BACKGROUND OF THE INVENTION The protein phosphorylation/dephosphorylation cycle is one of the major regulatory mechanisms employed by eukaryotic cells to control cellular activities. See U. S.

Patent 5,853, 997. It is estimated that more than 10% of the active proteins in a typical mammalian cell are phosphorylated. During protein phosphorylation/- dephosphorylation, phosphate groups are transferred from adenosine triphosphate molecules to a protein by protein kinases and are removed from the protein by protein phosphatases.

Protein phosphatases function in cellular signaling events that regulate cell growth and differentiation, cell-to-cell contacts, the cell cycle, and oncogenesis. Three protein phosphatase families have been identified as evolutionarily distinct. These include the serine/threonine phosphatases, the protein tyrosine phosphatases, and the acid/alkaline phosphatases (Carbonneau & Tonks, Ann. Rev. Cell Biol. 8, 463-93, 1992).

The serine/threonine phosphatases are either cytosolic or associated with a receptor.

On the basis of their sensitivity to two thermostable proteins, inhibitors 1 and 2, and their divalent cation requirements, the serine/threonine phosphatases can be separated into four distinct groups: PP1, PP2A, PP2B, and PP2C (also called PPM1). PP1 dephosphorylates many of the proteins phosphorylated by cyclic AMP-dependent protein kinase and is therefore an important regulator of many cyclic AMP mediated, hormone responses in cells. PP2A has broad specificity for control of cell cycle,

growth and proliferation, and DNA replication and is the main phosphatase responsible for reversing the phosphorylations of serine/threonine kinases. PP2B, or calcineurin (Cn), is a Ca+2-activated phosphatase; it is involved in the regulation of such diverse cellular functions as ion channel regulation, neuronal transmission, gene transcription, muscle glycogen metabolism, and lymphocyte activation. PP2C is a Mg+2-dependent phosphatase which participates in a wide variety of functions, including regulating cyclic AMP-activated protein-kinase activity, Ca+2-dependent signal transduction, tRNA splicing, and signal transmission related to heat shock responses. PP2C is a monomeric protein with a molecular mass of about 40-45 kDa.

Several isoforms of PP2C have been identified (Wenk et al., FEBS Lett. 297, 135-38, 1992; Terasawa et al., Arch. Biochem. Biophys. 307,342-49, 1993; and Kato et al., Arch. Biochem. Biophys. 318, 387-93,1995). Members of the PP2C family of serine/- threonine protein phosphotases have recently been shown to be important in the intracellular signaling pathways related to the reorganization of the actin cytoskeleton and cell mobility (Koh et al., Current Biology 12, 317-321,2002).

Because of the importance of protein phosphatases in a variety of biological functions, there is a need in the art to identify additional protein phosphatases which can be regulated to provide therapeutic effects.

SUMMARY OF THE INVENTION It is an object of the invention to provide reagents and methods of regulating a Human PP2C-like Protein Phosphatase. These and other objects of the invention are provided by one or more of the embodiments described below.

One embodiment of the invention is a method of screening for agents which regulate a Human PP2C-like Protein Phosphatase activity. A test compound is contacted with a polypeptide comprising an amino acid sequence selected from the group consisting of :

amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence shown in SEQ ID NO: 2; amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 78; the amino acid sequence shown in SEQ ID NO. 78.

Binding between the test compound and the polypeptide is detected. A test com- pound which binds to the polypeptide is thereby identified as a potential agent for regulating the Human PP2C-like Protein Phosphatase activity.

Another embodiment of the invention is a method of screening for agents which regulate the activity of Human PP2C-like Protein Phosphatase. A test compound is contacted with a polynucleotide encoding a Human PP2C-like Protein Phosphatase polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of : nucleotide sequences which are at least about 50% identical to, the nucleotide sequence shown in SEQ ID NO. 1; the nucleotide sequence shown in SEQ ID NO. 1; nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 77; the nucleotide sequence shown in SEQ ID NO. 77.

Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for reducing the activity of Human PP2C-like Protein Phosphatase. The agent can work by decreasing the amount of the PDE9A through interacting with the Human PP2C-like Protein Phosphatase mRNA.

Still another embodiment of the invention is a method of screening for agents which regulate a Human PP2C-like Protein Phosphatase activity. A test compound is contacted with a polypeptide comprising an amino acid sequence selected from the group consisting of : amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence shown in SEQ ID NO: 2; amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 78; the amino acid sequence shown in SEQ ID NO. 78.

A PP2C-like Protein Phosphatase activity of the polypeptide is detected. A test compound which increases the PP2C-like Protein Phosphatase activity of the polypeptide relative to PP2C-like Protein Phosphatase activity in the absence of the test compound is thereby identified as a potential therapeutic agent for increasing Human PP2C-like Protein Phosphatase activity. A test compound which decreases PP2C-like Protein Phosphatase activity of the polypeptide relative to PP2C-like Protein Phosphatase activity in the absence of the test compound is thereby identified as a potential therapeutic agent for decreasing Human PP2C-like Protein Phosphatase activity.

Still another embodiment of the invention is a method of screening for agents which regulate a Human PP2C-like Protein Phosphatase activity. A test compound is contacted with a product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of :

nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1 ; the nucleotide sequence shown in SEQ ID NO. 1; nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 77; the nucleotide sequence shown in SEQ ID NO. 77.

Binding of the test compound to the product is detected. A test compound which binds to the product is thereby identified as a potential agent for decreasing the Human PP2C-like Protein Phosphatase activity.

Even another embodiment of the invention is a method of reducing Human PP2C- like Protein Phosphatase activity. A cell is contacted with a reagent which specifically binds to a product encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of : nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1; the nucleotide sequence shown in SEQ ID NO. 1 ;. nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 77; the nucleotide sequence shown in SEQ ID NO. 77.

The PP2C-like Protein Phosphatase activity in the cell is thereby decreased.

Yet another embodiment of the invention is a Human PP2C-like Protein Phosphatase polypeptide comprising an amino acid sequence selected from the group consisting of :

amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence shown in SEQ ID NO: 2; amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 78; the amino acid sequence shown in SEQ ID NO. 78.

Even another embodiment of the invention is an isolated and purified Human PP2C- like Protein Phosphatase polypeptide consisting essentially of the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 78.

Yet another embodiment of the invention is a Human PP2C-like Protein Phosphatase polynucleotide comprising nucleotide sequence selected from the group consisting of : nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1; the nucleotide sequence shown in SEQ ID NO. 1 ; nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 77; the nucleotide sequence shown in SEQ ID NO. 77.

Yet another embodiment of the invention is an isolated and purified Human PP2C- like Protein Phosphatase polynucleotide consisting essentially of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 77.

Still another embodiment of the invention is a preparation of antibodies which specifically bind to a polypeptide consisting essentially of the amino acid sequence selected from the group consisting of :

amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence shown in SEQ ID NO: 2; amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 78; the amino acid sequence shown in SEQ ID NO. 78.

The invention thus provides reagents and methods for regulating Human PP2C-like Protein Phosphatase which can be used to treat diseases that are caused by aberrant activity of Human PP2C-like Protein Phosphatase and diseases whose symptoms can be ameliorated by stimulating or inhibiting the activity of Human PP2C-like Protein Phosphatase. Such diseases include asthma, COPD and disorders associated with an increase in apoptosis, including AIDS and other infectious or genetic immuno- deficiencies, neurodegenerative diseases, myelodysplasia, ischemic injuries, toxin- induced diseases, wasting diseases, viral infections, and osteoporosis; disorders associated with a decrease in apoptosis, including cancer ; and inflammatory disorders.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1. Quantitative expression profile of Human PP2C-like Protein Phosphatase in various tissues of the human body.

FIG. 2. Relative expression profile of Human PP2C-like Protein Phosphatase in human lung tissues and cells of the human body.

DETAILED DESCRIPTION OF THE INVENTION A novel Human PP2C-like Protein Phosphatase is a discovery of the present invention. Human PP2C-like Protein Phosphatase is 44% identical over 346 amino acids to the protein identified with Genbank Accession Nos. AAG02232, AAG49433, and CAC27993 (SEQ ID NOS: 74,75, 76; all identical in sequence) and annotated respectively as"Ser/Thr protein phosphatase type 2C beta 2 isoform," "protein phosphatase 2C-like protein,"or"protein phosphatase 1B1 43 kDa isoform". A Pfamsearch indicates that Human PP2C-like Protein Phosphatase contains a Protein phosphatase 2C region from residues 1 to 241. The transcript sequence encoding Human PP2C-like Protein Phosphatase (SEQ ID NO: 1) contains multiple ESTs, which are shown in SEQ ID NOS: 3 through 73, indicating that this coding sequence is expressed. Further evidence that the gene is expressed was obtained by cloning its cDNA by reverse transcription-polymerase chain reaction from total RNA extracted from human spleen. The sequence of the cloned cDNA is shown in SEQ ID NO: 77. SEQ ID NO: 1 and SEQ ID NO: 77 represent two allelic variants of the Human PP2C-like Protein Phosphatase transcript and differ at three nucleotide residues within the coding sequence. SEQ ID NO: 1 is a cDNA with a length of 1596 bp, and contains an open reading frame from bases 77 to 1132. SEQ ID NO: 77 is a cDNA with a length of 1596 bp, and contains an open reading frame from bases 3 to 1058. The conceptual translation of SEQ ID NO: 1 is shown in SEQ ID NO: 2 and the conceptual translation of SEQ ID NO: 77 is shown in SEQ ID NO: 78. Both translations give a protein product 352 amino acids in length. The protein products of the two alleles differ at only one amino acid residue, residue number 85, which in SEQ ID NO: 2 is a phenylalanine and in SEQ ID NO: 78 is a cysteine.

Polypeptides PP2C-like Protein Phosphatase polypeptides according to the invention comprise at least 75,100, 125,150, 175,200, 250,300, or 350 contiguous amino acids of SEQ

IID NO: 2 or SEQ ID NO: 78 or a biologically active variant thereof, as defined below. A PP2C-like Protein Phosphatase polypeptide of the invention therefore can be a portion of a PP2C-like Protein Phosphatase molecule, a full-length PP2C-like Protein Phosphatase molecule, or a fusion protein comprising all or a portion of a PP2C-like Protein Phosphatase molecule. <BR> <BR> <P>BiologlcallyXctive Variants<BR> PP2C-like Protein Phosphatase variants which are biologically active, i. e. , retain a PP2C-like Protein Phosphatase activity, also are PP2C-like Protein Phosphatase polypeptides. Preferably, naturally or non-naturally occurring PP2C-like Protein Phosphatase variants have amino acid sequences which are at least about 50, preferably about 55,60, 70, more preferably about 75,80, 85,90, 95,96, 97,98, or 99% identical to an amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 78. Percent identity between a putative PP2C-like Protein Phosphatase variant and an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 78 is determined by <BR> <BR> conventional methods. See, for example, Altschul et al. , Bull. Math. Bio. 48: 603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1992).

Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the. BLOSUM62 scoring matrix of Henikoff & Henikoff, 1992. Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences.

The. FASTA. similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'1 Acad. Sci. USA 85: 2444 (1988), and by Pearson, Meth. Enzymol. 183: 63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e. g. , SEQ ID NO: 2 or 78) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions.

The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are. trimmed. to include only those residues that contribute to the highest score. If there are several regions with scores greater than the. cutoff. value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman & Wunsch, J.

Mol. Biol. 48: 444 (1970); Sellers, SIAM J. Appl. Math. 26: 787 (1974) ), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=l, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183: 63 (1990). FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.

Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replace- ments are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.

Amino acid insertions or deletions are changes to or within an amino acid sequence.

They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well

known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active PP2C-like Protein Phosphatase polypeptide can readily be determined by assaying for PP2C-like Protein Phosphatase activity, as is known in the art and described, for example, in the specific examples below.

Fusion Proteins Fusion proteins are useful for generating antibodies against PP2C-like Protein Phosphatase amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a PP2C-like Protein Phosphatase polypeptide, including its active site and phosphatase domains. Methods such as protein affinity chromatography or library- based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.

A PP2C-like Protein Phosphatase fusion protein comprises two protein segments fused together by means of a peptide bond. Contiguous amino acids for use in a fusion protein can be selected from the amino acid sequences shown in SEQ ID NO: 2 or SEQ ID NO: 78 or from a biologically active variant thereof, such as those described above. For example, the first protein segment can comprise at least 75, 100,125, 150,175, 200,250, 300, or 350 contiguous amino acids of SEQ ID NO: 2 or SEQ ID NO: 78 or a biologically active variant thereof. Preferably, a fusion protein comprises the active site of the PP2C-like Protein Phosphatase or the functional domains. The first protein segment also can comprise full-length PP2C- like Protein Phosphatase.

The second protein segment can be a full-length protein or a protein fragment or polypeptide. Proteins commonly used in fusion protein construction include beta- galactosidase, beta-glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST),

luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.

A fusion protein also can be engineered to contain a cleavage site located between the PP2C-like Protein Phosphatase polypeptide-encoding sequence and the heterologous protein sequence, so that the PP2C-like Protein Phosphatase poly- peptide can be cleaved and purified away from the heterologous moiety.

A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two protein segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises PP2C-like Protein Phosphatase coding sequences disclosed herein in proper reading frame with nucleotides encoding the second protein segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).

Identification ofSpecies Horrzologs Species homologs of Human PP2C-like Protein Phosphatase can be obtained using PP2C-like Protein Phosphatase polynucleotides (described below) to make suitable probes or primers to screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of PP2C-like Protein Phosphatase, and expressing the cDNAs as is known in the art.

Polynucleotides A PP2C-like Protein Phosphatase polynucleotide can be single-or double-stranded and comprises a coding sequence or the complement of a coding sequence for a PP2C-like Protein Phosphatase polypeptide. A nucleotide sequence encoding the Human PP2C-like Protein Phosphatase polypeptide shown in-SEQ ID NO : 2-is shown in SEQ ID NO: 1. A nucleotide sequence encoding the Human PP2C-like Protein Phosphatase polypeptide shown in SEQ ID NO: 78 is shown in SEQ ID NO: 77.

Degenerate nucleotide sequences encoding Human PP2C-like Protein Phosphatase polypeptides, as well as homologous nucleotide sequences which are at least about 50, preferably about 55,60, 65,70, more preferably about 75,80, 85,90, 95,96, 97, 98, or 99% identical to the PP2C-like Protein Phosphatase coding sequences nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 77 also are PP2C-like Protein Phosphatase polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of-12 and a gap extension penalty of-2. Complementary DNA (cDNA) molecules, species homologs, and variants of PP2C-like Protein Phos- phatase polynucleotides which encode biologically active PP2C-like Protein Phosphatase polypeptides also are PP2C-like Protein Phosphatase polynucleotides.

Identification of Variants and Homologs Variants and homologs of the PP2C-like Protein Phosphatase polynucleotides disclosed above also are PP2C-like Protein Phosphatase polynucleotides. Typically, homologous PP2C-like Protein Phosphatase polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known PP2C-like Protein Phosphatase polynucleotides under stringent conditions, as is known in the art. For

example, using the following wash conditions--2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each--homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.

Species homologs of the PP2C-like Protein Phosphatase polynucleotides disclosed herein can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of PP2C-like Protein Phosphatase polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1. 5°C with every 1% decrease in homology (Bonner et al., J : Mol. Biol. 81, 123 (1973). Variants of Human PP2C-like Protein Phosphatase polynucleotides or PP2C-like Protein Phosphatase poly- nucleotides of other species can therefore be identified, for example, by hybridizing a putative homologous PP2C-like Protein Phosphatase polynucleotide with a poly- nucleotide having a nucleotide sequence of SEQ ID NO: 1,3, 5,7, 9,11, 13, or 15 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising PP2C-like Protein Phosphatase polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.

Nucleotide sequences which hybridize to PP2C-like Protein Phosphatase poly- nucleotides or their complements'following stringent hybridization and/or wash conditions are also PP2C-like Protein Phosphatase polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed. , 1989, at<BR> pages 9. 50-9. 51.

Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a PP2C-like Protein Phosphatase polynucleotide having a coding sequence disclosed herein and a polynucleotide sequence which is at least about 50, preferably about 75,90, 96, or 98% identical to that nucleotide sequence can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U. S. A. 4f, 1390 (1962): Tm = 81. 5°C-16. 6 (logio [Na+]) + 0.41 (% G + C) -0. 63 (% formamide)-600/1), where/= the length of the hybrid in basepairs.

Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0. 5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.

Preparation o Polvnucleotides A naturally occurring PP2C-like Protein Phosphatase polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or synthesized using an automatic synthesizer.

Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated PP2C-like Protein Phosphatase polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprise PP2C-like Protein Phosphatase nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70,80, or 90% free of other molecules.

PP2C-like Protein Phosphatase cDNA molecules can be made with standard molecular biology techniques, using PP2C-like Protein Phosphatase mRNA as a template. PP2C-like Protein Phosphatase cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of PP2C-like Protein Phosphatase poly- nucleotides, using either human genomic DNA or cDNA as a template.

Alternatively, synthetic chemistry techniques can be used to synthesize PP2C-like Protein Phosphatase polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a PP2C-like Protein Phosphatase polypeptide having, for example, the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof.

Obtaining Full-Length Pol The partial sequences of SEQ ID NOS: 1,3, 5,7, 9,11, 13, and 15 or their complements can be used to identify the corresponding full length gene from which they were derived. The partial sequences can be nick-translated or end-labeled with 32p using polynucleotide kinase using labeling methods known to those with skill in <BR> <BR> the art (BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al., eds. , Elsevier Press,<BR> N. Y. , 1986). A lambda library prepared from human tissue can be directly screened with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al., 1989, pg. 1.20).

Both methods are well known in the art. Briefly, filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters. The filters are hybridized with the labeled probe using hybridization conditions described by Davis et al., 1986. The partial sequences, cloned into lambda or pBluescript, can be used as positive controls

to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification. The resulting autoradio- grams are compared to duplicate plates of colonies or plaques ; each exposed spot corresponds to a positive colony or plaque. The colonies or plaques are selected and expanded, and the DNA is isolated from the colonies for further analysis and sequencing.

Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector. Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert of the same size or similar as the mRNA size determined from Northern blot Analysis.

Once one or more overlapping cDNA clones are identified, the complete sequence of the clones can be determined, for example after exonuclease III digestion (McCombie et al., Methods 3, 33-40,1991). A series of deletion clones are generated, each of which is sequenced. The resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.

Various PCR-based methods can be used to extend the nucleic acid sequences encoding the disclosed portions of Human PP2C-like Protein Phosphatase to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322,1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first

one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.

Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al., Nucleic Acids Res. 16, 8186,1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc. , Plymouth, Mimi.), to be 22-30 nucleo- tides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.

Another method which can be used is capture PCR, which involves PCR amplifi- cation of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al., PCR Methods Applic. 1, 111-119, 1991). In this method, multiple restriction enzyme digestions and ligations are used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.

Another method which can be used to retrieve unknown sequences is that of Parker et al., Nucleic Acids Res. 19, 3055-3060,1991. Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA. This process avoids the need to screen libraries and is useful in finding intron/exon junctions.

When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Also, random-primed libraries are preferable, in that they will contain more sequences which contain the 5'regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d (T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5'non-transcribed regulatory regions.

Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e. g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.

Obtaining Polypeptides PP2C-like Protein Phosphatase polypeptides can be obtained, for example, by purification from-cells, by expression of PP2C-like Protein Phosphatase poly- nucleotides, or by direct chemical synthesis.

Protein Purification PP2C-like Protein Phosphatase polypeptides can be purified from cells, including cells which have been transfected with PP2C-like Protein Phosphatase expression constructs. Human germinal B cells and normal prostate epithelial cells are especially useful sources of PP2C-like Protein Phosphatase polypeptides. A purified PP2C-like Protein Phosphatase polypeptide is separated from other compounds which normally associate with the PP2C-like Protein Phosphatase polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chroma- tography, and preparative gel electrophoresis. A preparation of purified PP2C-like

Protein Phosphatase polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Enzymatic activity of the purified preparations can be assayed, for example, as described in the specific examples, below.

Expression of Polynucleotides To express a PP2C-like Protein Phosphatase polypeptidej a PP2C-like Protein Phosphatase polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding PP2C-like Protein Phosphatase polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N. Y, 1989.

A variety of expression vector/host systems can be utilized to contain and express sequences encoding a PP2C-like Protein Phosphatase polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e. g., baculovirus), plant cell systems transformed with virus <BR> <BR> expression vectors (e. g. , cauliflower mosaic virus, CaMV ; tobacco mosaic virus, TMV) or with bacterial expression vectors (e. g., Ti or pBR322 plasmids), or animal cell systems.

The control elements or regulatory sequences are those non-translated regions of the vector--enhancers, promoters, 5'and 3'untranslated regions--which interact with

host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif. ) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e. g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e. g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a PP2C-like Protein Phosphatase polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.

Bacterial and Yeast Expression S In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the PP2C-like Protein Phosphatase polypeptide. For example, when a large quantity of a PP2C-like Protein Phosphatase polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the sequence encoding the PP2C-like Protein Phosphatase polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ß-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509,1989 or pGEX vectors (Promega, Madison, Wis. ) can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of

free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or Factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.

In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.

For reviews, see Ausubel et al. (1989) and Grant et al., Methods Enzymol. 153, 516- 544,1987.

Plant and Insect Expression Svstems If plant expression vectors are used, the expression of sequences encoding PP2C-like Protein Phosphatase polypeptides can be driven by any of a number of promoters.

For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu EMBO J. 6, 307-311,1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al., EMBO J 3,1671- 1680,1984 ; Broglie et al., Science 224, 838-843,1984 ; Winter et al., Results Probl.

Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (see, for example, Hobbs or Murray, in McGRAw HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N. Y. , pp. 191-196,1992).

An insect system also can be used to express a PP2C-like Protein Phosphatase poly- peptide. For example, in one such system Autographa californica nuclear poly- hedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding PP2C-like Protein Phosphatase polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.

Successful insertion of PP2C-like Protein Phosphatase polypeptides will render the

polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which PP2C-like Protein Phosphatase polypeptides can be expressed (Engelhard et al., Proc. Nat. Acad. Sci. 91, 3224-3227,1994).

Mammalian Expression Svstems A number of viral-based expression systems can be utilized in mammalian host cells.

For example, if an adenovirus is used as an expression vector, sequences encoding PP2C-like Protein Phosphatase polypeptides can be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a PP2C-like Protein Phosphatase polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad.

Sci. 81, 3655-3659,1984). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.

Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e. g., liposomes, polycationic amino polymers, or vesicles).

Specific initiation signals also can be used to achieve more efficient translation of sequences encoding PP2C-like Protein Phosphatase polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a PP2C-like Protein Phosphatase polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided.

The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al., Results Probl. Cell Differ. 20,125-162, 1994).

Host Cells A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process an expressed PP2C-like Protein Phosphatase polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a"prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and charac- teristic mechanisms for post-translational activities (e. g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.

Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express PP2C-like Protein Phos- phatase polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced PP2C-like Protein Phosphatase sequences.

Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type.

Any number of selection systems can be used to recover transformed cell lines.

These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11, 223-32,1977) and adenine phosphoribosyltransferase (Lowy et al., Cell 22, 817-23,1980). Genes which can be employed in tk or aprt cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci. 77,3567-70, 1980); npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al., J : Mol. Biol. 150, 1- 14,1981) ; and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992 supra). Additional selectable genes have been described, for example trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51,1988). Visible markers such as anthocyanins, ß-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al., Methods Mol. Biol. 55, 121-131,1995).

Detecting Expression of Polvpeptides Although the presence of marker gene expression suggests that the PP2C-like Protein Phosphatase polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a PP2C-like Protein Phosphatase polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a PP2C-like Protein Phosphatase polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a PP2C-like Protein Phosphatase polypeptide under the control of a single promoter. Expression of the marker gene in

response to induction or selection usually indicates expression of the PP2C-like Protein Phosphatase polynucleotide.

Alternatively, host cells which contain a PP2C-like Protein Phosphatase poly- nucleotide and which express a PP2C-like Protein Phosphatase polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.

The presence of a polynucleotide sequence encoding a PP2C-like Protein Phos- phatase polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a PP2C-like Protein Phosphatase polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a PP2C-like Protein Phosphatase polypeptide to detect transformants which contain a PP2C-like Protein Phosphatase polynucleotide.

A variety of protocols for detecting and measuring the expression of a PP2C-like Protein Phosphatase polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a PP2C-like Protein Phos- phatase polypeptide can be used, or a competitive binding assay can be employed.

These and other assays are described in Hampton et al., SEROLOGICAL METHODS : A <BR> <BR> LABORATORY MANUAL, APS Press, St. Paul, Minn. , 1990) and Maddox et al., J Exp.

Med. 158, 1211-1216, 1983).

A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding PP2C-like Protein Phosphatase polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a PP2C-like Protein Phosphatase polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase, such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, factors, inhibitors, magnetic particles,. and the like.

Expression and Purification of Polvpeptides Host cells transformed with nucleotide sequences encoding a PP2C-like Protein Phosphatase polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode PP2C-like Protein Phosphatase polypeptides can be designed to contain signal sequences which direct secretion of PP2C-like Protein Phosphatase polypeptides through a prokaryotic or eukaryotic cell membrane.

Other constructions can be used to join a sequence encoding a PP2C-like Protein Phosphatase polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating

domains include, but are not limited to, metal chelating peptides such as histidine- tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp. ,<BR> Seattle, Wash. ). The inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the PP2C-like Protein Phosphatase polypeptide can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a PP2C-like Protein Phosphatase polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography as described in Porath et al., Prot. Exp. Purif 3,263-281, 1992), while the enterokinase cleavage site provides a means for purifying the PP2C-like Protein Phosphatase polypeptide from the fusion protein. Vectors which contain fusion proteins are disclosed in Kroll et al., DNA Cell Biol. 12, 441-453,1993).

Chemical S Sequences encoding a PP2C-like Protein Phosphatase polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al., Nucl. Acids Res. Symp. Sei-. 215-223,1980 ; Horn et al. Nucl. Acids Res. Snip. Ser. 225-232,1980). Alternatively, a PP2C-like Protein Phosphatase polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence. For example, PP2C-like Protein Phosphatase polypeptides can be produced by direct peptide synthesis using solid-phase techniques (Merrifield, J Am.

Chem. Soc. 85, 2149-2154,1963 ; Roberge et al., Science 269, 202-204,1995).

Protein synthesis can be performed using manual techniques or by automation.

Automated synthesis can be achieved, for example, using Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer). Various fragments of PP2C-like Protein Phosphatase polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.

The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e. g. , Creighton, PROTEINS: STRUCTURES AND<BR> MOLECULAR PRINCIPLES, WH Freeman and Co. , New York, N. Y. , 1983). The com- position of a synthetic PP2C-like Protein Phosphatase polypeptide can be confirmed <BR> <BR> by amino acid analysis or sequencing (e. g. , the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the PP2C-like Protein Phosphatase polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.

Production ofAltered Polyeptides As will be understood by those of skill in the art, it may be advantageous to produce PP2C-like Protein Phosphatase polypeptide-encoding nucleotide sequences posses- sing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.

The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter PP2C-like Protein Phosphatase polypeptide- encoding sequences for a variety of reasons, including modification of the cloning, processing, and/or expression of the gene product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.

Antibodies Any type of antibody known in the art can be generated to bind specifically to an epitope of a PP2C-like Protein Phosphatase polypeptide. "Antibody"as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F (ab') 2, and Fv, which are capable of binding an. epitope of a PP2C-like Protein Phosphatase polypeptide. Typically, at least 6,8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e. g., at least 15,25, or 50 amino acids.

An antibody which specifically binds to an epitope of a PP2C-like Protein Phos- phatase polypeptide can be used therapeutically, as well as in immunochemical assays, including but not limited to Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.

Typically, an antibody which specifically binds to a PP2C-like Protein Phosphatase polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to PP2C-like Protein Phos- phatase polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a PP2C-like Protein Phosphatase polypeptide from solution.

PP2C-like Protein Phosphatase polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a PP2C-like Protein Phosphatase polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and

keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e. g., aluminum hydroxide), and surface active substances (e. g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.

Monoclonal antibodies which specifically bind to a PP2C-like Protein Phosphatase polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al., Nature 256, 495-497, 1985; Kozbor et al., J : Immunol. Methods 81, 31-42,1985 ; Cote et al., Proc. Natl.

Acad. Sci. 80, 2026-2030, 1983; Cole et al., Mol. Cell Biol. 62, 109-120,1984).

In addition, techniques developed for the production of"chimeric antibodies,"the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al., Proc. Natl. Acad. Sci. 81, 6851-6855, 1984 ; Neuberger et al., Nature 312, 604-608, 1984; Takeda et al., Nature 314, 452-454,1985). Monoclonal and other antibodies also can be"humanized"to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, one can produce humanized antibodies using recombinant methods, as described in GB2188638B. Antibodies which specifically bind to a PP2C-like Protein Phos-

phatase polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U. S. 5,565, 332.

Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to PP2C-like Protein Phosphatase polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl.

Acad. Sci. 88, 11120-23, 1991).

Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al., 1996, Eur. J Cancer Prev. 5, 507-11). Single-chain antibodies can be mono-or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. BiotechnoL 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J ; Biol. Chem. 269, 199-206.

A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology. Verhaar et al., 1995, Int. J Cancer 61, 497-501; Nicholls et al., 1993, J. Immunol. Meth. 165, 81- 91.

Antibodies which specifically bind to PP2C-like Protein Phosphatase polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al., Proc. Natl. Acad Sci. 86, 3833-3837, 1989 ; Winter et al., Nature 349, 293-299,1991).

Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the"diabodies"described in WO 94/13804, also can be prepared.

Antibodies of the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a PP2C-like Protein Phosphatase polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

Antisense Oligonucleotides Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12,15, 20,25, 30,35, 40,45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of PP2C-like Protein Phosphatase gene products in the cell.

Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5'end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.

Biol. 20,1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72,1994 ; Uhhnann et al., Chem. Rev. 90, 543-583,1990.

Modifications of PP2C-like Protein Phosphatase gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the PP2C-like Protein Phosphatase gene. Oligonucleotides derived from the transcription initiation site, e. g., between positions-10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using"triple helix"base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e. g., Gee et al., in Huber & Carr, <BR> <BR> MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co. , Mt. Kisco,<BR> N. Y. , 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.

Precise complementarity is not required for successful duplex formation between an antisense oligonucleotide and the complementary sequence of a PP2C-like Protein Phosphatase polynucleotide. Antisense oligonucleotides which comprise, for example, 2,3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a PP2C-like Protein Phosphatase polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent PP2C-like Protein Phosphatase nucleotides, can provide targeting specificity for PP2C-like Protein Phosphatase mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4,5, 6,7, or 8 or more nucleotides in length. Non- complementary intervening sequences are preferably 1,2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular PP2C-like Protein Phosphatase polynucleotide sequence.

Antisense oligonucleotides can be modified without affecting their ability to hybridize to a PP2C-like Protein Phosphatase polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3'hydroxyl group or the 5'phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.

These modified oligonucleotides can be prepared by methods well known in the art.

See, e. g., Agrawal et al., Trends Biotechnol. 10, 152-158,1992 ; Uhlmann et al., Chem. Rev. 90, 543-584,1990 ; Uhlmann et al., Tetrahedron. Lett. 215, 3539-3542, 1987.

Ribozymes Ribozymes are RNA molecules with catalytic activity. See, e. g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin.

Struct. Biol. 2,605-609 ; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e. g., Haseloff et al., U. S. Patent 5,641, 673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to, complementary target RNA, followed by endonucleolytic cleavage.

Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.

The coding sequence of a PP2C-like Protein Phosphatase polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the PP2C-like Protein Phosphatase polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff

et al. Nature 334, 585-591,1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete"hybridization"region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al., EP 321,201).

Specific ribozyme cleavage sites within a PP2C-like Protein Phosphatase RNA target are initially identified by scanning the RNA molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the PP2C-like Protein Phosphatase target RNA containing the cleavage site can be evaluated for secondary structural features which, may render the target inoperable. The suitability of candidate targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribo- nuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related; thus, upon hybridizing to the PP2C-like Protein Phosphatase target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.

Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease PP2C-like Protein Phosphatase expression. Alternatively, if it is desired that the cells stably retain the DNA construct, it can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. The DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.

As taught in Haseloff et al., U. S. Patent 5,641, 673, ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of PP2C-like Protein Phosphatase mRNA occurs only when both a ribozyme and a target gene are induced in the cells.

Screening Methods <BR> <BR> The invention provides methods for identifying modulators, i. e. , candidate or test compounds which bind to PP2C-like Protein Phosphatase polypeptides or poly- nucleotides and/or have a stimulatory or inhibitory effect on, for example, expression or activity of the PP2C-like Protein Phosphatase polypeptide or polynucleotide, so as to regulate degradation of the extracellular matrix. Decreased extracellular matrix degradation is useful for preventing or suppressing malignant cells from metastasiz- ing. Increased extracellular matrix degradation may be desired, for example, in developmental disorders characterized by inappropriately low levels of extracellular matrix degradation or in regeneration.

The invention provides assays for screening test compounds which bind to or modulate the activity of a PP2C-like Protein Phosphatase polypeptide or a PP2C-like Protein Phosphatase polynucleotide. A test compound preferably binds to a PP2C- like Protein Phosphatase polypeptide or polynucleotide. More preferably, a test compound decreases a PP2C-like Protein Phosphatase activity of a PP2C-like Protein Phosphatase polypeptide or expression of a PP2C-like Protein Phosphatase polynucleotide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.

Test Compounds Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The com-

pounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the"one-bead one-compound"library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145,1997.

Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al., Proc. Natl. Acad. Sci. U. SA. 90, 6909,1993 ; Erb et al. Proc.

Natl. Acad. Sci. U. Sua. 91, 11422,1994 ; Zuckermann et al., J Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303,1993 ; Carell et al., Angew. Chez. Int. Ed. Engl.

33,2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061 ; Gallop et al., J : Med. Chem. 37,1233, 1994). Libraries of compounds can be presented in solution (see, e. g., Houghten, BioTechniques 13, 412-421,1992), or on beads (Lam, Nature 354, 82-84,1991), chips (Fodor, Nature 364, 555-556,1993), bacteria or spores (Ladner, U. S. Patent 5,223, 409), plasmids (Cull et dl., Proc. Natl. Acad. Sci. U. S. A.

89, 1865-1869,1992), or phage (Scott & Smith, Science 249, 386-390,1990 ; Devlin, Science 249, 404-406,1990) ; Cwirla et al., Proc. Natl. Acad. Sci. 97, 6378-6382, 1990; Felici, J ; Mol. Biol. 222,301-310, 1991 ; and Ladner, U. S. Patent 5,223, 409).

High Throughput Screenin¢ Test compounds can be screened for the ability to bind to PP2C-like Protein Phosphatase polypeptides or polynucleotides or to affect PP2C-like Protein Phosphatase activity or PP2C-like Protein Phosphatase gene expression using high throughput screening. Using high throughput screening, many discrete compounds

can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates.

The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ul. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.

Alternatively, "free format assays, "or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by' Jayawickreme et al., Proc. Natl. Acad. Sci. U. S. A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.

Another example of a free format assay is described by Chelsky, "Strategies for<BR> Screening Combinatorial Libraries: Novel and Traditional Approaches, "reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10,1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combina- torial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.

Yet another example is described by Salmon et al., Molecular Diversity 2,57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.

Another high throughput screening method is described in Beutel et al., U. S. Patent 5,976, 813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.

When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.

Bi7çding Assaws For binding assays, the test compound is preferably a small molecule which binds to and occupies the active site or the fad-like domain of the PP2C-like Protein Phosphatase polypeptide, thereby making the active site or phosphatase domains inaccessible to substrate such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules. In binding assays, either the test compound or the PP2C-like Protein Phosphatase polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the PP2C-like Protein Phosphatase polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.

Alternatively, binding of a test compound to a PP2C-like Protein Phosphatase poly- peptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a target polypeptide. A microphysiometer (e. g., Cytosensor) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light- addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a PP2C-like Protein Phosphatase polypeptide. (McConnell et al., Science 257, 1906-1912,1992).

Determining the ability of a test compound to bind to a PP2C-like Protein Phos- phatase polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA). Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345,1991, and Szabo et al., Curr. Opin. Struct. Biol. 5, 699-705,1995. BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e. g., BIAcore). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.

In yet another aspect of the invention, a PP2C-like Protein Phosphatase polypeptide can be used as a"bait protein"in a two-hybrid assay or three-hybrid assay (see, e. g., U. S. Patent 5,283, 317; Zervos et al., Cell 72, 223-232,1993 ; Madura et al., J Biol.

Chem. 268, 12046-12054,1993 ; Bartel et al., BioTechniques 14, 920-924,1993 ; Iwabuchi et al., Oncogene 8, 1693-1696,1993 ; and Brent W094/10300), to identify other proteins which bind to or interact with the PP2C-like Protein Phosphatase polypeptide and modulate its activity.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct a poly- nucleotide encoding a PP2C-like Protein Phosphatase polypeptide is fused to a polynucleotide encoding the DNA binding domain of a known transcription factor <BR> <BR> (e. g. , GAL-4). In the other construct, a DNA sequence that encodes an unidentified protein ("prey"or"sample") is fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the"bait"and the"prey"proteins are able to interact in vivo to form a protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e. g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor.

Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence

encoding the protein which interacts with the PP2C-like Protein Phosphatase polypeptide.

It may be desirable to immobilize either the PP2C-like Protein Phosphatase poly- peptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the PP2C-like Protein Phosphatase polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the PP2C-like Protein Phosphatase polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a PP2C-like Protein Phosphatase polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.

In one embodiment, a PP2C-like Protein Phosphatase polypeptide is a fusion protein comprising a domain that allows the PP2C-like Protein Phosphatase polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed PP2C-like Protein Phos- phatase polypeptide; the mixture is then incubated under conditions conducive to complex formation (e. g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or

indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.

Other techniques for immobilizing polypeptides or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a PP2C-like Protein Phosphatase polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated PP2C-like Protein Phosphatase polypeptides or test compounds can be prepared from biotin-NHS (N-hydroxysuccinimide) using techniques well known in the art (e. g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a PP2C-like Protein Phosphatase polypeptide polynucleotides, or a test compound, but which do not interfere with a desired binding site, such as the active site or a phosphatase domain of the PP2C-like Protein Phosphatase poly- peptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.

Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using anti- bodies which specifically bind to the PP2C-like Protein Phosphatase polypeptide (or polynucleotides) or test compound, enzyme-linked assays which rely on detecting a PP2C-like Protein Phosphatase activity of the PP2C-like Protein Phosphatase polypeptide, and SDS gel electrophoresis under non-reducing conditions.

Screening for test compounds which bind to a PP2C-like Protein Phosphatase polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a PP2C-like Protein Phosphatase polynucleotide or polypeptide can be used in a cell-based assay system. A PP2C-like Protein Phosphatase poly- nucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, including neoplastic cell lines such as the colon cancer cell lines HCT116,

DLD1, HT29, Caco2, SW837, SW480, and RKO, breast cancer cell lines 21-PT, 21- MT, MDA-468, SK-BR3, and BT-474, the A549 lung cancer cell line, and the H392 glioblastoma cell line, can be used. An intact cell is contacted with a test compound.

Binding of the test compound to a PP2C-like Protein Phosphatase polypeptide or polynucleotide is determined as described above, after lysing the cell to release the PP2C-like Protein Phosphatase polypeptide-or polynucleotide-test compound complex.

Enzyme Assays Test compounds can be tested for the ability to increase or decrease a PP2C-like Protein Phosphatase activity of a PP2C-like Protein Phosphatase polypeptide. PP2C- like Protein Phosphatase activity can be measured, for example, using the methods described in the specific examples, below. PP2C-like Protein Phosphatase activity can be measured after contacting either a purified PP2C-like Protein Phosphatase polypeptide, a cell extract, or an intact cell with a test compound. A test compound which decreases PP2C-like Protein Phosphatase activity by at least about 10, preferably about 50, more preferably about 75,90, or 100% is identified as a potential therapeutic agent for decreasing Human PP2C-like Protein Phosphatase activity. A test compound which increases PP2C-like Protein Phosphatase activity by at least about 10, preferably about 50, more preferably about 75,90, or 100% is identified as a potential therapeutic agent for increasing Human PP2C-like Protein Phosphatase activity.

Gene Expression In another embodiment, test compounds which increase or decrease PP2C-like Protein Phosphatase gene expression are identified. A PP2C-like Protein Phos- phatase polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the PP2C-like Protein Phosphatase polynucleotide is determined. The level of expression of PP2C-like Protein Phosphatase mRNA or

polypeptide in the presence of the test compound is compared to the level of expression of PP2C-like Protein Phosphatase mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of PP2C-like Protein Phosphatase mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of PP2C-like Protein Phosphatase mRNA or polypeptide is less expression.

Alternatively, when expression of the mRNA or protein is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of PP2C-like Protein Phosphatase mRNA or polypeptide expression.

The level of PP2C-like Protein Phosphatase mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or protein. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a PP2C-like Protein Phosphatase polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a PP2C-like Protein Phosphatase polypeptide.

Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell which expresses a PP2C-like Protein Phosphatase polynucleotide can be used in a cell-based assay system. The PP2C-like Protein Phosphatase poly- nucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, including neoplastic cell lines such as the colon cancer cell lines HCT116, DLD1, HT29, Caco2, SW837, SW480, and RKO, breast cancer cell lines 21-PT, 21- MT, MDA-468, SK-BR3, and BT-474, the A549 lung cancer cell line, and the H392 glioblastoma cell line, can be used.

Pharmaceutical Compositions The invention also provides pharmaceutical compositions which can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise a PP2C-like Protein Phosphatase polypeptide, PP2C-like Protein Phosphatase polynucleotide, antibodies which specifically bind to a PP2C- like Protein Phosphatase polypeptide, or mimetics, agonists, antagonists, or inhibitors of a PP2C-like Protein Phosphatase polypeptide. The compositions can be admi- nistered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.

In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.

Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers,

such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose ; gums including arabic and tragacanth ; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.

Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e. , dosage.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions : Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.

Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the

suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e. g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.

Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., <BR> <BR> Easton, Pa. ). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condi- tion. Such labeling would include amount, frequency, and method of administration.

Diagnostic Methods The Human PP2C-like Protein Phosphatase and polynucleotides encoding it can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding Human PP2C-like Protein Phosphatase in individuals afflicted with a disease and in normal individuals. If a

mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.

Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.

Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e. g., Myers et al., Science 230,1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and Sl protection or the chemical cleavage method (e. g., Cotton et al., Proc. Natl. Acad. Sci. USA 85, 4397- 4401,1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.

In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

Altered levels of Human PP2C-like Protein Phosphatase also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.

Therapeutic Indications and Methods The Human PP2C-like Protein Phosphatase is expressed in tissues of the immune system, as demonstrated by the existence of Human PP2C-like Protein Phosphatase transcript-derived ESTs in libraries derived from germinal B-cells (flow-sorted from tonsils) (e. g. , SEQ ID NO : 70) and blood lymphocytes (e. g., SEQ ID NO: 5).

Furthermore, our quantitative expression profiling experiments show that Human PP2C-like Protein Phosphatase is expressed highest in the spleen, among 52 tissues and cells tested, and shows moderate expression in other immune tissues and cells such as thymus, tonsil, and activated CD4+ T cells (FIG. 1). The expression in these tissues and cells demonstrates that the activity of the Human PP2C-like Protein Phosphatase can be modulated to treat allergic or inflammatory diseases such as asthma and COPD.

Allergy is a complex process in which environmental antigens induce clinically adverse reactions. Asthma can be understood as an basically allergic disease of the lung and its tissues. The asthma inducing antigens, called allergens, typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction. Hypersensitivity reactions can be local or systemic and typically occur within minutes after allergen exposure in individuals who have previously been sensitized to the respective allergen. The hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions. Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.

Asthma is thought to arise as a. result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a narrowing of the airways, 2) airway hyperresponsiveness, and 3) airway inflammation. Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE. These effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to tissue destruction related to the disorder. Other resident cells, such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to its pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually makes asthma a chronic and disabling disorder requiring long-term management.

Chronic obstructive pulmonary (or airways) disease (COPD) is a condition defined physiologically as airflow obstruction that generally results from a mixture of emphysema and peripheral airway obstruction due to chronic bronchitis. Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung. Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years. In COPD, airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does also occur in non-smokers.

Chronic inflammation of the airways is a key pathological feature of COPD. The inflammatory cell population comprises increased numbers of macrophages, neutrophils and CD8+ lymphocytes. Inhaled irritants such as cigarette smoke activate macrophages resident in the respiratory tract as well as epithelial cells leading to release of chemokines (e. g. , interleukin-8) and other chemotactic factors which act to increase the neutrophil/monocyte trafficking from the blood into lung tissue and airways. Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species. Matrix degradation and emphysema, along with airway wall thickening, surfactant dysfunction and mucus hypersecretion are all potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.

In both asthma and COPD, although resident cells of the lungs play important parts in disease induction, the movement of inflammatory cells into respiratory tissues can be considered a prerequisite for the late-phase and chronic pathologies of these diseases. Members of the PP2C family of serine/threonine protein phosphotases have recently been shown to be important in the intracellular signaling pathways related to the reorganization of the actin cytoskeleton and cell mobility (Koh et al., Current Biology 12, 317-321,2002). Therefore, in one embodiment, Human PP2C-like Protein Phosphatase or a portion or biologically active variant thereof may be administered to a subject to prevent or treat an allergic or inflammatory disorder, such as asthma or COPD. In another embodiment, an agonist which is specific for Human PP2C-like Protein Phosphatase may be administered to a subject to regulate the intracellular signaling pathways involved in reorganization of the actin cytoskeleton and cell mobility, and thereby prevent or treat an allergic or inflammatory disorder, such as asthma or COPD.

During fetal development, decreased expression of Human PP2C-like Protein Phosphatase may cause an increase in apoptosis with no adverse effects to the subject. However, in other situations and in adults, decreased expression of Human PP2C-like Protein Phosphatase may cause an increase in apoptosis which is

detrimental to the subject. Therefore, in another embodiment, Human PP2C-like Protein Phosphatase or a portion or biologically active variant thereof may be administered to a subject to prevent or treat a disorder associated with an increase in apoptosis. Such disorders include, but are not limited to, AIDS and other infectious or genetic immunodeficiencies, neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, and cerebellar degeneration, myelodysplasia syndromes such as aplastic anemia, ischemic injuries such as myocardial infarction, stroke, and reperfusion injury, toxin- induced diseases such as alcohol-induced liver damage, cirrhosis, and lathyrism, wasting diseases such as cachexia, viral infections such as those caused by hepatitis B and C, and osteoporosis. In another embodiment, an agonist which is specific for Human PP2C-like Protein Phosphatase may be used to prevent or treat a disorder associated with increased apoptosis including, but not limited to, those listed above.

In still another embodiment, a vector capable of expressing Human PP2C-like Protein Phosphatase, or a fragment or a derivative thereof, may be used to prevent or treat a disorder associated with increased apoptosis including, but not limited to, those listed above.

Human PP2C-like Protein Phosphatase agonists and antagonists may be used to mimic, augment or inhibit the action of the enzyme, which may be useful to treat osteoporosis, Paget's disease, degradation of bone implants particularly dental implants. Osteoporosis is a disease characterized by low bone mass and micro- architectural deterioration of bone tissue, leading to enhanced bone fragility and a consequent increase in fracture risk. It is the most common human metabolic bone disorder. Established osteoporosis includes the presence of fractures.

Bone turnover occurs by the action of two major effector cell types within bone: the osteoclast, which is responsible for bone resorption, and the osteoblast, which synthesizes and mineralizes bone matrix. The actions of osteoclasts and osteoblasts are highly coordinated. Osteoclast precursors are recruited to the site of turnover; they differentiate and fuse to form mature osteoclasts which then resorb bone.

Attached to the bone surface, osteoclasts produce an acidic microenvironment in a tightly defined junction between the specialized osteoclast border membrane and the bone matrix, thus allowing the localized solubilization of bone matrix. This in turn facilitate the proteolysis of demineralized bone collagen. Matrix degradation is thought to release matrix-associated growth factor and cytokines, which recruit osteoblasts in a temporally and spatially controlled fashion. Osteoblasts synthesize and secrete new bone matrix proteins, and subsequently mineralize this new matrix.

In the normal skeleton this is a physiological process which does not result in a net change in bone mass. In pathological states, such as osteoporosis, the balance between resorption and formation is altered such that bone loss occurs. See WO 99/45923.

The osteoclast itself is the direct or indirect target of all currently available osteoporosis agents with the possible exception of fluoride. Antiresorptive therapy prevents further bone loss in treated individuals. Osteoblasts are derived from multipotent stem cells which reside in bone marrow and also gives rise to adipocytes, chondrocytes, fibroblasts and muscle cells. Selective enhancement of osteoblast activity is a highly desirable goal for osteoporosis therapy since it would result in an increase in bone mass, rather than a prevention of further bone loss. An effective anabolic therapy would be expected to lead to a significantly greater reduction in fracture risk than currently available treatments.

The agonists or antagonists to the newly discovered polypeptides may act as antiresorptive by directly altering the osteoclast differentiation, osteoclast adhesion to the bone matrix or osteoclast function of degrading the bone matrix. The agonists or antagonists could indirectly alter the osteoclast function by interfering in the synthesis and/or modification of effector molecules of osteoclast differentiation or function such as cytokines, peptide or steroid hormones, proteases, etc.

The agonists or antagonists to the newly discovered polypeptides may act as anabolics by directly enhancing the osteoblast differentiation and/or its bone matrix

forming function. The agonists or antagonists could also indirectly alter the osteoblast function by enhancing the synthesis of growth factors, peptide or steroid hormones or decreasing the synthesis of inhibitory molecules.

In a further embodiment, Human PP2C-like Protein Phosphatase or a fragment or derivative thereof may be added to cells to stimulate cell proliferation. In particular, Human PP2C-like Protein Phosphatase may be added to a cell or cells in vivo using delivery mechanisms such as liposomes, viral based vectors, or electroinjection for the purpose of promoting regeneration or cell differentiation of the cell or cells. In addition, Human PP2C-like Protein Phosphatase may be added to a cell, cell line, tissue, or organ culture in vitro or ex vivo to stimulate cell proliferation for use in heterologous or autologous transplantation. In some cases, the cell will have been selected for its ability to fight an infection or a cancer or to correct a genetic defect in. a disease such as sickle cell anemia, j3 thalassemia, cystic fibrosis, or Huntington's chorea.

In another further embodiment, an agonist which is specific for Human PP2C-like Protein Phosphatase may be administered to a cell to stimulate cell proliferation, as described above.

In another further embodiment, a vector capable of expressing Human PP2C-like Protein Phosphatase or a portion or a biologically active variant thereof, may be administered to a cell or cells in vivo using delivery mechanisms, or to a cell to stimulate cell proliferation, as described above.

Increased expression of Human PP2C-like Protein Phosphatase may be associated with increased cell proliferation. Therefore, in one embodiment, an antagonist of Human PP2C-like Protein Phosphatase or a portion or a biologically active variant thereof may be administered to a subject to prevent or treat cancer. Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal

counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these aberrant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.

Most standard cancer therapies target cellular proliferation and rely on the differen- tial proliferative capacities between transformed and normal cells for their efficacy.

This approach is hindered by the facts that several important normal cell types are also highly proliferative and that cancer cells frequently become resistant to these agents. Thus, the therapeutic indices for traditional anti-cancer therapies rarely exceed 2.0.

The advent of genomics-driven molecular target identification has opened up the possibility of identifying new cancer-specific targets for therapeutic intervention that will provide safer, more effective treatments for cancer patients. Thus, newly discovered tumor-associated genes and their products can be tested for their role (s) in disease and used as tools to discover and develop innovative therapies. Genes playing important roles in any of the physiological processes outlined above can be characterized as cancer targets.

Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.

These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities. Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and

toxicological analyses form the basis for drug development and subsequent testing in humans.

Cancers which can be treated according to the invention include, but are not limited to, adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma, and particularly, cancers of the adrenal gland, bladder, bone, bone marrow, brain, breast, cervix, gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle, ovary, pancreas, parathyroid, penis, prostate, salivary glands, skin, spleen, testis, thymus, thyroid, and uterus. In one aspect, an antibody specific for Human PP2C-like Protein Phosphatase may be used directly as an antagonist, or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissue which express Human PP2C-like Protein Phosphatase.

In still another embodiment, a vector expressing the complementary sequence or antisense of the polynucleotide encoding Human PP2C-like Protein Phosphatase or a portion or biologically active variant thereof may be administered to a subject to prevent or treat a disorder associated with cell proliferation including, but not limited to, the types of cancer listed above.

In a further embodiment, an antagonist of Human PP2C-like Protein Phosphatase or a portion or a biologically active variant thereof may be administered to a subject to prevent or treat inflammation of any type and, in particular, that which results from a particular disorder or conditions. Such disorders and conditions associated with inflammation include, but are not limited to, Addison's disease, adult respiratory distress syndrome, allergies, anemia, asthma, atherosclerosis, bronchitis, chole- cystitis, Crohn's disease, ulcerative colitis, atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, atrophic gastritis, glomerulonephritis, gout, Graves' disease, hypereosinophilia, irritable bowel syndrome, lupus erythematosus, multiple sclerosis, myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, polymyositis, rheumatoid arthritis, scleroderma, Sjogren's

syndrome, and autoimmune thyroiditis; complications of cancer, hemodialysis, extracorporeal circulation; viral, bacterial, fungal, parasitic, protozoal, and helminthic infections and trauma. In one aspect, an antibody specific for Human PP2C-like Protein Phosphatase may be used directly as an antagonist, or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissue which express Human PP2C-like Protein Phosphatase.

In another further embodiment, a vector expressing the complementary sequence or antisense of the polynucleotide encoding Human PP2C-like Protein Phosphatase or a portion or a biologically active variant thereof may be administered to a subject to prevent or treat inflammation of any type including, but not limited to, those listed above.

In other embodiments,. any of the therapeutic proteins, antagonists, antibodies, agonists, complementary sequences or vectors of the invention may be administered in combination with other appropriate therapeutic agents. Selection of the appro- priate agents for use in combination therapy may be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents may act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.

The invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e. g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a polypeptide- binding partner) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of

action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.

A reagent which affects PP2C-like Protein Phosphatase activity can be administered to a human cell, either in vitro or in vivo, to reduce PP2C-like Protein Phosphatase activity. The reagent preferably binds to an expression product of a Human PP2C- like Protein Phosphatase gene. If the expression product is a polypeptide, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.

In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung or liver.

A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 llg of DNA per 16 nmol of liposome delivered to about 106 cells, more preferably about 1. 0 Rg of DNA per 16 nmol of liposome delivered to about 106 cells, and even more preferably about 2. 0 ug ofDNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.

Suitable liposomes for use in the present invention include those liposomes used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.

Optionally, a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome.

Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U. S. Patent 5,705, 151). Preferably, from about 0.1 pg to about 10 llg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 llg to about 5 ig of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 sug of polynucleotides is combined with about 8 nmol liposomes.

In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al., GENE THERAPEUTICS : METHODS AND APPLICATIONS OF DIRECT GENE <BR> <BR> TRANSFER (J. A. Wolff, ed. ) (1994); Wu & Wu, J : Biol. Chem. 263, 621-24 (1988); Wu et al., J : Biol. Chem. 269, 542-46 (1994); Zenke et al., Proc. Natl. Acad. Sci.

U. S. A. 87, 3655-59 (1990) ; Wu et al., J Biol. Chem. 266, 338-42 (1991).

If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,"and DEAE-or calcium phosphate-mediated transfection.

Determination of'a Therapeutically Effective Dose The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases extracellular matrix degradation relative to that which occurs in the absence of the therapeutically effective dose.

For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.

Therapeutic efficacy and. toxicity, e. g., EDSO (the dose therapeutically effective in 50% of the population) and LDso (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LDso/EDso.

Pharmaceutical compositions which exhibit large therapeutic indices are preferred.

The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the EDso with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.

Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and

frequency of administration, drug combination (s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.

Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose. of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of poly- nucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.

Effective in vivo dosages of an antibody are in the range of about 5, ug to about 50 ug/kg, about 50 p, g to about 5 mg/kg, about 100 llg to about 500 vag/kg of patient body weight, and about zug to about 250 llg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ug to about 2 mg, about 5, ug to about 500 q, g, and about 20 wu to about 100 llg of DNA.

If the expression product is mRNA, the reagent is preferably an antisense oligo- nucleotide or a ribozyme. Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.

Preferably, a reagent reduces expression of a PP2C-like Protein Phosphatase poly- nucleotide or activity of a PP2C-like Protein Phosphatase polypeptide by at least about 10, preferably about 50, more preferably about 75,90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a PP2C-like Protein Phosphatase polynucleotide or the activity

of a PP2C-like Protein Phosphatase polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to PP2C-like Protein Phosphatase-specific mRNA, quantitative RT-PCR, immunologic detection of a PP2C-like Protein Phosphatase polypeptide, or measurement of PP2C-like Protein Phosphatase activity.

In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergis- tically to effect the treatment or prevention of the various disorders described above.

Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.

Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.

The above disclosure generally describes the present invention, and all patents and patent applications cited in this disclosure are expressly incorporated herein. A more complete understanding can be obtained by reference to the following specific examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.

EXAMPLE 1 Expression of recombinant Human PP2C-like Protein Phosphatase The Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of a recombinant Human PP2C-like Protein Phosphatase in yeast. The encoding DNA sequence is derived from the nucleotide sequence shown in SEQ ID NO: 1. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5'-end an initiation codon and at its 3'-end an enterokinase cleavage site, a His6 reporter tag, and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added.

After digestion of the multiple cloning site of pPICZB with the corresponding restriciton enzymes, the modified DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.

The yeast is cultivated under usual conditions in 5 liter shake flasks, and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified Human PP2C-like Protein Phosphatase is obtained.

EXAMPLE 2 Identification of a test compound which binds to a PP2C-like Protein Phosphatase polypeptide Purified PP2C-like Protein Phosphatase polypeptides comprising a glutathione-S- transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution : PP2C-like Protein Phosphatase poly- peptides comprise the amino acid sequence shown in SEQ ID NO: 2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.

The buffer solution containing the test compounds is washed from the wells.

Binding of a test compound to a PP2C-like Protein Phosphatase polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound was not incubated is identified as a compound which binds to a PP2C-like Protein Phosphatase polypeptide.

EXAMPLE 3 Measurement of Protein Phosphatase Activity and the Preparations of Phospho- protein Substrates Phosphorylase kinase (EC 2.7. 1. 38), protein kinase A (3' : 5'-cyclic AMP dependent), phosphorylase b (EC 2.4. 1.1), and crude histone (type 2AS) are obtained from Sigma Chemical Co. Okadaic acid can be obtained from a variety of commercial sources.

Phosphohistone with a specific activity >4.5 x 106 dpm/nmol incorporated phosphate is prepared by the phosphorylation of bovine brain histone (type 2AS from Sigma Chem. Co) with 3' : 5'-cAMP-dependent protein kinase (from rabbit muscle) in the

presence of y-"P-ATP essentially as described by Honkanen et al. (J. Biol. Chem.

265, 19401-04 (1990) and Mol. Pharmacol. 40, 577-83 (1991). The reaction is started by the addition of protein kinase A (1 mg) to a 20 mM Tris-buffer (pH 6.2) containing 20 mg of histone, 1 mCi Y-32P-ATP (150 uM ATP), 100 uM cAMP, 5 mM DTT, and 5 mM MgCl2. The final volume is 4 ml, and the phosphorylation reaction is allowed to continue for 3.5 hours at 30°C.

The reaction is terminated by the addition of 1.3 ml of ice cold 100% trichloroacetic acid. After placing the tube in ice for 10 minutes, the precipitated phosphohistone is collected by centrifugation at 3000 x g for 5 minutes. The supernatant is discarded, and the pellet is redissolved in 4 ml of 0.8 M Tris-Cl (pH 8.5). Trichloroacetic acid (1.3 ml of 100% w/v) is added to precipitate the phosphohistone a second time, and the precipitation-resuspension washing procedure is repeated 5 times.

The pellet produced after the final trichloroacetic acid precipitation is washed 2 times with 4 ml of ethanol: ethyl ether (1: 4; v/v) and then 2 additional times with 4 ml acidified ethanol: ethyl ether (1: 4 ; 0.1 N HC1). The washed phoshohistone pellet is allowed to air dry and resuspended in 5 mM Tris HC1 (pH 7.4).

Phosphorylase b is prepared essentially according to the methods described in Honkanen et al., Mol. Pharmacol. 40, 577-83 (1991). Briefly, 32 P-phosphorylase b is prepared by the phosphorylation of phosphorylase b with phosphorylase kinase using 30 mg of phosphorylase b, 1.4 mCi of y-32 P-ATP (to give 1 x 104 cpm mole-1) and 100 U of phosphorylase kinase. The phosphorylation reaction is carried out for 1.5 hour at pH 8.2 and 30°C. After termination of the reaction, phosphorylase b is crystallized by adjustment of the pH to 6.8 and placing the mixture on ice. The crystals are collected by centrifugation and washed extensively with 20 mM Tris- HCL, 50 mM 2-mercaptoethanol, pH 6.8.

After washing, the crystals are dissolved by the addition of NaCI to achieve a final concentration of 100 mM. The solution is dialyzed overnight at 4°C against 20 mM

. Tris-HCL, 50 mM 2-mercaptoethanol, pH 6.8. (2 x 4 liters). The phosphorylase b, which recrystalizes during dialysis, is redissolved in assay buffer containing 100 mM NaCI for immediate use or 100% glycerol for short term storage. This results in phosphorylase b with a specific activity of approximately 6 x 106 cpm/nmol of incorporated phosphate.

Determination of protein phosphatase activity. Protein phosphatase activity against phosphohistone is determined by the quantification of liberated 32p from phospho- histone according to previously established methods (see Honkanen et al., J bill Chem. 265, 19401-04, 1990 ; Honkanen et al., MoL PharmacoL 40, 577-83, 1991 ; Critz & Honkanen, Neuroprotocols 6, 78-83, 1995). Assays (80 u. l final volume) are conducted in 50 mM Tris-buffer (pH 7.4) containing 0.5 mM DTT, 4 mM EDTA, and phosphoprotein (2 uM P04). The assay is initiated by the addition of substrate (30 ill) to a 1.5 ml microfuge tube containing 50 ul of dilute homogenate. Assays are conducted at 30°C for 10 minutes and are stopped by the addition of 100 u, l of IN H2SO4 containing 1 mM K2HP04.

32P-Phosphate liberated by the enzyme is then extracted as a phosphomolybdate complex and measured according to the methods of Killilea et al., Arch. Biochem.

Biophys. 191, 638-46,1978). Briefly, free phosphate is extracted by adding 20 ul of ammonium molybdate (7.5% w/v in 1.4 N H2S04) and 250 RI of isobutanol : benzene (1: 1, v/v) to each tube. The tubes are mixed vigorously for approximately 10 seconds followed by centrifugation at 14,000 x g for 2 minutes. Aliquots of the upper phase (100 111) are removed for counting, and radioactivity is quantified with a scintillation counter.

For inhibition studies, fostriecin or okadaic acid or a test compound is added to the enzyme mixture 10 minutes before the reaction is initiated with the addition of substrate. Controls receive solvent alone, and in all experiments the amount of enzyme is diluted to ensure that the samples are below the titration endpoint. The titration endpoint is defined as the concentration of enzyme after which further

dilution no longer affects the IC50 of the toxin, and represents a point where the concentration of enzyme used in the assay no longer approaches that of the toxin.

This ensures that IC5o represents the potency of the inhibitor alone and is not representative of a combination of potency of the toxin and titration artifacts of the assay system. Preliminary assays are performed to ensure the dephosphorylation reaction is linear with respect to enzyme concentration and time.

EXAMPLE 4 Identification of a test compound which decreases PP2C-like Protein Phosphatase activity Cellular extracts from cells comprising Human PP2C-like Protein Phosphatase are contacted with test compounds from a small molecule library and assayed for PP2C- like Protein Phosphatase activity. Control extracts, in the absence of a test com- pound, also are assayed. Human PP2C-like Protein Phosphatase activity can be measured, for example, as described in Example 3, above.

A test compound which decreases PP2C-like Protein Phosphatase activity of the extract relative to the control extract by at least 20% is identified as a PP2C-like Protein Phosphatase inhibitor.

EXAMPLE 5 <BR> <BR> Identification of a test compound which decreases PP2C-like Protein Phosphatase gene expression A test compound is administered to a culture of the breast tumor cell line MDA-468 and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells incubated for the same time without the test compound provides a negative control.

RNA is isolated from the two cultures as described in Chirgwin et al., Biochem. 18, 5294-99,1979). Northern blots are prepared using 20 to 30 ug total RNA and hybridized with a 32P-labeled PP2C-like Protein Phosphatase-specific probe at 65°C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1. A test compound which decreases the PP2C-like Protein Phosphatase-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of PP2C-like Protein Phosphatase gene expression.

EXAMPLE 6 Treatment of breast cancer with a reagent which specifically binds to a PP2C-like Protein Phosphatase gene product Synthesis of antisense PP2C-like Protein Phosphatase oligonucleotides comprising at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1 is performed on a Pharmacia Gene Assembler series synthesizer using the phos- phoramidite procedure (Uhlmann et al., Chem. Rev. 90, 534-83, 1990). Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended. in phosphate-buffered saline (PBS) at the desired concentration.

Purity of these oligonucleotides is tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation are determined using the Limulus Amebocyte Assay (Bang, Biol. Bull. (Woods Hole, Mass.) 105, 361-362,1953).

An aqueous composition containing the antisense oligonucleotides at a concentration of 0.1-100 uM is administered directly to a patient's breast tumor by injection. The size of the tumor is thereby decreased.

EXAMPLE 7 Tissue-specific expression of PP2C-like Protein Phosphatase Expression profiling is based on a quantitative polymerase chain reaction (PCR) analysis, also called kinetic analysis, first described in Higuchi et al. , 1992 and Higuchi et al ;, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies. Using this technique, the expression levels of particular genes, which are transcribed from the chromosomes as messenger RNA (mRNA), are measured by first making a DNA copy (cDNA) of the mRNA, and then performing quantitative PCR on the cDNA, a method called quantitative reverse transcription-polymerase chain reaction (quantitative RT-PCR).

Quantitative RT-PCR analysis of RNA from different human tissues was performed to investigate the tissue distribution of PP2C-like Protein Phosphatase mRNA. In most cases, 25 llg of total RNA from various tissues (including Human Total RNA Panel I-V, Clontech Laboratories, Palo Alto, CA, USA) was used as a template to synthsize first-strand cDNA using the SUPERSCRIPTTM First-Strand Synthesis System for RT-PCR (Life Technologies, Rockville, MD, USA). First-strand cDNA synthesis was carried out according to the manufacturer's protocol using oligo (dT) to hybridize to the 3'poly A tails of mRNA and prime the synthesis reaction.

Approximately 10 ng of the first-strand cDNA was then used as template in a polymerase chain reaction. In other cases, 10 ng of commercially available cDNAs (Human Immune System MTC Panel and Human Blood Fractions MTC Panel, Clontech Laboratories, Palo Alto, CA, USA) were used as template in a polymerase chain reaction. The polymerase chain reaction was performed in a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN, USA), in the presence of the DNA-binding fluorescent dye SYBR Green I which binds to the minor groove of the DNA double helix, produced only when double-stranded DNA is successfully synthesized in the reaction (Morrison et al. , 1998). Upon binding to double-stranded

DNA, SYBR Green I emits light that can be quantitatively measured by the LightCycler machine. The polymerase chain reaction was carried out using oligonucleotide primers POPX3-L1 (GAGGAGGCGATCAGGAGGGAGCTA) and POPX3-R4 (CATGTCCAAGGCTGAGCCCAAATG) and measurements of the intensity of emitted light were taken following each cycle of the reaction when the reaction had reached a temperature of 86 C. Intensities of emitted light were converted into copy numbers of the gene transcript per nanogram of template cDNA by comparison with simultaneously reacted standards of known concentration.

To correct for differences in mRNA transcription levels per cell in the various tissue types, a normalization procedure was performed using similarly calculated expres- sion levels in the various tissues of five different housekeeping genes: glyceraldehyde-3-phosphatase (G3PDH), hypoxanthine guanine phophoribosyl transferase (HPRT), beta-actin, porphobilinogen deaminase (PBGD), and beta-2- microglobulin. The level of housekeeping gene expression is considered to be <BR> <BR> relatively constant for all tissues (Adams et al. , 1993, Adams et al. , 1995, Liew et al., 1994) and therefore can be used as a gauge to approximate relative numbers of cells per jj, g of total RNA used in the cDNA synthesis step. Except for the use of a slightly different set of housekeeping genes and the use of the LightCycler system to measure expression levels, the normalization procedure was similar to that described in the RNA Master Blot User Manual, Apendix C (1997, Clontech Laboratories, Palo Alto, CA, USA). In brief, expression levels of the five housekeeping genes in all tissue samples were measured in three independent reactions per gene using the LightCycler and a constant amount (25 u, g) of starting RNA. The calculated copy numbers for each gene, derived from comparison with simultaneously reacted standards of known concentrations, were recorded and the mean number of copies of each gene in all tissue samples was determined. Then for each tissue sample, the expression of each housekeeping gene relative to the mean was calculated, and the average of these values over the five housekeeping genes was found. A normalization factor for each tissue was then calculated by dividing the final value for one of the tissues arbitrarily selected as a standard by the corresponding value for each of the

tissues. To normalize an experimentally obtained value for the expression of a particular gene in a tissue sample, the obtained value was multiplied by the normalization factor for the tissue tested. This normalization method was used for all tissues except those derived from the Human Blood Fractions MTC Panel, which showed dramatic variation in some housekeeping genes depending on whether the tissue had been activated or not. In these tissues, normalization was carried out with a single housekeeping gene, beta-2-microglobulin.

Results are given FIG. 1 and 2, showing the experimentally obtained copy numbers of mRNA per 10 ng of first-strand cDNA on the left and the normalized values on the right. RNAs used for the cDNA synthesis, along with their supplier and catalog numbers are shown in tables 1 and 2.

Table 1 Whole-body-screen tissues Tissue Supplier Panel name and catalog number 1. brain Clontech Human Total RNA Panel I, K4000-1 2. heart Clontech Human Total RNA Panel I, K4000-1 3. kidney. Clontech Human Total RNA Panel I, K4000-1 4. liver Clontech Human Total RNA Panel I, K4000-1 5. lung Clontech Human Total RNA Panel I, K4000-1 6. trachea Clontech Human Total RNA Panel I, K4000-1 7. bone marrow Clontech Human Total RNA Panel II, K4001-1 8. colon Clontech Human Total RNA Panel II, K4001-1 9. small intestine Clontech Human Total RNA Panel II, K4001-1 10. spleen Clontech Human Total RNA Panel 11, K4001-1 11. stomach Clontech Human Total RNA Panel II, K4001-1 12. thymus Clontech Human Total RNA Panel II, K4001-1 13. mammary gland Clontech Human Total RNA Panel III, K4002-1 14. skeletal muscle Clontech Human Total RNA Panel III, K4002-1 15. prostate Clontech Human Total RNA Panel III, K4002-1 16. testis Clontech Human Total RNA Panel III, K4002-1 17. uterus Clontech Human Total RNA Panel III, K4002-1 18. cerebellum Clontech Human Total RNA Panel IV, K4003-1 19. fetal brain Clontech Human Total RNA Panel IV, K4003-1 20. fetal liver Clontech Human Total RNA Panel IV, K4003-1 21. spinal cord Clontech Human Total RNA Panel IV, K4003-1 22. placenta Clontech Human Total RNA Panel IV, K4003-1 23. adrenal gland Clontech Human Total RNA Panel V, K4004-1 24. pancreas Clontech Human Total RNA Panel V, K4004-1 25. salivary gland Clontech Human Total RNA Panel V, K4004-1 26. thyroid Clontech Human Total RNA Panel V, K4004-1 Table 2 Blood/lung-screen tissues Tissue Supplier Panel name and catalog number 1. lymph node Clontech Human Immune System MTC Panel, K1426-1 2. peripheral blood leukocytes Clontech Human Immune System MTC Panel, K1426-1 3. tonsil Clontech Human Immune System MTC Panel, K1426-1 4. peripheral blood mononuclear Clontech Human Blood Fractions MTC Panel, K1428-1 cells 5. peripheral blood Clontech Human Blood Fractions MTC Panel, K1428-1 mononuclear cells-activated 6. T-cell (CD8+) Clontech Human Blood Fractions MTC Panel, K1428-1 7. T-cell (CD8+)-activated Clontech Human Blood Fractions MTC Panel, K1428-1 8. T-cell (CD4+) Clontech Human Blood Fractions MTC Panel, K1428-1 9. T-cell (CD4+) -activated Clontech Human Blood Fractions MTC Panel, K1428-1 10. B-cell (CD19+) Clontech Human Blood Fractions MTC Panel, K1428-1 11. B-cell (CD 19+)-activated Clontech Human Blood Fractions MTC Panel, K1428-1 12. Monocytes (CD14+) Clontech Human Blood Fractions MTC Panel, K1428-1 13. Thl clone In-house 14. Th2 clone In-house 15. neutrophil In-house 16. Natural killer cells In-house 17. Lymphokine-activated killer In-house cells 18. Interleukin-2-activated natural In-house killer cells 19. Normal Bronchial/Tracheal In-house Epithelial Cells 20. Normal Bronchial/Tracheal In-house smooth muscle cell 21. Normal lung fibroblast In-house 22. Microvascular Endothelial cell In-house 23. RAMOS In-house 24. Jurkat In-house 25. IMR-90 In-house 26. HEK293 In-house

SEO ID NO: 79 >POPX3-L1 GAGGAGGCGATCAGGAGGGAGCTA SEQ ID NO: 80 >POPX3-R4 CATGTCCAAGGCTGAGCCCAAATG References Higuchi, R., Dollinger, G., Walsh, P. S. and Griffith, R. (1992) Simultaneous amplification and detection of specific DNA sequences. BioTechnology 10: 413-417.

Higuchi, R. , Fockler, C. , Dollinger, G. and Watson, R. (1993) Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. BioTechnology 11: 1026-1030.

T. B. Morrison, J. J. Weis & C. T. Wittwer. (1998) Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification.

Biotechniques 24: 954-962.

Adams, M. D., Kerlavage, A. R. , Fields, C. & Venter, C. (1993) 3,400 new expressed sequence tags identify diversity of transcripts in human brain. Nature Genet. 4: 256- 265. <BR> <BR> <P>Adams, M. D. , et al. (1995) Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence. Nature 377 supp: 3-174.

Liew, C. C. , Hwang, D. M. , Fung, Y. W. , Laurenson, C., Cukerman, E. , Tsui, S. & Lee, C. Y. (1994) A catalog of genes in the cardiovascular system as identified by expressed sequencetags. Proc. Natl. Acad. Sci. USA 91: 10145-10649.