monoclonal antibodies failed to protect against challenge with SIVmac25 1. AIDS Res Hum Retroviruses 1994, 10:189-194.

129. Mitchell, W.M., Rosenbloom, S.T., and Gabriel, J. Induction of Mucosal Anti-HIV Antibodies by Facilitated Transfection of Airway Epithelium with Liposperrriine/DNA Complexes. Immunotechnology

1 :211-219 (1995) .

130. Xu J-Y, Gomy MK, Palker T, Karwowska S, Zolla-Pazner S. Epitope mapping of two imrnunodoniinant domains of gp41, the transmembrane protein of human immunodeficiency virus type 1, using ten human monoclonal antibodies. J Virol 1991, 65:4832-4838.

131. Haynes JR, Cao SX, Rovinski B, Sia C, James 0, Dekaban GA, Klein MH. Production of inununogenic HIV-l viruslike particles in stably engineered monkey cell lines. Aids Res Human Retroviruses 1991, 7:17-27.

132. D'Souza MP, Mil an G, Bradac JA, McPhee D, Hanson CV, Hendry RM, Collaborating Investigators. Neutralization of pimrary HIV-l isolates by anti- envelope monoclonal antibodies. AIDS 1995, 9:867- 874.

134. Robinson et al . VI Internat'l Conference on AIDS, Final Program and Abs tracts vol 2, Friday, 22 June, 1990, San Francisco, June 1990, pp 13 [Abstract Th.A78] .

135. Freed et al . Mutational analysis of the cleavage sequence of the human immunodeficiency virus type 1 envelope glycoprotein precursor gpl60. J Virol 1989, 63 -.4670-4675.

136. von Brunn et al . Principal neutralizing domain of HIV-l is highly immunogenic when expressed on the surface of hepatitis B core particles. Vaccine 1993, 11:817-824.

137. Gabriel and Mitchell. Proposed atomic structure of ^■ truncated HIV gpl20 derived by molecular modeling: target CD4 recognition and docking mechanism. Proc Natl Acad Sci USA 1993, 90:4186-4190.

138. Gabriel and Mitchell. Functional design of potential inhibitors of HIV binding to CD4+ target cells: a molecular model of gpl20 predicts ligand binding. Drug Des Disc 1996, 14:103-114.

139. Jameson et al . Conserved structural features ir. the interaction between surface and transmembrane glycoproteins. AIDS Res Hum Retroviruses 1992, 8:1571-1580.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims: