DIFFERENTIATION OF SIV AND HIV-2 GROUP OF VIRUSES

The present invention is related generally to the field of isolation and characterization of proteins and their coding sequence. More particularly, the present invention is related to the identification, char¬ acterization and diagnostic use of a protein unique to the SIV and HIV-2 group of viruses and the gene encoding said protein. BACKGROUND OF THE INVENTION

Simian immunodeficiency viruses (SIVs) cause a fatal disease in susceptible primate species with symp¬ toms similar to human AIDS caused by human immunodefi¬ ciency viruses type 1 (HIV-1) and type 2 (HIV-2). Strains of SIV were originally isolated from rhesus mon¬ keys with immunodeficiency or lymphoma (SIV/mac) and subsequently from asymptomatic mangabey monkeys (SIV/SMM, SIV/SMLV, SIV/Delta) and from Macaca nemestrina with lymphoma (SIV/Mne). A strain of SIV originally thought to be obtained from African green monkeys (STLV-III/agm) has since been shown to be SIV/mac. SIV strains are closely related to each other (greater than 90% identity) and also partially related to HIV-1 (40% nucleotide sequence identity), but are more closely related to HIV-2 (75% overall nucleotide sequence identity).

The geno ic organizations of HIV-1, HIV-2 and SIV are very similar, each containing open reading frames (ORFs) designated gag, pol, env, Q, R, trs, tat, and F. However, HIV-2 and SIV each contain an ORF designated X that is not found in HIV-1 [Chakrabarti, et al, Nature 328, 543 (1987); Franchini, et al, Nature 328, 539 (1987); and Guyader, et al, Nature 326, 662 (1987)]. The X-ORF is located in the central region of the genome between the pol-ORF and the env-ORF. However, the nature and properties of X-ORF, its translational product and their significance have not heretofore been known or described.

SUMMARY OF THE INVENTION It is, therefore, an object of the present invention to provide an isolated, substantially pure protein designated herein as the "pl4" or "sid-protein." It is a further object of the present invention to identify a coding sequence which directs the synthesis of the sid-protein in a suitable expression vector.

It is another object of the present invention to provide a diagnostic kit for differential detection of HIV-2 and SIV group of viruses from other similar viruses, such as the group of HIV-1 strains.

A further object of the present invention is to provide a method for differentiating between HIV-2, SIV and HIV-1 infection. Other objects and advantages of the present invention will become apparent from the following detailed description of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accom¬ panying drawings wherein:

Figure 1 represents SDS gel electrophoresis showing protein products of the X-ORFs in SIV/Mne, SIV/mac and HIV-2 and the purified protein (pi4) obtained from SIV/Mne. Figure 1(a) shows a coomassie stained gel of SIV/Mne (lane 1) and purified pl4 (lane 2). Viral gag proteins (p.28, pi6, pδ, and p6) are identified in lane i. Figure 1(b) shows a coomassie stained gel of HIV-1 (lane 1), HIV-2 (lane 2), SIV/Mne (lane 3) and SIV/mac (lane 4). Figure 1(c) shows the results of immunoblot analysis of separated viral proteins (SDS gel identical to panel-b) using rabbit antiserum to purified SIV/Mne pl4. After SDS gel electrophoresis, proteins were trans¬ ferred to nitro-cellulose and probed with antiserum at 1 to 500 dilution. Antigen-antibody complexes were

detected by radioautography after reaction with ¹² ^I- labeled staphylococcal protein A as described by Henderson, et al, Virol 61, 1116 (1987). Approximately 50 ι q of total protein was applied to each viral lane

- (panel b and c) ;

Figure 2 shows amino acid sequences of tryptic peptides from pl4 and alignment with the protein pre¬ dicted by the HIV-2 X-ORF. Figure 2(a): Purification of Tryptic Peptides: Purified pl4 (Fig. 1, lane 2) (200 ^g)

■^- ^■j was dissolved in 0.5 ml of 0.1 M Tris-HCl (pH 7.4) and 20 _/ iq of trypsin (Cooper Biomedical) added. The diges¬ tion was continued for 8 hr. and stopped by adding tri- fluoroacetic acid (TFA) to pH 2.0. Peptides were sepa¬ rated by RP-HPLC at 1.0 ml/min on _. u-Bondapak C18 (3.9 x

¹⁵ 300 mm column) at pH 2.0 (0.05% TFA) with a linear gradi¬ ent of acetonitrile ( ) and detected by u.v. absorption

( ) at 206nm. Peaks containing peptides taken for further analysis are indicated by the letters "a" through ii i ;/

^{' ύ} Figure 2(b): Tryptic peptides of SIV/Mne pl4 aligned with the amino acid sequence predicted by the X- ORF of HIV-2. Tryptic peptides derived from pl4 (as in Fig. 2(a) were analyzed for amino acid content (Pico Tag system, Waters Inc. Milford, MA.) and sequence (gas phase 5 sequencer, model 470A equipped with model 120A analyzer, Applied Biosystems, Foster City, CA. ) and the results compared to the amino acid sequence predicted by the X- ORF in the nucleotide sequence of HIV-2 [Guyader, et al, Nature 326, 661 (1987)]. Peptides are indicated by brac-

-^ kets and dashed lines [—]. Arrowheads to the right (

>) indicate the last residue identified by amino acid sequence analysis. Arrows to the left (< ) indicate residues determined by digestion of pl4 with carboxypep- tidase-p. Residues in parentheses and separated by com-

3~ mas represent residues confirmed by amino acid content of purified peptides. Lower case letters (a, b, c, etc.) refer to peptides purified in Fig. 2(a). Asterisks (*)

show where the amino acid sequences differ. The unknown blocking group on the N-terminal end of pl4 is indicated by x; and

Figure 3 demonstrates that purified pl4 binds to polyethenoaden lic acid. Purified SIV/Mne proteins including p28, p2, p8, p6 and pl4 were tested for single stranded nucleic acid binding activity by the fluores¬ cence enhancement assay using 2.19 _a polyethenoadenine as described by Karpel, et al, \J . Biol. Chem. 262, 4961 (1987)]. Of the viral proteins tested only pl4 and p8 produced significant enhancement of fluorescence when added to solutions of polyethenoadenine.

DETAILED DESCRIPTION OF THE INVENTION

The above and various other objects and advan- tages of the present invention are achieved by an iso¬ lated, substantially pure protein which, in whole or in part, possesses specific binding affinity only for anti¬ body to sid-protein without cross-reacting with anti¬ bodies to HIV-1 strain of viruses . Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed herein are standard methodologies well known to one of ordinary skill in the art.

The term "substantially pure" as used herein means as pure as can be obtained by standard purification techniques well known to one of ordinary skill in the art. Isolation and Characterization of the Protein

In order to grow the SIV/Mne virus, a single

cell clone of Hut-78 cells infected with SIV/-Mne (clone E11S) was cultured for propagation of the virus and the virus then purified by standard sucrose density gradient centrifugation. Viral proteins were then fractionated, isolated and purified by standard procedures well known in the art, including reversed phase high pressure liquid chromatography (RP-HPLC) until a homogeneous preparation was obtained. The protein was then characterized by NH ₂ and COOH amino acid sequence analysis as described, for example, by Henderson, et al, J. Virol 52:492 (1984).

The homogenous preparation of the protein, as shown by SDS-PAGE analysis (Fig. 1(a), lane 2) was inert to Edman degradation (gas phase sequencer) suggesting that it had a derivatized NH2- terminal residue (blocked NH2"ter inus ) . To obtain amino acid sequence, the pro¬ tein was digested with trypsin and the purified peptide fragments thus obtained (Fig. 2(a), "a" through "1") were subjected to analysis for determining amino acid composi¬ tion and sequence [Fig. 2(b)], The determined amino acid sequences and compositions were compared to the trans¬ lated proviral DNA sequence of SIV/mac and HIV-2 and found to be highly homologous to predicted sequences located in the X-ORF of each virus. The SIV/Mne pl4 peptides [Fig. 2(b)] align with residues predicted by the X-ORF of HIV-2 starting at position 2 and continue through position 112 except that peptides corresponding to predicted residues 69 through 70 and 85 through 88 were not isolated. Of the 105 amino acid residues of SIV/Mne pl4 that were determined by analysis of purified peptides, 90 were identical to predicted residues in the HIV-2 X-ORF (86% identity) and 103 were found to be iden¬ tical to the predicted residues in SIVmac X-ORF (98% identity) . The amino acid sequence of SIV/Mne pl4 dif¬ fers from the sequence predicted by the SIV/mac X-ORF in that the SIV/Mne protein does not contain aspartic acid at position 3 and has- valine substituted for threonine at position 67. In addition, the mature pl4 protein has

undergone modifications resulting in removal of the initiator methionine and addition of a blocking group to the newly formed NH ₂ -terminal group. The nature of the modifying group remains to be determined. The COOH-ter- inal residues of SIV/Mne pl4 were determined by the rate of release of residues by digestion with carboxypepti- dase-P [2 min., Ala (0.30), Leu (0.22); 20 min. , Ala (0.40), Leu (p.47)]. These results are consistent with a COOH-terminal amino acid sequence of -Leu-Ala-OH and are in agreement with the sequence deduced from the last two codons of the X-ORFs of HIV-2 and SIV/mac.

The degree of amino acid sequence identity between the protein predicted by the X-ORF of SIV/mac and SIV/Mne pi4 (98% identities) is greater than the degree of identity found for proteins derived from the gag gene (92% identity) and also greater than the degree of iden¬ tity found between the two viruses for a 1.6 Kb proviral DNA fragment including the 3'-LTR (93% identities). These results indicate that the X-ORF protein is highly conserved among SIV strains.

To estimate the molar amount of pi4 present in the viral preparation and to relate this amount to the molar amounts of other known viral proteins, the pl8, pl6, pl4, and pδ bands were cut from the gel shown in Fig. 1(a) (lane 1) and their protein content determined by amino acid analysis as described by Henderson, et al,

J. Virol 52, 492 (1984). The results were in agreement with the known amino acid content of each protein and showed that the gel contained the proteins in the follow- ing molar ratios: 1.0 : 1.2 : 1.1 : 0.8 (p28 : plδ : p8

: pl4). Several preparations of SIV/Mne, including viruses obtained from an infectious molecular clone, were examined by visual inspection of bands after SDS PAGE and found to contain similar ratios of pl4 to plδ as shown in Fig. 1(a) (lane 1) .

A polyclonal rabbit antiserum to purified SIV/Mne pi4 was used to detect pi4 in SIV/Mne and probe

for cross-reactive proteins in HIV-1, HIV-2 and SIV/mac by immunoblot anlaysis [Fig. 1(c)]. The serum detected a 14kD band in SIV/Mne (lane 3) and SIV/mac (lane 4) and 16kD band in HIV-2 (lane 2), but did not appear to react significantly with proteins in HIV-1 (lane 1). The detected antigen in SIV/mac has the same mobility in SDS- PAGE as SIV/Mne pl4. This evidence leads to the conclu¬ sion that pl4 is the translational product of the SIV/mac X-ORF gene. The detected antigen in HIV-2 (pi6) has a slower mobility in SDS-PAGE than the pl4s of SIV/Mne and SIV/mac (Fig. 1C). However, SIV isolates from other primate species appear to have cross-reactive proteins with mobilities more similar to the protein detected in HIV-2 (data not shown) . Without being bound to any theory, it is believed that the observed difference in the SDS-PAGE mobilities is probably due to differences in amino acid compositions of the proteins rather than dif¬ ferences in actual molecular weights. In any event, the data support the conclusion that the X-ORF translational products of HIV-2 and SIV/mac are found in the purified viruses and that HIV-1 does not contain a similar cross- reactive protein.

To visualize and estimate the amounts of viral proteins in each viral preparation a SDS-PAGE gel, iden- tical to that used for immunoblotting, was stained with coomassie brilliant blue [Fig. 1(b)]. Coomassie stained bands at 14kD and 16kD (pi4 and pl6-gag) are readily apparent in SIV/Mne (lane 3) and SIV/mac (lane 4); how¬ ever in HIV-2 (lane 2) the 14kD band is absent and there is a prominent 16kD band. The 16kD band in the HIV-2 lane contains both pi6 gag (data not shown) and the X-ORF protein. The staining intensities of the major gag pro¬ teins (HIV-1 p24 and pl7, HIV2 p26 and SIV p28ε and plδs) may be taken as relative indicators of the amount of virus applied to each lane. A comparison of the intensi¬ ties of the bands in the immunoblot analysis [Fig. 1(c)] to the intensifies of the coomassie stained bands [Fig.

1(b)] suggests that SIV/mac and HIV-2 may contain as much of the translational products from their X-ORFs as is observed for pl4 in SIV/Mne.

The established structure and genetic origin of pl4 as demonstrated here shows that the X-ORF functions as a gene in SIV/Mne. Since the gene and gene product (pl4) were first recognized in SIV/Mne and appear unique to _simian _^ immunodeficiency (sid) and closely related virsues, this gene is herein designated as the sid gene. The amino acid sequences of SIV and HIV-2 sid proteins contain conserved cysteine residues in positions 73, 87 and 89 and a histidine residue in position 82 [Fig. 2(b)]. Similar cyεteine-hiεtidine motifs are believed to play a role in the nucleic acid binding pro- perties of retroviral [Henderson, et al, J. Biol. Chem. 256, 8400 (1981)] and other proteins [J. Berg, Science 232, 485 (1986)]. Purified pl4 was tested for nucleic acid binding activity by the method of fluorescence enhancement using polyethenoadenine as a single stranded polynucleotide template [Karpel, et al, J. Biol. Chem. 262, 4961 (1987)]. Figure 3 shows the titration curve obtained by adding pi4 to a solution of polyethenoade¬ nine. Also included in Fig. 3 are the titration results obtained for SIV/Mne p8 gag nucleocapsid protein and p28 gag. The data show that pl4 and p8 bind to the template and indicate that these proteins are capable of binding to a single stranded RNA. The shape of the titration curve is dependent upon the degree and nature of coopera¬ tive binding which is different for each protein. The capacity of pl4 to bind to single stranded nucleic acids may in part account for its apparent high concentration in the purified virus. However, the fact that pl4 is capable of binding to single stranded nucleic acids sug¬ gests that it may function in vivo as a specific RNA binding protein.

Because the sid protein is unique to the HIV-2 and SIV group of viruses, diagnostic procedures utilizing

this protein are developed to unequivocally distinguish between HIV-1, HIV-2 and strains of SIV. A diagnostic kit comprises containers separately containing sid pro¬ tein and anti-pl4 antibodies, the latter reacting only with those viruses which have antigenic components homol¬ ogous, in whole or in part, to the sid protein. Since the HIV-1 strains do not have antigenic components which cross-react with sid antibodies, a positive antigen-anti¬ body reaction between a biological sample and the com- 0 ponents of the diagnostic kit (antibody or antigen) indi¬ cates the presence of a virus which has "sid" homology.

UTITLITY OF THE PRESENT INVENTION A. DIAGNOSIS OF SIV/HIV-2 INFECTION

1. Detection of antibodies with protein from 5 virus. a. As illustrated herein above, the sid pro¬ tein can be purified from any strain of the SIV/HIV-2 group by chromatography such as RP-HPLC or any other suitable protein 0 purification method offering sufficient resolving power. The purified protein is then used to detect specific antibodies in patients' blood (sera) employing ELISA or similar techniques . The sensitivity of 5 this method is below the microgram range and nanogram quantities will be sufficient for a single test. Current available diagnostic tests do not readily differen¬ tiate between HIV-1 and HIV-2 infection. 0 In contrast, the sid protein provides an unequivocal differential diagnosis of HIV- 2. False positives are virtually elimi¬ nated when purified protein or its frag¬ ments are used. False negatives may iJ appear oanly at very early stages of infection due to the absence of anti¬ bodies . But once immunreactive amounts of

antibodies are produced, false negatives are not probable. b. The present invention now allows sensitive diagnostic kits. A kit having sid protein or its fragments as one of the components can identify any virus which has a domain reactive with the sid protein. 2. Recombinant sid protein

The sid gene of the SIV/HIV-2 group of virus can be cloned by routine laboratory tech¬ niques. The complete gene or its fragments can be expressed in either prokaryotic or eukary- otic expression vectors and the products used for diagnostic tests as described herein supra. 3. Synthetic Protein

Sid protein or fragments of sid protein can be synthesized by conventional techniques of pep- tide synthesis and the resultant products used in diagnostic tests to detect antibody in patient sera as described herein supra.

B. TESTS FOR THE DIFFERENTIATION OF NEW VIRUS ISOLATES

1. Monoclonal or polyclonal antibodies specific for sid protein can be prepared with any of the available technology. The antibody can be used for identification and typing of new isolates from any animal species including humans, employing western blot analysis or other suit¬ able detection techniques for the presence of sid protein in the virus isolate. Localization of the site of infection can be achieved by immunohistological, immunoradiological and other methods. Such techniques are well known to one of ordinary skill in the art. The results readily determine whether the new virus is a member of the SIV/HIV-2 group and whether the infection is due to HIV-2 or SIV. Viruses which belong to HIV-1 group will not show

UBST U E

positive reaction.

It is understood that the examples and embodi¬ ments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims .

HIV-2 _R0D sid GENE SEQUENCE atgacagaccccagagagacagtaccaccaggaaacagcggcgaagagactatcgga gaggccttcgcctggctaaacaggacagtagaagccataaacagagaagcagtgaat cacctaccccgagaacttattttccaggtgtggcagaggtcctggagatactggcat gatgaacaagggatgtcagaaagttacacaaagtatagatatttgtgcataatacag aaagcagtgtacatgcatgttaggaaagggtgtacttgcctggggaggggacatggg ccaggagggtggagaccagggcctcctcctcctccccctccaggtctggtctaa

SIV _Mac sid GENE SEQUENCE

ATGtcaga tcccagggag agaatcccac ctggaaacag tggagaagag acaataggag aagccttcga gtggctaaac agaacagtag aggagataaa cagagaggcg gtaaacca cc taccgaggga gctaattttc caggtttggc aaaggtcttg ggaatactgg caTGA tgaac aagggatgtc acaaagctat acaaaataca gatacttgtg tttaatacaa aa ggctttat ttatgcattg caagaaagga tgtagatgta taggggaagg acacggggca gggggatgga gaccaggacc tcctcctcct ccccctccag gactagca TA.

SUBSΠTOΓE sπεεr