Retroviral delivery of synthetic gene cassettes

Field of invention

The present invention relates to a multifunctional molecule which is capable of initiating first and/or second strand DNA synthesis of a retroviral RNA genome or derivatives thereof. The multifunctional molecule comprises a first part complementary to a part of the retroviral RNA genome or derivatives thereof. A second part of the multifunctional molecule comprises genetic elements and/or labels. The genetic elements may be gene cassettes for the expression of proteins, peptides or polypeptides or for example functional RNA elements such as shRNA, siRNA, miRNA and the like. The multifunctional molecule represents a novel tool for insertion of genes into host cell genomes. The present invention therefore relates to the field of gene delivery and methods employed therefore.

Background of invention

Retroviruses are enveloped viruses with a RNA genome and characterized by reverse transcription of their genomic RNA into double stranded DNA which is integrated into DNA of the host cell.

The bilipid envelope is derived from the host cell, when a virus buds off the surface of a host cell, however, viral envelope proteins, surface (SU) proteins and transmembrane (TM) proteins are embedded into the bilipid layer. A matrix protein (MA) surrounds the inner core of a virus particle, and thus positioned under the outer membrane. A capsid (CA) protein forms the inner core. The inner core of the virus particle harbours two copies of the retroviral RNA genome, where the two copies are 'linked' to each other via hydrogen bonding at the 5'end of the RNA copies. In addition, the core harbours viral enzymes needed for the retroviral lifecycle, namely reverse transcriptase (RT), protease (PR) and integrase (IN), the nucleocapsid protein (NC) which bind to the viral RNA genome. The virus also harbours a number of tRNA molecules derived from the host cell, where the tRNA is packaged into the virion during virus assembly.

All retroviruses use a host cell tRNA as a primer to initiate reverse transcription. The retroviral reverse transcription is shown schematically in Figure 1. Reverse transcription is usually initiated at a position in the viral RNA genome, known as the primer binding site (PBS). The tRNA primer interacts through base pairing with the PBS region situated downstream of the U5 region at the 5' end of the genome. In MuLV 18 bases of the aminoacceptor stem and the T-psi-C loop of the tRNApro molecule is annealed to the PBS. Reverse transcription of the retroviral genome is initiated from the 3' end of the tRNA molecule, leading to synthesis of the first strand DNA, the minus-strand strong stop DNA. The 3' end of the minus-strand strong stop DNA harbours an R region (a repeat region) which is complementary to an R region positioned 3' of the genomic RNA genome. It is believed that through complementarity of the R regions the newly synthesised minus-strand strong stop DNA 'jumps' or base pairs with the R region positioned 3' of the genomic RNA genome (first jump or first strand transfer), from where the synthesis of the minus-strand strong stop DNA proceeds. While the minus-strand strong stop DNA is synthesised the RNase H activity of the RT degrades viral RNA of the DNA-RNA base paired double stranded helix. Only a purine rich fragment (poly purine tract PPT) of the RNA genome escapes degradation and the resulting PPT acts as a primer for subsequent plus-strand DNA synthesis. Plus-strand DNA synthesis continues through the U3, R, and U5 region and also copies the bases of the tRNA molecule complementary to the PBS until a modified nucleotide at position 57 of the tRNA molecule is encountered by the RT and the synthesis of plus-strand DNA is terminated. The overhanging part of the tRNA molecule is removed by RNase H. The plus-strand DNA is relocated to the 5' end of the newly synthesised minus-strand DNA through complementarity between the region of the plus-strand DNA complementary to the 3' bases of the tRNA and the region of the minus-strand DNA complementary to the PBS (second jump or second strand transfer) and synthesis of the plus-strand DNA continues. The final outcome is a double stranded DNA molecule, a proviral DNA, which encompasses additional sequences as compared to the original RNA template due to the copying of repetitive sequences U3 and R. The proviral RNA can now be integrated into the genome of a host cell by the action of the viral IN protein.

The natural tRNA molecule normally used for the priming of reverse transcriptase varies with different retroviruses. The tRNA used by human immunodeficiency virus-1 (HIV-1 ) is the tRNA(Lys3), whereas murine leukaemia viruses (MuLVs) utilize tRNA(Pro) and avian virus such as avian leukosis virus (ALVs) uses tRNA (T rp). Lund et al. 1997 describes a synthetic tRNA complementation system in murine leukemia viruses. The PBS of a murine leukaemia-based vector was mutated not to match any naturally occurring tRNA. The mutated vector allowed efficient RNA encapsidation but resulted in a drastic reduction in the replication ability of the vector. Upon complementation with a synthetic tRNA-like primer designed to match the mutated PBS replication was restored (figure 4). tRNA complementation was subsequently shown to restore replication of PBS mutated lentiviral-based vectors in a similar manner (Hansen et al. 2001 )

It is believed that both MuLV and HIV-1 require the tRNA to be transported from the nucleus to the cytoplasm which indicates that the selection of which tRNA is to be used for reverse transcription occurs at the site of translation in the host cell (Kelly et al. 2003).

A retroviral particle enters a host cell through receptor-dependent fusion between the viral membrane and a membrane of the target cell, whereby the retroviral particle is internalized into the cytoplasm of the host cell. After the entry of the viral core into the cytoplasm of the host cell, enzymatic functions are performed within the virus particle which ultimately leads to the integration of the double-stranded DNA provirus in the host cell DNA. The enzymes responsible for these functions are all encoded by the virus, however, synthesized by the previous host cell's translational machinery, packaged into virus particles and brought along in the virus particle. A nucleoprotein complex is believed to be formed comprising RT, integrase (IN), CA and the retroviral RNA. Reverse transcription of the retroviral RNA genome is presumably taking place in the nucleoprotein complex.

For simple retroviruses such as for example MuLV mitosis is believed to be required for the entry of the nucleoprotein complex to enter the nucleus of the host cell, most likely because as the nucleoprotein complex cannot penetrate the nuclear membrane of the host cell. In contrast complex retroviruses such as for example Antiviruses (such as HIV-1 ) are believed not to require mitosis of the host cell for entry into the host cell nucleus.

Once the nucleoprotein complex is inside the nucleus of the host cell, IN mediates the integration of proviral DNA into the host cell DNA. IN recognises conserved nucleotides known as inverted repeats (IR) present at the ends of the Long Terminal Repeat (LTR) of the proviral DNA. IN removes 2 bases from the 3'hydroxyl termini of both strands of the proviral DNA. Additionally, IN catalyses the cleavage of the host cell DNA and mediates the transfer of cleaved proviral DNA and the cleaved DNA of the host cell, forming a host cell genome now comprising the proviral DNA.

The site of integration in the host cell genome is not sequence specific, but rather seems to take place at regions in the genome that are active with respect to transcriptional activity.

The host cell thus subsequently transcribes and translates the viral proteins needed for the production of new viral particles, and RNA is synthesised that make up the genomic RNA of a novel virus particle. The particles assemble at the host membrane (at least in the case of MuLV) and buds off the host membrane, whereby a bipid envelope layer surrounds the viral particle. After budding off the host cell, a maturation process takes place, wherein viral Gag and Gag-Pol polypeptides are cleaved by the viral protease PR, allowing for the final change in virus particle morphology.

The present invention exploits the efficiency of retroviral gene transfer for the introduction of genes into a host genome. However, the the majority of the elements of retroviral genome normally being integrated into the host genome together with the transgene are largely absent using the present invention.

The present invention offers a means for stable introduction of synthetic gene cassettes harbouring genetic elements of interest by-passing traditional recombinant DNA cloning and vector propagation procedures. The present invention exploits virus particles comprising multifunctional molecules as an all-in-one tool for the synthesis, delivery and integration of synthetic gene cassettes (figure 4).

The present invention has advantages over current techniques in at least two fields i.e. for research and drug development purposes, and in relation to safety issues associated with retroviral gene therapy.

For research and drug development the present invention offers simplified procedures for the cloning of constructs comprising a gene of interest and subsequent introduction of the gene of interest into a target cell. Typically, barriers exist in the packaging cells to transcription of the vector construct, processing of viral RNA such as for example splicing, polyadenylation, ribozymes, hairpin processing, editing or transcription blocking elements. With the generation of a gene cassette in a retroviral particle as disclosed in the present invention in contrast to for example generating the gene cassette in a producer cell avoids such barriers. With the present invention the safety of retroviral gene therapy is improved as the reduction of the number of retroviral elements present minimises the risk of mobilising vectors and minimises the risk of recombination. Further, the risk of undesired genetic alteration in the target cell is minimised as tethering of strand-invading modified nucleotides to the synthetic gene cassettes is expected aid in minimising the risk of undesired genetic alteration.

Summary of invention

The present invention in a first aspect provides a multifunctional molecule capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or derivative thereof or a retroviral element present in a cell, wherein said molecule comprises a first part, wherein said first part comprises a nucleotide sequence at least partly complementary to a primer binding site and/or another region of the retroviral RNA genome or derivative thereof or the retroviral element present in a cell, and

a second part, comprising at least one genetic element and/or at least one label,

wherein said multifunctional molecule is not a functional tRNA molecule, or a derivative thereof, capable of initiating one or more of a first strand DNA synthesis.

In a second aspect the present invention relates to vector construct expressing the multifunctional molecule.

In a third aspect the invention pertains to a retroviral vector comprising at least one site for annealing of the at least one multifunctional molecule.

Furthermore, in a fourth aspect the invention relates to a packaging cell comprising the multifunctional molecule or part thereof. Also a retroviral particle comprising at least one multifunctional molecule constitutes another aspect of the present invention. Other aspects relates to an RNA and/or DNA molecule derived from the retroviral particle according to the invention, a target cell comprising at least one multifunctional molecule or part thereof, a composition comprising at least one retroviral particle comprising the multifunctional molecule for treatment of cancer, viral infections, or autoimmune disorders, a pharmaceutical composition comprising a pharmaceutically effective amount of a composition comprising at least one retroviral particle comprising the at least one multifunctional molecule, and a pharmaceutical composition for treating cancer, viral infections, or autoimmune disorders comprising at least one retroviral particle comprising the at least one multifunctional molecule as defined in any of claims 1 to 32.

In a further aspect the present invention provides a kit of parts comprising the multifunctional molecule and optionally instructions for use. Additionally, the present invention in separate aspects relates to methods of the present invention, such as a method for synthesizing double stranded proviral DNA, comprising the steps of a) providing the multifunctional molecule providing a template b) providing reverse transcriptase c) contacting the multifunctional molecule of step a) with the template of b) d) contacting the complex of step d) with the reverse transcriptase enzyme of step c) e) obtaining a double stranded proviral DNA

Another aspect relates to a method for transferring the multifunctional molecule into a packaging cell comprising the steps of a) providing a packaging cell b) providing the multifunctional molecule as defined in any of claims c) transferring the multifunctional molecule of step b) into the packaging cell d) obtaining a packaging cell comprising the multifunctional molecule of step b).

Yet a further aspect pertains to a method for producing a viral particle comprising the steps of a) providing at least one multifunctional molecule b) providing a template for said multifunctional molecule of step a) c) providing a packaging cell d) transferring said at least one multifunctional molecule of step a) and said template of step b) into the packaging cell of step c) e) obtaining a virus particle

Another aspect of the present invention relates to a method for integration of foreign

DNA into a target cell comprising the steps of i) providing at least one viral particle comprising at least one multifunctional molecule and optionally a template for first and or second strand DNA synthesis ii) providing at least one target cell iii) contacting the viral particle of step i) and the target cell of step ii) iv) obtaining a target cell wherein said target cell in its genome comprises said foreign DNA Similarly the present invention provide in one aspect a method for producing a target cell harbouring at least one integrated multifunctional molecule or part thereof comprising the steps of a) providing at least one multifunctional molecule b) providing a target cell c) Transferring the multifunctional molecule of step a) to the target cell of step b) d) Obtaining a target cell harbouring the at least one multifunctional molecule of a) or part thereof integrated into the host cell genome.

Furthemore yet another aspect relates to a method for delivery of at least one multifunctional molecule or part thereof to a target cell comprising the steps of a) providing a retroviral particle comprising said at least one genetic element and/or label b) contacting a cell with the retroviral particle of step a) c) obtaining a target cell comprising said at least one genetic element and/or label

A method of treatment of cancer, viral infections and/or autoimmune disorders constitute an aspect of the present invention comprising administration of the multifunctional molecule or part thereof to an individual in need thereof in a therapeutically effective amount.

The present invention also pertains to a method for screening for functional mutants of interest comprising the steps of a) providing at least one multifunctional molecule or part thereof b) producing a virus particle comprising said at least one multifunctional molecule of step a) c) contacting a cell with the virus particle of step b) d) obtaining a target cell with the multifunctional molecule e) identifying functional mutants of interest.

Finally the present invention relates to the use of the multifunctional molecule or the retroviral particle according to the present invention for the manufacture of a medicament.

The present invention exploits the enzymes encapsidated within a retroviral particle in order to generate stably integrated synthetic gene cassettes in host cell genomes.

The present invention in one aspect is directed to compositions, multifunctional molecules and methods relating to the identification and characterization of genes and biological pathways related to these genes as represented by the expression of the identified genes, as well as use of imiRNAs related to such, for therapeutic, prognostic, and diagnostic applications.

Description of Drawings

Figure 1 is a schematic representation of reverse transcription of the retroviral RNA genome resulting in a double-stranded DNA molecule, proviral DNA.

Figure 2:

Introduction of mutations in the PBS sequence of a viral genome inhibits binding of the natural tRNA, which is necessary for initiation of reverse transcription. Expression of a modified tRNA molecule with complementarity to the mutated PBS restores reverse transcription of the viral genome. (AH Lund, M Duch, J Lovmand, P Jorgensen and FS Pedersen. 1997) Figure 3:

Cloverleaf structure of Transfer RNA From Yeast; tRNA_phe. The acceptor stem is a 7-bp stem made by the base pairing of the 5'-terminal nucleotide with the 3'-terminal nucleotide (which comprises the CCA 3'-terminal group used to attach the amino acid during translation). The acceptor stem may contain non- Watson-Crick base pairs.

The CCA tail is a CCA sequence at the 3' end of the tRNA molecule. This sequence is important for the recognition of tRNA by enzymes critical in translation. The D arm is a 4 bp stem ending in a loop that in a majority of tRNAs contains dihydrouridine. The anticodon arm consists of a 5-bp stem and a loop where the loop contains the anticodon. It also contains a Y which represents a modified purine nucleotide. A 5 bp stem containing the sequence TΨC where Ψ is a pseudouridine is known as the T arm. Outside the anticodon, bases may be modified typically by methylation. Similarly, the first anticodon base is sometimes modified to inosine (derived from adenine) or pseudouridine (derived from uracil).

Figure 4:

The function of the nascent tRNA in initiation of reverse transcription might be performed by other oligonucleotides (or nucleotide analogues) including synthetic ones and or other molecules that can function as primer for reverse transcriptase. Replacing the tRNA primer with synthetic oligonucleotides harbouring additional functional elements, enables insertion of heterologous sequences into the provirus. The oligonucleotide must be designed to allow the formation of a product that can be recognized by the retroviral integrase. In the illustration this has been accomplished by including the inverted repeat/attachment (att) in the oligonucleotide that functions as a primer.

Figure 5: A: The envisaged utilisation of the procedure described in figure 4 to introduce shRNAs into a viral vector containing a polymerase III promoter upstream of PBS resulting in shRNA expression. The promoter and shRNA cassette are found in two copies one in the middle and one at the end of the provirus. B: To ensure that the downstream copy of the primer vector is integrated into the host genome, the normal attachment site for integrase (I. R.) at the end of U5 is mutated and a new attachment site is incorporated into the primer vector.

Figure 6:

A tRNA primer is replaced by a synthetic DNA oligonucleotide containing a heterologous sequence at its 5' end. This situation results in normal initiation of first strand and second strand syntheses (se figure 1 ). Following second strand jump the heterologous DNA sequence must anneal to the plus strand DNA in order for the reverse transcription to continue. Homology between the heterologous DNA sequence and the plus strand viral DNA facilitates this. After recombination the reverse transcription is complete. The resulting provirus contains a double stranded copy of the heterologous DNA sequence at its end as well as a fully or partly double-stranded copy downstream copy downstream of PBS which may be repaired by the target cell DNA repair machinery to a double stranded sequence.

Figure 7:

Alternative non-conventional designs for retroviral vectors to be used with synthetic primervectors: A: Relocation of the ppt from downstream LTR to the upstream end of the vector eliminates the need for both first and second strand jumps.

B: Utilisation of a second primer vector containing the appropriate elements including an attachment site for integrase (I. R.) which abolishes any need for retroviral cis elements in the resulting 'viral' vector integrated in the target cell. This situation is reminiscent of a single round of PCR performed inside a virion.

Figure 8:

Utilisation of a second strand primer vector containing a homology region to the RNA genome results in enrichment of the primer in viral particles. More importantly the expected effect of RNase H on the homology region enables production of DNA molecules corresponding to shorter versions of the RNA.

Figure 9:

Schematic representation of the proviral genome exemplified by a murine leukaemia virus (MLV) and a traditional MLV-based retroviral vector. A) Schematic representation of the MLV proviral genome comprising sequences required in cis or in trans for retroviral replication. B) an outline of a traditional retroviral vector, wherein the gene of interest is inserted between the LTRs in place of the coding sequences for the structural viral proteins that are in stead provided in trans by the packaging cell line.

Figure 10:

PBS UMU is a retroviral vector based on Akv Murine Leukemia virus, in which the PBS sequence is mutated in order to inhibit binding of the tRNA primer naturally used to initiate reverse transcription (tRNApro). The vector also contains a neo resistance gene as a selection marker (Lund et al. 1997)

Figure 1 1 :

Retroviral vector used (PBS UMU SV40 -5' IR) is equivalent to PBS UMU 5' IR but contains an sv40 promoter to drive a neo resistance gene. The primers are designed to produce a provirus that lacks the upstream LTR so that neo expression is driven from the sv40 promoter, and to reconstitute the downstream LTR to provide a poly A signal.

Figure 12

Schematic representation showing integration of the second strand primer. The left panel illustrates first strand synthesis mediated by the first strand primer and second strand synthesis mediated by the second strand primer. The right panel illustrates first strand synthesis mediated by the first strand primer and second strand synthesis mediated by the ppt site which is preserved during RnaseH digestion. The resulting DNA second strands recombine, and DNA synthesis results in a DNA double strand molecule containing the heterologous sequence from the second strand primer and a U3 sequence in opposite direction. The DNA molecule is integrated into the host genome.

Figure 13 Utilisation of a second strand primer vector containing a homology region to the RNA genome results in enrichment of the primer in viral particles. The second strand primer contains an shRNA sequence used to introduce shRNA into the provirus. The presence of a polymerase III promoter in the template results in expression of the shRNA. The effect of RNase H on the homology region enables production of DNA molecules corresponding to shorter versions of the RNA. Figure 14

Schematic representation showing integration of the second strand primer. The left panel illustrates first strand synthesis mediated by the first strand primer and second strand synthesis mediated by the second strand primer. The second strand primer contains an shRNA sequence used to introduce shRNA into the provirus. The presence of a polymerase III promoter in the template results in expression of the shRNA. The right panel illustrates first strand synthesis mediated by the first strand primer and second strand synthesis mediated by the ppt site which is preserved during RnaseH digestion. The resulting DNA second strands recombine, and DNA synthesis results in a DNA double strand molecule containing the heterologous sequence from the second strand primer and a U3 sequence in opposite direction. The DNA molecule is integrated into the host genome.

Detailed description of the invention

Definitions The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

The term 'primervectors' is used interchangeably with the term multifunctional molecule.

Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

Retrovirus is a term encompassing any virus belonging to the viral family of Retroviridae. Retroviruses are enveloped viruses harbouring an RNA genome, and replicate via a DNA intermediate, through a process known as reverse transcription. Reverse transcription is performed through the action of the virally encoded enzyme reverse transcriptase, whereby the retroviral genome is converted from RNA into DNA, which can subsequently be integrated into the genome of a host cell through the action of the virally encoded integrase enzyme. The virus then replicates as part of the cell's DNA. The family Retroviridae are enveloped single-stranded RNA viruses that typically infect mammals, such as, for example, bovines, monkeys, sheep, and humans, as well as avian species.

Retroviral particle. The terms 'retroviral particle', 'virus particle' and 'virion' is used interchangeably herein. Retroviruses are enveloped viruses with a RNA genome and characterized by reverse transcription of their genomic RNA into double stranded DNA which is integrated into DNA of the host cell. The bilipid envelope is derived from the host cell, when a virus buds off the surface of a host cell, however, viral envelope proteins, surface (SU) proteins and transmembrane (TM) proteins are embedded into the bilipid layer. A matrix protein (MA) surrounds the inner core of a virus particle, and thus positioned under the outer membrane. A capsid (CA) protein forms the inner core. The inner core of the virus particle harbours two copies of the retroviral RNA genome, where the two copies are 'linked' to each other via hydrogen bonding at the 5'end of the RNA copies. In addition, the core harbours viral enzymes needed for the retroviral lifecycle, namely reverse transcriptase (RT), protease (PR) and integrase (IN), the nucleocapsid protein (NC) which bind to the viral RNA genome. The virus also harbours a number of tRNA molecules derived from the host cell, where the tRNA is packaged into the virion during virus assembly. Reverse transcription is the process of making a double stranded DNA (deoxyribonucleic acid) molecule from a single stranded RNA (ribonucleic acid) template. It is called reverse transcription as it acts in the opposite or reverse direction to transcription.

Reverse transcriptase is a virally encoded protein which catalyses the conversion of a RNA molecule to a DNA molecule.

tRNA and tRNA-like structures: the term "tRNA" according to the present invention includes any naturally occurring transfer RNA and any synthetic tRNA molecule, and any modified tRNA engineered to anneal to a complementary non-naturally occurring modified PBS. ??AHN mere her

Proviral DNA is double stranded DNA synthesised by the action of reverse transcription. Proviral DNA is trimmed at the termini and integrated in the host genome.

lntegrase (IN) is a virally encoded protein that catalyses the integration of proviral DNA into genomic DNA of a host cell.

The packaging signal is an element positioned in the 5' untranslated region downstream of the PBS and upstream of the the gag open reading frame of the retroviral RNA

Repeat region (R region): Sequence of at least two elements, groups, or residues, occurring more than once in a molecule. In the present invention the R region refers to two regions comprising nucleotides that are identical in the retroviral RNA genome (and also present in the proviral DNA). The R regions are positioned in the LTR of the 5' and 3' end of the retroviral RNA genome (and also present in the proviral DNA).

Primer binding site (PBS) is positioned in the retroviral genome or derivative thereof. The primer binding site is typically 18 nucleotides long and is complementary to a corresponding tRNA molecule. The corresponding tRNA molecule anneals to the PBS and primes the synthesis of first strand DNA synthesis during reverse transcription. In the present context the PBS may be any of the PBS of the retroviruses or retroviral elements listed herein. Similarly, the PBS may be a modified PBS which does not match a naturally occurring tRNA. One example is the modified PBS UMU of the present invention, see also figure 2, also known from US 5,866,41 1 ; US 5,886,166 US 6,037,172 and US 6,108,478.

DNA: deoxyribonucleic acid.

RNA: ribonucleic acid. Different groups of ribonucleic acids are within the scope of the present invention: mRNA, tRNA, rRNA and nRNA.

Multifunctional Molecule The present invention relates to a multifunctional molecule capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or a retroviral element present in a cell, wherein said molecule comprises a first part, wherein said first part comprises a nucleotide sequence at least partly complementary to a primer binding site and/or another region of the retroviral RNA genome or derivative thereof or a retroviral element or the retroviral element present in a cell, and a second part, comprising at least one genetic element and/or at least one label, wherein said multifunctional molecule is not a functional tRNA molecule, or a derivative thereof, capable of initiating one or more of a first strand DNA synthesis. In another embodiment the present invention relates to a multifunctional molecule capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or derivative thereof or a retroviral element present in a cell, wherein said molecule comprises a first part, wherein said first part comprises a nucleotide sequence at least partly complementary to a primer binding site and/or another region of the retroviral RNA genome or the retroviral element present in a cell, and a second part, comprising at least one genetic element and/or at least one label.

The present invention relates to a multifunctional molecule capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or derivative thereof or a retroviral element present in a cell, wherein said molecule comprises a first part, wherein said first part comprises a nucleotide sequence at least partly complementary to a primer binding site and/or another region of the retroviral RNA genome or the retroviral element present in a cell, and a second part, comprising at least one genetic element and/or at least one label, wherein said multifunctional molecule is not a functional tRNA molecule, or a derivative thereof, capable of initiating one or more of a first strand DNA synthesis. In another embodiment the present invention relates to a multifunctional molecule capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or a retroviral element present in a cell, wherein said molecule comprises a first part, wherein said first part comprises a nucleotide sequence at least partly complementary to a primer binding site and/or another region of the retroviral RNA genome or the retroviral element present in a cell, and a second part, comprising at least one genetic element and/or at least one label. It is appreciated that the multifunctional molecule may be capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or part thereof or a retroviral element present in a cell.

Retroviral RNA genome or derivative thereof or a retroviral element

When referring to the retroviral genome or derivative thereof or a retroviral element it is contemplated that the retroviral RNA genome or derivative thereof or a retroviral element is derived from any of the viruses listed below.

The retroviral RNA genome or derivative thereof or a retroviral element may be derived from any species of retroviridae. In one embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Orthoretrovirinae, comprising Alpharetrovirus, Betaretrovirus, and Gammaretrovirus. In a specific embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Avian carcinoma Mill Hill virus 2, Avian leukosis virus, Avian myeloblastosis virus, Avian myelocytomatosis virus 29, Avian sarcoma virus CT10, Fujinami sarcoma virus, Rous sarcoma virus, UR2 sarcoma virus or Y73 sarcoma virus. The alphaviruses are listed in table 1. Each of the alphaviruses specified above is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them is claimed individually.

Table 1. List of alpharetroviruses

Alpharetrovirus Avian carcinoma Mill Hill virus 2

Alpharetrovirus Avian leukosis virus

Alpharetrovirus Avian myeloblastosis virus

Alpharetrovirus Avian myelocytomatosis virus 29

Alpharetrovirus Avian sarcoma virus CT10

Alpharetrovirus Fujinami sarcoma virus Alpharetrovirus Rous sarcoma virus Alpharetrovirus UR2 sarcoma virus Alpharetrovirus Y73 sarcoma virus

In another specific embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Jaagsiekte sheep retrovirus, Langur virus, Mason- Pfizer monkey virus, Mouse mammary tumor virus or Squirrel monkey retrovirus. The betaviruses are listed in table 2. Each of the betaviruses specified herein is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them may be claimed individually.

Table 2. List of betaretroviruses

Betaretrovirus Jaagsiekte sheep retrovirus

Beta retrovirus Langur virus

Betaretrovirus Mason-Pfizer monkey virus

Betaretrovirus Mouse mammary tumor virus

Betaretrovirus Squirrel monkey retrovirus

In another embodiment the retroviral RNA genome or derivative thereof or a retroviral element according to the present invention is derived from gammaretroviruses as shown in table 3 below. Table 3. List of gammaretroviruses

o Avian (Reticuloendotheliosis) virus group

^■ Chick syncytial virus o Reticuloendotheliosis virus

^■ Avian spleen necrosis virus ■ Spleen necrosis virus o Mammalian virus group

^■ Murine endogenous retrovirus o Murine leukemia-related retroviruses

Epicrionops marmoratus retrovirus ■ lchthyophis kohtaoensis retrovirus

^■ Osteolaemus tetraspis retrovirus

^■ Sericulus bakeri retrovirus

^■ Terdus iliacus retrovirus

^■ Tomistoma schlegelii retrovirus ■ Viper berus retrovirus

• Xenotropic MuLV-related virus

^■ Monodelphis sp. retrovirus o Replication competent viruses

• Feline leukemia virus • Gibbon ape leukemia virus (GALV)

• Murine leukemia virus

• Porcine type-C oncovirus o Replication defective viruses ■ Abelson murine leukemia virus

^■ Gardner-Arnstein feline sarcoma virus

• Hardy-Zuckerman feline sarcoma virus

^■ Harvey murine sarcoma virus

^■ Kirsten murine sarcoma virus • Moloney murine sarcoma virus

• Murine osteosarcoma virus

^■ Snyder-Theilen feline sarcoma virus

• Spleen focus-forming virus

^■ Woolly monkey sarcoma virus o unclassified Gammaretrovirus o Baboon endogenous virus

^■ Baboon endogenous virus strain M7 o Feline endogenous virus

^■ Feline endogenous virus ECE1 ■ Feline endogenous virus RD114

^■ Koala retrovirus o Macaca mulatta type C retrovirus

^■ Macaca endogenous retrovirus

^■ MLV-related retrovirus ■ Rat leukemia virus

Rat sarcoma virus

^■ RD1 14 retrovirus

Recombinant M-MuLV/RaLV retrovirus

Mammalian virus group ■ Murine endogenous retrovirus o Murine leukemia-related retroviruses

^■ Epicrionops marmoratus retrovirus lchthyophis kohtaoensis retrovirus

^■ Osteolaemus tetraspis retrovirus ■ Sericulus bakeri retrovirus

^■ Terdus iliacus retrovirus

^■ Tomistoma schlegelii retrovirus

^■ Viper berus retrovirus o Xenotropic MuLV-related virus ■ Xenotropic MuLV-related virus VP35

^■ Xenotropic MuLV-related virus VP42

^■ Xenotropic MuLV-related virus VP62

^■ Monodelphis sp. retrovirus o Replication competent viruses o Feline leukemia virus

^■ Feline leukemia provirus (clone CFE-16)

^■ Feline leukemia provirus (clone CFE-6) Feline leukemia provirus ftt

^■ Feline leukemia virus strain A/Glasgow-1 ■ Feline leukemia virus strain B/lambda-B1 Feline leukemia virus strain C/FA27

^■ Feline leukemia virus strain C/FS246 Feline leukemia virus strain C/Sarma

• Feline sarcoma virus ■ Gardner-Arnstein feline leukemia oncovirus B o Gibbon ape leukemia virus (GALV)

^■ Simian sarcoma-associated virus o Murine leukemia virus

^■ AKR (endogenous) murine leukemia virus • Friend murine leukemia virus

^■ Moloney murine leukemia virus

• Murine leukemia virus isolates

• unclassified Murine leukemia virus o Porcine type-C oncovirus • Porcine endogenous retrovirus

^■ Porcine endogenous type C retrovirus o Replication defective viruses

^■ Abelson murine leukemia virus

^■ Gardner-Arnstein feline sarcoma virus o Hardy-Zuckerman feline sarcoma virus

■ Feline sarcoma virus (STRAIN HARDY-ZUCKERMAN 2)

■ Feline sarcoma virus (STRAIN HARDY-ZUCKERMAN 4) Harvey murine sarcoma virus

^■ Kirsten murine sarcoma virus o Moloney murine sarcoma virus

^■ Cas-NS-1 murine sarcoma virus

^■ FBJ murine osteosarcoma virus

^■ Moloney murine sarcoma virus (STRAIN HT-1 )

^■ Moloney murine sarcoma virus (STRAIN M1 ) ■ Moloney murine sarcoma virus (strain TS1 10)

^■ Murine sarcoma virus 361 1

• Myeloproliferative sarcoma virus

^■ NS.C58 murine sarcoma virus o Murine osteosarcoma virus ■ FBR murine osteosarcoma virus

^■ Snyder-Theilen feline sarcoma virus o Spleen focus-forming virus

• Friend spleen focus-forming virus

■ Rauscher spleen focus-forming virus ■ Woolly monkey sarcoma virus

Thus, the retroviral RNA genome or derivative thereof or a retroviral element is in one embodiment derived from Chick syncytial virus, Feline leukemia virus, Finkel-Biskis- Jinkins murine sarcoma virus, Gardner-Arnstein feline sarcoma virus, Gibbon ape leukemia virus, Guinea pig type-C oncovirus, Hardy-Zuckerman feline sarcoma virus, Harvey murine sarcoma virus, Kirsten murine sarcoma virus, Moloney murine sarcoma virus, Murine leukemia virus (MLV), Porcine type-C oncovirus, Reticuloendotheliosis virus, Snyder-Theilen feline sarcoma virus, Trager duck spleen necrosis virus, Viper retrovirus or Woolly monkey sarcoma virus. See table 3 for a list of gammaviruses. Each of the gammaviruses specified herein is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them may be claimed individually. In a particularly preferred embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Murine Leukemia Virus (MLV) or Moloney Murine Leukemia Virus (MoMLV) or Akv MLV.

In a specific embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Avian (Reticuloendotheliosis) virus group such as Chick syncytial virus, Reticuloendotheliosis virus, Avian spleen necrosis virus , Spleen necrosis virus, Mammalian virus group , Murine endogenous retrovirus , Murine leukemia-related retroviruses , Epicrionops marmoratus retrovirus , lchthyophis kohtaoensis retrovirus , Osteolaemus tetraspis retrovirus , Sericulus bakeri retrovirus , Terdus iliacus retrovirus , Tomistoma schlegelii retrovirus , Viper berus retrovirus , Xenotropic MuLV-related virus , Monodelphis sp. retrovirus, Replication competent viruses , Feline leukemia virus , Gibbon ape leukemia virus (GALV) , Murine leukemia virus , Porcine type-C oncovirus , Replication defective viruses , Abelson murine leukemia virus , Gardner-Arnstein feline sarcoma virus , Hardy-Zuckerman feline sarcoma virus , Harvey murine sarcoma virus , Kirsten murine sarcoma virus , Moloney murine sarcoma virus , Murine osteosarcoma virus , Snyder-Theilen feline sarcoma virus , Spleen focus-forming virus , Woolly monkey sarcoma virus, unclassified Gammaretrovirus , Baboon endogenous virus , Baboon endogenous virus strain M7, Feline endogenous virus , Feline endogenous virus ECE1 , Feline endogenous virus RD1 14, Koala retrovirus , Macaca mulatta type C retrovirus , Macaca endogenous retrovirus, MLV-related retrovirus , Rat leukemia virus , Rat sarcoma virus , RD114 retrovirus , Recombinant M-MuLV/RaLV retrovirus, Murine endogenous retrovirus , Murine leukemia-related retroviruses , Epicrionops marmoratus retrovirus , lchthyophis kohtaoensis retrovirus , Osteolaemus tetraspis retrovirus , Sericulus bakeri retrovirus , Terdus iliacus retrovirus , Tomistoma schlegelii retrovirus , Viper berus retrovirus , Xenotropic MuLV-related virus , Xenotropic MuLV-related virus VP35 , Xenotropic MuLV-related virus VP42 , Xenotropic MuLV-related virus VP62, Monodelphis sp. retrovirus, Replication competent viruses , Feline leukemia virus , Feline leukemia provirus (clone CFE-16) , Feline leukemia provirus (clone CFE-6) , Feline leukemia provirus ftt , Feline leukemia virus strain A/Glasgow-1 , Feline leukemia virus strain B/lambda-B1 , Feline leukemia virus strain C/FA27 , Feline leukemia virus strain C/FS246 , Feline leukemia virus strain C/Sarma , Feline sarcoma virus , Gardner- Arnstein feline leukemia oncovirus B, Gibbon ape leukemia virus (GALV) , Simian sarcoma-associated virus, Murine leukemia virus , AKR (endogenous) murine leukemia virus , Friend murine leukemia virus , Moloney murine leukemia virus , Murine leukemia virus isolates , unclassified Murine leukemia virus , Porcine type-C oncovirus , Porcine endogenous retrovirus , Porcine endogenous type C retrovirus, Replication defective viruses , Abelson murine leukemia virus , Gardner-Arnstein feline sarcoma virus , Hardy-Zuckerman feline sarcoma virus , Feline sarcoma virus (STRAIN HARDY- ZUCKERMAN 2) , Feline sarcoma virus (STRAIN HARDY-ZUCKERMAN 4), Harvey murine sarcoma virus , Kirsten murine sarcoma virus , Moloney murine sarcoma virus , Cas-NS-1 murine sarcoma virus , FBJ murine osteosarcoma virus , Moloney murine sarcoma virus (STRAIN HT-1 ) , Moloney murine sarcoma virus (STRAIN M1 ) , Moloney murine sarcoma virus (strain TS110) , Murine sarcoma virus 361 1 , Myeloproliferative sarcoma virus , NS.C58 murine sarcoma virus, Murine osteosarcoma virus , FBR murine osteosarcoma virus, Snyder-Theilen feline sarcoma virus , Spleen focus-forming virus , Friend spleen focus-forming virus , Rauscher spleen focus-forming virus or Woolly monkey sarcoma virus. Each of the gammaviruses mentioned above is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them is claimed individually.

In a further embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Bovine leukemia virus, Primate T-lymphotropic virus 1 , Primate T-lymphotropic virus 2 or Primate T-lymphotropic virus 3. The deltaviruses are listed in table 4. Each of the deltaviruses mentioned herein is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them is claimed individually.

Table 4. List of deltaretroviruses

Deltaretrovirus Bovine leukemia virus

Deltaretrovirus Primate T-lymphotropic virus 1

Deltaretrovirus Primate T-lymphotropic virus 2

Deltaretrovirus Primate T-lymphotropic virus 3 In yet a further embodiment, the retroviral RNA genome or derivative thereof or a retroviral element is derived from Walleye dermal sarcoma virus, Walleye epidermal hyperplasia virus 1 or Walleye epidermal hyperplasia virus 2. The epsilonviruses are listed in table 5. Each of the epsilonviruses mentioned herein is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them may is individually.

Table 5. List of epsilonretroviruses

Epsilonretrovirus Walleye dermal sarcoma virus Epsilonretrovirus Walleye epidermal hyperplasia virus 1

Epsilonretrovirus Walleye epidermal hyperplasia virus 2

In yet another aspect of the present invention the retroviral RNA genome or derivative thereof or a retroviral element is derived from Bovine immunodeficiency virus, Caprine arthritis encephalitis virus, Equine infectious anemia virus, Feline immunodeficiency virus, Human immunodeficiency virus 1 , Human immunodeficiency virus 2, Puma lentivirus, Simian immunodeficiency virus, Visna/maedi virus or hepatitis C. The lentiviruses, wherefrom the lentiviral envelope or fragment thereof can be derived are listed in table 6.

Table 6. List of lentiviruses from which the retroviral RNA genome or derivative thereof or a retroviral element is derived according to the present invention.

Lentivirus Bovine immunodeficiency virus

Lentivirus Caprine arthritis encephalitis virus

Lentivirus Equine infectious anemia virus

Lentivirus Feline immunodeficiency virus

Lentivirus Human immunodeficiency virus 1

Lentivirus Human immunodeficiency virus 2

Lentivirus ^Puma lentivirus

Lentivirus Simian immunodeficiency virus

Lentivirus Visna/maedi virus

Each of the lentiviruses mentioned above is intended to be an individual embodiment. Consequently, a retroviral RNA genome or derivative thereof or a retroviral element according to the present invention derived from each of them is claimed individually. In a particularly preferred embodiment the retroviral RNA genome or derivative thereof or the retroviral element according to the present invention is derived from HIV-1.

The term retroviral RNA genome or derivative thereof encompasses the retroviral genomes of the listed retroviruses elsewhere herein and furthermore encompasses retroviral RNA genome or derivative thereof also comprising retroviral transfer vectors (retroviral vectors) that are commonly applied in the art of gene delivery. Traditionally, retroviral vectors are gene transfer vehicles for birds and mammals that exploit features of the retroviral lifecycle such as effective infection and stable collinear integration of the virally transmitted information in a target cell chromosome.

Traditionally the murine leukaemia viruses (MLV) are used a basis for the production of retroviral vectors. However, also lentiviruses are employed and desired as basis for the design of retroviral vectors. Traditional retroviral vectors comprise as a minimum the cis-acting sequences as shown in figure 9 namely, the U3, R and U5 regions, the inverted repeats positioned in U3 and U5, the primer binding site (PBS), the poly purine tract (PPT) and the packaging sequence.

According to the present invention the need for cloning a gene of interest into a traditional retroviral vector is no longer be necessary in order to have a gene of interest inserted into the genome of a host cell, as the multifunctional molecule harbours the gene of interest to be inserted into the genome of a host cell by integration while also being capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome or derivative thereof or a retroviral element present in a cell. It is however contemplated that the multifunctional molecule according to the present invention may initiate one or more of first or second strand synthesis of a retroviral vector comprising a gene of interest or a retroviral transfer vector not comprising a gene of interest.

The present invention may entirely or partly abolish the need for cis-elements of a retroviral vector which is normally employed in gene transfer events by retroviral gene delivery..

Retroviral elements in a host cell are stretches of DNA in the genome of a host cell in which proviral DNA or part thereof has been integrated. Such elements comprise endogenous retroviral sequences. One example is Human endogenous retroviruses (HERVs) that are hypothesised as being involved in some autoimmune diseases, in particular with multiple sclerosis. In this disease, there appears to be a specially associated member of the familly of human endogenous retrovirus W known as "MS- associated retrovirus (MSRV). Many thousands of endogenous retroviruses are believed to exist within human DNA (HERVs comprise 8% of the human genome, with 98,000 elements and fragments). All appear to be defective, containing nonsense mutations or major deletions, and cannot produce infectious virus particles, presumably because most of the elements are evolutionary traces of the original virus, having integrated millions of years ago. In one embodiment retroviral elements are endogenous retrotransposons.The multifunctional molecule of the present invention is capable of initiating first strand DNA synthesis and/or second strand DNA synthesis using a retroviral RNA genome or derivative thereof or a retroviral element present in a cell as a template. Initiation of first strand DNA synthesis and/or second strand DNA synthesis is accomplished within a retroviral particle by the action of the virally encoded reverse transcriptase enzyme. Thus, in one embodiment the multifunctional molecule is capable of initiating first strand DNA synthesis. In another embodiment the multifunctional molecule is capable of initiating second strand DNA synthesis. In another embodiment the at least one multifunctional molecule is capable of initiating first and second strand DNA synthesis.

Initiation of first and/or second strand DNA synthesis by use of the retroviral-encoded reverse transcriptase via 'jumping' or strand transfer reactions on the strands as described elsewhere herein results in the synthesis of a double stranded DNA molecule known as the proviral DNA. The virally encoded integrase enzyme will integrate the proviral DNA into the genome of the host cell.

Whether proviral DNA has been synthesised using the multifunctional molecule can be analysed by determining whether double stranded DNA is present in the retroviral particle. A person skilled in the art appreciates that a mild detergent may be used to disrupt the viral envelope and capsid, whereby the contents of the retroviral particle can be visualized for example by EtBr staining following gel electrophoresis. This method of detection may also include in vitro DNA synthesis.

DNA synthesis can alternatively be determined by infection of permissible cells by the virus. Low molecular weight unintegrated DNA or genomic DNA of the cells may be harvested by conventional methods and the presence of nucleotides corresponding to the multifunctional molecule or part thereof present in the unintegrated or integrated provirus of the host cell may be determined, for example by PCR analysis and/or nucleotide sequence analysis.

In yet another embodiment the number of cells that are resistant to a selectable marker compound due to the infection of the cell by virus particles harbouring a proviral DNA encoding a resistance gene for the selectable marker compound may also be used as a measure of first and/or second strand transfer initiation. Typically, virus particles devoid of said resistance gene will be used as controls in such experiments, also known as determination of titer. Determination of titer is shown in the examples of the present invention.

Functional tRNA not within the scope of the present invention

It is appreciated that the multifunctional molecule according to the present invention is not a functional tRNA molecule, or a derivative thereof, capable of initiating one or more of a first strand DNA synthesis. A functional tRNA is a small RNA molecule (usually in the range of 74-95 nucleotides long) involved in the transfer of a specific active amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation. However, tRNAs also serve as primers of reverse transcription of the retroviral RNA of retroviral genomes or retroviral elements. The functional tRNAs are for example tRNA-Ala, tRNA-Arg, tRNA-Asp, tRNA-Cys, tRNA- GInI , tRNA-Gln2, tRNA-Glu, tRNA-Gly, tRNA-His, tRNA-lle, tRNA-Lys, tRNA-Lys, tRNA-Lys3, tRNA-Met(i), tRNA-Met, tRNA-Phe, tRNA-Pro, tRNA-Ser, tRNA-Trp, tRNA- VaI.

A functional tRNA has a gnjττary_structure, sec^ndary_structure (which is typically represented graphically as a cloverleaf, see figure 3 representing the tRNA phe from yeast), and tertiary structure (all tRNAs have a similar L-shaped 3D structure that allows them to fit into the P_and_A . _.. sjtes of the πbosorne when the tRNA is involved in protein synthesis).

The tRNA primer molecule found naturally in cells interacts through basepairing with the PBS region of the genomic retroviral RNA. For example in murine leukemia viruses 18 bases from the aminoacceptor stem and the T psi C loop of the tRNA anneals to the PBS and reverse transcription of the retroviral genome is initiated from the 3' end of the tRNA molecule. Further, as disclosed herein the multifunctional molecule of the present invention is not a functional genetically modified tRNA molecule, for example modified in one or more of the 18 bases from the aminoacceptor stem and the TpsiC loop of the tRNA .

Nucleotide sequence

The first part of the multifunctional molecule of the present invention comprises a nucleotide sequence at least partly complementary to a primer binding site and/or at least one other region of the retroviral RNA genome or derivative thereof or the retroviral element.

It is appreciated that the first part of the multifunctional molecule may optionally further comprise a label selected from the labels listed elsewhere herein.

By the term nucleotide sequence is meant a number of nucleotides linked together in a sequence of nucleotides to form an oligonucleotide or a polynucleotide. In the present invention the term oligonucleotide is used interchangeably with polynucleotide. The term oligonucleotide comprises oligonucleotides of both natural and/or non-natural nucleotides, including any combination thereof. The natural and/or non-natural nucleotides may be linked by natural phosphodiester bonds or by non-natural bonds.

The oligomer or polymer sequences of the present invention are formed from the chemical or enzymatic addition of monomer subunits. The term "oligonucleotide" as used herein includes linear oligomers of natural or modified monomers or linkages, including deoxyribonucleotides, ribonucleotides, anomeric forms thereof, peptide nucleic acid monomers (PNAs), locked nucleotide acid monomers (LNA), and the like, capable of specifically binding to a single stranded polynucleotide tag by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like. Usually monomers are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g. 3-4, to several tens of monomeric units, e.g. 40-60. Whenever an oligonucleotide is represented by a sequence of letters, such as "ATGCCTG," it will be understood that the nucleotides are in 5' -> 3' order from left to right and the "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes thymidine, unless otherwise noted. Usually oligonucleotides of the invention comprise the four natural nucleotides; however, they may also comprise methylated or non-natural nucleotide analogs. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers (Tetrahedron Lett, 22, 1859-1862, 1981 ), or by the triester method according to Matteucci, et al. (J. Am. Chem. Soc, 103, 3185, 1981 ), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPS. TM. technology. When oligonucleotides are referred to as "double-stranded," it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical configuration typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term "double-stranded" as used herein is also meant to refer to those forms which include such structural features as bulges and loops. For example as described in US 5.770.722 for a unimolecular double-stranded DNA. It is clear to those skilled in the art when oligonucleotides having natural or non-natural nucleotides may be employed, e.g. where processing by enzymes is called for, usually oligonucleotides consisting of natural nucleotides are required. When nucleotides are conjugated together in a string using synthetic procedures, they are always referred to as oligonucleotides.

Nucleotide Each nucleotide monomer is normally composed of two parts, namely a nucleobase moiety, and a backbone. The back bone may in some cases be subdivided into a sugar moiety and an internucleoside linker.

The nucleobase moiety may be selected among naturally occurring nucleobases as well as non-naturally occurring nucleobases. Thus, "nucleobase" includes not only the known purine and pyrimidine hetero-cycles, but also heterocyclic analogues and tautomers thereof. Illustrative examples of nucleobases are adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N ⁶ -methyladenine, 7- deazaxanthine, 7-deazaguanine, N ⁴ ,N ⁴ -ethanocytosin, N ⁶ ,N ⁶ -ethano-2,6-diamino- purine, 5-methylcytosine, 5-(C ³ -C ⁶ )-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S. Pat No. 5,432,272. The term "nucleobase" is intended to cover these examples as well as analogues and tautomers thereof. Especially interesting nucleobases are adenine, guanine, thymine, cytosine, 5-methylcytosine, and uracil, which are considered as the naturally occurring nucleobases.

Examples of suitable specific pairs of nucleobases are shown below:

Natural Base Pairs

R=H Uracil R R=CH ₃ Thymine Cytosine

HN_Λ ^Backb0πe Adenine

Guanine

Synthetic Base Pairs

Synthetic purine bases pairring with natural pyrimidines

R=H Uracil

7-deaza adenine

Suitable examples of backbone units are shown below (B denotes a nucleobase):

DNA 0xy-LNA Thio-LNA Ammo-LNA

Phosphorthioate 2'-0-Methyl 2'-MOE 2'-Fluoro 2'-F-ANA

The sugar moiety of the backbone is suitably a pentose but may be the appropriate part of an PNA or a six-member ring. Suitable examples of possible pentoses include ribose, 2'-deoxyribose, 2'-O-methyl-ribose, 2'-flour-ribose, and 2'-4'-O-methylene- ribose (LNA). Suitably the nucleobase is attached to the V position of the pentose entity.

An internucleoside linker connects the 3' end of preceding monomer to a 5' end of a succeeding monomer when the sugar moiety of the backbone is a pentose, like ribose or 2-deoxyribose. The internucleoside linkage may be the natural occurring phospodiester linkage or a derivative thereof. Examples of such derivatives include phosphorothioate, methylphosphonate, phosphoramidate, phosphotriester, and phosphodithioate. Furthermore, the internucleoside linker can be any of a number of non-phosphorous-containing linkers known in the art. Preferred nucleic acid monomers include naturally occurring nucleosides forming part of the DNA as well as the RNA family connected through phosphodiester linkages. The members of the DNA family include deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine. The members of the RNA family include adenosine, guanosine, uridine, cytidine, and inosine.

A natural nucleotide is any of the four deoxyribonucleotides, dA, dG, dT, and dC (constituents of DNA), and the four ribonucleotides, A, G, U, and C (constituents of RNA) are the natural nucleotides. Each natural nucleotide comprises or essentially consists of a sugar moiety (ribose or deoxyribose), a phosphate moiety, and a natural/standard base moiety. Natural nucleotides bind to complementary nucleotides according to well-known rules of base pairing (Watson and Crick, Nature), where adenine (A) pairs with thymine (T) or uracil (U); and where guanine (G) pairs with cytosine (C), wherein corresponding base-pairs are part of complementary, anti-parallel nucleotide strands. The base pairing results in a specific hybridization between predetermined and complementary nucleotides. The base pairing is the basis by which enzymes are able to catalyze the synthesis of an oligonucleotide complementary to the template oligonucleotide. In this synthesis, building blocks (normally the triphosphates of ribo or deoxyribo derivatives of A, T, U, C, or G) are directed by a template oligonucleotide to form a complementary oligonucleotide with the correct, complementary sequence. The recognition of an oligonucleotide sequence by its complementary sequence is mediated by corresponding and interacting bases forming base pairs. In nature, the specific interactions leading to base pairing are governed by the size of the bases and the pattern of hydrogen bond donors and acceptors of the bases. A large purine base (A or G) pairs with a small pyrimidine base (T, U or C). Additionally, base pair recognition between bases is influenced by hydrogen bonds formed between the bases. In the geometry of the Watson-Crick base pair, a six membered ring (a pyrimidine in natural oligonucleotides) is juxtaposed to a ring system composed of a fused, six membered ring and a five membered ring (a purine in natural oligonucleotides), with a middle hydrogen bond linking two ring atoms, and hydrogen bonds on either side joining functional groups appended to each of the rings, with donor groups paired with acceptor groups.

A non-natural oligonucleotide is any nucleotide not falling within the definition of a natural nucleotide. For example PNA, LNA, TNA, GNA or PMO (morpholinos). Complementary nucleotides according to the present invention are nucleotides that comprise nucleobases that are capable of base-pairing. Of the naturally occurring nucleobases adenine (A) pairs with thymine (T) or uracil (U); and guanine (G) pairs with cytosine (C). Accordingly, e.g. a nucleotide comprising A is complementary to a nucleotide comprising either T or U, and a nucleotide comprising G is complementary to a nucleotide comprising C.

A nucleotide analog is a nucleotide capable of base-pairing with another nucleotide, but incapable of being incorporated enzymatically into a template or a complementary template. Nucleotide analogs often include monomers or oligomers containing non- natural bases or non-natural backbone structures that do not facilitate incorporation into an oligonucleotide in a template-directed manner. However, interaction with other monomers and/or oligomers through specific base pairing is possible. Alternative oligomers capable of specifically base pairing, but unable to serve as a substrate of enzymes, such as DNA polymerases and RNA polymerases, or mutants or functional equivalents thereof, are defined as nucleotide analogs herein. Oligonucleotide analogs includes e.g. nucleotides in which the phosphodiester-sugar backbone of natural oligonucleotides has been replaced with an alternative backbone include peptide nucleic acid (PNA), locked nucleic acid (LNA), and morpholinos.

Glycerol nucleic acid (GNA) is a polymer similar to doxyribose nucleic acid (DNA) or ribose nucleic acid (RNA) but differing in the composition of the backbone structure. DNA and RNA have a deoxyribose and ribose sugar backbones respectively, whereas GNA's backbone is composed of repeating glycerol units linked by phosphodiester bonds. Interestingly, the Watson-Crick base pairing is much more stable in GNA than its natural counterparts DNA and RNA, as it requires a high temperature to melt a duplex of GNA. It is possibly the simplest of the nucleic acids, hence being regarded as a hypothetical precursor to RNA. Like DNA and RNA, to strands of GNA are able to self-pair to a GNA-GNA structure.

Threose nucleic acid (TNA) is a polymer similar to DNA, RNA and GNA but differing in the composition of the backbone struckture. DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, whereas TNA's backbone is composed of repeating threose units linked by phosphodiester bonds. The threose molecule is easier to assemble than ribose making it a possible precursor to RNA. DNA-TNA hybrid chains have been made in the laboratory using DNA polymerase. TNA can specifically base pair with RNA and DNA; this capability and chemical simplicity suggests that TNA could have preceded RNA as genetic material.

Locked nucleic acid (LNA) is often referred to as RNA that is inaccessible. LNA is a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' and 4' carbons. The bridge "locks" the ribose in the 3'- endo structural conformation, which is often found in the A-form of DNA or RNA. The locked ribose conformation enhances base stacking and backbone pre-organization, which is believed to increases the thermal stability of oligonucleotides. LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleotide whenever desired. Such mixed oligomers are commercially available. The locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the thermal stability (melting temperature) of oligonucleotides. LNA nucleotides are used to increase the sensitivity and specificity of expression in DNA microarrays, FISH probes, real-time PCR probes and other molecular biology techniques based on oligonucleotides. For the in situ detection of imiRNA the use of LNA is a very efficient method.

Peptide nucleic acid (PNA) is an artificially synthesized polymer similar to DNA or RNA. PNA is not known to occur naturally. DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, whereas PNA's backbone is composed of repeating N- (2-aminoethyl)-glycine units linked by peptide bonds. The various purine and pyrimidine bases are linked to the backbone by methylene carbonyl bonds. PNAs are depicted like peptides, with the N-terminus at the first (left) position and the C-terminus at the right. Since the backbone of PNA contains no charged phosphate groups, the binding between PNA/DNA strands is stronger than between DNA/DNA strands due to the lack of electrostatic repulsion. Early experiments with homopyrimidine strands (strands consisting of only one repeated pyrimidine base) have shown that the melting temperature of a 6-base thymine PNA/adenine DNA double helix was 31 °C in comparison to an equivalent 6-base DNA/DNA duplex that denatures at a temperature less than 10 °C. Mixed base PNA molecules are true mimics of DNA molecules in terms of base-pair recognition. PNA/PNA binding is stronger than PNA/DNA binding. Synthetic peptide nucleic acid oligomers have been used in recent years in molecular biology procedures, diagnostic assays and antisense therapies. Due to their higher binding strength it is not necessary to design long PNA oligomers for use in these roles, which usually require oligonucleotide probes of 20-25 bases. The main concern of the length of the PNA-oligomers is to guarantee the specificity. PNA oligomers also show greater specificity in binding to complementary DNAs, with a PNA/DNA base mismatch being more destabilizing than a similar mismatch in a DNA/DNA duplex. This binding strength and specificity also applies to PNA/RNA duplexes. PNAs are not easily recognized by either nucleases or proteases, making them resistant to enzyme degradation. PNAs are also stable over a wide pH range. Though an unmodified PNA cannot readily cross cell membranes to enter the cytosol, covalently coupling a cell penetrating peptide to a PNA can improve cytosolic delivery.

Morpholino - Phosphorodiamidate morpholino oligo (PMO): Morpholinos are synthetic molecules which are the product of a redesign of natural nucleic acid structure. Usually 25 bases in length, they bind to complementary sequences of RNA by standard Watson-Crick nucleic acid base-pairing. Structurally, the difference between

Morpholinos and DNA is that while Morpholinos have standard nucleic acid bases, those bases are bound to morpholine rings instead of deoxyribose rings and linked through phosphorodiamidate groups instead of phosphates. This may be easiest to visualize by referring to the first figure and comparing the structures of the two strands depicted there, one of RNA and the other of a Morpholino. Replacement of anionic phosphates with the uncharged phosphorodiamidate groups eliminates ionization in the usual physiological pH range, so Morpholinos in organisms or cells are uncharged molecules. The entire backbone of a Morpholino is made from these modified subunits. Morpholinos are most commonly used as single-stranded oligos, though heteroduplexes of a Morpholino strand and a complementary DNA strand may be used in combination with cationic cytosolic delivery reagents.

Morpholinos are usually used as a research tool for reverse genetics by knocking down gene function. This is achieved by preventing cells from making a targeted protein or by modifying the splicing of pre-mRNA. These molecules have been applied to studies in several model organisms, including mice, zebrafish and frogs. Morpholinos do not degrade their target RNA molecules, unlike many antisense structural types (e.g. phosphorothioates, siRNA). Instead, Morpholinos act by "steric blocking", binding to a target sequence within an RNA and simply getting in the way of molecules which might otherwise interact with the RNA. Morpholinos are being developed as pharmaceuticals under the name "NeuGenes" by AVI BioPharma Inc. Morpholinos as pharmaceutical therapeutics has been targeted against pathogenic organisms such as Mycobacterium tuberculosis and genetic diseases. They have been used in mammals ranging from mice to humans, and some are currently being tested in clinical trials as anticancer therapies.

In one embodiment the nucleotide sequence of the first part of the multifunctional molecule of the present invention is 5 or more nucleotides long.

However it is appreciated that the nucleotide sequence of the first part of the multifunctional molecule of the present invention is at least 5 residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 61 , 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441 , 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790,

800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides. In one embodiment the range the nucleotide sequence of the first part of the multifunctional molecule according to the present invention is 5 to 100 nucleotides long, for example 10 to 100, 10 to 75, 10 to 50, 10 to 40, 10 to 35, 10 to 20 nucleotides long. In a particular embodiment the nucleotide sequence of the first part of the multifunctional molecule according to the present invention is in the range of 5 to 50, or for example 10 to 25 nucleotides long.

It is contemplated that the nucleotide sequence of the first part of the multifunctional molecule of the present invention is a continuous stretch of nucleotides of at least at least 5 residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 61 , 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441 , 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900,

910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides. In one embodiment the range the nucleotide sequence of the first part of the multifunctional molecule according to the present invention is a stretch of 5 to 100 continuous nucleotides, for example 10 to 100, 10 to 75, 10 to 50, 10 to 40, 10 to 35, 10 to 20 continuous nucleotides. In a particular embodiment the nucleotide sequence of the first part of the multifunctional molecule according to the present invention is a stretch of 10 to 25 continuous nucleotides.

However, in one embodiment the nucleotide sequence of the first part of the multifunctional molecule according to the present invention may comprise two or more, such as 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 stretches of continuous nucleotides that are separated by one or more non-complementary stretches of nucleotides. Thus, the nucleotide sequence of the first part of the multifunctional molecule according to the present invention may comprise one or more mutations relative to the otherwise complementary RNA genome or derivative thereof or retroviral element of a cell.

The nucleotide sequence of the invention has complementarity to another nucleic acid such as the primer binding site and/or at least one other region of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell. The complementarity serves for the multifunctional molecule of the present invention to anneal to a retroviral RNA genome or derivative thereof or retroviral element in a cell. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 61 , 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441 , 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 contiguous nucleotides. It is further understood that the length of complementarity within nucleotide sequence of the first part of the multifunctional molecule and a primer binding site and/or at least one other regions of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell are such lengths. Moreover, the complementarity may be expressed as a percentage, meaning that the complementarity between a probe (nucleotide sequence of first part of the multifunctional molecule) and its target (a primer binding site and/or at least one other regions of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell) is 50% or greater over the length of the probe. In some embodiments, complementarity is or is at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57% ,58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, , 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In particular, such lengths may be applied to any nucleic acid comprising a nucleic acid sequence identified in any of SEQ ID NOs described herein, accession number, or any other sequence disclosed herein.

Complementary or partly complementary refers to the hybridization or base pairing between nucleotides or nucleic acids, such as, for instance, between two strands of a double stranded DNA molecule, between two strands of a RNA-DNA duplex or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid to be sequenced, amplified or reversely transcribed according to the present invention. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, such as 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, usually at least about 90%, 91 %, 92%, 93%, 94%,95%, and more preferably from about 98 to 100%.

It is contemplated that the first part of the multifunctional molecule comprising a nucleotide sequence is at least partly complementary to a primer binding site and/or another region of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell, refers to the fact that the multifunctional molecule is complementary to either strand of a primer binding site and/or another region of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell.

Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Selective hybridization conditions include, but are not limited to, stringent hybridization conditions. Selective hybridization occurs in one embodiment when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementarity. See, M. Kanehisa (Nucleic Acids Res. 12, 203, 1984), incorporated herein by reference. For shorter nucleotide sequences selective hybridization occurs when there is at least about 65% complementarity over a stretch of at least 8 to 12 nucleotides, preferably at least about 75%, more preferably at least about 90% complementarity. Stringent hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM. Hybridization temperatures can be as low as 5 ⁰ C and are preferably lower than about 3O ⁰ C. However, longer fragments may require higher hybridization temperatures for specific hybridization. Hybridization temperatures are generally about 2 ⁰ C to 6 ⁰ C lower than melting temperatures (T _m ), which for polynucleotides comprising less than about 20 nucleotides can be calculated as

T _m = 4 x (G+C content) + 2 x (A+T content). As other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, the combination of parameters is more important than the absolute measure of any one alone.

The following terms are used to describe the sequence relationships between two or more polynucleotides: "predetermined sequence", "comparison window", "sequence identity", "percentage of sequence identity", and "substantial identity".

A "predetermined sequence" is a defined sequence used as a basis for a sequence comparision; a predetermined sequence may be a subset of a larger sequence, for example, as a segment of a full-length DNA or gene sequence given in a sequence listing, such as a polynucleotide sequence of SEQ ID NO:1 , or may comprise a complete DNA or gene sequence. Generally, a predetermined sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.

Since two polynucleotides may each (1 ) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window", as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a predetermined sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the predetermined sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.

Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981 ) Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. MoI. Biol. 48: 443, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.

The term "sequence identity" means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparision (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms "substantial identity" as used herein denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a predetermined sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the predetermined sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the predetermined sequence over the window of comparison. The predetermined sequence may be a subset of a larger sequence, for example, a segment of the full- length SEQ ID NO:1 polynucleotide sequence illustrated herein.

The first part of the multifunctional molecule of the present invention comprises a nucleotide sequence at least partly complementary to a primer binding site and/or at least one other region of the retroviral RNA genome or derivative thereof or the retroviral element. As described elsewhere herein the complementarity may be to any of the strands of the of the target template ie. the retroviral RNA genome or derivative thereof or the retroviral element. In one embodiment the nucleotide sequence is at least partly complementary to a primer binding site of the target template. According to the present invention the PBS may be from any of the viruses listed herein or synthetic primer binding sites, for example PBS such as PBS UMU as described in the examples herein. In a particular embodiment the nucleotide sequence of the first part of the multifunctional molecule the nucleotide sequence is at least partly complementary to the PBS of murine leukaemia virus. In another particular embodiment the nucleotide sequence of the first part of the multifunctional molecule is at least partly complementary to the PBS of HIV-1.

It is contemplated that the nucleotide sequence of the first part of the multifunctional molecule is at least partly complementary to at least one other region of the retroviral RNA genome or derivative thereof or the retroviral element.

In one particular embodiment the the first part of the multifunctional molecule may anneal to any other region of the retroviral RNA genome or derivative thereof or the retroviral element. Thus, the first part of the multifunctional molecule may anneal outside the traditional PBS for priming first strand DNA synthesis. It is similarly appreciated that the first part of the multifunctional molecule anneals out side the traditional site for initiation of second strand synthesis, namely in a region other than the PPT region of a retroviral RNA genome or derivative thereof or retroviral element.

However, it is also within the scope of the present invention that the first part of the multifunctional molecule comprises a nucleotide sequence that is at least partly complementary to a primer binding site and at least one other region of the retroviral RNA genome or derivative thereof or the retroviral element.

It is appreciated that the the first part of the multifunctional molecule of the present invention serves to anneal (hybridise) to the primer binding site and/or at least one other region of the retroviral RNA genome or derivative thereof or the retroviral element and thereby prime the synthesis of first and/or second strand DNA synthesis.

The second part of the multifunctional molecule

The second part of the multifunctional molecule of the present invention comprises at least one genetic element and/or at least one label.

It is within the scope of the present invention that the mulficunctional molecule of the present invention optionally may comprise additional parts providing further functions to the multifunctional molecule. The optional additional functions may be comprised in the second part of the multifunctional molecule. No limitation to the number of genetic elements and/or labels exists.

Label

A label according to the present invention is any recognizable feature which is, for example: microscopically distinguishable in shape, size, color, optical density, electromagnetic properties, etc.; differently absorbing or emitting light; chemically reactive; magnetically or electronically encoded; or in some other way distinctively marked with the required information. Examples include, but are not limited to: a fluorochrome/fluorophor, an epitope, an enzyme, a DNA tag, any molecule that is detectable in a mass spectrometer, and a first (small) molecule that can bind to a second (larger) molecule for example, but not limited to, biotin, wherein said first molecule does not interfere with the function of the nucleotide to which the label is attached. Labeling substances specifically include, but are not particular limited to luminescent molecules, fluorescent molecules such as fluorescein, enzymes such as peroxidase and alkali phosphatase, antibodies, and other molecules having binding specificity to specific molecules such as a biotin or other that are used in the art. By a fluorescent label as a chemical modification of the multifunctional molecule of the present invention is meant a fluorescent chemical group (fluorophore) with which the multifunctional molecule is modified, and the fluorescence of this label enables sensitive and quantitative detection of the multifunctional molecule or for example the presence of the label in viral RNA, proviral DNA or integrated DNA as part of the genome of a host cell. Fluorescein (and derivatives therof) is an example of a fluorophore chemically attached to the multifunctional molecule of the present invention. Other examples of flourescent dyes suitable for the present invention are derivatives of rhodamine, coumarin and cyanine. Derivatives of cyanine are for example Cy3 and Cy5. Non-limiting examples of rhodamine dyes are Rhodamine 6G, Rhodamine B, TRITC, TAMRA, sulforhodamine 101 (and its sulfonyl chloride form Texas Red) and Rhodamine Red.

Labels on the multifunctional molecule may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include <125>1 , <32>P, <33>P, and <35>S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and [beta]- galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phycoerythrin. The colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4- methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum Dye(TM); Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; , fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB.

Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568,

BODIPY 564/570, BODIPY 576/589, BODIPY 581/591 , BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6- FAM, Fluorescein Isothiocyanate, HEX, 6- JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2',4',5',7'-Tetrabromosulfonefluorescein, and TET.

Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein- 12-UTP, BODIPY FL- 14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14- UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.

Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)- 1 1-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein- 12-dUTP,

Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546- 14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5- dUTP, BODIPY TR- 14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650- 14-dUTP, BODIPY 650/665-14-d UTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16- OBEA-dCTP, Alexa Fluor 594- 7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP.

It is contemplated that the nucleic acids comprised in the multifunctional molecule of the present invention acids may be labeled with at least two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention {e.g., Klostermeier et ah, 2002; Emptage, 2001 ; Didenko, 2001 , each incorporated by reference).

In a separate embodiment of the present invention, the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid. For example, the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody.

The labelled multifunctional molecule may be detected by a number of techniques that are known to a person skilled in the art and readily available.. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody- based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al, 1997), spectroscopy, capillary gel electrophoresis (Cummins et al, 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques.

In embodiments where two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize association of one or more nucleic acid. Furthermore, a person of ordinary skill in the art is well aware of ways of visualizing, identifying, and characterizing labeled nucleic acids, and accordingly, such protocols may be used as part of the invention. Examples of tools that may be used also include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm (Molecular Dynamics), Array Scanner, FACS (fluorescent activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule.

The label of the present invention may further be selected from the group consisting of contrast agents for positron emission tomography (PET) imaging, contrast agents for x- ray or computated tomography (CT) x-ray imaging and contrast agents for magnetic resonance (MR) imaging.

Radionuclides used in PET scanning decay by emitting a positron, which also has been chemically incorporated into a metabolically active molecule, is injected into the living subject (usually into blood circulation). Examples of radionuclides are isotopes with short half lives such as carbon-1 1 (-20 min), nitrogen-13 (—10 min), oxygen-15 (~2 min), and Fluorine-18 (—110 min). Due to their short half lives, the radionuclides must be produced in a cyclotron which is not too far away in delivery-time to the PET scanner. These radionuclides are incorporated into compounds normally used by the body such as glucose, water or ammonia and then injected into the body to trace where they become distributed. Such labelled compounds are known as radiotracers. The aptamers of the present invention comprise in one embodiment of the present invention radionucleotides. In particular fluorine-18 may be incorporated into the aptamers as at the 2' position of pyrimidines as described elsewhere herein.

For x-ray or computed tomography (CT) imaging, the label is in the form of an agent which provides a contrast to the surrounding tissue. Such an agent has a different electron density than the surrounding tissues (either more or less electron density than compared to the surrounding tissue) to make it visible. For CT imaging agents that will increase electron density in desired body parts, known as positive contrast agents. The positive contrast agents are selected from the group consisting of bromine moieties, fluorine moieties, iodine moieties and materials that comprise radioopaque metal atoms. It is understood, that bromine, fluorine or iodine moieties may be used separately or in combination. However, agents known as negative contrast agents are also within the scope of the present invention. Non-limiting examples of labelling agents for x-ray imaging or CT imaging is barium sulphate and/or iodine.

In one embodiment the aptamers of the present invention comprise at least one chemical modification in the form of a radioisotope. "Radioactive labeling" or "Radioactively label" refers to labeling using a substance including radioactive isotopes. Radioisotopes are selected from the group consisting of yttrium-90, indium- 1 11 , iodine-131 , lutetium-177, copper-67, rhenium-186, rhenium-188, bismuth-212, bismuth-213, astatine-21 1 , and actinium-225. However, the use of radioisotopes such as carbon-13 ( ¹³ C), tritium ( ³ H), carbon-14, S-35 Or ³² P, is also within the scope of the present application. Short lived isotopes is in one embodiment coupled through reactive groups, for example thio groups,, wherease longer lived isotopes are incorporated by the the use of radiolabeled nucleotides during or after synthesis of the aptamer.

The label of the present invention may be at least one contrast agents for MR imaging. MRI is a a diagnostic imaging technique involving the use of a magnetic field, field gradients and radiofrequency energy to excite protons, resulting in the manufacture of an image of mobile protons in water or fats of the body being subjected to MRI. Examples of contrast agents for MRI are an imageable nucleus (such as 19Fe) radioisotopes, diamagnetic, paramagnetic, ferromagnetic or superparamagnetic substances. In one preferred embodiment the contrast agents for MRI are those which have paramagnetic properties such as for example gadolinium or manganese- pramagnetic substances. In a preferred embodiment of the present invention gadolinium-based contrast agents are used. Other examples are contrast agents, such as iron oxides, ferric ion, ferric ammonium citrate for example diethylenetriaminepentaacetic (gadolinium-DTPA) and the like. In one preferred embodiment, superparamagnetic contrast agents such as iron oxide nanoparticles are used for the aptamers of the present invention.

Genetic element

Nucleotide sequence of genetic element

The second part of the multifunctional molecule comprises at least one genetic element and/or a label, wherein said at least one genetic element is selected from at least one nucleotide sequence and/or gene cassette.

Where the genetic element is in a form of at least one nucleotide sequence, said nucleotide sequence comprises at least one element capable of directing recombination during reverse transcription, at least one cis-element for retroviral integration and/or at least one regulatory RNA element.

In one embodiment the at least one nucleotide sequence capable of directing recombination is at least partly complementary to at least one region of the retroviral RNA genome or derivative thereof or the retroviral element. The characteristics of a nucleotide sequence being complementary to a target sequence is defined elsewhere herein.The presence of said nucleotide sequence may mediate recombination taking place where said nucleotide sequence anneals to a complementary or partly complementary region of the retroviral RNA genome or derivative thereof or the retroviral element. In a preferred embodiment the at least one sequence for directing recombination during reverse transcription, is at least 40% complementary to a RNA genome or derivative thereof or a retroviral element.

It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 61 , 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441 , 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560,

570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 contiguous nucleotides. It is further understood that the length of complementarity within nucleotide sequence of the second part of the multifunctional molecule and at least one region of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell are such lengths. Moreover, the complementarity may be expressed as a percentage, meaning that the complementarity between a probe (nucleotide sequence of second part of the multifunctional molecule) and its target (at least one region of the retroviral RNA genome or derivative thereof or a retroviral element present in a cell) is 40% or greater over the length of the probe. In some embodiments, complementarity is or is at least 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57% ,58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, , 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In particular, such lengths may be applied to any nucleic acid comprising a nucleic acid sequence identified in any of SEQ ID NOs described herein, accession number, or any other sequence disclosed herein.

The recombination process recombines two or more sequences by a process, the product of which is a sequence comprising sequences from each of the two or more sequences. When involving nucleotides, the recombination involves an exchange of nucleotide sequences between two or more nucleotide molecules at sites of identical nucleotide sequences (homologous recombination). Alternatively recombination may take place at sites of nucleotide sequences that are not identical, in which case the recombination can occur randomly (non-homologous recombination). Thus, in one embodiment the nucleotide sequence of the second part of the multifunctional molecule comprises at least one element capable of recombination during reverse transcription directs non-homologous and/or homologous recombination. In a particular embodiment the at least one element directs homologous recombination. Integration

Where the genetic element is in a form of at least one nucleotide sequence where the nucleotide sequence comprises at least one cis-element for retroviral integration. The cis-element is able to direct functional integration into a target genome, for example the genome of a host cell. Integration is mediated by the virally encoded integrase enzyme.

The cis-elements conferring functional integration according to the present invention are an inverted repeat and/or an imperfect inverted repeat. Inverted repeat in the present context refers to the inverted repeat found in the U3 region of the two LTR of a proviral DNA molecule. In one embodiment the cis-element conferring functional integration is an inverted repeat, but the cis-element may alternatively be an imperfect inverted repeat. The inverted repeat or imperfect inverted repeat may be derived from any of the viruses listed elsewhere herein - or be derivatives of such inverted repeats. In particular embodiments the inverted repeat or imperfect inverted repeat are derived from MLV or HIV-1.

Regulatory RNA sequences

The genetic element according to the present invention may be in a form of at least one nucleotide sequence, where said nucleotide sequence comprises at least one regulatory RNA element.

By regulatory RNA element is meant for example one or more of IRES, retroviral LTR, packaging signal, splice/donor acceptor, RRE or TAR. It is appreciated that any of the mentioned regulatory elements form separate embodiments. However, the multifunctional molecule may alternatively comprise any combination of regulatory elements.

IRES is an abbreviation for internal ribosome entry site which is a nucleotide sequence that allows for translation initiation in the middle of a messenger RNA (imRNA) sequence as part of the greater process of protein synthesis. Usually, in eukaryotes, translation can only be initiated at the 5' end of the imRNA molecule, since 5' cap recognition is required for the assembly of the initiation complex. IRES according to the present invention may be any IRES, preferably the IRES is derived from encephalomyocarditis virus. TAR is found in the LTR of HIV RNA/DNA. It's present in all mRNA transcripts and prevents the efficient use of the mRNA. tat binds to the RNA version of TAR and cancels its effect, allowing the mRNA to be efficiently processed into protein, In one particular embodiment the TAR region is used in the present context.

^» f

% J-

Ml U-v C

H!¥~1 TAR region

C O

U -\ U G 80 U -^ C G U S C l3 U -\

<SUGλ<jUUCCSUU£>f . U

RRE rev responsive element of HIV-1

Alternatively a packaging signal may be present in said nucleotide sequence. A packaging signal is a cis-regulatory element found in retroviruses which has an important role in regulating the packaging of the viral genome or derivative thereof into the capsid.

Splice/donor acceptor elements may be comprised in said nucleotide sequence as a regulatory element. By the introduction of splice/donor acceptor elements alternative splicing may take place in the target DNA. Alternative splicing is the RNA splicing variation mechanism in which the exons of the primary gene transcript, the pre-mRNA, are separated and reconnected so as to produce alternative ribonucleotide arrangements, and consequently the production of proteins. Consequently, the use of alternative splicing may facilitate the synthesis of a greater vairety of proteins. In one embodiment the genetic element is in the form of at least one nucleotide sequence, said nucleotide sequence comprising at least one element capable of directing recombination during reverse transcription and at least one cis-element for retroviral integration. In another embodiment the genetic element is in the form of at least one nucleotide sequence, said nucleotide sequence comprising at least one element capable of directing recombination during reverse transcriptionand at least one regulatory RNA element. In yet another embodiment the at least one nucleotide sequence comprises at least one cis-element for retroviral integration and at least one regulatory RNA element. In yet a further embodiment the genetic element is in a form of at least one nucleotide sequence, said nucleotide sequence comprising at least one element capable of directing recombination during reverse transcription, at least one cis-element for retroviral integration and at least one regulatory RNA element.

It is appreciated that the genetic element of the second part of the multifunctional nolecule comprises at least one nucleotide sequence comprising two, three, four, 5, 6, 7, 8, 9, 10 or more elements in any desirable combination.

Gene casettes

It is contemplated that the second part of the multifunctional molecule comprises a genetic element and/or label, wherein said genetic element is for example a gene cassette. The multifunctional molecule comprises at least one gene cassette encoding at least one functional RNA molecule and/or at least one gene cassette encoding for at least one protein, polypeptide or part thereof.

It is appreciated that the gene cassette may comprise at least one site for insertion of a yet other molecules encoding for various functionally enzymes. For example genes encoding proteins, peptides, shRNA, miRNA, antisense, ribozymes and the like may be inserted at the at least one or structures insertion site. It is contemplated that entire libraries of said molecules may be inserted at the insertion site deriving from the gene cassette comprised in the multifunctional molecule of the present invention.

Gene cassettes comprising functional RNA molecules

Where the multifunctional molecule comprises at least one gene cassette encoding at least one functional RNA molecule, the gene cassette encodes at least one functional RNA molecules as examplified below. The present invention relates to retroviral delivery, wherein gene cassettes may be stably integrated in host cell genomes, without the use of traditional recombinant DNA cloning and retroviral vector propagation but in stead uses a viral particle harbouring all tools for synthesis, delivery and/or integration of gene cassettes.

The targets for the functional RNA molecules of the present invention are not limited to any specific RNA molecules present in a host cell. The concept of the present invention enables the delivery of a functional RNA molecule (or sequences encoding such functional RNA molecules) that is capable of modifying the effect of a gene which has been transcribed into imRNA. Consequently, the targets i.e. transcripts of interest according to the present invention are transcripts of for example disease-causing genes, such as oncogenes, or for example, viruses such as HIV-1 , Hepatitis C, Hepatitis B, influenza, or mediators of inflammation such as tumor necrosis factor alpha.

One example of a functional RNA molecule encoded by the gene cassette is antisense RNA. Antisense RNA is RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs according to the present invention are complementary to a part of a target imRNA molecule and are used to affect the functioning of specific genes for investigative such as target validation or therapeutic purposes. Without being bound by theory it is believed that the target imRNA upon binding by the antisense RNA is blocked from being translated.

RNA interference (RNAi) is a mechanism that inhibits gene expression at the stage of translation or by hindering the transcription of specific genes. Small interfering RNA strands (siRNA) are key to the RNAi process, and have complementary nucleotide sequences to the targeted RNA strand. Specific RNAi pathway proteins are guided by the siRNA to the targeted messenger RNA (mRNA), where they "cleave" the target, breaking it down into smaller portions that can no longer be translated into protein. A type of RNA transcribed from the genome itself, microRNA (miRNA), works in the same way. The RNAi pathway is initiated by the enzyme dicer, which cleaves long, dsRNA molecules into short fragments of 20-25 base pairs. One of the two strands of each fragment, known as the guide strand, is then incorporated into the RNA-induced silencing complex (RISC) and pairs with complementary sequences. The most well- studied outcome of this recognition event is post-transcriptional gene silencing. This occurs when the guide strand specifically pairs with an mRNA molecule and induces cleavage by argonaute, the catalytic component of the RISC complex. Another outcome is epigenetic changes to a gene - histone modification and DNA methylation - affecting the degree the gene is transcribed.

Another example of a functional RNA molecule encoded by the gene cassette is small interfering RNA. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of 20-25 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway, where it interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g., as an antiviral mechanism or in shaping the chromatin structure of a genome; the complexity of these pathways is only now being elucidated. siRNAs were first discovered as part of post-transcriptional gene silencing (PTGS) in plants. Later, synthetic siRNAs were shown to be able to induce RNAi in mammalian cells. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. SiRNAs can also be exogenously (artificially) introduced into cells by various transfection methods to bring about the specific knockdown of a gene of interest. Essentially any gene of which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA. This has made siRNAs an important tool for gene function and drug target validation studies in the post-genomic era.

Transfection of an exogenous siRNA can be problematic because the gene knockdown effect is only transient, particularly in rapidly dividing cells. One way of overcoming this challenge is to modify the siRNA in such a way as to allow it to be expressed by an appropriate vector, e.g., a plasmid. This is done by the introduction of a loop between the two strands, thus producing a single transcript, which can be processed into a functional siRNA. Small hairpin RNA or short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA usually uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA- induced silencing complex (RISC). This complex binds to and cleaves imRNAs which match the siRNA that is bound to it.

In another embodiment the gene cassette may encode shRNA. shRNA is transcribed by RNA polymerase III which uses the U6, H1 or H7SK promoter. shRNA production in a mammalian cell can sometimes cause the cell to mount an interferon response as the cell seeks to defend itself from what it perceives as viral attack. This problem is not observed in imiRNA, which is transcribed by RNA polymerase Il (the same polymerase used to transcribe mRNA). The promoter of the present invention may be any promoter driving RNA polymerase Ill-based expression, for example the U6 promoter, H1 promoter or the H7SK promoter. However, the promoter of the present invention is not limited to the given examples.

shRNAs can also be made for use in plants and other systems, and are not necessarily driven by a U6 promoter. In plants the traditional promoter for strong consitutive expression (in most plant species) is the cauliflower mosaic virus 35S promoter (CaMV35S), in which case RNA Polymerase Il is used to express the transcript destined to initiate RNAi.

Yet another embodiment relates to a gene cassette encoding a ribozyme. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage. Within the scope of the present invention these are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between fifteen (15) and twenty (20) ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.

Investigators studying the origin of life have produced ribozymes in the laboratory that are capable of catalyzing their own synthesis under very specific conditions, such as an RNA polymerase ribozyme. Some ribozymes may play an important role as therapeutic agents, as enzymes which tailor defined RNA sequences, as biosensors, and for applications in functional genomics and gene discovery. Many ribozymes have either a hairpin - or hammerhead - shaped active center and a unique secondary structure that allows them to cleave other RNA molecules at specific sequences. It is now possible to make ribozymes that will specifically cleave any RNA molecule. These RNA catalysts may have pharmaceutical applications. For example, a ribozyme has been designed to cleave the RNA of HIV. If such a ribozyme was made by a cell, all incoming virus particles would have their RNA genome cleaved by the ribozyme, which would prevent infection

Also RNA decoys may be encoded by the gene cassette of the present invention. RNA decoys are small stretches of RNA intended to "trick" other molecules, in particular enzymes, to bind to the RNA decoy instead of the normal ligand for the molecule. The principle originates from research of AIDS and HIV. HIVs Tat molecule is required for the transcription of the HIV genome - it binds to the HIV TAR during transcription. Providing RNA decoys which Tat will bind to instead of the TAR, then this will occupy the Tat molecules and therefore put obstacles in the way of HIV replication and slow it down or even stop it.

In yet another embodiment the gene cassette of the present invention encodes imiRNA. miRNA or microRNAs are single-stranded RNA molecules of about 21-23 nucleotides in length, which regulate gene expression. According to the present invention the at least one gene cassette comprises at least one gene encoding imiRNAs that are transcribed from DNA into non-coding RNA. The non-coding RNAs are processed from primary transcripts known as pri-miRNA to short stem-loop structures called pre- miRNA and finally to functional miRNA. According to the present invention insertion of a gene cassette into a host genome results in the formation of mature miRNA molecules that are partially complementary to one or more messenger RNA (mRNA) of interest. The miRNA may be preceded by a promoter driving RNA polymerase II- based expression for example cytomegalo virus (CMV) promoter, SV40, EF1 alpha.

According to the present invention the at least one gene cassette comprises at least one gene encoding miRNAs that are transcribed from DNA into non-coding RNA, wherein the at least one gene cassette comprises at least one gene encoding the miRNAs as listed herein.

The following tables are obtained from imiRBase Release 12.0 - September 19, 2008 ^■ 14.10 (2.10 pm)

697 sequences on chromosomes 1 -22 and X

Chromosome 1

Chromosome 2

Chromosome 4

Chromosome 5

Chromosome 6

Chromosome 7

Chromosome 8 MI0005761 hsa-mir-939 8 145590172 145590253

MI0006324 hsa-mir-1234 8 145596284 145596367

Chromosome 9

Chromosome 10

Chromosome 12

Chromosome 13 I MI0006404 I hsa-mir-1267 | 13 | 106981520 | 106981597 |

Chromosome 14

Chromosome 15 I MI0006363 | hsa-mir-1302-2 | 15 | 100318185 | 100318322 |

Chromosome 16

Chromosome 17

Chromosome 18

Chromosome 19

Chromosome 20 Chromosome 21

Chromosome 22

Chromosome X

The transcription process of non-protein encoding genes, such as genes transcribed into rRNA, tRNA and small RNA molecules such as ribozymes, nsRNA, shRNA and siRNA. These genes are all transcribed by RNA Polymerase III (Pol III). The genes transcribed into miRNA are transcribed by RNA polymerase Il (Pol II), and uses the transcription promoters and enhancers listed elsewhere herein. Pol III promoters generally fall into two classes: Internal promoters are used for rRNA and tRNA transcription, while external promoters are used when transcribing small RNA molecules. In both cases, the individual elements that are necessary for promoter function consist exclusively of sequences recognized by transcription factors, which in turn direct the binding of RNA polymerase. Preferred promoters for Pol III trancscription include U6 and H1. Polymerase III terminates transcription at small polyTs stretch. In one particular embodiment the multifunctional molecule complements a retroviral vector comprising for example a part of a gene cassette. The multifunctional molecule may for example comprise genetic elements encoding siRNAs, imiRNAs, shRNAs, ribozymes, antisense or the like or genes encoding proteins, and the retroviral vector may comprise a cassette comprising suitable promoters for the expression of said functional RNA molecules or vice versa. It is contemplated that the complementation of the retroviral gene cassette with the genetic elements of the multifunctional molecule results in functional gene cassettes that when integrated into a host cell genome expresses the siRNA, miRNA, shRNA, ribozymes, antisense and the like.

Promoters and Enhancers for protein encoding genes in gene cassettes

The promoters and enhancers that control the transcription of protein-encoding genes are composed of multiple genetic elements. The cellular machinery is able to gather and integrate the regulatory information conveyed by each element, allowing different genes to evolve distinct, often complex patterns of transcriptional regulation.

The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator proteins. At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV 40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between elements is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.

Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation.

The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Aside from this operational distinction, enhancers and promoters are very similar entities. They have the same general function of activating transcription in the cell. They are often overlapping and contiguous, often seeming to have a very similar modular organization. Taken together, these considerations suggest that enhancers and promoters are homologous entities and that the transcriptional activator proteins bound to these sequences may interact with the cellular transcriptional machinery in fundamentally the same way.

Particularly preferred promoters include the lac-lpp promoter which is well-known in the art. Other promoters contemplated to be useful in the practice of the invention include the ara, tet, tac, trc, trp, phoA, P. sub. BAD, .lambda..sub. PL, Ipp, and the T7 promoters.

Vector comprising a multifunctional molecule

While it is anticipated that the multifunctional molecule is produced synthetically as an oligonucleotide described herein previously, one aspect of the present invention relates to an isolated mammalian vector comprising at least one multifunctional molecule according to the present invention from which the multifunctional molecule may be excised or amplified.

Numerous vectors are available and the skilled person will be able to select a useful vector for the specific purpose. The vector may, for example, be in the form of a plasmid, cosmid, viral particle or artificial chromosome. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures, for example, DNA may be inserted into an appropriate restriction endonuclease site(s) using techniques well known in the art. Apart from the nucleic acid sequence according to the invention, the vector may furthermore comprise one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. The vector may also comprise additional sequences, such as enhancers, poly-A tails, linkers, polylinkers, operative linkers, multiple cloning sites (MCS), STOP codons, internal ribosomal entry sites (IRES) and host homologous sequences for integration or other defined elements. Methods for engineering nucleic acid constructs are well known in the art (see, e.g., Molecular Cloning: A Laboratory Manual, Sambrook et al., eds., Cold Spring Harbor Laboratory, 2nd Edition, Cold Spring Harbor, N.Y., 1989). In another embodiment, the vector is preferably an expression vector, comprising the multifunctional molecule operably linked to a regulatory nucleic acid sequence directing expression thereof in a suitable cell. Within the scope of the present invention said regulatory nucleic acid sequence should in general be capable of directing expression in a mammalian cell, preferably a human cell, more preferably in an antigen presenting cell.

Gene cassettes encoding proteins, polypeptides and/or peptides In one embodiment the at least one gene cassette encodes at least one protein, polypeptide or part thereof and/or peptides. The proteins, peptides and polypeptides may be any desirable protein, peptide and/or polypeptide. The protein, peptide and/or polypeptide may be selected from selectable markers, therapeutic proteins immunoglobulins, T cell receptors, viral envelope proteins, ligands for extracelluar receptors, or peptide recognition motifs.

Examples of selectable markers are proteins conferring resistance to for example neomycin, streptomycin, kanamycin or any other antibiotic. Thus one example of a gene cassette is a gene cassette encoding neomycin phosphotransferase. Selectable markers may also be genes encoding enhanced green fluorescent protein (EGFP), yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyano fluorescent protein (CFP), and/or Discosoma sp. red fluorescent protein (dsRED). Non-limiting examples of therapeutic proteins include interferons, tumor suppressor proteins and erythropoeitin.

It is appreciated that two or more gene cassettes may be preent in the second part of the multifunctional molecule, such as 2, 3, 4, 5, 6, 7, 8,9 or 10 gene cassettes. The gene casettes may be any combination of gene casettes.

Methods In one aspect of the present invention there is provided for a method for synthesizing double stranded proviral DNA. The method initially comprises the step of providing at least one multifunctional molecule according to the present invention or a composition providing such at least one multifunctional molecule. In a further step at least one template to which said multifunctional molecule can hybridise is provided. The template can be a retroviral element as defined herein or a viral RNA genome or derivative as defined herein. The only requirement one has to observe is that the multifunctional molecule can hybridise to the retroviral element or the viral RNA genome or derivative, for example by hybridising to a primer binding site or to at least one other region of the retroviral RNA genome or derivative or said element. In another step reverse transcriptase is provided. In a further step the multifunctional molecule of the present invention or composition comprising said multifunctional molecule contacts the template forming a complex that upon a further step is contacted with the reverse transcriptase enzyme. First and second strand DNA synthesis takes place by action of reverse transcriptase and the priming by the multifunctional molecule using the template RNA. By these steps double stranded proviral DNA is obtained.

It is appreciated that the multifunctional molecule and the template may be transferred into a packaging cell. The transfer may be for example by transfection, wherein said transfection of the multifunctional molecule and the template simultaneously or in separate steps. The steps wherein the template and the multifunctional molecule forms a complex and the reverse transcriptase contacts said complex may take place in a target cell, where first and second strand synthesis as well as the synthesis of virus specific proteins and building blocks required for the synthesis and assembly of a functional virus particle takes place.

Transfection is the process by which foreign DNA is introduced into cells by non-viral methods. Transfection typically involves opening transient pores in the cell plasma membrane, to allow the uptake of material. In addition to electroporation, transfection can be carried out by mixing a cationic lipid with the material to produce liposomes, which fuse with the cell plasma membrane and deposit their cargo inside.

A number of methods exist for the introduction of nucelic acids into a eukaryotic cells.

One method is transfection by use of calcium phosphate. A HEPES-buffered saline solution (HeBS) containing phosphate ions is combined with a calcium chloride solution containing the DNA to be transfected. When the two are combined, a precipitate of the positively charged calcium and the negatively charged phosphate will form, binding the DNA to be transfected on its surface. Subsequently, the suspension of the precipitate is added to the cells to be transfected and the cells take up some of the precipitate, and with it, the foreign DNA. Another efficient method is the inclusion of the DNA to be transfected in liposomes. Liposomes are small, membrane-bounded entities that can fuse with the cell membrane, releasing the DNA into the cell. Yet another method involves the use of cationic polymers such as DEAE-dextran or for example polyethylenimine.

Other methods of transfection include nucleofection, heat shock, magnetofection and the use of transfection reagents such as Lipofectamine, Dojindo Hilymax, Fugene, jetPEI, Effectene or DreamFect.

An alternative to the above methods for transfection, transfection may also be obtained by use of a gene gun employing pressure to shoot DNA into the nucleus of a target cell. Typically DNA is coupled to a nanoparticle of an inert solid.

Another aspect of the present invention relates to a method for transferring the multifunctional molecule into a packaging cell. The method initially comprises the step of providing at least one multifunctional molecule according to the present invention or a composition comprising such at least one multifunctional molecule. A further step comprises transferring the multifunctional molecule into the packaging cell.

Conventionallly this is performed by transfection of packaging cells as described elsewhere herein. The result is a packaging cell comprising the multifunctional molecule of the present invention. Optionally a further step of providing at least one template to which said multifunctional molecule can hybridise is included in the method. The template can be a retroviral element as defined herein or a viral RNA genome or derivative as defined herein. The only requirement one has to observe is that the multifunctional molecule can hybridise to the retroviral element or the viral RNA genome or derivative, for example by hybridising to a primer binding site or to at least one other region of the retroviral RNA genome or derivative or said element. In such an instance a packaging cell comprising at least one multifunctional molecule of the present invention and a RNA template to which the multifunctional molecule anneals to the PBS and/or to at least one other region of the RNA template.

In another aspect of the present invention there is provided a method for producing a viral particle. The method initially comprises the step of providing at least one multifunctional molecule according to the present invention or a composition comprising such at least one multifunctional molecule. In a further step at least one template to which said multifunctional molecule can hybridise is provided. The template can be a retroviral element as defined herein or a viral RNA genome or derivative as defined herein. The only requirement one has to observe is that the multifunctional molecule can hybridise to the retroviral element or the viral RNA genome or derivative, for example by hybridising to a primer binding site or to at least one other region of the retroviral RNA genome or derivative or said element. In an even further step a packaging cell is provided and the at least one multifunctional molecule and the at least one template is transferred to the packaging cell and internalised into the packaging cell according to any available method known to the skilled artisan. In a final step a virus particle is obtained comprising the multifunctional molecule of the present invention and at least one RNA template, wherein said template is at least one retroviral genome or derivative thereof.

In yet another aspect of the present invention there is provided a method for integration of foreign DNA into a target cell. The method initially comprises the step providing at least one viral particle comprising at least one multifunctional molecule and optionally a template for first and or second strand DNA synthesis. Another step comprises providing at least one target cell. A further step comprises contacting the viral particle and the target cell. The contact between target cell and virus particle mediates entry of the virus particle into the target cell through receptor-dependent fusion between the viral membrane and the membrane of the target cell. Subsequently, the retroviral particle is internalized into the cytoplasm of the target cell. Reverse transcription of the template is primed by the at least one multifunctional molecule. The reverse transcription process takes place within the target cell and a proviral double-stranded DNA molecule is synthesised and found within the target cell. Subsequently, the proviral double-stranded DNA is integrated into the genome of the target cell by action of the integrase enzyme. Thus, a target cell is obtained wherein said target cell in its genome comprises said foreign DNA.

The foreign DNA in the present context refers to the at least one multifunctional molecule or part thereof according to the present invention.

The present invention in a further aspect provides a method for producing a host cell harbouring at least one integrated multifunctional molecule or part thereof. The method initially comprises the step of providing at least one multifunctional molecule. Optionally a template for first and or second strand DNA synthesis and/or a viral particle comprising at least one multifunctional molecule and optionally a template for first and or second strand DNA synthesis is provided. Another step comprises providing at least one target cell (here also host cell). The multifunctional molecule is in a next step transferred to the target cell (host cell) by any method for example selected from the transfection methods described herein. When the multifunctional molecule is found vwithin a retroviral particle said retroviral particle infects the host cell by receptor- dependent fusion. In a final step a host cell harbouring the at least one multifunctional molecule or part thereof integrated into the host cell genome.

In yet a further aspect the present invention provides a method for delivery of at least one multifunctional molecule or part thereof to a host cell comprising the steps of i) providing a retroviral particle comprising at least one genetic element and/or label ii) contacting a cell with the retroviral particle of step i), iii) obtaining a host cell comprising said at least one genetic element and/or label. In one embodiment the at least one multifunctional molecule of part thereof is delivered to a cell. In another embodiment the at least one multifunctional molecule is stably integrated in the genome of the host cell. Consequently the host cell in one embodiment comprises at least one genetic element and/or label derived from the multifunctional molecule. In another embodiment the host cell in another embodiment comprises at least one genetic element and/or label derived from the multifunctional molecule stably integrated in its genome.

The present invention also relates to a method for screening for functional mutants of interest. The method initially comprises the step providing at least one multifunctional molecule. Optionally a template for first and or second strand DNA synthesis may be provided. A second step comprises producing a virus particle comprising said at least one multifunctional molecule. The method further comprises contacting a target cell with said virus particle and subsequently comprising the step of obtaining a host cell with the at least one multifunctional molecule or part thereof. In one embodiment the at least one multifunctional molecule or part thereof is stably integrated into the target cell genome. In a final step of the method functional mutants of interest are identitied. Again it is appreciated that the method may involve the process wherein the contact between target cell and virus particle mediates entry of the virus particle into the target cell through receptor-dependent fusion between the viral membrane and the membrane of the target cell. Subsequently, the retroviral particle is internalized into the cytoplasm of the target cell. Reverse transcription of the template is primed by the at least one multifunctional molecule. The reverse transcription process takes place within the target cell and a proviral double-stranded DNA molecule is synthesised and found within the target cell. Subsequently, in one embodiment the proviral double-stranded DNA is integrated into the genome of the target cell by action of the integrase enzyme. Thus, a target cell is obtained wherein said target cell comprises foreign DNA, the function of which may be identified.

Packaging cells/producer cells

Packaging cells according to the present invention refers to cells that express transacting virus-encoded components necessary for the packaging of retroviral RNA genome or derivatives thereof. Packaging cells are also referred to as producer cells, and the terms are used interchangeably and synonymously herein.

Packaging/producer cells are often produced by transfecting cells with genetic information and/or genes essential for retroviral particle formation. The culture of packaging cells is subsequently transfected with the retroviral vector DNA and in the present context the multifunctional molecule. However, the genetic information and/or genes essential for retroviral particle formation, the retroviral vector DNA and the multifunctional molecule may also be introduced in a single round of transfection. The transfected packaging cell will subsequently produce infectious viral particles comprising the vector RNA genome and the multifunctional molecule. Said particles, which will be released from the packaging cell, can be isolated.

A great number of packaging cells exist. The packaging cell according to the present invention is not limited to any particular cell. The packaging cells of the present invention are selected from all types of eukaryotic cells e.g. mammalian cells, and/or yeast cells. Packaging cells for murine leukaemia virus genomic RNA and derivatives thereof are for example packaging cell Psi-2, BOSC cells or PLAT-E cells.

In a further embodiment, cells from old world monkeys and humans are used as packaging cells for production of infectious viral particles. Examples of cells suitable as packaging cells cell are Human embryonic Kidney cells HEK 293, HEK 293T, Human rhabdomysarcoma cells TE671 , Canine osteosarcome cells D17, murine fibroblast cells NIH3T3.

Host/target cells The retroviral particles are preferably capable of infecting animal cells, such as mammalian cells, preferably human cells. In a specific embodiment, the retroviral particles are capable of infecting stem cells.

It is within the scope of the present invention that at least one multifunctional molecule may be used in the methods disclosed herein, wherein said at least one multifunctional molecule is capable of priming first and/or second strand of the retroviral RNA genome or derivative thereof or retroviral element.

It is appreciated that for any of the methods provided two or more multifunctional molecules may be used. For example one multifunctional molecule may be used for priming first strand of the retroviral RNA genome or derivative thereof or retroviral element and another, different, multifunctional molecule primes the second strand of the retroviral RNA genome or derivative thereof or retroviral element, allowing for the synthesis of double-stranded DNA. Such a process may be regarded as a polymerase chain amplification reaction- like reaction for synthesis of DNA occurring in a target cell using the virus as a test tube.

The result of the afore-mentioned steps is the provision of a functional virus particle comprising the multifunctional molecule or a complementary strand thereof. Likewise, the mentioned methods provide a target cell comprising at least one multifunctional molecule or complementary strand thereof, for example stably integrated.

The present invention in one aspect is directed to various methods exploiting the multifunctional molecule according to the present invention. The methods of the present invention exploit the capability of the multifunctional molecule to initiate one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome, or derivative thereof, or a retroviral element in general, when such an element is present in a cell. The functionality of the molecule is provided by a first molecule part comprising a nucleotide sequence which is at least partly complementary to a primer binding site (PBS) and/or another region of the retroviral RNA genome or the retroviral element present in a cell, and a second molecule part comprising at least one genetic element and/or at least one label. Following a first and/or second strand synthesis of a retroviral RNA genome, or derivative thereof, or a retroviral element, the synthesised strand(s) can be exploited for several diagnostic and/or therapeutic or other purposes. In one embodiment, the diagnostic and/or therapeutic or other methods of the present invention are made possible by initially performing a method comprising the steps of i) providing at least one multifunctional molecule according to the invention capable of initiating one or more of a first strand DNA synthesis and a second strand DNA synthesis of a retroviral RNA genome, or derivative thereof, or a retroviral element, and optionally providing a template such as a retroviral RNA genome, or derivative thereof, or a retroviral element ii) providing a packaging cell iii) transferring said at least one multifunctional molecule and optionally said template to a packaging cell , iv) obtaining a retroviral particle comprising said at least one multifunctional primer and optionally the template, comprising at least one genetic element and/or a label, v) contacting the viral particle and a target cell, and vi) obtaining a cell said host cell comprising said at least one genetic element and/or said at least one label.

The diagnostic and/or therapeutic or other purposes of the present invention are related to establishing and/or expressing, as the case may be, in the biological cell of interest the at least one genetic element and/or the at least one label. The at least one genetic element and/or the at least one label can in principle be introduced into said biological cell by any means available in the prior art.

In one aspect the present invention relates to a retroviral vector designed to comprise sites for annealing of the multifunctional molecule according to the present invention. In contrast to existing retroviral vectors the retroviral vector of the present invention may in one embodiment be devoid of at least one or more cis elements as characterised herein. Thus, the retroviral vector in one embodiment is devoid of a packaging signal, when a packaging signal is present in the multifunctional molecule. Similarly, the retroviral vector according to the present invention is devoid of inverted repeats when inverted repeats are present in the multifunctional molecule. It is appreciated that the retroviral vector lacks all retroviral cis-elements. In one embodiment of the present invention the retroviral vector in contrast to traditional retroviral vector does not comprise a foreign gene of interest to be transferred to the target cell genome. Instead the gene of interest or nucleotide sequence of interest is supplied by the multifunctional vector of the present invention. However, the retroviral vector of the present invention may comprise part of a gene cassette where said cassette is completed by the multifunctional molecule upon reverse transcription of the retroviral vector RNA, yielding a comple functional cassette (or functional genetic element) that is integrated into the target cell genome.

Packaging cell and retroviral particle comprising a multifunctional molecule.

It is appreciated that one aspect of the present invention is a packaging cell comprising the at least one multifunctional molecule or part thereof or at least one composition comprising said multifunctional molecule or part thereof. The packaging cell may further comprise a template to which the first part and optionally the second part of the multifunctional molecule or part thereof anneals. A first part of the multifunctional molecule may anneal to a primer binding site and/or at least one other region of the template. The template is a for example a retroviral RNA genome or derivative thereof (for example a retroviral vector) or the retroviral element present in a cell. It is appreciated that the packaging cell comprises structural genes that allow the production of viral particles. Another aspect of the present invention is a retroviral particle comprising at least one multifunctional molecule as described herein. The retroviral particle in a preferred embodiment further comprises a template to which the first part and optionally the second part of the multifunctional molecule or part thereof anneals. A first part of the multifunctional molecule may anneal to a primer binding site and/or at least one other region of the template. The template is for example a retroviral RNA genome or derivative thereof (for example a retroviral vector).

In a further aspect of the present invention relates to RNA and/or DNA molecules derived from the retroviral particle comprising at least one multifunctional molecule or part thereof.

Furthemore within the scope of the present invention is the aspect of a target cell comprising at least one multifunctional molecule or part thereof according to the present invention. In a preferred embodiment the at least one multifunctional molecule or part thereof is stably integrated into the genome of the target cell. The target cell in a preferred embodiment comprises at least one genetic element and/or label stably integrated into the genome. Consequently, the at least one genetic element is expressed in the target cell where the genetic element can exert its function.

Composition and pharmaceutical composition The present invention in one aspect provides compositions comprising the at least one multifunctional molecule according to the present invention, polynucleotides and vectors comprising said multifunctional molecule, and diagnostic or therapeutic methods exploiting said multifunctional molecules and/or said compositions.

Thus, in one aspect is provided a composition comprising at least one retroviral particle comprising at least one multifunctional molecule according to the invention for treatemtn of for example diseases such as outlined herein. It is appreciated that the retroviral particle in a preferred embodiment further comprises template to which the at least one multifunctional molecule anneals.

The methods can be aimed e.g. at solving problems in the art associated with identifying genes and/or controlling the expression of genes in cells, for example mammalian cells, such as human cells, for example cancer cells, such as cancer cells in mammals, such as human beings, which are aberantly expressed. An aberantly expressed gene in this context is any gene the expression of which results in a discernable phenotype in the individual or subject in question. Some genes and the transcripts thereof are targets for imiRNA (used interchangably with microRNA herein) regulation. However, genes can also exist which exert a downstream regulation of other genes. Accordingly, the present invention in one aspect is directed to methods for controlling or altering gene expression in a biological cell. A gene can be a direct target or an indirect target. An indirect target will often be a "downstream" target of regulation following a microRNA-mediated modification of an "upstream" gene expression in a gene regulation pathway. The genetic element can e.g. encode a therapeutic polypeptide or a microRNA which it is desirable to deliver and/or to express or produce in a given biological host cell or host cell organism.

The packaging cell and/or the virus particle can be used for carrying out various methods of the present invention e.g. relating to the identification and characterization of genes and biological pathways related to certain disease or clinical indication associated genes, or for the study of a number of biological events signal transduction pathways, immunoglobulines, T-cell receptor interaction and the like. A number of methods for disease or clinical indication therapy, disease or clinical indication prognosis and disease or clinical indication diagnosis are also provided in accordance with the present invention. In one embodiment, the present invention is directed to methods related to assessing and/or identifying pathological conditions directly or indirectly related to microRNA expression or aberrant microRNA expression.

Thus, the present invention discloses a method for expression of stably integrated foreign DNA which in one embodiment may be miRNA, shRNAs, ribozymes, antisense RNA and RNA descoys. In one particular embodiment the stably integrated foreign DNA may be libraies of peptides, or the mentioned miRNA, shRNAs, ribozymes, antisense RNA and RNA decoys. The present invention discloses a method for expression of stably integrated foreign DNA without any cloning steps involved (mix virus and primer, add to cells).

The present invention also discloses a method for the elimination of RNA intermediates in packaging cells, enabling utilization of retroviral vectors for stable expression of active RNA elements, for example ribozymes and the like. The present invention also presents the stable and efficient integration of gene cassettes into a host cell, using retroviral integrase enzyme. Consequently, in effect all traces of RNA cis-elements are eliminated from the integrated provirally-derived DNA comprising the gene cassette. The generation of the present invention of a gene cassette in a retroviral virus particle in contrast to the generation of a gene cassette in a traditional producer cell makes possible to bypass barriers of transcription and processing of viral RNA, such as barriers in the form of splicing and/or polyadenylation, hairpin processing, editing or transcription blocking elements.

As the number of viral elements in the molecule or in the vector expressing said molecule, is reduced, the risk of mobilizing vectors to yield undesired potentially infectious virus particles is reduced. Similarly, the risk of recombination events with other viruses or endogenous viral sequences in the genome of the host cell is reduced.

Furthermore, the tethering of strand invading modified nucleotides to the synthetic gene cassettes can serve to minimise the risk of undesired genetic alteration in the target cell, for example avoiding oncogene activation. Kit or kit of parts

The present invention is also directed to kits comprising multifunctional molecules according to the invention or compositions comprising such multifunctional molecules according to the invention and capable of implementing the methods of the present invention.

Thus, in one aspect of the present invention there is provided a kit of parts comprising the at least one multifunctional molecule of the present invention. Optionally the kit comprises instructions for use.

In one embodiment the multifunctional molecule is provided as a retroviral particle comprising multifunctional molecules according to the invention. The retroviral particle may comprise template RNA to which the multifunctional molecules according to the invention is able to anneal and capable of initiating one or more of first or second strand DNA synthesis.

However the kit may comprise retroviral particles devoid of the multifunctional molecule and/ optionally template RNA or derivatives thereof (for example the retroviral vector as described elsewhere herein) which may be transferred into the retroviral particle by any means known to a person skilled in the art, for example by electroporation or use of agents that make the membrane of the particle permeable.

The kit may also comprise packaging cells, the multifunctional molecule and/or the template RNA or derivative thereof. The multifunctional molecules according to the invention or compositions comprising such multifunctional molecules and/or the template RNA or derivative thereof may be transferred into the packaging cells by methods known to the skilled person, for example by transfection or similar methods. It is appreciated that the multifunctional molecule and the template RNA or derivative thereof may be transferred simultaneously or in separate steps.

Alternatively, the kit comprises packaging cells in which the retroviral vector is stably expressed. In such a kit the multifunctional molecule is provided and is to be transferred into the packaging cells. It is appreciated that a kit in stead of packaging cells comprises cell lines that can be transfected with gagpol encoding constructs and some type of envelope encoding construct. The envelope encoding construct may encode any envelope protein, in one embodiment the envelope protein is from the vsv-g virus.

The kit may further include reagents for transfection of the multifunctional molecule of the present invention and/or template RNA or derivative thereof into packaging cells.

In one particular embodiment of the present invention the retroviral vector that is supplied in the kit is devoid of a primer binding site or has a mutated primer binding site.

In some embodiments, the kits can be used to evaluate one or more marker molecules, and/or express one or more miRNAs or miRNA inhibitors, siRNA, shRNA, antisense, ribozymes or RNA decoys. In embodiments, a kit contains at least or contains at most 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 100, 150, 200 or more multifunctional molecules related to the markers to be assessed or a particular miRNA or miRNA inhibitor, siRNA, shRNA, antisense, ribozymes or RNA decoys to be expressed or modulated, and the kit may include any range or combinations derivable therein.

The kits can comprise further components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means. Individual components may also be provided in a kit in concentrated amounts; in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as Ix, 2x, 5x, 10x, or 2Ox or more.

Kits for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically included in the kits according to the invention are any such molecules corresponding to any miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys which is reported to or believed to influence biological activity or expression of one or more marker genes or gene pathways. Negative and/or positive controls can be included in the kits. Control molecules present in the kits can be used to verify transfection efficiency and/or control for transfection- induced changes in cells.

The kits can comprise in suitable container means, two or more nucleic acid hybridization or amplification reagents. The kit can also comprise reagents for labeling nucleic acids in a sample and/or nucleic acid hybridization reagents. The hybridization reagents typically comprise hybridization probes. Amplification reagents include, but are not limited to amplification primers, reagents, and enzymes.

Any of the compositions described herein may be comprised in a kit. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained.

When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.

However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. In some embodiments, labeling dyes are provided as a dried power. It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 [mu]g or at least or at most those amounts of dried dye are provided in kits of the invention. The dye may then be resuspended in any suitable solvent, such as DMSO. A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit.

Instructions may include variations that can be implemented.

Treatment and use The term "treatment", as used anywhere herein comprises any type of therapy, which aims at terminating, preventing, ameliorating and/or reducing the susceptibility to a clinical condition as described herein. In a preferred embodiment, the term treatment relates to prophylactic treatment, i.e. a therapy to reduce the susceptibility of a clinical condition, a disorder or condition as defined herein.

Thus, "treatment," "treating," and the like, as used herein, refer to obtaining a desired pharmacologic and/or physiologic effect, covering any treatment of a pathological condition or disorder in a mammal, including a human. The effect may be prophylactic in terms of completely or partially preventing a disorder or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disorder and/or adverse affect attributable to the disorder. That is, "treatment" includes (1 ) preventing the disorder from occurring or recurring in a subject who may be predisposed to the disorder but has not yet been diagnosed as having it, (2) inhibiting the disorder, such as arresting its development, (3) stopping or terminating the disorder or at least symptoms associated therewith, so that the host no longer suffers from the disorder or its symptoms, such as causing regression of the disorder or its symptoms, for example, by restoring or repairing a lost, missing or defective function, or stimulating an inefficient process, or (4) relieving, alleviating, or ameliorating the disorder, or symptoms associated therewith, where ameliorating is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, such as inflammation, pain, and/or immune deficiency.

The terms "prevent," "preventing," and "prevention", as used herein, refer to a decrease in the occurrence of pathological cells in an animal. The prevention may be complete, e.g., the total absence of pathological cells in a subject. The prevention may also be partial, such that for example the occurrence of pathological cells in a subject is less than that which would have occurred without the present invention. Prevention also refers to reduced susceptibility to a clinical condition. The terms "inhibiting," "reducing," or "prevention," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result.

imiRNA and siRNA Related Methods

The term "miRNA" is used according to its ordinary meaning in the art and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. See, e.g., Carrington et al, 2003, which is hereby incorporated by reference. The term is used to refer to the single-stranded RNA molecule processed from a precursor as well as, in certain instances, the precursor itself.

MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length, though lengths of 19 and up to 23 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold- back-like structure, which is cleaved in animals by a ribonuclease Ill-like nuclease enzyme called Dicer. The processed miRNA is typically a portion of the stem.

The processed miRNA (also referred to as "mature miRNA") becomes part of a large complex to down-regulate a particular target gene or its gene product. Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al, 1999; Seggerson et al, 2002).

siRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. siRNAs are not naturally found in animal cells, but they can direct the sequence-specific cleavage of an mRNA target through a RNA-induced silencing complex (RISC) (Denli et al, 2003).

A "microRNA" or "microRNA inhibitor" as defined herein in one embodiment includes the full length precursor of microRNAs, or complement thereof or processed {i.e., mature) sequence of microRNAs and related sequences set forth herein, as well as 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of a precursor miRNA or its processed sequence, or complement thereof, including all ranges and integers there between. In certain embodiments, the microRNAs or microRNA inhibitors contain the full-length processed miRNA sequence or complement thereof and is referred to herein as the "microRNA full-length processed nucleic acid sequences" or "microRNA full-length processed inhibitor sequences, respectively."

The general term microRNAs includes all members of the microRNAs family that share at least part of a mature microRNAs sequence. In certain aspects, a microRNA, or a segment or a mimetic thereof, will contain at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of the precursor miRNA, or its processed sequence, including all ranges and integers there between.

The microRNA can be a recombinant nucleic acid molecule and it can in priciple be a ribonucleic acid or a deoxyribonucleic acid. The recombinant nucleic acid may comprise a microRNA or a microRNA inhibitor expression cassette, i.e., a nucleic acid segment that expresses a nucleic acid when introduced into an environment containing components for nucleic acid synthesis.

Also, any embodiment of the invention involving specific genes (including representative fragments thereof), mRNA, or miRNAs by name is contemplated also to cover embodiments involving miRNAs whose sequences are at least 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99% identical to the sequence or mature sequence of the specified miRNA, mRNA, gene, or representative nucleic acid.

It will be further understood that shorthand notations are employed such that a generic description of a gene or marker thereof, or of a miRNA refers to any of its gene family members (distinguished by a number) or representative fragments thereof, unless otherwise indicated. It is understood by those of skill in the art that a "gene family" refers to a group of genes having the same or similar coding sequence or miRNA coding sequence.

Typically, miRNA members of a gene family are identified by a number following the initial designation. For example, microRNA-1 and microRNA-2 are members of the microRNA gene family and e.g. "mir-7" refers to miR-7-1 , miR-7-2 and miR-7-3. Moreover, unless otherwise indicated, a shorthand notation refers to related miRNAs (distinguished by a letter). Exceptions to this shorthand notation will be otherwise identified.

In a further aspect, the genetic element or expression cassette forms part of a viral vector, or a plasmid DNA vector, or any other therapeutic nucleic acid vector or delivery vehicle, including liposomes and the like. In a particular aspect, the microRNA is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic.

In a particular aspect, the microRNA or microRNA inhibitors is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic. In still further aspects, a nucleic acid of the invention or a DNA encoding such a nucleic acid of the invention can be administered at 0.001 , 0.01 , 0.1 , 1 , 10, 20, 30, 40, 50, 100, 200, 400, 600, 800, 1000, 2000, to 4000 μg or mg, including all values and ranges there between. In yet a further aspect, nucleic acids of the invention, including synthetic nucleic acid, can be administered at 0.001 , 0.01 , 0.1 , 1 , 10, 20, 30, 40, 50, 100, to 200 [mu]g or mg per kilogram (kg) of body weight. Each of the amounts described herein may be administered over a period of time, including 0.5, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, minutes, hours, days, weeks, months or years, including all values and ranges there between.

In one aspect the present invention in one embodiment is directed to controlling or monitoring genes, diseases, and/or physiologic gene expression pathways and networks that are influenced by microRNA. Many of these genes and pathways are associated with various cancers and other diseases. The altered expression of microRNAs in cells leads to changes in the expression of such key genes and contribute to a positive development and/or reversal of a disease affected e.g. by the expression of genes contolled by or affected by imiRNA expression.

Introducing microRNAs (for diseases where the imiRNA is down-regulated) or a microRNA inhibitors (for diseases where the miRNA is up- regulated) into disease cells or tissues in accordance with the methods of the present invention generates a therapeutic response. In certain aspects of the present invention, a cell may e.g. be an epithelial cell, stromal cell, or a mucosal cell. The cell can be, but is not limited to, a brain cell, a neuronal cell, a blood cell, an esophageal cell, a lung cell, a cardiovascular cell, a liver cell, a breast cell, a bone cell, a thyroid cell, a glandular cell, an adrenal cell, a pancreatic cell, a stomach cell, a intestinal cell, a kidney cell, a bladder cell, a prostate cell, a uterus cell, an ovarian cell, a testicular cell, a splenic cell, a skin cell, a smooth muscle cell, a cardiac muscle cell, or a striated muscle cell.

In other aspects of the present invention, the cell, tissue, or target may not yet be defective in miRNA expression, but the cell, tissue or target will still respond therapeutically to the expression or over expression of a miRNA in accordance with the methods of the present invention.

microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys can be used as a therapeutic delivery vehicle or a target for any of the diseases cited herein below. Accordingly, in certain aspects, compositions of the invention are administered to a subject either having, suspected of having, or at risk of developing, e.g. a metabolic disease or condition, an immunologic disease or condition, an infectious disease or condition, a cardiovascular disease or condition, a digestive disease or condition, an endocrine disease or condition, an ocular disease or condition, a genitourinary disease or condition, a blood disease or condition, a musculoskeletal disease or condition, a nervous system disease or condition, a congenital disease or condition, a respiratory disease or condition, a skin disease or condition, or a cancerous disease or condition.

A subject, individual or patient may be selected for treatment based on the expression and/or aberrant expression of one or more genes and/or one or more microRNAs, siRNA, shRNA, antisense RNA, ribozymes or RNA decoys. A subject, individual or patient may thus also be selected for treatment based on aberrations in one or more biologic or physiologic pathway(s), including aberrant expression of one or more gene associated with a pathway, or the aberrant expression of one or more proteins encoded by one or more genes associated with a pathway. A subject, individual or patient can also be selected based on aberrations in miRNA expression, or biologic and/or physiologic pathway(s).

A subject may be assessed for sensitivity, resistance, and/or efficacy of a therapy or treatment regime based on the evaluation and/or analysis of microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys or mRNA expression or lack thereof. A subject may be evaluated for amenability to certain therapies prior to, during, or after administration to said subject of compositions or multifunctional molecules according to the present invention.

Many of the genes and pathways capable of being controlled or monitored in accordance with the methods of the present invention are associated with the onset or further development of various cancers and other diseases. Cancerous conditions include, but are not limited to, anaplastic large cell lymphoma, B-cell lymphoma, chronic lymphoblastic leukemia, multiple myeloma, testicular tumor, astrocytoma, acute myelogenous leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, urothelial carcinoma. For all of the above-cited cancers, modulation of the expression of one or more genes in accordance with the methods of the present invnetion can be sufficient for a therapeutic response. Typically, a cancerous condition is an aberrant, hyperproliferative condition associated with the uncontrolled cell growth or the inability of cells to undergo cell death, including apoptosis.

A cell, tissue, or subject may thus be a cancer cell, a cancerous tissue, harbor cancerous tissue, or it may be a subject or patient diagnosed or at risk of developing a disease or condition. A cell, tissue, or subject may in principle be or suffer from an abnormal or pathologic condition, or in the case of a cell or tissue, the component of a pathological condition. In certain aspects, a cell, tissue, or subject is a cancer cell, a cancerous tissue or harbor cancerous tissue, or a cancer patient. In a particular aspect the cancer is neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, or thyroid cancer. The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application.

A cancer or a cancer cell can e.g. be neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, fat, bone, cervical, esophageal, pancreatic, prostate, kidney, testicular or thyroid cell. The term cancer also includes includes, but is not limited to anaplastic large cell lymphoma, B-cell lymphoma, chronic lymphoblastic leukemia, multiple myeloma, testicular tumor, astrocytoma, acute myelogenous leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, urothelial carcinoma.

It is possible to provide, in accordance with the present invention, methods for modulating gene expression, or modulating biological or physiological pathways in a cell, a tissue, or a subject. The methods comprise administering to the cell, tissue, or subject an amount of a multifunctional molecule as defined herein elsewhere. The multifunctional molecule encodes a genetic element encoding a therapeutic polypeptide or a miRNA, or a miRNA mimetic, or a miRNA inhibitor sequence, in an amount sufficient to modulate the expression of a gene of interest positively or negatively.

In addition to comprising one or more microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys, or complements thereof, the multifunctional molecules according to the present invention can also comprise or encode various heterologous nucleic acid sequences, i.e., those sequences not typically found operatively coupled with microRNAs and therapeutic polypeptides in nature, such as promoters, enhancers, and the like.

In certain embodiments of the present invention, administration of the composition(s) and multifunctional molecules can be enteral or parenteral. In certain aspects, enteral administration is oral. In further aspects, parenteral administration is intralesional, intravascular, intracranial, intrapleural, intratumoral, intraperitoneal, intramuscular, intralymphatic, intraglandular, subcutaneous, topical, intrabronchial, intratracheal, intranasal, inhaled, or instilled. Compositions of the invention can also be administered regionally or locally and not necessarily directly into a lesion. In one embodiment of the invention is directed to methods for modulating a cellular pathway, wherein the method comprises administering to the cell an amount of an isolated multifunctional molecule comprising one or more microRNAs in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway. Modulation of a cellular pathway includes, but is not limited to, modulating the expression of one or more genes. Modulation of a gene can include inhibiting the function of an endogenous miRNA, or it can include the step of providing a functional imiRNA to a cell, tissue, or subject. Modulation refers to the expression levels and/or activities of a gene, or its related gene product or protein. mRNA levels may e.g. be modulated, or the translation of an mRNA may be modulated. Modulation may increase or up regulate a gene or gene product, or it may decrease or down regulate a gene or gene product as the case may be.

In a different and related embodiment the present invention includes methods for treating a patient having contrcted a pathological condition, wherein the method comprises one or more of the steps (a) administering to the patient an amount of an isolated multifunctional molecule comprising one or more microRNAs in an amount sufficient to modulate the expression of a cellular pathway; and (b) administering to said patient a second therapy or therapeutic agent, wherein the modulation of the cellular pathway sensitizes the patient to the second therapy or therapeutic agent.

A second therapy or therapeutic agent can include a second microRNA, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys, or another nucleic acid therapy, or one or more standard treatment therapies, such as chemotherapy, drug therapy, radiation therapy, immunotherapy, thermal therapy, and the like. A second therapy can also include administration of a siRNA or antisense oligonucleotide. In a particular aspect, a second therapy is chemotherapy. A chemotherapy can include, but is not limited to paclitaxel, cisplatin, carboplatin, doxorubicin, oxaliplatin, larotaxel, taxol, lapatinib, docetaxel, methotrexate, capecitabine, vinorelbine, cyclophosphamide, gemcitabine, amrubicin, cytarabine, etoposide, camptothecin, dexamethasone, dasatinib, tipifarnib, bevacizumab, sirolimus, temsirolimus, everolimus, lonafarnib, cetuximab, erlotinib, gefitinib, imatinib mesylate, rituximab, trastuzumab, nocodazole, sorafenib, sunitinib, bortezomib, alemtuzumab, gemtuzumab, tositumomab or ibritumomab. Embodiments of the present invention are also directed to methods for treating a subject with a disease or pathological condition, wherein the method comprises one or more of the steps of (a) determining an expression profile of one or more genes expressed in said subject; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using the selected therapy.

The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more genes or genetic markers in the sample. It is contemplated that the nucleic acid profile can be obtained using a set of RNAs, by using for example nucleic acid amplification or hybridization techniques well known to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, is indicative of a pathologic, disease, or cancerous condition.

Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient comprising measuring or determining an expression profile of one or more marker(s) in a sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer.

Aspects of the invention therefore also include treating, diagnosing, or prognosing a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or a related pathway as a first therapy, or to render a subject sensitive or more responsive to a second therapy.

In particular aspects, assessing the pathological condition of the patient can be assessing the prognosis of the patient. Prognosis may include, but is not limited to, an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition.

Certain embodiments of the invention can include a determination of the expression of one or more markers, genes, or nucleic acids representative thereof, by using e.g. an amplification assay, a hybridization assay, or protein assay, a variety of which are well known to one of ordinary skill in the art.

In certain aspects, an amplification assay can be a quantitative amplificationassay, such as quantitative RT-PCR or the like. In still further aspects, a hybridization assay can include array hybridization assays or solution hybridization assays. The nucleic acids from a sample may be labeled from the sample and/or hybridizing the labeled nucleic acid to one or more nucleic acid probes. Nucleic acids, imRNA, and/or nucleic acid probes may be coupled to a support. Such supports are well known to those of ordinary skill in the art and include, but are not limited to glass, plastic, metal, or latex. In particular aspects of the invention, the support can be planar or in the form of a bead or other geometric shapes or configurations known in the art. Proteins are typically assayed by immunoblotting, chromatography, mass spectrometry or other methods known to those of ordinary skill in the art.

The invention is also directed to methods for modulating a cellular pathway in an individual or a subject, wherein the method comprises administering to the cell an amount of an isolated multifunctional molecule comprising one or more microRNAs or one or more microRNA inhibitors. A cell, tissue, or subject may be a cancer cell, a cancerous tissue or a cancer patient.

The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application.

The invention is also directed to methods for modulating a cellular pathway, wherein the method comprises the step of administering to a cell an amount of an isolated multifunctional molecule comprising one oir more microRNAs in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway. Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene(s). Modulation of a gene can include inhibiting the function of an endogenous miRNA or providing a functional miRNA to a cell, tissue, or subject. Modulation refers to the expression levels or activities of a gene or its related gene product (e.g., mRNA) or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA may be modulated. Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product (e.g., protein levels or activity).

The invention is directed to methods of treating a subject with a disease or condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from the tables; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using a selected therapy. Typically, the disease or condition will have as a component, indicator, or resulting mis-regulation of one or more gene described herein.

In certain aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys may be used in sequence or in combination. For instance, any combination of a microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys or a inhibitors with another microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys.

In certain embodiments, microRNAs, siRNA, shRNA, antisense RNA, ribozymes and RNA decoys or microRNA inhibitors are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, medulloblastoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

It is contemplated that when microRNAs or microRNA inhibitors is given in combination with one or more other miRNA molecules, the two different miRNAs or inhibitors may be given at the same time or sequentially. In some embodiments, therapy proceeds with one imiRNA or inhibitor and that therapy is followed up with therapy with the other miRNA or inhibitor 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 hours, 1 , 2, 3, 4, 5, 6, 7 days, 1 , 2, 3, 4, 5 weeks, or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12 months or any such combination later.

Therapeutic methods In certain embodiments of the invention there is provided compositions and multifunctional molecules capable of performing the activities of, or inhibiting, endogenous miRNAs, or for example siRNAs when introduced into cells. Sequence- specific miRNA inhibitors or siRNA inhibitors can be used to inhibit sequentially or in combination the activities of one or more endogenous miRNAs, or for example siRNAs, in cells, as well those genes and associated pathways modulated by the endogenous miRNA, or for example siRNA,.

The present invention concerns, in some embodiments, short nucleic acid molecules that function as miRNAs, or for example siRNAs, or as inhibitors of miRNA or siRNA, in a cell. The term "short" refers to a length of a single polynucleotide that is 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 50, 100, or 150 nucleotides or fewer, including all integers or ranges range derivable there between. The nucleic acid molecules are typically synthetic or comprise one or more non-natural ("synthetic") nucleotides.

The term "synthetic" refers to a nucleic acid molecule that is isolated and not produced naturally in a cell. In certain aspects the sequence (the entire sequence) and/or chemical structure deviates from a naturally- occurring nucleic acid molecule, such as an endogenous precursor miRNA or miRNA , siRNA, shRNA, antisense, ribozymes or RNA decoys molecule or complement thereof. While in some embodiments, nucleic acids of the invention do not have an entire sequence that is identical or complementary to a sequence of a naturally-occurring nucleic acid, such molecules may encompass all or part of a naturally- occurring sequence or a complement thereof. It is contemplated, however, that a synthetic nucleic acid administered to a cell may subsequently be modified or altered in the cell such that its structure or sequence is the same as non-synthetic or naturally occurring nucleic acid, such as a mature miRNA sequence. For example, a synthetic nucleic acid may have a sequence that differs from the sequence of a precursor imiRNA, but that sequence may be altered once in a cell to be the same as an endogenous, processed miRNA or an inhibitor thereof. The term "isolated" means that the nucleic acid molecules of the invention are initially separated from different (in terms of sequence or structure) and unwanted nucleic acid molecules such that a population of isolated nucleic acids is at least about 90% homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous with respect to other polynucleotide molecules. In many embodiments of the invention, a nucleic acid is isolated by virtue of it having been synthesized in vitro separate from endogenous nucleic acids in a cell. It will be understood, however, that isolated nucleic acids may be subsequently mixed or pooled together. In certain aspects, synthetic miRNA, or for example siRNA, of the invention are RNA or RNA analogs. miRNA, or for example siRNA, inhibitors may be DNA or RNA, or analogs thereof. miRNA, or for example siRNA, and miRNA or aiRNA inhibitors of the invention are collectively referred to as "synthetic nucleic acids."

In certain embodiments, synthetic miRNA, or for example siRNA, have (a) a "miRNA region" or a "siRNA region" whose sequence or binding region from 5' to 3' is identical or complementary to all or a segment of a mature miRNA or siRNA sequence, and (b) a "complementary region" whose sequence from 5' to 3' is between 60% and 100% complementary to the miRNA or si RNA sequence in (a). In certain embodiments, these synthetic miRNA, or for example siRNA, are also isolated, as defined above. The terms "miRNA region" or "siRNA region" refers to a region on the synthetic miRNA or siRNA that is at least 75, 80, 85, 90, 95, or 100% identical, including all integers there between, to the entire sequence of a mature, naturally occurring miRNA or siRNA sequence or a complement thereof. In certain embodiments, the miRNA region or siRNA is or is at least 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 99.1 , 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring miRNA or siRNA or complement thereof.

The term "complementary region" or "complement" refers to a region of a nucleic acid or mimetic that is or is at least 60% complementary to the mature, naturally occurring miRNA or siRNA sequence. The complementary region is or is at least 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 99.1 , 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein. With single polynucleotide sequences, there may be a hairpin loop structure as a result of chemical bonding between the miRNA or for example siRNA region and the complementary region. In other embodiments, the complementary region is on a different nucleic acid molecule than the miRNA or siRNA region, in which case the complementary region is on the complementary strand and the miRNA or siRNA region is on the active strand.

In other embodiments of the invention, there are synthetic nucleic acids that are miRNA inhibitors, or for example siRNA inhibitors. A miRNA inhibitor or siRNA inhibitor is between about 17 to 25 nucleotides in length and comprises a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of a mature miRNA or siRNA. In certain embodiments, a miRNA inhibitor or siRNA inhibitor molecule is 17, 18, 19, 20, 21 , 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, an miRNA inhibitor or siRNA inhibitor may have a sequence (from 5' to 3') that is or is at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 99.1 , 99.2, 99.3, 99.4, 99.5,

99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5' to 3' sequence of a mature miRNA or siRNA, particularly a mature, naturally occurring miRNA or siRNA. One of skill in the art could use a portion of the miRNA sequence that is complementary to the sequence of a mature miRNA as the sequence for a miRNA inhibitor or siRNA inhibitor. Moreover, that portion of the nucleic acid sequence can be altered so that it is still comprises the appropriate percentage of complementarity to the sequence of a mature miRNA, or for example siRNA.

In some embodiments, of the invention, a synthetic miRNA or siRNA or inhibitor thereof contains one or more design element(s). These design elements include, but are not limited to: (i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5' terminus of the complementary region; (ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, (iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3' end of the complementary region and the corresponding nucleotides of the miRNA or siRNA region. A variety of design modifications are known in the art, see below.

In certain embodiments, for example a synthetic miRNA has a nucleotide at its 5' end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the "replacement design"). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In particular embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2 O-Me (2 Oxygen-methyl), DMTO (4,4'-dimethoxytrityl with oxygen), fluorescein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. This design element can also be used with a miRNA inhibitor.

Additional embodiments concern a synthetic miRNA having one or more sugar modifications in the first or last 1 to 6 residues of the complementary region (referred to as the "sugar replacement design"). In certain cases, there is one or more sugar modifications in the first 1 , 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein. In additional cases, there are one or more sugar modifications in the last 1 , 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein, have a sugar modification. It will be understood that the terms "first" and "last" are with respect to the order of residues from the 5' end to the 3' end of the region. In particular embodiments, the sugar modification is a 2 O-Me modification. In further embodiments, there are one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region. This design element can also be used with a miRNA inhibitor. Thus, a miRNA inhibitor can have this design element and/or a replacement group on the nucleotide at the 5' terminus, as discussed above.

In other embodiments of the invention, there is a synthetic miRNA or inhibitor in which one or more nucleotides in the last 1 to 5 residues at the 3' end of the complementary region are not complementary to the corresponding nucleotides of the miRNA region ("noncomplementarity") (referred to as the "noncomplementarity design"). The noncomplementarity may be in the last 1 , 2, 3, 4, and/or 5 residues of the complementary miRNA. In certain embodiments, there is noncomplementarity with at least 2 nucleotides in the complementary region.

It is contemplated that synthetic miRNA, or for example siRNA, of the invention have one or more of the replacement, sugar modification, or noncomplementarity designs. In certain cases, synthetic RNA molecules have two of them, while in others these molecules have all three designs in place. The miRNA or siRNA region and the complementary region may be on the same or separate polynucleotides. In cases in which they are contained on or in the same polynucleotide, the miRNA or siRNA molecule will be considered a single polynucleotide. In embodiments in which the different regions are on separate polynucleotides, the synthetic miRNA or siRNA will be considered to be comprised of two polynucleotides.

When the RNA molecule is a single polynucleotide, there can be a linker region between the miRNA or siRNA region and the complementary region. In some embodiments, the single polynucleotide is capable of forming a hairpin loop structure as a result of bonding between the miRNA or siRNA region and the complementary region. The linker constitutes the hairpin loop. It is contemplated that in some embodiments, the linker region is, is at least, or is at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range derivable therein. In certain embodiments, the linker is between 3 and 30 residues (inclusive) in length.

In addition to having a miRNA or siRNA or inhibitor region and a complementary region, there may be flanking sequences as well at either the 5' or 3' end of the region. In some embodiments, there is or is at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range derivable therein, flanking one or both sides of these regions.

Methods of the invention include reducing or eliminating activity of one or more imiRNAs, or for example siRNAs, in a cell comprising introducing into a cell a miRNA inhibitor or siRNA inhibitor (which may be described generally herein as an miRNA or siRNA, so that a description of miRNA or siRNA, where appropriate, also will refer to a miRNA inhibitor); or supplying or enhancing the activity of one or more miRNAs, or for example siRNAs, in a cell. The present invention also concerns inducing certain cellular characteristics by providing to a cell a particular nucleic acid, such as a specific synthetic miRNA or siRNA molecule or a synthetic miRNA inhibitor molecule or siRNA inhibitor molecule. However, in methods of the invention, the miRNA or siRNA molecule, or miRNA or siRNA inhibitor need not be synthetic. They may have a sequence that is identical to a naturally occurring miRNA, or for example siRNA, or they may not have any design modifications. In certain embodiments, the miRNA or siRNA molecule, and/or the miRNA or siRNA inhibitor are synthetic, as discussed above.

The particular nucleic acid molecule provided to the cell is understood to correspond to a particular miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys in the cell, and thus, the miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys in the cell is referred to as the "corresponding miRNA." In situations in which a named miRNA, or for example siRNA, molecule is introduced into a cell, the corresponding miRNA, or for example siRNA, will be understood to be the induced or inhibited miRNA or siRNA, or induced or inhibited miRNA or siRNA function. It is contemplated, however, that the miRNA or siRNA molecule introduced into a cell is not a mature miRNA or siRNA but is capable of becoming or functioning as a mature miRNA or siRNA under the appropriate physiological conditions. In cases in which a particular corresponding miRNA or siRNA is being inhibited by a miRNA or siRNA inhibitor, the particular miRNA or siRNA will be referred to as the "targeted miRNA" or "targeted siRNA". It is contemplated that multiple corresponding imiRNAs, or for example siRNAs, may be involved. In particular embodiments, more than one miRNA or siRNA molecule is introduced into a cell. Moreover, in other embodiments, more than one miRNA or siRNA inhibitor is introduced into a cell. Furthermore, a combination of miRNA or siRNA molecule(s) and miRNA or siRNA inhibitor(s) may be introduced into a cell. The inventors contemplate that a combination of miRNA, or for example siRNA, may act at one or more points in cellular pathways of cells with aberrant phenotypes and that such combination may have increased efficacy on the target cell while not adversely effecting normal cells. Thus, a combination of miRNA, or for example siRNA, may have a minimal adverse effect on a subject or patient while supplying a sufficient therapeutic effect, such as amelioration of a condition, growth inhibition of a cell, death of a targeted cell, alteration of cell phenotype or physiology, slowing of cellular growth, sensitization to a second therapy, sensitization to a particular therapy, and the like.

Methods include identifying a cell or patient in need of inducing those cellular characteristics. Also, it will be understood that an amount of a synthetic nucleic acid that is provided to a cell or organism is an "effective amount," which refers to an amount needed (or a sufficient amount) to achieve a desired goal, such as inducing a particular cellular characteristic(s).

In certain embodiments of the methods include providing or introducing to a cell a nucleic acid molecule corresponding to a mature miRNA, or for example siRNA, in the cell in an amount effective to achieve a desired physiological result.

Moreover, methods can involve providing synthetic or non-synthetic miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys molecules. It is contemplated that in these embodiments, that the methods may or may not be limited to providing only one or more synthetic miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys molecules or only one or more nonsynthetic miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys molecules. Thus, in certain embodiments, methods may involve providing both synthetic and nonsynthetic miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys molecules. In this situation, a cell or cells are most likely provided a synthetic miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys molecule corresponding to a particular miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys and a nonsynthetic miRNA molecule corresponding to a different miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys. Furthermore, any method articulated using a list of miRNAs, siRNA, shRNA, antisense, ribozymes or RNA decoys using Markush group language may be articulated without the Markush group language and a disjunctive article (i.e., or) instead, and vice versa.

In some embodiments, there is a method for reducing or inhibiting cell proliferation comprising introducing into or providing to the cell an effective amount of (i) a miRNA or siRNA inhibitor molecule or (ii) a synthetic or nonsynthetic miRNA or siRNA molecule that corresponds to a miRNA or siRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of (i) an miRNA or siRNA inhibitor molecule having a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of one or more mature miRNA or siRNA.

Certain embodiments of the invention include methods of treating a pathologic condition, in particular cancer, e.g., lung or liver cancer. In one aspect, the method comprises contacting a target cell with one or more nucleic acid, synthetic miRNA or siRNA, or miRNA or siRNA comprising at least one nucleic acid segment having all or a portion of a miRNA or siRNA sequence. The segment may be 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30 or more nucleotides or nucleotide analog, including all integers there between. An aspect of the invention includes the modulation of gene expression, miRNA or siRNA expression or function or mRNA expression or function within a target cell, such as a cancer cell.

Typically, an endogenous gene, miRNA or siRNA or mRNA is modulated in the cell. In particular embodiments, the nucleic acid sequence comprises at least one segment that is at least 70, 75, 80, 85, 90, 95, or 100% identical in nucleic acid sequence to one or more miRNA, or for example siRNA, or gene sequence. Modulation of the expression or processing of an endogenous gene, miRNA, or for example siRNA,, or mRNA can be through modulation of the processing of a mRNA, such processing including transcription, transportation and/or translation with in a cell. Modulation may also be effected by the inhibition or enhancement of miRNA or siRNA activity with a cell, tissue, or organ. Such processing may affect the expression of an encoded product or the stability of the mRNA. In still other embodiments, a nucleic acid sequence can comprise a modified nucleic acid sequence. In certain aspects, one or more miRNA or siRNA sequence may include or comprise a modified nucleobase or nucleic acid sequence.

It will be understood in methods of the invention that a cell or other biological matter such as an organism (including patients) can be provided a miRNA or siRNA, or miRNA or siRNA molecule corresponding to a particular miRNA or siRNA by administering to the cell or organism a nucleic acid molecule that functions as the corresponding miRNA or siRNA once inside the cell. The form of the molecule provided to the cell may not be the form that acts a miRNA or siRNA once inside the cell. Thus, it is contemplated that in some embodiments, a synthetic miRNA, or for example siRNA, or a nonsynthetic miRNA, or for example siRNA, is provided a synthetic miRNA, or for example siRNA, or a nonsynthetic miRNA, or for example siRNA,, such as one that becomes processed into a mature and active miRNA or siRNA once it has access to the cell's miRNA or siRNA processing machinery. In certain embodiments, it is specifically contemplated that the miRNA or siRNA molecule provided to the biological matter is not a mature miRNA or siRNA molecule but a nucleic acid molecule that can be processed into the mature miRNA or siRNA once it is accessible to miRNA or siRNA processing machinery. The term "nonsynthetic" in the context of miRNA or siRNA means that the miRNA or siRNA is not "synthetic," as defined herein. Furthermore, it is contemplated that in embodiments of the invention that concern the use of synthetic imiRNAs, or for example siRNAs, the use of corresponding nonsynthetic miRNAs, or for example siRNAs, is also considered an aspect of the invention, and vice versa. It will be understand that the term "providing" an agent is used to include "administering" the agent to a patient.

In certain embodiments, methods also include targeting a miRNA, or for example siRNA, to modulate in a cell or organism. The terms "targeting a miRNA to modulate" or "targeting an siRNA to modulate" means a nucleic acid of the invention will be employed so as to modulate the selected miRNA or siRNA. In some embodiments the modulation is achieved with a synthetic or non-synthetic miRNA that corresponds to the targeted miRNA or siRNA, which effectively provides the targeted miRNA or siRNA to the cell or organism (positive modulation). In other embodiments, the modulation is achieved with a miRNA or siRNA inhibitor, which effectively inhibits the targeted miRNA or siRNA in the cell or organism (negative modulation).

In some embodiments, the miRNA or siRNA targeted to be modulated is a miRNA or siRNA that affects a disease, condition, or pathway. In certain embodiments, the miRNA is targeted because a treatment can be provided by negative modulation of the targeted miRNA or siRNA. In other embodiments, the miRNA or siRNA is targeted because a treatment can be provided by positive modulation of the targeted miRNA or siRNA or its targets.

In certain methods of the invention, there is a further step of administering the selected miRNA or siRNA modulator to a cell, tissue, organ, or organism (collectively "biological matter") in need of treatment related to modulation of the targeted miRNA or siRNA or in need of the physiological or biological results discussed herein (such as with respect to a particular cellular pathway or result like decrease in cell viability). Consequently, in some methods of the invention there is a step of identifying a patient in need of treatment that can be provided by the miRNA or siRNA modulator(s). It is contemplated that an effective amount of a miRNA or siRNA modulator can be administered in some embodiments. In particular embodiments, there is a therapeutic benefit conferred on the biological matter, where a "therapeutic benefit" refers to an improvement in the one or more conditions or symptoms associated with a disease or condition or an improvement in the prognosis, duration, or status with respect to the disease. It is contemplated that a therapeutic benefit includes, but is not limited to, a decrease in pain, a decrease in morbidity, a decrease in a symptom. For example, with respect to cancer, it is contemplated that a therapeutic benefit can be inhibition of tumor growth, prevention of metastasis, reduction in number of metastases, inhibition of cancer cell proliferation, induction of cell death in cancer cells, inhibition of angiogenesis near cancer cells, induction of apoptosis of cancer cells, reduction in pain, reduction in risk of recurrence, induction of chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay of death directly or indirectly related to cancer.

Furthermore, it is contemplated that the imiRNA or siRNA compositions may be provided as part of a therapy to a patient, in conjunction with traditional therapies or preventative agents. Moreover, it is contemplated that any method discussed in the context of therapy may be applied as preventatively, particularly in a patient identified to be potentially in need of the therapy or at risk of the condition or disease for which a therapy is needed.

In addition, methods of the invention concern employing one or more nucleic acids corresponding to a imiRNA or siRNA and a therapeutic drug. The nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or toxicity, modify its bioavailability, and/or decrease the dosage or frequency needed. In certain embodiments, the therapeutic drug is a cancer therapeutic. Consequently, in some embodiments, there is a method of treating cancer in a patient comprising administering to the patient the cancer therapeutic andan effective amount of at least one imiRNA or siRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells. Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include but are not limited to, for example, 5-fluorouracil, alemtuzumab, amrubicin, bevacizumab, bleomycin, bortezomib, busulfan, camptothecin, capecitabine, cisplatin (CDDP), carboplatin, cetuximab, chlorambucil, cisplatin (CDDP), EGFR inhibitors (gefitinib and cetuximab), procarbazine, mechlorethamine, cyclophosphamide, camptothecin, COX-2 inhibitors (e.g., celecoxib), cyclophosphamide, cytarabine, ) ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, dasatinib, daunorubicin, dexamethasone, docetaxel, doxorubicin (adriamycin), EGFR inhibitors (gefitinib and cetuximab), erlotinib, estrogen receptor binding agents, bleomycin, plicomycin, mitomycin, etoposide (VP 16), everolimus, tamoxifen, raloxifene, estrogen receptor binding agents, taxol, taxotere, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, gefitinib, gemcitabine, gemtuzumab, ibritumomab, ifosfamide, imatinib mesylate, larotaxel, lapatinib, Ionafarnib, mechlorethamine, melphalan, transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate, mitomycin, navelbine, nitrosurea, nocodazole, oxaliplatin, paclitaxel, plicomycin, procarbazine, raloxifene, rituximab, sirolimus, sorafenib, sunitinib, tamoxifen, taxol, taxotere, temsirolimus, tipifarnib, tositumomab, transplatinum, trastuzumab, vinblastin, vincristin, or vinorelbine or any analog or derivative variant of the foregoing.

Generally, inhibitors of miRNAs or for example siRNAs can be given to decrease the activity of an endogenous imiRNA. For example, inhibitors of imiRNA or siRNA molecules that increase cell proliferation can be provided to cells to increase proliferation or inhibitors of such molecules can be provided to cells to decrease cell proliferation. The present invention contemplates these embodiments in the context of the different physiological effects observed with the different imiRNA or siRNA molecules and miRNA or siRNA inhibitors disclosed herein. These include, but are not limited to, the following physiological effects: increase and decreasing cell proliferation, increasing or decreasing apoptosis, increasing transformation, increasing or decreasing cell viability, activating or inhibiting a kinase (e.g., Erk)ERK, activating/inducing or inhibiting hTert, inhibit stimulation of growth promoting pathway (e.g., Stat 3 signaling), reduce or increase viable cell number, and increase or decrease number of cells at a particular phase of the cell cycle. Methods of the invention are generally contemplated to include providing or introducing one or more different nucleic acid molecules corresponding to one or more different miRNA or siRNA molecules. It is contemplated that the following, at least the following, or at most the following number of different nucleic acid or miRNA or siRNA molecules may be provided or introduced: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to the number of different miRNA or siRNA molecules that can be provided or introduced into a cell.

Methods of the present invention include the delivery of an effective amount of a microRNAs, siRNA, shRNA, antisense RNA, ribozymes or RNA decoys or an expression construct encoding the same. An "effective amount" of the pharmaceutical composition, generally, is defined as that amount sufficient to detectably and repeatedly to achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. Other more rigorous definitions may apply, including elimination, eradication or cure of disease.

Administration

In certain embodiments, it is desired to kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size, and/or reverse or reduce the malignant or disease phenotype of cells. The routes of administration will vary, naturally, with the location and nature of the lesion or site to be targeted, and include, e.g., intradermal, subcutaneous, regional, parenteral, intravenous, intramuscular, intranasal, systemic, and oral administration and formulation. Direct injection, intratumoral injection, or injection into tumor vasculature is specifically contemplated for discrete, solid, accessible tumors, or other accessible target areas. Local, regional, or systemic administration also may be appropriate. For tumors of >4 cm, the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml).

Multiple injections delivered as a single dose comprise about 0.1 to about 0.5 ml volumes. Compositions of the invention may be administered in multiple injections to a tumor or a targeted site. In certain aspects, injections may be spaced at approximately 1 cm intervals.

In the case of surgical intervention, the present invention may be used preoperative Iy, to render an inoperable tumor subject to resection. Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a imiRNA or siRNA or combinations thereof. Administration may be continued post- resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment also is envisioned. Continuous perfusion of an expression construct or a viral construct also is contemplated.

Continuous administration also may be applied where appropriate, for example, where a tumor or other undesired affected area is excised and the tumor bed or targeted site is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is contemplated. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.

Treatment regimens may vary as well and often depend on tumor type, tumor location, immune condition, target site, disease progression, and health and age of the patient. Certain tumor types will require more aggressive treatment. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations.

In certain embodiments, the tumor or affected area being treated may not, at least initially, be resectable. Treatments with compositions of the invention may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection may serve to eliminate microscopic residual disease at the tumor or targeted site.

Treatments may include various "unit doses." A unit dose is defined as containing a predetermined quantity of a therapeutic composition(s). The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. With respect to a viral component of the present invention, a unit dose may conveniently be described in terms of [mu]g or mg of miRNA or miRNA mimetic. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose.

miRNA, or for example siRNA can be administered to the patient in a dose or doses of about or of at least about 0.5, 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 μg or mg, or more, or any range derivable therein. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose, or it may be expressed in terms of mg/kg, where kg refers to the weight of the patient and the mg is specified above. In other embodiments, the amount specified is any number discussed above but expressed as mg/im ² (with respect to tumor size or patient surface area).

Injectable Compositions and Formulations

In some embodiments, the method for the delivery of a miRNA or siRNA or an expression construct encoding such or combinations thereof is via systemic administration. However, the pharmaceutical compositions disclosed herein may also be administered parenterally, subcutaneously, directly, intratracheal^, intravenously, intradermally, intramuscularly, or even intraperitoneally as described in U.S. Patents 5,543,158; 5,641 ,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety).

Injection of nucleic acids may be delivered by syringe or any other method used for injection of a solution, as long as the nucleic acid and any associated components can pass through the particular gauge of needle required for injection. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent 5,846,225).

Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol {e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

In certain formulations, a water-based formulation is employed while in others, it may be lipid-based. In particular embodiments of the invention, a composition comprising a tumor suppressor protein or a nucleic acid encoding the same is in a water-based formulation. In other embodiments, the formulation is lipid based.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral, intralesional, and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035- 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologies standards.

As used herein, a "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.

The nucleic acid(s) are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., the aggressiveness of the disease or cancer, the size of any tumor(s) or lesions, the previous or other courses of treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner. Suitable regimes for initial administration and subsequent administration are also variable, but are typified by an initial administration followed by other administrations. Such administration may be systemic, as a single dose, continuous over a period of time spanning 10, 20, 30, 40, 50, 60 minutes, and/or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or more hours, and/or 1 , 2, 3, 4, 5, 6, 7, days or more. Moreover, administration may be through a time release or sustained release mechanism, implemented by formulation and/or mode of administration.

Combination Treatments

In certain embodiments, the compositions and methods of the present invention involve a miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys, or expression construct encoding such. These miRNA or siRNA compositions can be used in combination with a second therapy to enhance the effect of the miRNA or siRNA therapy, or increase the therapeutic effect of another therapy being employed. These compositions would be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with the miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys or second therapy at the same or different time. This may be achieved by contacting the cell with one or more compositions or pharmacological formulation that includes or more of the agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition provides (1 ) miRNA; , siRNA, shRNA, antisense, ribozymes or RNA decoys and/or (2) a second therapy. A second composition or method may be administered that includes a chemotherapy, radiotherapy, surgical therapy, immunotherapy, or gene therapy.

It is contemplated that one may provide a patient with the miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys therapy and the second therapy within about 12- 24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1 , 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

[00129] In certain embodiments, a course of treatment will last 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90 days or more. It is contemplated that one agent may be given on day 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18,

19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and another agent is given on day 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28,

29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no treatment is administered. This time period may last 1 , 2, 3, 4, 5, 6, 7 days, and/or 1 , 2, 3, 4, 5 weeks, and/or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12 months or more, depending on the condition of the patient, such as their prognosis, strength, health, etc. Administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the vector or any protein or other agent. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.

In specific aspects, it is contemplated that a second therapy, such as chemotherapy, radiotherapy, immunotherapy, surgical therapy or other gene therapy, is employed in combination with the imiRNA or siRNA therapy, as described herein below in more detail.

Chemotherapy A wide variety of chemotherapeutic agents may be used in accordance with the present invention. The term "chemotherapy" refers to the use of drugs to treat cancer. A "chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.

Alkylating agents

Alkylating agents are drugs that directly interact with genomic DNA to prevent the cancer cell from proliferating. This category of chemotherapeutic drugs represents agents that affect all phases of the cell cycle, that is, they are not phase-specific. Alkylating agents can be implemented to treat chronic leukemia, non-Hodgkin's lymphoma, Hodgkin's disease, multiple myeloma, and particular cancers of the breast, lung, and ovary. They include: busulfan, chlorambucil, cisplatin, cyclophosphamide (Cytoxan), dacarbazine, ifosfamide, mechlorethamine (mustargen), and melphalan. Troglitazaone can be used to treat cancer in combination with any one or more of these alkylating agents. Antimetabolites

Antimetabolites disrupt DNA and RNA synthesis. Unlike alkylating agents, they specifically influence the cell cycle during S phase. They have been used to combat chronic leukemias in addition to tumors of breast, ovary and the gastrointestinal tract. Antimetabolites include 5-fluorouracil (5-FU), cytarabine (Ara-C), fludarabine, gemcitabine, and methotrexate.

5-Fluorouracil (5-FU) has the chemical name of 5-fluoro-2,4(IH,3H)- pyrimidinedione. Its mechanism of action is thought to be by blocking the methylation reaction of deoxyuridylic acid to thymidylic acid. Thus, 5-FU interferes with the synthesis of deoxyribonucleic acid (DNA) and to a lesser extent inhibits the formation of ribonucleic acid (RNA). Since DNA and RNA are essential for cell division and proliferation, it is thought that the effect of 5-FU is to create a thymidine deficiency leading to cell death. Thus, the effect of 5-FU is found in cells that rapidly divide, a characteristic of metastatic cancers.

Antitumor Antibiotics

Antitumor antibiotics have both antimicrobial and cytotoxic activity. These drugs also interfere with DNA by chemically inhibiting enzymes and mitosis or altering cellular membranes. These agents are not phase specific so they work in all phases of the cell cycle. Thus, they are widely used for a variety of cancers. Examples of antitumor antibiotics include bleomycin, dactinomycin, daunorubicin, doxorubicin (Adriamycin), and idarubicin, some of which are discussed in more detail below. Widely used in clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg/m<2> at 21 day intervals for adriamycin, to 35- 100 mg/m<2> for etoposide intravenously or orally, d. Mitotic Inhibitors

Mitotic inhibitors include plant alkaloids and other natural agents that can inhibit either protein synthesis required for cell division or mitosis. They operate during a specific phase during the cell cycle. Mitotic inhibitors comprise docetaxel, etoposide (VP 16), paclitaxel, taxol, taxotere, vinblastine, vincristine, and vinorelbine.

Nitrosureas Nitrosureas, like alkylating agents, inhibit DNA repair proteins. They are used to treat non-Hodgkin's lymphomas, multiple myeloma, malignant melanoma, in addition to brain tumors. Examples include carmustine and lomustine.

Radiotherapy

Radiotherapy, also called radiation therapy, is the treatment of cancer and other diseases with ionizing radiation. Ionizing radiation deposits energy that injures or destroys cells in the area being treated by damaging their genetic material, making it impossible for these cells to continue to grow. Although radiation damages both cancer cells and normal cells, the latter are able to repair themselves and function properly. Radiotherapy may be used to treat localized solid tumors, such as cancers of the skin, tongue, larynx, brain, breast, or cervix. It can also be used to treat leukemia and lymphoma (cancers of the blood-forming cells and lymphatic system, respectively).

Radiation therapy used according to the present invention may include, but is not limited to, the use of [gamma]-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. Radiotherapy may comprise the use of radiolabeled antibodies to deliver doses of radiation directly to the cancer site (radioimmunotherapy). Once injected into the body, the antibodies actively seek out the cancer cells, which are destroyed by the cell-killing (cytotoxic) action of the radiation. This approach can minimize the risk of radiation damage to healthy cells.

Stereotactic radio-surgery (gamma knife) for brain and other tumors does not use a knife, but very precisely targeted beams of gamma radiotherapy from hundreds of different angles. Only one session of radiotherapy, taking about four to five hours, is needed. For this treatment a specially made metal frame is attached to the head. Then, several scans and x- rays are carried out to find the precise area where the treatment is needed. During the radiotherapy for brain tumors, the patient lies with their head in a large helmet, which has hundreds of holes in it to allow the radiotherapy beams through. Related approaches permit positioning for the treatment of tumors in other areas of the body.

Immunotherapy

In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Trastuzumab (Herceptin(TM)) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of ErbB2 would provide therapeutic benefit in the treatment of ErbB2 overexpressing cancers.

In one aspect of immunotherapy, the tumor or disease cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamima- IFN, and chemokines such as MIP-I, MCP-I, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor such as MDA-7 has been shown to enhance anti-tumor effects (Ju et al, 2000). Moreover, antibodies against any of these compounds can be used to target the anti-cancer agents discussed herein.

Examples of immunotherapies currently under investigation or in use are immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds (U.S. Patents 5,801 ,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998), cytokine therapy e.g., interferons [alpha], [beta] and [gamma]; IL-I, GM-CSF and TNF (Bukowski et al., 1998; Davidson et al, 1998; Hellstrand et al, 1998) gene therapy e.g., TNF, IL-I, IL-2, p53 (Qin et al, 1998; Austin- Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945) and monoclonal antibodies e.g., anti-ganglioside GM2, anti-HER- 2, anti-pl85; Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,31 1 ). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). A non-limiting list of several known anti-cancer immunotherapeutic agents and their targets includes, but is not limted to (Generic Name (Target)) Cetuximab (EGFR), Panitumumab (EGFR), Trastuzumab (erbB2 receptor), Bevacizumab (VEGF), Alemtuzumab (CD52), Gemtuzumab ozogamicin (CD33), Rituximab (CD20), Tositumomab (CD20), Matuzumab (EGFR), lbritumomab tiuxetan (CD20), Tositumomab (CD20), HuP AM4 (MUCI), MORAb-009 (Mesothelin), G250 (carbonic anhydrase IX), imAb 8H9 (8H9 antigen), M195 (CD33), lpilimumab (CTLA4), HuLuc63 (CSI), Alemtuzumab (CD53), Epratuzumab (CD22), BC8 (CD45), HuJ591 (Prostate specific membrane antigen), hA20 (CD20), Lexatumumab (TRAIL receptor- 2), Pertuzumab (HER-2 receptor), Mik-beta-1 (IL-2R), RAV12 (RAAG12), SGN-30

(CD30), AME-133v (CD20), HeFi-I (CD30), BMS-663513 (CD137), Volociximab (anti- [alpha]5[beta]l integrin), GC1008 (TGF[beta]), HCD 122 (CD40), Siplizumab (CD2), MORAb-003 (Folate receptor alpha), CNTO 328 (IL- 6), MDX-060 (CD30), Ofatumumab (CD20), or SGN-33 (CD33). It is contemplated that one or more of these therapies may be employed with the miRNA or siRNA therapies described herein.

A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow.

Gene Therapy

In yet another embodiment, a combination treatment involves gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as one or more therapeutic miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys. Delivery of a therapeutic polypeptide or encoding nucleic acid in conjunction with a miRNA, siRNA, shRNA, antisense, ribozymes or RNA decoys may have a combined therapeutic effect on target tissues. A variety of proteins are encompassed within the invention, some of which are described below. Various genes that may be targeted for gene therapy of some form in combination with the present invention include, but are not limited to inducers of cellular proliferation, inhibitors of cellular proliferation, regulators of programmed cell death, cytokines and other therapeutic nucleic acids or nucleic acid that encode therapeutic proteins.

The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors (e.g., therapeutic polypeptides) p53, FHIT, pi 6 and C-CAM can be employed.

In addition to p53, another inhibitor of cellular proliferation is pi 6. The major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK' s. One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the Gl. The activity of this enzyme may be to phosphorylate Rb at late Gl. The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pl6INK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al, 1993; Serrano et al, 1995). Since the pl6INK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein, pi 6 also is known to regulate the function of CDK6.

pl6INK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6B, pi 9, p2 IWAFI, and p27KIPI . The pl6INK4 gene maps to 9p21 , a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the pl6INK4 gene are frequent in human tumor cell lines. This evidence suggests that the pl6INK4 gene is a tumor suppressor gene. This interpretation has been challenged, however, by the observation that the frequency of the pl6INK4 gene alterations is much lower in primary uncultured tumors than in cultured cell lines (Caldas et al, 1994; Cheng et al, 1994; Hussussian et al, 1994; Kamb et al, 1994; Mori et al, 1994; Okamoto et al, 1994; Nobori et al, 1995; Orlow et al, 1994; Arap et al, 1995). Restoration of wild-type pl6INK4 function by transfection with a plasmid expression vector reduced colony formation by some human cancer cell lines (Okamoto, 1994; Arap, 1995).

Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-I, NF-2, WT-I, MEN-I, MEN-II, zacl, p73, VHL, MMACI / PTEN, DBCCR-I, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-I, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, EIA, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-I, GDAIF, or their receptors) and MCC.

Surgery

Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.

Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.

Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1 , 2, 3, 4, 5, 6, or 7 days, or every 1 , 2, 3, 4, and 5 weeks or every 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , or 12 months. These treatments may be of varying dosages as well. 6. Other Agents

It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-I, MIP-I beta, MCP-I, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 / TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy.

Apo2 ligand (Apo2L, also called TRAIL) is a member of the tumor necrosis factor (TNF) cytokine family. TRAIL activates rapid apoptosis in many types of cancer cells, yet is not toxic to normal cells. TRAIL imRNA occurs in a wide variety of tissues. Most normal cells appear to be resistant to TRAIL'S cytotoxic action, suggesting the existence of mechanisms that can protect against apoptosis induction by TRAIL. The first receptor described for TRAIL, called death receptor 4 (DR4), contains a cytoplasmic "death domain"; DR4 transmits the apoptosis signal carried by TRAIL. Additional receptors have been identified that bind to TRAIL. One receptor, called DR5, contains a cytoplasmic death domain and signals apoptosis much like DR4. The DR4 and DR5 mRNAs are expressed in many normal tissues and tumor cell lines. Recently, decoy receptors such as DcRI and DcR2 have been identified that prevent TRAIL from inducing apoptosis through DR4 and DR5. These decoy receptors thus represent a novel mechanism for regulating sensitivity to a pro-apoptotic cytokine directly at the cell's surface. The preferential expression of these inhibitory receptors in normal tissues suggests that TRAIL may be useful as an anticancer agent that induces apoptosis in cancer cells while sparing normal cells. (Marsters et ah, 1999).

There have been many advances in the therapy of cancer following the introduction of cytotoxic chemotherapeutic drugs. However, one of the consequences of chemotherapy is the development/acquisition of drug-resistant phenotypes and the development of multiple drug resistance. The development of drug resistance remains a major obstacle in the treatment of such tumors and therefore, there is an obvious need for alternative approaches such as gene therapy.

Another form of therapy for use in conjunction with chemotherapy, radiation therapy or biological therapy includes hyperthermia, which is a procedure in which a patient's tissue is exposed to high temperatures (up to 106[deg.]F). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia. Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe , including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.

A patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.

Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases. Preparation of Nucleic Acids

A nucleic acid making up the multifunctional molecule of the present invention may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production, or biological production.

In some embodiments of the invention, miRNA or siRNAs are recovered or isolated from a biological sample. The miRNA or siRNA may be recombinant or it may be natural or endogenous to the cell (produced from the cell's genome). It is contemplated that a biological sample may be treated in a way so as to enhance the recovery of small RNA molecules such as miRNA. U.S. Patent Application Serial No. 10/667,126 describes such methods and it is specifically incorporated by reference herein. Generally, methods involve lysing cells with a solution having guanidinium and a detergent.

Alternatively, nucleic acid synthesis is performed according to standard methods. See, for example, ltakura and Riggs (1980) and U.S. Patents 4,704,362, 5,221 ,619, and 5,583,013, each of which is incorporated herein by reference. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite, or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and U.S. Patent 5,705,629, each incorporated herein by reference. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571 , 5,141 ,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference. [00212] A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR(TM) (see for example, U.S. Patents 4,683,202 and 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference. See also Sambrook et ah, 2001 , incorporated herein by reference).

Oligonucleotide synthesis is well known to those of skill in the art. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571 , 5,141 ,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors (viral and non-viral), plasmids, cosmids, and other vehicles for delivering a nucleic acid to a cell, which may be the target cell {e.g., a cancer cell) or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.

Isolation of Nucleic Acids

Nucleic acids may be isolated using techniques well known to those of skill in the art, though in particular embodiments, methods for isolating small nucleic acid molecules, and/or isolating RNA molecules can be employed. Chromatography is a process often used to separate or isolate nucleic acids from protein or from other nucleic acids. Such methods can involve electrophoresis with a gel matrix, filter columns, alcohol precipitation, and/or other chromatography.

If miRNA or siRNA from cells is to be used or evaluated, methods generally involve lysing the cells with a chaotropic {e.g., guanidinium isothiocyanate) and/or detergent {e.g., N-lauroyl sarcosine) prior to implementing processes for isolating particular populations of RNA.

In particular methods for separating miRNA or siRNA from other nucleic acids, a gel matrix is prepared using polyacrylamide, though agarose can also be used. The gels may be graded by concentration or they may be uniform. Plates or tubing can be used to hold the gel matrix for electrophoresis. Usually one-dimensional electrophoresis is employed for the separation of nucleic acids. Plates are used to prepare a slab gel, while the tubing (glass or rubber, typically) can be used to prepare a tube gel. The phrase "tube electrophoresis" refers to the use of a tube or tubing, instead of plates, to form the gel. Materials for implementing tube electrophoresis can be readily prepared by a person of skill in the art or purchased, such as from CB. S. Scientific Co., Inc. or Scie-Plas. Methods may involve the use of organic solvents and/or alcohol to isolate nucleic acids, particularly miRNA or siRNA used in methods and compositions of the invention. Some embodiments are described in U.S. Patent Application Serial No. 10/667,126, which is hereby incorporated by reference. Generally, this disclosure provides methods for efficiently isolating small RNA molecules from cells comprising: adding an alcohol solution to a cell lysate and applying the alcohol/lysate mixture to a solid support before eluting the RNA molecules from the solid support. In some embodiments, the amount of alcohol added to a cell lysate achieves an alcohol concentration of about 55% to 60%. While different alcohols can be employed, ethanol works well. A solid support may be any structure, and it includes beads, filters, and columns, which may include a mineral or polymer support with electronegative groups. A glass fiber filter or column has worked particularly well for such isolation procedures.

In specific embodiments, miRNA or siRNA isolation processes include: a) lysing cells in the sample with a lysing solution comprising guanidinium, wherein a lysate with a concentration of at least about 1 M guanidinium is produced; b) extracting miRNA or siRNA molecules from the lysate with an extraction solution comprising phenol; c) adding to the lysate an alcohol solution for forming a lysate/alcohol mixture, wherein the concentration of alcohol in the mixture is between about 35% to about 70%; d) applying the lysate/alcohol mixture to a solid support; e) eluting the miRNA or siRNA molecules from the solid support with an ionic solution; and, f) capturing the miRNA or siRNA molecules. Typically the sample is dried and resuspended in a liquid and volume appropriate for subsequent manipulation.

Examples

Production of viral particles harbouring the multifunctional molecule of the present invention

Virions containing the multifunctional molecule (in the examples the multifunctional molecule is also referred to as primervector) were produced as follows:

Plat-E packaging cells [1] were transfected (calcium phosphate transfection) with the retroviral vector (PBS-UMU) containing a mutated PBS and a neo selection marker.

24h later the primervector DNA (5nmol) was transfected into the same packaging cells, using a pUC19 plasmid as carrier DNA. Virions containing the primervector were harvested 5 hours later and transferred onto TE671 cells that were engineered to express the mCAT-1 receptor. The transduced TE671 mCAT cells were selected with G418 (600ug/ml_) for 10 days until emergence of resistant colonies.

Genomic DNA was prepared from the resistant colonies and PCR was used to determine the sequence of the integrated viral DNA in order to confirm incorporation of the primervector DNA into the provirus.

Primer vectors used:

There are several designs of the primer vectors. Common to all is the fact that functional elements are located at either end (figure 5). Therefore it is possible to include heterologous sequences of interest in the middle part to be incorporated into the integrated provirus.

Simple primervector design:

AATGAAAGACCCCtqqaqqctqq cqaqqtttcqααα αtt cαa ate aαα ttt (SEQ ID NO:1 )

Primer vector with homology to facilitate the recombination necessary for completion of the second strand synthesis: CGC TTG CTG TCC ATA AAA CC ctgg cαaααtttcα ααα αtt cαa ate aαα ttt (SEQ ID NO:2)

Primer vectors with homology and inverted repeat: Hom-IR-PBS

CGC TTG CTG TCC ATA AAA CC aatqaaaqaccccq ααα αtt cαa ate aαα ttt (SEQ ID N0:3)

IR-hom-arab-PBS Aatqaaaqacccc CGC TTG CTG TCC ATA AAA CC ctgg cgaggtttcg ααα αtt cαa ate aααttt (SEQ ID N0:4)

Underlined sequence shows the inverted repeat (IR).

The nucleotides shown in italic capital letters correspond to the second part of the multifunctional molecule of the present invention wherein said at least one genetic element in this example is homologous to the internal sequence of retroviral vector PBS UMU to facilitate recombination following second strand transfer.

Double underlined sequence shows the nucleotide sequence of the first part of the multifunctional molecule which in this example anneals to the mutated PBS in PBS UMU.

The nucleotide sequence shown in bold corresponds to the second part of the multifunctional molecule of the present invention wherein in this example a heterologous sequence (for identification of integrated primervector in the integrated host cell DNA). The nucleotide sequence can be replaced by genetic elements, such as gene cassettes expressing for example shRNA, miRNA, antisense RNA ribozymes and the like, or alternatively therapeutic proteins).

Below is shown a sequence downstream of the PBS of the integrated provirus of a host cell, wherein the multifunctional molecule here (Hom-IR-PBS) was used to initiate first strand synthesis. The sequence shows a point mutation which was present in the primer vector (multifunctional molecule): ATAGAATACTCAAGCTATGTCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGA GCGGCGGCCGCGAATTCACTAGTGATTGTCTCCTCAGAGTGAAAGAATGCCCAG CCTGGGGGTCTTTACGGAAACCTGATTCGAACCCCCGGGGTCTTACATTGGTTTT ATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTAG AAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGAATCTGATGGCGC AGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAAC AAGATGGATTGCACGAATCGAATTCCCGCGGCCGCCATGGCGGCCGGGAGCATG CGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTC GTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTA (SEQ ID NO:5)

Sequence showing integration of the same primervector at the end of the provirus (including a small deletion and the same point mutation):

ATCGCTTTAGCCCAGGAGGTGGAAGCTGCAGTGAGCCGAGATCGCGCCACTGCA CCCCTGTCTGGGCGACGGCGAGACCCCGTCCATAAAACCAATGTAAGACCCCGG GGGTTCGAATCAGGTTTCCGTAAAGACCCCCAGGCTGGGCAGTCAATCACTCTGA

GGAGACCCTCCCAAGGATCAGCGAGACCACGATTCGGATGCAACAGCAAAAGGC TTTATTGGATACACGGGTACCCGGGCGACTCAGTCTATCGGAGGACTGGCGCAAT CACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAAC (SEQ ID NO:6)

A schematic representation of the retroviral vector PBS UMU is shown in figure 10.

PBS UMU is a retroviral vector based on Akv Murine Leukemia virus, in which the PBS sequence is mutated in order to inhibit binding of the tRNA primer naturally used to initiate reverse transcription (tRNApro). The vector also contains a neo resistance gene as a selection marker. tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtca cagcttgtctgtaagcggat gccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctgg cttaactatgcggcatca gagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaagg agaaaataccgcatcagg cgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcg ctattacgccagctggcgaa agggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacg ttgtaaaacgacggccagt gaattctaccttacgtttccccgaccagagctgatgttctcagaaaaacaagaacaagga agtacagagaggctggaa agtaccgggactagggccaaacaggatatctgtggtcaagcactagggccccggcccagg gccaagaacagatggt ccccagaaacagagaggctggaaagtaccgggactagggccaaacaggatatctgtggtc aagcactagggccccg gcccagggccaagaacagatggtccccagaaatagctaaaacaacaacagtttcaagaga cccagaaactgtctca aggttccccagatgaccggggatcaaccccaagcctcatttaaactaaccaatcagctcg cttctcgcttctgtacccgcg cttattgctgcccagctctataaaaagggtaagaaccccacactcggcgcgccagtcctc cgatagactgagtcgcccg ggtacccgtgtatccaataaagccttttgctgttgcatccgaatcgtggtctcgctgatc cttgggagggtctcctcagagtga ttgactgcccagcctgggggtctttcattaaacctgattcgaaccccttggagacccccg cccagggaccaccgacccac cgtcgggaggtaagctggccagcgatcgttttgtctccgtctctgtctttgtgcgtgtgt gtgtgtgtgccggcatctactttttgc gcctgcgtctgattctgtactagttagctaactagatctgtatctggcggctccgtggaa gaactgacgagttcgtattcccga ccgcagccctgggagacgtctcagaggcatcgggggggggatccgtcgacctgcagccaa gcttcacgctgccgcaa gcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaa acggtgctgaccccg gatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagca ggtagcttgcagtggg cttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgcca gctggggcgccctctggta aggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggc gcaggggatctgatcaaga gacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggc cgcttgggtggagaggctatt cggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtc agcgcaggggcgcccggtt ctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcgg ctatcgtggctggccacga cgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgc tattgggcgaagtgccggg gcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc aatgcggcggctgcatacgctt gatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtact cggatggaagccggtctt gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc aggctcaaggcgcgcat gcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggt ggaaaatggccgcttttctgg attcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctac ccgtgatattgctgaagagct tggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgca gcgcatcgccttctatcgccttct tgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaac ctgccatcacgagatttcg attccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggct ggatgatcctccagcgcgggg atctcatgctggagttcttcgcccaccccgggctcgatcccctcggacctggtgggacgg gcagggcgccgcccgagtct tcgcctcggcggcgggcgctctgctcatggagcgcgcgtccggggccggggaccttgcac agatagcgtggtccggcc aggacgacgaggcttgcaggatctactattcctaaaagagggaggtttgtgtgctgcctt aaaagaagaatgctgtttctat gccgaccacacaggattggtacgggatagcatggccaaacttagagaaagattgagtcag agacaaaagctctttgaa tcccaacaagggtggtttgaagggctgtttaataagtccccttggttcaccaccctgata tccaccatcatgggtcccctgat aatcctcttgttaattttactctttgggccttgtattctcaatcgcctggtccagtttat caaagacaggatttcggtagtgcaggc cctggttctgactcaacaatatcatcaacttaagacaatagaagattgtaaatcacgtga ataaaagattttattcagtttac agaaagaggggggaatgaaagaccccttcataaggcttagccagctaactgcagtaacgc cattttgcaaggcatggg aaaataccagagctgatgttctcagaaaaacaagaacaaggaagtacagagaggctggaa agtaccgggactagg gccaaacaggatatctgtggtcaagcactagggccccggcccagggccaagaacagatgg tccccagaaacagag aggctggaaagtaccgggactagggccaaacaggatatctgtggtcaagcactagggccc cggcccagggccaaga acagatggtccccagaaatagctaaaacaacaacagtttcaagagacccagaaactgtct caaggttccccagatgac cggggatcaaccccaagcctcatttaaactaaccaatcagctcgcttctcgcttctgtac ccgcgcttattgctgcccagctc tataaaaagggtaagaaccccacactcggcgcgccagtcctccgatagactgagtcgccc gggtacccgtgtatccaat aaagccttttgctgttgcatccgaatcgtggtctcgctgatccttgggagggtctcctcc tctgtcggtcgacctgcaggcatg caagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaa ttccacacaacatacgagccgga agcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttg cgctcactgcccgctttccagt cgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtt tgcgtattgggcgctcttcc gcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagct cactcaaaggcggtaatacgg ttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaag gccaggaaccgtaaa aaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaat cgacgctcaagtcagaggtg gcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcg ctctcctgttccgaccctgc cgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagct cacgctgtaggtatctcagttcggt gtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctg cgccttatccggtaactatcg tcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacag gattagcagagcgaggtat gtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggaca gtatttggtatctgcgctctgc tgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtt tgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttct acggggtctgacgctcagtg gaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcaccta gatccttttaaattaaaaatga agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgctta atcagtgaggcacctatctcagcg atctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgata cgggagggcttaccatctggcccc agtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaac cagccagccggaagggc cgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccg ggaagctagagtaagtagttcg ccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcg tcgtttggtatggcttcattcagctc cggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttag ctccttcggtcctccgatcgtt gtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattct cttactgtcatgccatccgtaag atgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcg accgagttgctcttgcccggcgtc aatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacg ttcttcggggcgaaaactct caaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgat cttcagcatcttttactttcacca gcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcga cacggaaatgttgaat actcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgag cggatacatatttgaatgtatttagaaa aataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaa accattattatcatgacatta acctataaaaataggcgtatcacgaggccctttcgtc (SEQ ID NO:7)

Sequence of the retroviral vector PBS UMU 5' IR: PBS UMU 5' IR is equivalent to PBS UMU except for four nucleotide changes that abolishes the upstream I. R. tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtca cagcttgtctgtaagcggat gccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctgg cttaactatgcggcatca gagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaagg agaaaataccgcatcagg cgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcg ctattacgccagctggcgaa agggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacg ttgtaaaacgacggccagt gaattctaccttacgtttccccgaccagagctgatgttctcagaaaaacaagaacaagga agtacagagaggctggaa agtaccgggactagggccaaacaggatatctgtggtcaagcactagggccccggcccagg gccaagaacagatggt ccccagaaacagagaggctggaaagtaccgggactagggccaaacaggatatctgtggtc aagcactagggccccg gcccagggccaagaacagatggtccccagaaatagctaaaacaacaacagtttcaagaga cccagaaactgtctca aggttccccagatgaccggggatcaaccccaagcctcatttaaactaaccaatcagctcg cttctcgcttctgtacccgcg cttattgctgcccagctctataaaaagggtaagaaccccacactcggcgcgccagtcctc cgatagactgagtcgcccg ggtacccgtgtatccaataaagccttttgctgttgcatccgaatcgtggtctcgctgatc cttgggagggtctcctcagagtga ttgactgcccagcctgggggtctttACGGaaacctgattcgaaccccttggagacccccg cccagggaccaccgacc caccgtcgggaggtaagctggccagcgatcgttttgtctccgtctctgtctttgtgcgtg tgtgtgtgtgtgccggcatctactttt tgcgcctgcgtctgattctgtactagttagctaactagatctgtatctggcggctccgtg gaagaactgacgagttcgtattcc cgaccgcagccctgggagacgtctcagaggcatcgggggggggatccgtcgacctgcagc caagcttcacgctgccg caagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgca gaaacggtgctgacc ccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaa gcaggtagcttgcagtg ggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgc cagctggggcgccctctgg taaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatg gcgcaggggatctgatcaag agacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccgg ccgcttgggtggagaggcta ttcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctg tcagcgcaggggcgcccggt tctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcg gctatcgtggctggccacga cgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgc tattgggcgaagtgccggg gcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc aatgcggcggctgcatacgctt gatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtact cggatggaagccggtctt gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc aggctcaaggcgcgcat gcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggt ggaaaatggccgcttttctgg attcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctac ccgtgatattgctgaagagct tggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgca gcgcatcgccttctatcgccttct tgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaac ctgccatcacgagatttcg attccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggct ggatgatcctccagcgcgggg atctcatgctggagttcttcgcccaccccgggctcgatcccctcggacctggtgggacgg gcagggcgccgcccgagtct tcgcctcggcggcgggcgctctgctcatggagcgcgcgtccggggccggggaccttgcac agatagcgtggtccggcc aggacgacgaggcttgcaggatctactattcctaaaagagggaggtttgtgtgctgcctt aaaagaagaatgctgtttctat gccgaccacacaggattggtacgggatagcatggccaaacttagagaaagattgagtcag agacaaaagctctttgaa tcccaacaagggtggtttgaagggctgtttaataagtccccttggttcaccaccctgata tccaccatcatgggtcccctgat aatcctcttgttaattttactctttgggccttgtattctcaatcgcctggtccagtttat caaagacaggatttcggtagtgcaggc cctggttctgactcaacaatatcatcaacttaagacaatagaagattgtaaatcacgtga ataaaagattttattcagtttac agaaagaggggggaatgaaagaccccttcataaggcttagccagctaactgcagtaacgc cattttgcaaggcatggg aaaataccagagctgatgttctcagaaaaacaagaacaaggaagtacagagaggctggaa agtaccgggactagg gccaaacaggatatctgtggtcaagcactagggccccggcccagggccaagaacagatgg tccccagaaacagag aggctggaaagtaccgggactagggccaaacaggatatctgtggtcaagcactagggccc cggcccagggccaaga acagatggtccccagaaatagctaaaacaacaacagtttcaagagacccagaaactgtct caaggttccccagatgac cggggatcaaccccaagcctcatttaaactaaccaatcagctcgcttctcgcttctgtac ccgcgcttattgctgcccagctc tataaaaagggtaagaaccccacactcggcgcgccagtcctccgatagactgagtcgccc gggtacccgtgtatccaat aaagccttttgctgttgcatccgaatcgtggtctcgctgatccttgggagggtctcctcc tctgtcggtcgacctgcaggcatg caagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaa ttccacacaacatacgagccgga agcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttg cgctcactgcccgctttccagt cgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtt tgcgtattgggcgctcttcc gcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagct cactcaaaggcggtaatacgg ttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaag gccaggaaccgtaaa aaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaat cgacgctcaagtcagaggtg gcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcg ctctcctgttccgaccctgc cgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagct cacgctgtaggtatctcagttcggt gtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctg cgccttatccggtaactatcg tcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacag gattagcagagcgaggtat gtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggaca gtatttggtatctgcgctctgc tgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtt tgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttct acggggtctgacgctcagtg gaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcaccta gatccttttaaattaaaaatga agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgctta atcagtgaggcacctatctcagcg atctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgata cgggagggcttaccatctggcccc agtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaac cagccagccggaagggc cgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccg ggaagctagagtaagtagttcg ccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcg tcgtttggtatggcttcattcagctc cggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttag ctccttcggtcctccgatcgtt gtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattct cttactgtcatgccatccgtaag atgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcg accgagttgctcttgcccggcgtc aatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacg ttcttcggggcgaaaactct caaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgat cttcagcatcttttactttcacca gcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcga cacggaaatgttgaat actcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgag cggatacatatttgaatgtatttagaaa aataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaa accattattatcatgacatta acctataaaaataggcgtatcacgaggccctttcgtc (SEQ ID NO:8)

Second strand synthesis

Retroviral vector used (PBS UMU SV40 -5' IR) is equivalent to PBS UMU 5' IR but contains an SV40 promoter to drive a neo resistance gene. The primers are designed to produce a provirus that lacks the upstream LTR so that neo expression is driven from the SV40 promoter, and to reconstitute the downstream LTR to provide a poly A signal (figure 7B): tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtca cagcttgtctgtaagcggat gccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctgg cttaactatgcggcatca gagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaagg agaaaataccgcatcagg cgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcg ctattacgccagctggcgaa agggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacg ttgtaaaacgacggccagt gaattctaccttacgtttccccgaccagagctgatgttctcagaaaaacaagaacaagga agtacagagaggctggaa agtaccgggactagggccaaacaggatatctgtggtcaagcactagggccccggcccagg gccaagaacagatggt ccccagaaacagagaggctggaaagtaccgggactagggccaaacaggatatctgtggtc aagcactagggccccg gcccagggccaagaacagatggtccccagaaatagctaaaacaacaacagtttcaagaga cccagaaactgtctca aggttccccagatgaccggggatcaaccccaagcctcatttaaactaaccaatcagctcg cttctcgcttctgtacccgcg cttattgctgcccagctctataaaaagggtaagaaccccacactcggcgcgccagtcctc cgatagactgagtcgcccg ggtacccgtgtatccaataaagccttttgctgttgcatccgaatcgtggtctcgctgatc cttgggagggtctcctcagagtga ttgactgcccagcctgggggtctttacggaaacctgattcgaaccccttggagacccccg cccagggaccaccgaccca ccgtcgggaggtaagctggccagcgatcgttttgtctccgtctctgtctttgtgcgtgtg tgtgtgtgtgccggcatctactttttg cgcctgcgtctgattctgtactagttagctaactagatctgtatctggcggctccgtgga agaactgacgagttcgtattcccg accgcagccctgggagacgtctcagaggcatcgggggggggatccgtcgacctgcagcca agcttatgcaaagcatg catctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaact ccgcccagttccgcccattctc cgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctg agctattccagaagtagtgagga ggcttttttggaggcctaggcttttgcaaaaagcttcacgctgccgcaagcactcagggc gcaagggctgctaaaggaa gcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagcta ctgggctatctggacaa gggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagc tagactgggcggttttat ggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccct gcaaagtaaactggatg gctttcttgccgccaaggatctgatggcgcaggggatctgatcaagagacaggatgagga tcgtttcgcatgattgaaca agatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactg ggcacaacagacaatcggc tgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaag accgacctgtccggtgccctga atgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcg cagctgtgctcgacgttgt cactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtc atctcaccttgctcctgccg agaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacct gcccattcgaccaccaagcg aaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgat ctggacgaagagcatcag gggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggat ctcgtcgtgacccatgg cgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactg tggccggctgggtgtggcggac cgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgg gctgaccgcttcctcgtgcttt acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttct tctgagcgggactctggggttcg aaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgcct tctatgaaaggttgggcttc ggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggag ttcttcgcccaccccgggctc gatcccctcggacctggtgggacgggcagggcgccgcccgagtcttcgcctcggcggcgg gcgctctgctcatggagc gcgcgtccggggccggggaccttgcacagatagcgtggtccggccaggacgacgaggctt gcaggatctactattcct aaaagagggaggtttgtgtgctgccttaaaagaagaatgctgtttctatgccgaccacac aggattggtacgggatagca tggccaaacttagagaaagattgagtcagagacaaaagctctttgaatcccaacaagggt ggtttgaagggctgtttaat aagtccccttggttcaccaccctgatatccaccatcatgggtcccctgataatcctcttg ttaattttactctttgggccttgtattc tcaatcgcctggtccagtttatcaaagacaggatttcggtagtgcaggccctggttctga ctcaacaatatcatcaacttaag acaatagaagattgtaaatcacgtgaataaaagattttattcagtttacagaaagagggg ggaatgaaagaccccttcat aaggcttagccagctaactgcagtaacgccattttgcaaggcatgggaaaataccagagc tgatgttctcagaaaaaca agaacaaggaagtacagagaggctggaaagtaccgggactagggccaaacaggatatctg tggtcaagcactagg gccccggcccagggccaagaacagatggtccccagaaacagagaggctggaaagtaccgg gactagggccaaac aggatatctgtggtcaagcactagggccccggcccagggccaagaacagatggtccccag aaatagctaaaacaac aacagtttcaagagacccagaaactgtctcaaggttccccagatgaccggggatcaaccc caagcctcatttaaactaa ccaatcagctcgcttctcgcttctgtacccgcgcttattgctgcccagctctataaaaag ggtaagaaccccacactcggc gcgccagtcctccgatagactgagtcgcccgggtacccgtgtatccaataaagccttttg ctgttgcatccgaatcgtggtct cgctgatccttgggagggtctcctcctctgtcggtcgacctgcaggcatgcaagcttggc gtaatcatggtcatagctgtttc ctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagt gtaaagcctggggtgcctaa tgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaac ctgtcgtgccagctgcattaatg aatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgct cactgactcgctgcgctcggt cgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga atcaggggataacgcagg aaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgct ggcgtttttccataggc tccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccga caggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttac cggatacctgtccgcctttctccc ttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggt cgttcgctccaagctgggctgtgt gcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtc caacccggtaagacacgact tatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtg ctacagagttcttgaagtg gtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagcc agttaccttcggaaaaagagt tggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaa gcagcagattacgcgcagaaa aaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacga aaactcacgttaagggattttg gtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagtttt aaatcaatctaaagtatatatgagt aaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtc tatttcgttcatccatagttgcctg actccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgc aatgataccgcgagaccca cgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcaga agtggtcctgcaacttta tccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtt aatagtttgcgcaacgttgttgcc attgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggt tcccaacgatcaaggcgagttac atgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcag aagtaagttggccgcagtgttat cactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgct tttctgtgactggtgagtactcaac caagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacg ggataataccgcgccacata gcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaagga tcttaccgctgttgagatcca gttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcg tttctgggtgagcaaaaacagga aggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactc ttcctttttcaatattattga agcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaat aaacaaataggggttccgcgcac atttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaaccta taaaaataggcgtatcacgag gccctttcgtc (SEQ ID NO:9)

First strand primer:

Aatgaaagacccccaggctgggcagtcaatcactctgaggagaccctcccaaggatc agcgagaccacgattcggat gcaacagcaaaaggctttattgg (SEQ ID NO:10)

Second strand primer:

AATGAAAGACCCCaagcttggctgcaggtcgacggatcccccccccgatgcctctga atgcaaagcatgcatct caattagtcagcaaccatagtcccgc (SEQ ID N0:11 ) EXAMPLE 1

First strand synthesis.

Integration of primer vector IR-hom-ARAB-pbs (SEQ ID NO: 4) into human chromosome 16

The experiment shows incorporation of the primer vector IR-hom-ARAB-pbs as a part of the provirus into human chromosome 16 (Figure 6).

The sequence below shows the primer vector IR-hom-ARAB-pbs integrated into human chromosome 16. There are two point mutations (underlined) in the sequence compared to the sequence of the primer vector. Point mutations can be introduced during reverse transcription/integration of the resulting provirus or during PCR amplification and sequencing of the genomic DNA.

The integrated primer vector lacks the last two nucleotides (AA), indicating integrase mediated integration.

ACGTAGTCATTGTATACGACTCACTATAGGGCGAATTGAATTTAGCGGCCGCGAA TTCGCCCTTGAATCG — TGGTCTCGCTGATCCTTGGGAGGGTCTCCTCATAGTGAT-

TGACTGCCCAGCCTGGGGGTCTTTACCGaaacctqattcgaaccccCGyWlCCTCGC CGG

GGTTTTA T— GGACA GCAA GCGGGGG TCTTTCA

AAGTCAGCAGAG-

CTTGTATCAGGGACCTTCCCACTTTCCTCGCTCACACTCCCG- GCCTTCCCTCCCTGCGGGAAGGCTCCCATCCCAGGCCCAGCCGGTGTCTCCT-

CTCCAGGACAGGCGCGG"

AGGAGGAGGCAGAGTAAAACCAGCCACCGCTCAGTGAGCACGTGCTACGCCCC

AGGCCCCGGTGAGGCACCGCATTATTCTCTATTCCACTGGGGAGAGGAGGGGG

GCTCTATTCCTAT-TTTACAGATGAGGAAACT-GAG- GCCCCTCAGAATTCCTGGACAAG-CTTGAACTGAAGGGCGAATT-CGTTTAAACC-

TGCAGGACT-AGTCCCTTTAGTGAGGGTT-

AATTCTGAGCTTGGCGTAATCATGGTCATA-

GCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCG

G-AAGCATAAAGTGTAAAGCCTGGGGTGCCTAA- TGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGC-

CCGCTTTCCAGTCGGGAAACCTGTCGTGCCA-

GCTGCATTAAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC

GCTCTTCGCTTCTCGCTCACTGACTCGCTGCGCTCGGTCGTCGGCTGCGCGAGC

GTATCAGCTCACTCAAAGCGTATACGGTTATCACAGAATCAAGGGATTACGCAGA AAGAAACATGGTGAGCAAAAGGCCAGCA (SEQ ID NO:12)

Double underlined sequence: I. R. sequence as found in the template PBS-UMU5'IR. The point mutation is indicated in bold. Underlined sequence: Primer vector IR-hom-arab-PBS. The point mutation is indicated in bold. Lower case letters show the nucleotide sequence of the first part of the multifunctional molecule which anneals to the mutated PBS in PBS UMU. Two AA nucleotides are removed from the end indicating integrase mediated integration.

Bold sequence: Human chromosome 16

EXAMPLE 2 First strand synthesis

Integration of the primer vector IR-hom-arab-PBS (SEQ ID NO: 4) into PBS UMU- 5 IR.

The sequence below shows the primer vector has initiated reverse transcription and at a later step in the process has recombined with the template as predicted (Figure 6). The recombination event has taken place close to the site of homology between the primer vector IR-hom-arab-PBS and the template PBS UMU 5'I. R.

Sequence of genomic DNA: GCGTAGTGATTGTATACGACTCACTATAGGGCGAATTGAATTTAGCGGCCGCGAA

TTCGCCCTTGAATCGTGGTCTCGCTGATCCTTGGGAGGGTCTCCTCAGAGTGATT GACTGCCCAGCCTGGGGGTCTTTACGGaaacctqattcqaaccccCGAAACCTCGCCAG GGTTTTATGGACAGCAAGCGGGGGJC AGCTGGGGCGCCCTCTGGTAAGGTTAGGAAGCCCTGCAAAGTAAACTGGATGG CTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAATATCTGATCAAGAGA

CAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTC CGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATC GGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCT TTTTTGTCAAGACCGACCTGTCCCGGTGCCCTGAAATGAACTGCAGGACGAGGC CCCTGGGAAATTTCCTTGGACCAAAGCCTTGAAACTGAAAGGGGCGGAAATTTC

GTTTTAAACCCTGGACAGGAACTAGTCCCTTTTAGTGAGGGGGTTAAATTCTGAA GCTTGGG (SEQ ID NO:13)

Underlined sequence: Primer vector IR-hom-arab-PBS. Lower case letters show the nucleotide sequence of the first part of the multifunctional molecule which anneals to the mutated PBS in PBS UMU. The heterologous sequence is displayed in bold and underlined. Sequence of homology between primer vector IR-hom-arab-PBS and the template PBS UMU -5'I. R is displayed in italic and underlined.

Bold sequence: Template sequence (PBS UMU-5'I.R) after recombination. The sequence (SEQ ID NO:14) below shows the corresponding sequence in the template (PBS UMU -5'I. R). The underlined sequence is homologous with part of the primer vector (sequence shown in italic and underlined). It is obvious that the homology sequence incorporated into the primer vector has directed the i recombination. Sequence shown in italic is found in the provirus (see SEQ ID NO: 13).

Cgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctaga ctgggcggttttatggacagc aagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagt aaactggatggctttcttg ccgccaaggatctga tggcgcagggga tctga tcaagaga cagga tgaggatcgtttcgca tga tt (SEQ ID NO:14)

EXAMPLE 3 First strand synthesis Integration of truncated primer vector hom-ir-pbs (SEQ ID NO:3) into human chromosome 6

The data shows integration of the primer vector hom-ir-pbs into human chromosome 6. The recombination/integration event results in the truncation of the nucleotides 5'- CGCTTGCT. The truncation is probably facilitated by the homology found in the provirus and the insertion site (Figure 6)

GGCCGCGAATTCACTAGTGATTGCGCCAGTCCTCCGATAGACTGAGTCGCCCGG GTACCCGTGTATCCAATAAAGCCTTTTGCTGTTGCATCCGAATCGTGGTCTCGCTG ATCCTTGGGAGGGTCTCCTCAGAGTGATTGACTGCCCAGCCTGGGGGTCTTTACG GaaacctgattcgaaccccCGGGGTCTTACATTGGTTTTΛ TGGΛCGGGGTCTCGCCGTCG CCCAGACAGGGGTGCAGTGGCGCGATCTCGGCTCACTGCAGCTTCCACCTCCT GGGCTAAAGCGATCCTTCCACCTCAGCCTACGGAGTAGATGGGACCACAGGCC CCTCTTGGAATTCCTGGACAAGCTTGAACTGAATCGAATTCCCGCGGCCGCCAT GGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTAT

TACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGG (SEQ ID NO:15)

Underlined sequence: Primer vector hom-ir-PBS. Lower case letters shows the nucleotide sequence of the first part of the multifunctional molecule which anneals to the mutated PBS in PBS UMU. Sequence of homology between primer vector hom-ir- PBS and the template PBS UMU -5'I. R is displayed in italic and underlined. The sequence shows that 8 nucleotides have been deleted from the primer vector hom-ir- pbs. Three nucleotides which are equal in both the genomic and the proviral DNA are shown in italic, bold and underlined. Double underlined sequence shows the inverted repeat (IR). Bold sequence:: Human chromosome 6.

EXAMPLE 4

Second strand synthesis Integration of second strand primer vector SV40 (SEQ ID NO: 11) into mouse chromosome 7

The experiment shows integration of the second strand primer vector SV40 into the mouse chromosome 7. The integration event results in the deletion of the 35 nucleotides AATGAAAGACCCCaagcttggctgcaggtcgacg. The result shows that second strand synthesis has been initiated by the primer vector SV40, and the resulting provirus has been integrated into chromosome 7 of the mouse genome. The integration event is outlined in figure 8.

TCAGTTCAAGCTTGTCCAGGAATTCGACAGGCCTAGCAAACACAGAAGTGGATG

CTCACAGTCAGCTATTGGATGAATCACAGGGCCCACAATGGAGGAGCTAGAGA AAGTACCCAAAGAGCTAAAGGCATCTGCAACCCTATAGGTGGAACAACAATATG AGCTAACCAATACCCCCCCGCCCCCGGGCTCGTGTCTCTAGCTGCATATGTATG AGAAGATGGCCTAGTTGGCCATCAGTGGAAAGAGAGGCCGATCCCCACCCCGA TGCCTCTGAATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCC

TAACAAGGGCGAATTCGTTTAAACCTGCAGGACTAGTCCCTTTAGTGAGGGTTAAT TCTGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCT (SEQ ID NO:16)

Bold sequence: mouse chromosome 7. Underlined sequence: Second strand primer vector SV40 containing a point mutation shown in bold. The sequence shows that 34 nucleotides have been deleted from the primer vector SV40.

The experiment as described above can also be used to introduce shRNA into the genome of a host cell. In this case, the second strand primer contains an shRNA sequence used to introduce shRNA into the provirus. The presence of a polymerase III promoter in the template results in expression of the shRNA (figure 13).

EXAMPLE 5 Second strand synthesis

Integration of second strand primer vector SV40 (SEQ ID NO: 11) into mouse chromosome 17

First integration site:

The sequence below shows integration of the second strand primer vector SV40 into mouse chromosome 17 (red box in figure 12). The sequence shows deletion of the two nucleotides AA of the inverted repeat (IR) sequence indicative of processing by integrase.

CACGTAGTGATTGTAATACGACTCACTATAGGGCGAATTGAATTTAGCGGCCGCG AATTCGCCCTTGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCT TTGCATTCAGAGGCATCGGGGGGGGGATCCGTCGACCTGCAGCCAAGCTTGGG GTCTTTCACTAGGGCAAAGGGTGGCCTTTGGGGCCACCAGTGACATTGTAAAAG TGATGATAGCTAGCCCTGTTAGTTACAGTTGGTCCTTAGACAGCAGCCATAGAA

TTGAAATTAGAGGGGGGCTCTGTGGACTGAACGTGGCACGTGGAGCCTACACT GGAACTGGTCCTTTTGGCAGTGCCATGTAGCAGGCTTTCCAGAGGATGTTCTGA AATTGGTGCTGATGTAATCCCCCCACCCCCACCCCACCAGAATAGTCCAGTCAT AGAAAGAACTGGCCTCACCTTGTTCCAGTAGGCTAGCGATGAAGCCTGGATGCT GGGTTCCTGGAGCCCAGCTGAAAGTGCTGACAGGTACCACAGACATAGAGGTC

AGCTTTGGCTATGTTAATCTAACTTTAAGTGATACCTTTTCCTACCCTACTCCTAT GCTGGGTTCCATGTGTCTCTCTTGAGGATTTCCAGAACTGCCTGCCAGTTTTACA CCCACATGGGAGAACACTGTTCTGTTAGAACGTCCTCCTGGCAATGTCCCCGCT GGCACTGATGGCTGCAGCAGCCCACAAGCTTGTCTCCTGGACAAGTCCGTGAT GCTCACAGATGCATGTGGATCCTGGGTGCTACACCCCAACTCCCAAGCCCATGG

GCTTTAAAGGTTCTCTCTCCCTAGATGCATCATAGCAGCTCAGCCCTGATGATGT TCCTGCCCAGCTCTGTGCTAAGCCACCCCACCCC (SEQ ID NO:17)

Underlined sequence: Second strand primer vector SV40. Double underlined sequence shows the inverted repeat (IR). Bold and underlined sequence complementary to first strand in order to initiate second strand synthesis.

Italic and underlined sequence is complimentary to genomic RNA in order to facilitate incorporation into particles and possible activation of RNAse H activity.

Bold: mouse chromosome 17

Second integration site (red circle in figure 12)

ACGTTAGTGAATTGTATACGACTCACTATAGGGCGAATTGAATTTAGCGGCCGCG AATTCGCCCTTOCGCCAGTCCTCCβATAOACTαAGTCOCCCGGGTACCCGTGTA TCCAATAACTTGGGG TTGΛ TCCCCGGTCA TCTGGGGAACCTTGA GA CAGTTTCTG

GGTCTCTTGAAACTG TTG TTG TTTTAGCTA TTTCTGGGGA CCA TCTG TTCTTGA CC CTGGGCCGGGGCCCTAGTGCTTGACCACAGATATCCTGTTTGGCCCTAGTCCCG GTACTTTCCAGCCTCTCTGTTTCTGGGGACCATCTGTTCTTGGCCCTGGGCCGGG GCCCTA G TGCTTGA CCA CA GA TA TCCTG TTTGGCCCT A G TCCCG GT ACTTTCC A G CCTCTCTGTACTTCCTTGTTCTTGTTTTTCTGAGAACA TCAGCTCTGGTA TTTTCCC ATGCCTTGCAAAATGGCGTTACTGCAGTTAGCTGGCTAAGCCTTATGAAGGGGTC TTTCA TTAGACATGGCCAAGGTTGTAAGCCAGTGAATGCAGGCCAGCGGTATAA TCAATTGACTCATGGTACTTACAGTACTTATATGAAGGTGATTCCAAACCAGGCC AGGTCTGCTGCTACACACAAAGGCAAGGATAGCTTTCTCCTT (SEQ ID NO:18)

Bold sequence: mouse chromosome 17 Sequence shown in italic shows U3 in opposite direction.

Underlined sequence: R region ending at the "AAUAAA" of the polyA signal. The last A has been deleted.

Insertion of provirus into mouse chromosome 17 using first strand primer vector and second strand primer vector

GCCATGTCTAATGAAAGACCCC G7C777CΛCTAGGGCAAAGGGTGGCCT

(SEQ ID NO:19)

Italic sequence: provirus seqeunce. BoIs sequence: mouse chromosome 17 with a G to A mutation.

Insertion of a provirus usually results in replication of four nucleotides derived from genomic DNA at each end of the provirus. In this case these nucleotides are CTAG. The G-^A mutation could be due to PCR amplification during sequencing of the genomic DNA or due to error in cellular processes that are involved in gap repair introduced by integrase.

Insertion site in mouse chromosome 17

ATTGCAGTGCATCCAGCAGGGGTGGCTATAGTGTGGGCATTTGGCAGCTGGGGT GTGTGCAGGGTGTGGCTAGTGCAGCATCCAGTTCCACTTCCAAGGAGGGTGCAG

CTCTGCCAAGGGCCACAGGGTGGTATGTGGACAGACCTCTCTCTCTAAAGGCATG GAAAGATTACAGATAATGGGTGGGAACGTGATGGGCTGGACCCGTGTGAGGGCA GGAAGTCCACACTGATGAAGGAGAAAGCTATCCTTGCCTTTGTGTGTAGCAGCAG ACCTGGCCTGGTTTGGAATCACCTTCATATAAGTACTGTAAGTACCATGAGTTAAT TGATTGTACCGCTGGCCTGCATTCACTGGCTTACAACCTTGGCCATGTCT

AGGGCAAAGGGTGGCCTTTGGGGCCACCAGTGACATTGTAAAAGTGATGATAGC TAGCCCTGTTAGTTACAGTTGGTCCTTAGACAGCAGCCATAGAATTGAAATTAGAG GGGGGCTCTGTGGACTGAACGTGGCACGTGGAGCCTACACTGGAACTGGTCCTT TTGGCAGTGCCATGTAGCAGGCTTTCCAGAGGATGTTCTGAAATTGGTGCTGATG TAATCCCCCCACCCCCACCCCACCAGAATAGTCCAGTCATAGAAAGAACTGGCCT

CACCTTGTTCCAGTAGGCTAGTGATGAAGCCTGGATGCTGGGTTCCTGGAGCCCA GCTGAAAGTGCTGACAGGTACCACAGACATAGAGGTCAGCTTTGGCTATGTTAAT CTAACTTT (SEQ ID NO:20) The experiment as described above can also be used to introduce shRNA into the genome of a host cell. In this case, the second strand primer contains an shRNA sequence used to introduce shRNA into the provirus. The presence of a polymerase promoter in the template results in expression of the shRNA (figure 14).

References

AH Lund, M Duch, J Lovmand, P Jorgensen and FS Pedersen. 1997. J. Virol., 02 1997, 1191-1 195, VoI 71 , No. 2. Complementation of a primer binding site-impaired murine leukemia virus- derived retroviral vector by a genetically engineered tRNA-like primer.

Hansen A.C., Grunwald T, Lund A.H., Schmitz, A., Duch, M., Liberia, K. and Finn Skou Pedersen. 2001. J Virol. 2001 May; 75(10): 4922-4928. Transfer of Primer Binding Site-Mutated Simian Immunodeficiency Virus Vectors by Genetically Engineered Artificial and Hybrid tRNA-Like Primers

S. Morita, T. Kojima and T. Kitamura, Plat-E: an efficient and stable system for transient packaging of retroviruses, Gene Ther, 7, 1063-6, (2000)