CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority benefit of U.S. Provisional Patent

Application No. 62/487,252, filed April 19, 2017, the entire contents of which are incorporated herein by reference.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on April 18, 2018, is named 58849_0011_SL.txt and is 12,405 bytes in size.

FIELD OF THE INVENTION

[0003] The present invention relates to a protein marker associated with healthy breast tissue. The invention provides a protein for monitoring, diagnosing, screening, and prevention of breast cancer and hormonal disorders. More precisely, the invention relates a protein marker specifically down-regulated in breast cancer tissue.

BACKGROUND OF THE INVENTION

[0004] Breast cancer is the most common invasive cancer in females worldwide.

It accounts for 16% of all female cancers, 22.9% of invasive cancers in women, and 18.2% of all cancer related deaths worldwide, including both males and females. Breast cancer rates are much higher in developed nations compared to developing ones. (Friedman, 2013) Breast cancer usually originates in the inner lining of milk ducts (i.e., ductal carcinoma) or lobules (i.e., lobular carcinoma) and can spread to other parts of the body. (Fisher, 1977)

[0005] Sex steroids, estrogens and androgens, are essential for reproduction and thus essential for survival. Aberrant estrogen signaling has been linked to development and progression of breast cancer. Under normal conditions, the three major estrogens, estradiol, estrone and estriol, promote the healthy development of female sex characteristics during puberty and to ensure fertility. Estrogens (i.e., estradiol) are instrumental in breast development, fat distribution in the hips, legs, and breasts and the development of reproductive organs. Estrogens bind to estrogen receptor-a, generating a powerful stimulus for breast gland cell proliferation. While estrogens promote de novo breast cancer development through receptor-dependent mechanisms (Santen, 2015), estrogen receptor knockout mice showed a higher incidence of tumor development, indicating that estrogens can also promote breast cancer development through estrogen receptor-independent mechanisms. (Bocchinfuso, 1999) Progesterone is essential for normal breast development during puberty and in preparation for lactation and breastfeeding. The actions of progesterone are primarily mediated by its high-affinity receptors, which include the classical progesterone receptor (PR)-A and -B isoforms, located in various tissues, including the brain, where progesterone controls reproductive behavior, as well as the breast and reproductive organs.

[0006] There are multiple gene mutations, epigenetic changes, and signaling pathways, in addition to aromatase involvement in the genesis of breast tumors. 70% of breast tumors are ER-a ⁺ , there are ER-a ^" breast tumors. Additionally, local production of estrogen from the aberrant expression of aromatase in adipose stromal cells is also observed in breast cancer in both pre- and post-menopausal women. (Simpson, Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis., 1994) Through the aromatization of androgens, aromatase converts androstenedione and testosterone to estrone and estradiol, respectively. Thus, a single enzyme, aromatase, is central for breast cancer development, and identifying aromatase activity is a key to predict in advance of possibility developing for breast cancer.

[0007] Estradiol (abbreviated as E ₂ ), or 17 -estradiol, is the primary steroid sex hormone in females. Estradiol, like other steroids, is derived from cholesterol. It regulates the estrous and menstrual female reproductive cycles and develops and maintains female reproductive tissues. Estradiol is biosynthesized by aromatase from Δ4- androstenedione generating estrone, which upon further action of a dehydrogenase yields 17 -estradiol. (Miller, 2011) After side chain cleavage and using the Δ5 or the Δ4- pathway, A4-androstenedione is the key intermediary. A4-androstenedione can be converted to testosterone, which is then converted to 17 -estradiol. (Simpson, Aromatase - a brief overview, 2002) [0008] In females' reproductive years, estradiol in women is produced by the granulosa cells of the ovaries by the aromatization of A4-androstenedione (produced in the theca folliculi cells) to estrone, followed by conversion of estrone to estradiol by 17β- hydroxysteroid dehydrogenase. Part of the circulating estradiol is also produced by fat cells and this continues after menopause. During pregnancy, estriol becomes the predominant circulating estrogen and it is the only time when estriol is present in the body, whereas after menopause, estrone is the predominant form of estrogen.

[0009] Estradiol acts through estrogen receptors. Two subtypes of estrogen receptors, ERa and ERJ3, efficiently bind estradiol resulting in modulation of gene transcription and expression in estrogen receptor-expressing cells. This is the predominant mechanism by which estradiol mediates its biological effects in the body. In the E2 classical pathway, estradiol enters the cytoplasm, causes dissociation of heat-shock protein (HSP) and binds to HSP forming homodimers. The homodimers bind to the estrogen response element domains on the nucleus, allowing for gene transcription to take place.

[00010] Breast development at puberty and during sexual maturity is stimulated by 17 -estradiol (E ₂ ), which is the predominant circulating ovarian steroid and the most biologically active hormone in breast tissue. At menopause E2 plasma levels decrease by 90%. (Henderson, 1988) In spite of the markedly different circulating levels of estrogens in pre- and post-menopausal women, the concentrations of E2 in breast cancer tissues do not differ between these two groups of women, an indication that its uptake from the circulation might not contribute significantly to the total content of this hormone in breast tumors, but rather that possibly de novo biosynthesis, i.e., peripheral aromatization of ovarian and adrenal androgens or directly in the breast tissues possibly act to supplement as necessary for the E2 synthesis.

[00011] Currently available drugs for breast cancer treatment, such as Tamoxifen and Aromatase inhibitors, are part of treatment regimens that seek to suppress available estrogen in the body. Such treatment regimens focus on the fact that about 80% of breast cancers, once established, depend on available estrogen to grow, thus a reduction of available estrogen will inhibit cancer growth. Such treatment regimens have limited benefits for post-menopausal woman, who already have a significantly reduced level of available estrogens. Further, estrogen suppression treatment regimens are not effective as breast cancer preventative measures, but rather their utility is limited to treatment after tumors have already manifested.

[00012] New methods and compositions for monitoring, diagnosing, screening, preventing and treating manifestation of breast cancer at a much earlier stage than what current methods allow are needed. Additionally, upon manifestation of breast tumors, new methods for treating patients that do not rely on available estrogen suppression are needed.

SUMMARY OF THE INVENTION

[00013] In one aspect, the present invention provides SAM-1 protein markers for diagnosing, screening, preventing and/or treating breast cancer and hormonal disorders, and compositions for monitoring changes to these protein markers. In another aspect, the invention provides methods for screening drug candidates using these protein markers.

[00014] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample comprising the steps of (i) contacting the biological sample with one or more probes, and (ii) detecting binding between the probes and the biological sample to determine the presence of SAM-1 protein. The presence of SAM-1 protein in a human subject, as determined directly by protein detection or indirectly by coding nucleic acid detection, can be quantified and compared to levels of SAM-1 protein in healthy tissue, to identify a disorder such as breast cancer, Polycystic Ovarian Syndrome, disorders associated with increased levels of estrogen, or other disorders of increased aromatase activity, in order to therapeutically treat the subject. Therapeutically treating the subject can comprise administration of a composition to increase the level of SAM-1 in targeted tissue of the subject, or treatment through of a wide variety of other disease specific treatments now known (e.g., surgery, chemotherapy, radiation) or developed in the future. [00015] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample, wherein the presence of SAM-1 protein is determined by detecting the presence of a nucleic acid of SEQ ID NO: 1 encoding for SAM- 1 protein in a biological sample.

[00016] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample, wherein the presence of a nucleic acid encoding for SAM- 1 protein in a biological sample comprising the steps of (i) contacting the biological sample with one or more labeled oligonucleotides that specifically bind to the nucleic acid encoding for SAM-1 protein, and (ii) detecting binding between the labeled oligunucleotides and the nucleic acid encoding for SAM-1 protein to determine the presence of the nucleic acid encoding for SAM-1 protein.

[00017] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample comprising the steps of (i) contacting the biological sample with one or more labeled oligonucleotides that specifically bind to the nucleic acid encoding for SAM-1 protein, (ii) amplifying the nucleic acid between the bound labeled oligonucleotides, and (iii) detecting binding between the labeled oligunucleotides and the nucleic acid encoding for SAM-1 protein to determine the presence of the nucleic acid encoding for SAM- 1 protein.

[00018] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample, wherein the presence of SAM-1 protein is determined by detecting the presence of RNA encoding for SAM-1 protein in a biological sample.

[00019] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample comprising the steps of (i) contacting the sample with one or more labeled SAM- 1 antibodies that specifically bind to SAM-1 protein, and (ii) detecting binding between the labeled SAM-1 antibodies and SAM-1 protein to determine the presence SAM-1 protein.

[00020] In embodiments, the invention provides a method for determining the presence of SAM-1 protein in a human biological sample, wherein the detection of SAM-1 protein is used for early detection of breast cancer. [00021] In embodiments, the invention provides a method for determining whether SAM-1 protein is present in a human biological sample at a level lower than in a healthy biological sample, and if the level is lower treating the human for breast cancer.

[00022] In embodiments, the invention provides a composition for detecting a nucleotide sequence encoding for SAM-1 protein comprising a pair of nucleic acid primers selected from the group consisting of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, and 14.

[00023] In embodiments, the invention provides a composition for detecting a nucleotide sequence encoding for SAM-1 protein wherein the primers are labeled with a detectable moiety.

[00024] In embodiments, the invention provides an isolated SAM-1 protein having an amino acid sequence as shown in SEQ ID NO: 2.

[00025] In embodiments, the invention provides a nucleic acid expression vector comprising a nucleic acid sequence encoding SAM-1 protein and a nucleic acid sequence encoding a promoter.

[00026] In embodiments, the invention provides a pharmaceutical composition comprising a SAM-1 protein or a functional fragment thereof and a pharmaceutically acceptable excipient.

[00027] In embodiments, the invention provides a method of preventing or treating breast cancer comprising administering to a human subject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

[00028] In embodiments, the invention provides a method of preventing or treating Polycystic Ovarian Syndrome comprising administering to a human subject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

[00029] In embodiments, the invention provides a method of treating or preventing hormonal disorders associated with increased levels of estrogens comprising administering to a human subject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

[00030] In embodiments, the invention provides a method of treating or preventing hormonal disorders associated with increased aromatase activity comprising administering to a humansubject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

BRIEF DESCRIPTION OF THE DRAWINGS [00031] FIGS. 1A-1I: Aromatase expression in breast cell lysates. FIG. 1A depicts a schematic presentation of the steroid synthesis pathway showing the specific catalytic activity of aromatase. At the endoplasmic reticulum (ER), aromatase catalyzes the conversion of androstenedione to estrone and testosterone to estradiol. Androstenedione, testosterone, estrone and estradiol are inter-catalyzed by 17 -hydroxysteroid dehydrogenase (17 -HSD1). FIG. IB depicts the metabolic activity with the microsomal membrane. Metabolic activity of aromatase from the unaffected and affected breast tissue from the same patient as well as its comparison with the tumorigenic T47D and non- tumorigenic MCF12A cell lysates incubated with ¹⁴ C-testosterone followed by initiation with cytochrome P450 (cyp450) and NADPH. The un affected breast and the non- tumorigenic cells had minimal level of lines converted androstenedione to estrone, and the major product from testosterone was estradiol synthesis as compared to the affected tissues or tumorigenic cells. FIG. 1C depicts a quantitative analysis of the amount of estradiol synthesized. FIGS. 1D-1F depict PCR amplification of the 3' (FIG. ID), 5 ' (FIG. IE) and the cloning of the full-length cDNA sequence (FIG. IF). FIG. 1G depicts the open reading frame and the untranslated 3' region of the cDNA sequence. FIG. 1H identifies the presence of SAM-1 (by staining) in patients with ER ⁺ /PR ⁺ /HER ^~ ,ER /PR/ ^~ HER ⁺ , ER ⁺ /PR7HER ^" , and ER7PR7HER ^" patient tissues and its comparison with the unaffected human breast tissue. FIG. II depicts the determination of the presence of SAM- 1 in non-tumorigenic MCF12A and tumorigenic T47D cells by staining with SAM-1 antibody.

[00032] FIG. 2: Depicts the analysis of the SAM-1 protein sequence (SEQ ID NO:22), with the Blast search matching only with the first 42 N-terminal amino acids with the StAR protein.

[00033] FIGS. 3A-3M: Depicts the localization of the SAM-1 protein in breast tissues. FIGS. 3 A, 3B, and 3C depict different sections of the breast tissue stained with SAM-1 antibody in 1.0 mM scale, whereas a higher magnification is presented in FIG 3C. Similar probing with aromatase antibody in FIGS. 3D, 3E, and 3F depicts the localization of the aromatase antibodies. FIGS. 3G, 3H, and 31 depict different sections of the breast tissue stained with SAM-1 and aromatase antibodies showing co-localization of the aromatase and SAM-1 antibodies. FIG. 3 J depicts the role of various protease inhibitors with the indicated protease inhibitors, including RVKR (SEQ ID NO:23) being incubated with tumorigenic T47D cells for 6 hours to determine the restoration of SAM-1 expression stained with antibody. FIG. 3K depicts the localization of SAM-1 in different organelle fractions of the MCF12A cell (bottom panel) and unaffected breast tissue (top), where RER, MAM and mitochondria were isolated independently and then stained with SAM-1 antibody. FIG. 3L depicts the localization of peroxisome in unaffected breast tissue stained with SAM-1 antibody, a higher magnification is presented in FIG. 3M.

[00034] FIGS. 4A-4F depict the localization of SAM-1 and aromatase in affected (tumorigenic tissues) and unaffected tissues. FIGS. 4A and 4B depict the difference in organelle structure between the unaffected (FIG. 4 A) and affected breast tissue (FIG. 4B). In the unaffected breast tissue the mitochondria is well structured (FIG. 4A right) having OMM, IMM and christae but not the affected tissue mitochondria (FIG. 4B right). FIG. 4C depict the localization of aromatase in affected tissue where it is localized in the ER, but not in the mitochondria (FIGS. 4C(2) and 4C(3)), where FIG. 4C(2) and 4C(3) are enlarged from FIG. 4C(1), and FIG. 4C(4) depicts aromatase in the Golgi apparatus. FIG. 4D depicts the localization of SAM-1 in affected tissue. Fig. 4D(1) depicts SAM-1 localized in the ER, FIG. 4D(2) in the mitochondria and FIG. 4D(3) near the MAM section. FIG. 4E depicts organelle fractionation of the affected breast tissue (top) and T47D cells stained with SAM-1 antibody. FIG. 4F depicts colocalization of SAM-1 (55 nm) and aromatase (15nm) in tumorigenic tissue. An amplified version is on the right, which is mostly peroxisome.

[00035] FIGS. 5A-5E depict the effect of SAM-1 in the estradiol synthesis. FIG. 5 A (bottom) depicts the effect of 30 and 60 pmol of SAM-1 siRNA in MCF12A cells determined by western staining with SAM-1 antibody. FIG. 5 A (top) depicts the quantitative analysis of the estradiol synthesis from the bottom panel. FIG. 5B depicts the metabolic activity measurement from testosterone to estradiol following incubation of the indicated siRNA. FIG. 5C depicts the quantitative analysis of the amount of estradiol synthesized. FIG. 5D depicts the quantitative measurement of aromatase expression in MCF12A and T47D cells. FIG. 5E depicts the quantitative measurement of intensity of bands.

[00036] FIGS. 6A-6C depict the interaction between SAM-1 and aromatase through co-immunoprecipitation (CoIP) and independently staining with SAM-1 antibodies and aromatase antibodies. CoIP of the MCF12A (FIG. 6A) and T47D (FIGS. 6B and 6C) cell lysate.

DETAILED DESCRIPTION OF THE INVENTION

[00037] Unless otherwise defined, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligonucleotide or polynucleotide chemistry and hybridization described herein are those well-known and commonly used in the art. Standard techniques are used for recombinant DNA, oligonucleotide synthesis, tissue culture and cell transformation. Enzymatic reactions and purification techniques are performed using commercially available kits according to manufacturer's specifications or as commonly accomplished in the art or as described herein.

[00038] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al , 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J .E. Cellis, ed., 1998) Academic Press; Animal Cell Culture (R.I. Freshney, ed., 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., 1993- 1998) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D .M. Weir and CC. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); Current Protocols in Molecular Biology (F .M. Ausubel et al , eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al , eds., 1994); Current Protocols in Immunology (J.E. Coligan et al , eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: apractical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J.D. Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (V. T. DeVita et al , eds., J.B. Lippincott Company, 1993).

A. Definitions

[00039] To facilitate understanding of the invention, a number of terms and abbreviations as used herein are defined below as follows:

[00040] When introducing elements of the present invention or the preferred embodiment(s) thereof, the articles "a", "an", "the" and "said" are intended to mean that there are one or more of the elements. The terms "comprising", "including" and "having" are intended to be inclusive and mean that there may be additional elements other than the listed elements.

[00041] The term "and/or" when used in a list of two or more items, means that any one of the listed items can be employed by itself or in combination with any one or more of the listed items. For example, the expression "A and/or B" is intended to mean either or both of A and B, i.e. A alone, B alone or A and B in combination. The expression "A, B and/or C" is intended to mean A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination or A, B, and C in combination. [00042] It is understood that aspects and embodiments of the invention described herein include "consisting" and/or "consisting essentially of aspects and embodiments.

[00043] Isolated Protein: The term "isolated protein" referred to herein means a protein of cDNA, recombinant RNA, or synthetic origin or some combination thereof, which by virtue of its origin, or source of derivation, the "isolated protein" (1) is not associated with at least some of the proteins found in nature, (2) is free of other proteins from the same source, (3) is expressed by a cell from a different species, or (4) does not occur in nature.

[00044] Conservative Substitutions: The term "conservative substitutions" or "conservative replacements" are changes between amino acids of broadly similar molecular properties. Generally, conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into families: (1) acidic amino acids are aspartate, glutamate; (2) basic amino acids are lysine, arginine, histidine; (3) non-polar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, and tyrosine. The hydrophilic amino acids include arginine, asparagine, aspartate, glutamine, glutamate, histidine, lysine, serine, and threonine. The hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine and valine. Other families of amino acids include (i) serine and threonine, which are the aliphatic -hydroxy family; (ii) asparagine and glutamine, which are the amide containing family; (iii) alanine, valine, leucine and isoleucine, which are the aliphatic family; and (iv) phenylalanine, tryptophan, and tyrosine, which are the aromatic family. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the binding or properties of the resulting molecule. In embodiments, conservative substitution groups are aspartate-glutamate; asparagine - glutamine; valine-leucine-isoleucine; alanine-valine; phenylalanine-tyrosine; and lysine - arginine.

[00045] Naturally-Occurring: The term "naturally-occurring" as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory or otherwise is naturally-occurring. [00046] Amino Acids: As used herein "amino acids" refers to the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology-A Synthesis (2nd Edition, E. S. Golub and D. R. Gren, Eds., Sinauer Associates, Sunderland Mass. (1991)). Stereoisomers (e.g. , D-amino acids) of the twenty conventional amino acids, non-natural amino acids such as α,α-disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4 hydroxyproline, γ-carboxyglutamate, ε-Ν,Ν,Ν- trimethyllysine, ε-Ν-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, a-N-methylarginine, and other similar amino acids and imino acids (e.g. , 4-hydroxyproline). In the polypeptide notation used herein, the left- hand direction is the amino terminal direction and the right-hand direction is the carboxy- terminal direction, in accordance with standard usage and convention. Similarly, unless specified otherwise, the left-hand end of single-stranded polynucleotide sequences is the 5' end the left-hand direction of double- stranded polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences", sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences".

[00047] Polypeptide, Peptide, and Protein: The terms "polypeptide", "peptide," and "protein" (if single chain) are used interchangeably herein to refer to polymers of amino acids. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.

[00048] Substantial Identity: As applied to polypeptides, peptides, and proteins the term "substantial identity" means that two peptide sequences, when optimally aligned share at least 80% sequence identity, preferably at least 90% sequence identity, more preferably at least 95% sequence identity, and most preferably at least 99% sequence identity.

[00049] As discussed herein, variations in the amino acid sequences of polypeptides, peptides, and proteins are contemplated as being encompassed by the present invention, providing that the variations in the amino acid sequence maintain at least 75%, more preferably at least 80%, 90%, 95%, and most preferably 99%. Certain percentages in between are included, such as 75%, 76%, 77%, 78%, 79% 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% sequence identity. In particular, conservative amino acid replacements are contemplated. In certain embodiments, amino acid substitutions are those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and (4) confer or modify other physicochemical or functional properties of such analogs.

[00050] Polypeptide Fragment: As used herein, the term "polypeptide fragment" refers to a polypeptide that has an amino terminal and/or carboxy-terminal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the naturally-occurring sequence deduced, for example, from a full length cDNA sequence. Fragments typically are at least 5, 6, 8 or 10 amino acids long, preferably at least 14 amino acids long more preferably at least 20 amino acids long, usually at least 50 amino acids long, and even more preferably at least 70 amino acids long. The term "SAM-1 analog" as used herein refers to polypeptides which are comprised of a segment of at least 5 amino acids that has substantial identity to a portion of the deduced amino acid sequence of SAM-1 or a biologically active derivative thereof under suitable conditions. Typically, polypeptide analogs comprise a conservative amino acid substitution (or addition or deletion) with respect to the naturally-occurring sequence. Analogs typically are at least 5 amino acids long, preferably at least 10 amino acids long or longer, and can often be as long as a full-length naturally-occurring polypeptide.

[00051] Drug analogs are commonly used in the pharmaceutical industry as non- peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed "peptide mimetics" or "peptidomimetics". Peptidomimetics are compounds based on, or derived from, peptides and proteins. Peptidomimetics can be obtained by for example structural modification of known peptide sequences using unnatural amino acids, conformational restraints, and isosteric replacement. Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic or prophylactic effect. Generally, peptidomimetics are structurally similar to a polypeptide, such as human antibody, but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: -CH2NH-, -CH2S-, -CH2-CH2-, -CH=CH-(cis and trans), -COCH2-, CH(OH)CH ₂ - and -CH2SO-, by methods well known in the art. Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g. , D-lysine in place of L-lysine) may be used to generate more stable peptides. In addition, constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch Ann. Rev. Biochem. 61 :387 (1992)); for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide.

[00052] Antibody: The term "antibody" as used herein refers to proteins that specifically bind to epitopes, including polyclonal antibody, monoclonal antibody, and recombinant antibody. Antibodies typically contain a conserved region and available region with heavy and light chains. The invention contemplates antibody fragments which functionally bind to the epitope of interest.

[00053] Antigen- antibody complex: The term "antigen- antibody complex" as used herein refers to the protein complex resulting from binding of specific antibody to SAM- 1 protein.

[00054] Biological Sample: the term "biological sample" has used herein refers to cells, tissues, or bodily fluids that include but are not limited to breast tissue, urine, blood, plasma, and serum from a patient.

[00055] Nucleic Acid or Polynucleotide: The terms "nucleic acid" or "polynucleotide" or "oligonucleotide" as used herein refer to purine- and pyrimidine- containing polymers of any length, either polyribonucleotides or polydeoxyribonucleotides or mixed polyribo-polydeoxyribo nucleotides. This includes single- and double-stranded molecules, such as, for example, DNA-DNA, DNA-RNA and RNA-RNA hybrids. This also includes nucleic acids containing modified bases. [00056] Complement: A "complement" of a nucleic acid sequence as used herein refers to the antisense sequence that participates in Watson-Crick base-pairing with the original sequence.

[00057] Primer: The term "primer" as used herein is an isolated oligonucleotide between about 10 and about 50 nucleotides in length, preferably between about 12 and about 25 nucleotides in length and most preferably between about 12 and about 18 nucleotides in length, that forms a duplex with a single-stranded nucleic acid sequence of interest and allows polymerization of a complementary strand using, e.g., reverse transcriptase or DNA polymerase.

[00058] An "isolated" nucleic acid as used herein refers to a component that is removed from its original environment (for example, its natural environment if it is naturally occurring or a reaction mixture if it is synthetic). An isolated nucleic acid typically contains less than about 50%, preferably less than about 75%, and most preferably less than about 90%, of the components with which it was originally associated.

[00059] A nucleic acid sequence that is "derived from" a designated sequence refers to a sequence that corresponds to a region of the designated sequence. This encompasses sequences that are homologous or complementary to the sequence.

[00060] Pharmaceutical Agent or Drug: As used herein, the terms "pharmaceutical agent" or "drug" refer to a chemical compound, a biologic compound, or composition capable of inducing a desired therapeutic effect when properly administered to a patient.

[00061] Pharmaceutically Acceptable Carrier: The term "pharmaceutically acceptable carrier" is art-recognized and refers to a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting any subject composition or component thereof from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the subject composition and its components and not injurious to the patient. Some examples of materials which may serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

[00062] Therapeutically Effective Amount: As used herein, the term "therapeutically effective amount" refers to those amounts that, when administered to a particular subject in view of the nature and severity of that subject's disease or condition, will have a desired therapeutic effect, e.g. , an amount which will cure, prevent, inhibit, or at least partially arrest or partially prevent a target disease or condition. In some embodiments, the term "therapeutically effective amount" or "effective amount" refers to an amount of a therapeutic agent that when administered alone or in combination with an additional therapeutic agent to a cell, tissue, or subject is effective to prevent or ameliorate the disease or condition or condition, or the progression of the disease or condition. A therapeutically effective dose further refers to that amount of the therapeutic agent sufficient to result in amelioration of symptoms, e.g. , treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient administered alone, a therapeutically effective dose refers to that ingredient alone. When applied to a combination, a therapeutically effective dose refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.

[00063] Treating, Treatment, or Alleviation: As used herein the terms "treating" or "treatment" or "alleviation" refers to therapeutic treatment wherein the object is to slow down (lessen) if not cure the targeted pathologic condition or disorder or prevent recurrence of the condition. [00064] Preventative Treatment: The term "preventative treatment" as used herein is meant to indicate a postponement of development of a disease, a symptom of a disease, or medical condition, suppressing symptoms that may appear, or reducing the risk of developing or recurrence of a disease or symptom.

[00065] Subject or Patient: As used herein, the terms "subject" or "patient" refers to an animal, a non-human mammal or a human. As used herein, "animals" include a pet, a farm animal, an economic animal, a sport animal and an experimental animal, such as a cat, a dog, a horse, a cow, an ox, a pig, a donkey, a sheep, a lamb, a goat, a mouse, a rabbit, a chicken, a duck, a goose, a primate, including a monkey and a chimpanzee.

[00066] Throughout this disclosure, various aspects of this invention are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[00067] Other objects, advantages and features of the present invention will become apparent from the following specification taken in conjunction with the accompanying figures.

B. Exemplary compositions

[00068] Provided herein are peptides, polypeptides, proteins, and variants thereof that are differentially expressed in unaffected and malignant breast tissues. Peptides may comprise a segment of the novel protein Savannah Anderson Mercer- 1 (SAM-1). A nucleotide sequence encoding SAM-1 is set forth in SEQ ID NO: l and the SAM-1 protein encoded thereby is set forth as SEQ ID NO:2. SAM-1 is a 207 amino acid sequence.

[00069] cDNA sequence encoding for SAM-1 protein open reading Frame: ATG CTG CTA GCG ACA TTC AAG CTG TGC GCT GGG AGC TCC TAC AGA CAC ATG CGC AAC ATG AAG GGG CTG GCG CAA CAG CCT GTG ATG GCC ATC AGC CAG GAA CTG AAC CGG AGG GCC CTG GGG GGC CCC ACC CTA GCA CGT GGA TTA ACC AGG TTC GGC GGC GGA GCT CTC TAC TCG GTT CTA GGC TGG AAG AGA CTC TCT ACA GTG ACC AGG AGC TGG CCT ATC TCC AGC AGG GGG AGG AGG CCA TGC AGA AGG CCT GGG CAT CCT GGG CAA CCA AGA GGG CTG GAA GAA GGA GAG TCA GCA GGA CAA TGG GGA CAA AGT GAT GAG TCG AGT GGT CCC AGA TGT GGG CAA GGT GTT CCG GCT GGA GGT CGT GGT GGA CCA GCC CAT GGA GAG GCT CTG GAG GTC GTG GTG GAC CAG CCC ATG GAG AGG CTC TGG ACA GTC GCT GAA ATC ACT GAA TGC CTC CTC AGG TCA TTT AGC ACT TAT TTT ATC CAG TAT CTT TGG GCT CCT TCT CCT GGT TCT GTT TAT TCT ATT TCT CAC GTG GTG CCG AGT TCA GAA ACA AAA ACA TCT GCC CCT CAG AGT TTC AAC CAG AAG GAG GGG TTC TCT CGA GGA GAA TTT ATT CCA TGA (SEQ ID NO: 1).

[00070] 3 ' Untranslated sequence (underlining shows termination and poly (A) tail sequences):

TC AATACAGC AACC ATGAATTATC ACCTGCAAAAGTTGAGAATGAATGCTGTG AGGGGAACGCCCCCATCATCAACTTGCCCGGTAGAACCCCACACGCATTGCTC CCGCTGGGACTGTTAGACGTGAAGCTGTGGATGCGTCCCCCCTGTACCGCACA TAGCAAACCATCTGTATGATGATGCAGGCGCTCGAGATGCTGCCTTCCGGAAC ATTAAGAACATTGCTGAGTGGCTGGAGATGAGCTCATCAATGCTGCCAAGGNC TCCTCGAACTCCTATGCCATTAAGAAGAAGGACGAGCTGGAGCGTGTTGGCCA AGTCCAACCCGTGATTTTCCCGACTGCTGCCCAATAAACCTGTCTGCCCTTTGG GGCAGCCCCAGCAAAAAAAAAAAAAAAAAATGATCAACAAAACNNGGACAA AAACGTACTTTTGTGAAGGGTGGGCTANNTTNNNNTTTTTTTTTTTTTTATTTT GTTTT (SEQ ID NO: 15).

[00071] Translated sequence for SAM-1 protein: MLLATFKLCA GSSYRHMRNM KGLAQQPVMA ISQELNRRAL GGPTLARGLT RFGGGALYSV LGWKRLSTVT RSWPISSRGR RPCRRPGHPG QPRGLEEGES AGQWGQSDES SGPRCGQGVP AGGRGGPAHG EALEVVVDQP MERLWTVAEI TECLLRSFST YFIQYLWAPS PGSVYSISHV VPSSETKTSA PQSFNQKEGF SRGEFIP (SEQ ID NO:2).

[00072] In embodiments, the invention provides functional fragements of SAM-1 protein, which may be polypeptides comprising about 5 to about 200 amino acids of the SAM-1 protein. A SAM-1 peptide may comprise from about 10 to about 100, or from about 20 or 50 amino acids or from about 20 to about 30 or 35 amino acids of the SAM-1 protein. For example, a peptide may comprise an amino acid sequence identical to the SAM-1 protein sequence from about amino acid 1 to about amino acids 35, 30, 25, 20, 15, or 10 of the SAM-1 protein, such as a protein having SEQ ID NOs:3 or 4. The amino acid sequences of these exemplary SAM-1 human peptides are LEVVVDQPMERL (SEQ ID NO:3) and LYEELVER (SEQ ID NO:4), respectively.

[00073] Additional SAM-1 peptides related to SEQ ID NO:2 are also provided. In some embodiments, the peptide comprises about 5 to about 207 amino acids of the SAM-1 protein. For example, peptides may comprise an amino acid sequence starting with any of the first 203 amino acids of the SAM-1 protein such as starting at amino acid 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 150, 200, or 203 or any other of the SAM-1 protein. Other examples may be peptides comprising an amino acid sequence ending with any of the last 203 amino acids of the SAM-1 protein such as ending at amino acid 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100, 150, 200, or 207. Illustrative peptides may comprise amino acids; 2 to 27 of the SAM-1 protein; 3 to 207 of the SAM-1 protein; 203 to 207 of the SAM-1 protein; or 1 to 5 of the SAM-1 protein.

[00074] In other embodiments, the peptides may comprise an amino acid sequence which terminates with 5 or more of the amino acids of the N-terminus amino acid sequence of the SAM- 1 protein. The invention contemplates recombinant chimeric S AM- 1 proteins and peptides containing a portion of a SAM-1 protein and all or a portion of another protein.

[00075] In other embodiments peptides may comprise an amino acid sequence beginning with 5 or more of the amino acids of the C-terminus amino acid sequence of the SAM-1 protein.

[00076] Peptides may also comprise, consist of, or consist essentially of any of the amino acid sequences described herein. In certain embodiments peptides comprise, consist of, or consist essentially of an amino acid sequence that has at least about 70%, 80%, 90%, 95%, 98% or 99% identity or homology with the SAM-1 protein. For example, peptides that differ from the sequence in the naturally occurring SAM-1 protein in about 1, 2, 3, 4, 5 or more amino acids are also contemplated. The differences may be substitutions, e.g., conservative substitutions, deletions or additions.

[00077] In other embodiments the peptides comprise modified amino acids. Exemplary peptides are peptides containing one or more amino acids modified by glycosylation, pegylation, phosphorylation or any similar process that retains at least one biological function of the peptide from which it was derived.

[00078] Peptides may also comprise one or more non-naturally occurring amino acids. For example, non-naturally occurring amino acids can be introduced as a substitution or addition into peptides. Non-naturally occurring amino acids include, but are not limited to, the D-isomers of the twenty conventional amino acids, α-,α- disubstituted amino acids, N-alkyl amino acids, lactic acid 4 hydroxyproline, γ- carboxyglutamate, ε-Ν,Ν,Ν-trimethyllysine, ε-Ν-acetyllysine, O-phosphoserine, N- acetylserine, N-formylmethionine, 3-methylhistidine, 5 -hydroxy lysine, a-N- methylarginine, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, 2- amino butyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, , and other similar amino acids and imino acids.

[00079] Peptides may be modified during or after synthesis by benzylation, glycosylation, acetylation, phosphorylation, amidation, pegylation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, or any similar process that retains at least one biological function of the peptide from which it was derived. Peptide analogs, such as chemically modified peptides and peptidomimetics are also contemplated.

[00080] Also encompassed herein are peptides that are fused to a heterologous peptide or other signal sequences, such as a peptide that can be used for detecting; purifying; stabilizing; or solubilizing the peptide. Peptides may be used as a substantially pure preparation, e.g., wherein at least about 90% of the peptides in the preparation are the desired peptide. Compositions comprising at least about 50%, 60%, 70%, or 80% of the desired peptide may also be used. Peptides may be denatured or non-denatured and may be aggregated or non- aggregated as a result thereof. Peptides can be denatured according to methods known in the art.

Detection of SAM-1

[00081] The presence and expression levels of SAM-1 protein for early detection of breast cancer in the present invention can be detected by using a method which detects the presence and expression levels SAM-1 protein or of nucleic acid sequences that encode the SAM-1 protein relative to expression levels of a healthy subject or healthy tissue sample of the patient.

[00082] The detection method of the presence and expression levels of DNA and RNA typically use procedures which detect the presence and expression levels and/or patterns of mRNAs transcribed from these genes relative to expression levels of a healthy subject or healthy tissue sample of the patient. Analytical methods that detect presence and expression levels and/or patterns of mRNAs include but are not limited to RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay, northern blot, and DNA chip.

[00083] Through analytic methods, the levels of mRNAs in a biological sample from an unaffected person and a biological sample from patients at risk of breast cancer can be compared, and the expression levels and/or patterns of mRNAs that encode for SAM-1 protein for early stage breast cancer can be determined to diagnose breast cancer.

[00084] In some embodiments the invention provides methods for the detection of a nucleic acid encoding SAM-1 protein comprising.

[00085] (A) performing a reverse transcription reaction using as a template RNA derived from a biological sample collected from a patient to produce first cDNA strand reverse transcription products using a generic 3 '-primer, such as GGC CAC GCG TCG ACT AGT ACT TTT TTT TTT TTT TTT T (SEQ ID NO:5);

[00086] (B) amplifying the first cDNA strand reverse-transcription products using one or more pairs of labeled or unlabeled oligonucleotide primers specific for SAM- 1 to produce SAM-1 -specific amplification products, where each of the pairs comprise:

[00087] (a) a primer selected from the group consisting of: 5'-CTG GAG GTC GTG GTG GAC CAG CCC ATG GAG AGG CTC-3' (SEQ ID NO:6), 5'-AGCT AGATCT ACC CTG GAG GTC GTG GTG GAC CAG CCC ATG GAG AGG CTC-3' (SEQ ID NO:7), 5'-AGCTA GAATTC TCA ACA CCT GGC TTC AGA GGC AGG-3' (SEQ ID NO:8), 5'-CTC TAT GAA GAG CTC GTG GAG CGC-3' (SEQ ID NO:9), 5'-AGCTA AGATCT ACC ATG CTG CTA GCG ACA TTC-3' (SEQ ID NO: 10), 5'-GAG CCT CTC CAT GGG CTG GTC CAC CAC GAC CTC CAG-3' (SEQ ID NO: 11), 5'-GCG CTC CAC GAG CTC TTC ATA GAG-3' (SEQ ID NO: 12), 5'-AACT GAATTC GAG CCT CTC CAT GGG CTG GTC CAC CAC GAC CTC CAG-3' (SEQ ID NO: 13), and 5'- AACT GAATTC GCG CTC CAC GAG CTC TTC ATA GAG-3' (SEQ ID NO: 14); and

[00088] (C) detecting the amplification products, where detection of the amplification products indicates the presence of SAM-1 encoding RNA in the sample.

[00089] The present invention relates to the nucleic acids encoding for SAM- 1 and also include vectors, such as expression vectors for producing a peptide as described herein. Also encompassed are cells comprising a nucleic acid sequence encoding for peptides described herein and methods for producing the peptides. The formation of such cells and methods can be performed using protocols that are known by those skilled in the art.

[00090] Another aspect if the present invention relates to polynucleotide sequences encoding for SAM- 1 protein. In some embodiments the polynucleotide sequence may also encode for a leader sequence. Alternatively, the nucleic acid can be engineered such that the natural leader sequence is deleted and a heterologous leader sequence inserted in its place. For example, the desired DNA sequence may be fused in the same reading frame to a DNA sequence which aids in expression and secretion of the polypeptide from the host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of the polypeptide from the cell.

[00091] The polypeptides may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions to improve stability and persistence in the host cell. Additionally, peptide moieties may be added to the polypeptide to facilitate purification.

[00092] Another aspect of the present invention relates detecting the presence and expression level of SAM-1 protein. The specific detection of presence and expression level of the SAM-1 protein for early detection of breast cancer in the present invention entails a process of confirming the presence and the expression level of SAM-1 protein within a biological sample. For example, specific antibodies that bind to SAM-1 protein can be used to detect the presence and expression level of SAM-1 protein. Upon introduction of the SAM-1 specific antibodies to a biological sample if the SAM-1 protein is present a detectable antigen- antibody complex will be formed.

[00093] Methods of detecting SAM-1 protein expression levels using antibodies include but are not limited to western blot, ELISA (enzyme linked immunosorbent assay), Radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion analysis, rocket immunoelectrophoresis, immunohistochemistry, immunoprecipitation assay, Complement Fixation Assay, FACS (fluorescent activated cell sorter), and protein chip.

[00094] The amount of the antigen-antibody complex can be measured by the levels and patterns of signals from detection labels of secondary antibodies. These detection labels include but are not limited to enzymes, fluorescent materials, ligands, luminescent materials, microparticles, redox molecules, and radioisotopes.

[00095] Through these analytic methods, the levels of antigen-antibody complexes in a biological sample from an unaffected person and a biological sample from patients at risk of breast cancer can be compared, and the expression levels of SAM-1 protein for early stage breast cancer could be determined, ultimately making it possible to diagnose breast cancer for patients at risk at early stage.

Therapeutic Compositions and Methods

[00096] Compositions may be provided in pharmaceutical compositions and administered to a patient to treat or prevent the development of breast cancer in the subject. The invention provides pharmaceutical compositions which increase the levels or expression of SAM-1 in a patient. Appropriate pharmaceutical agents can be administered to a subject in an amount that is therapeutically effective to prevent, inhibit, or decrease the development or growth of breast cancer. The pharmaceutical agents may be administered alone or, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practices. Pharmaceutical agents may be administered directly into breast tissue, orally or parenterally, including but not limited to intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally and topically. [00097] Pharmaceutical compositions containing a pharmaceutical agent may be in a form suitable for oral use, such as but not limited to tablets, troches, and suspensions. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more pharmaceutically acceptable soluble excipients. The pharmaceutically acceptable excipients are known in the art, and the soluble excipients may include viscosity modifiers, surface active agents, diluents, and other non-active ingredients of the formulation intended to facilitate handling, stability, dispersibility, and/or release kinetics of the drug.

[00098] The pharmaceutical composition may contain other active agents may also be included in formulations, such as but not limited to anti-inflammatory agents, analgesics, antimicrobial agents, antifungal agents and other antibiotics.

[00099] In one aspect, the present invention provides pharmaceutical compositions and methods for preventing and/or treating breast cancer in a patient, which method comprises administering, to a patient in need an effective amount of a pharmaceutical agent for preventing breast cancer, treating breast cancer, diagnosing breast cancer, prognosing breast cancer and/or monitoring prevention or treatment of breast cancer.

[000100] In one aspect, the present invention provides pharmaceutical compositions and methods for preventing and/or treating Polycystic Ovarian Syndrome comprising administering to a human subject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

[000101] In one aspect, the present invention provides pharmaceutical compositions and methods for treating or preventing hormonal disorders associated with increased levels of estrogens comprising administering to a human subject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

[000102] In one aspect, the present invention provides pharmaceutical compositions and methods for treating or preventing hormonal disorders associated with increased aromatase activity comprising administering to a human subject in need thereof an effective amount of a pharmaceutical composition comprising a SAM-1 protein or functional fragment thereof and a pharmaceutically acceptable excipient.

Examples

[000103] The following examples are listed to improve the understanding of the present invention and do not limit the scope of the invention in any way.

METHODS

Detection of SAM-1 in Breast Tissues

[000104] Breast cancer tissue samples were obtained from a single surgical practice and submitted by a single surgeon at the Anderson Cancer Institute at the Memorial Hospital in Savannah. Study patients had core needle, biopsy-proven invasive ductal carcinoma of at least 1 cm in diameter. The affected and unaffected tissue was identified through the use of a hand-held ultrasound and sampled using a 14g disposable Bard biopsy gun (Bard, Tempe, AZ). The tissues were immediately transferred into ice and were stored in liquid nitrogen, if not processed for organelle fractionation or activity assay. The tissue specimens were placed on ice, and then the organelle fractions containing endoplasmic reticulum and the mitochondria from the epithelial cells were separated following a well-developed procedure (Walter, 1981) that was partially modified.

Membrane integration assay

[000105] To confirm the localization of aromatase, endoplasmic reticulum fractions from MCF12A and T47D cells were, as previously described (Prasad, 2015), isolated. Isolated microsomes were collected by ultracentrifugation at 109,000 xg (Beckman TL- 100.2; Brea, CA) at 4°C for 30 min. The pellets (containing 10μg of protein) were treated with freshly prepared 100 mM sodium carbonate (pH, 11.4) on ice for 15 min. The samples were ultracentrifuged at 80,000 x g to separate the soluble fraction from the membranous fraction. Washing the pellet with the buffer served as the control.

Western blot analysis

[000106] Protein (12.5 μg) was separated by 15% SDS-PAGE and transferred to a polyvinylidinedifluoride (PVDF) membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 3% nonfat dry milk for 45 min, probed overnight with the primary antibodies, and then incubated with the peroxide-conjugated goat anti-rabbit IgG or anti mouse IgG (Pierce). Signals were developed with a chemiluminescent reagent (Pierce).

Design of the siRNA

[000107] DHARMACON/GE program was used to design siRNA sequences for SAM-1 protein knockdown bio assays. The program resulted four siRNA oligonucleotides, where the first SAM-1 siRNA (siRNA 1), where sense (5'- GGGAGGAGGCCAUGCAGAAUU-3 ') (SEQ ID NO: 16) and antisense (5'- UUCUGCAUGGCCUCCUCCCUU-3') (SEQ ID NO: 17), and the second siRNA (siRNA 2) had sense (5'-CACCUAGCACGUGGAUUAUU-3') (SEQ ID NO: 18) and the antisense (5'-UAAUCCACGUGCUAGGGUGUU-3') (SEQ ID NO: 19). siRNA 1 and siRNA 2 were independently applied to knockdown the expression of SAM-1. Expression levels were determined by western blotting.

Biological activity assay

[000108] To develop the biological activity assay ¹⁴ carbon-labeled testosterone and androstenedione was used as substrates in the presence of NADPH and human cytochrome P450 ferrodoxin reductase (Sigma, St. Louis, MO) as activators. The metabolic conversion assay was carried out in a glass tube (VWR, 16x100mm) in 50mM potassium phosphate buffer (pH 7.4). Radiolabeled testosterone at a concentration of 0.5UC or radiolabeled 0.3UC of androstenedione was incubated with 100 μg of cell or tissue lysate as the source of enzyme (aromatase). The role of SAM-1 protein was elucidated by transfecting MC12A or T47D cells with siRNA 1 and siRNA 2 using oligofectamine in the absence of any serum. Twelve hours following transfection the incubation media was changed with a media containing serum and antibiotics and the cells were incubated for an additional 36 hours. After incubation the cells were washed with PBS two times and lysate was prepared for metabolic conversion. The reaction was initiated with 2μg of cytochrome P450 and 2mM NADPH. For complete metabolic conversion, the reaction was chased with 10-fold cold testosterone and androstenedione independently. The reaction mixture was gently vortexed, and the reaction tubes, which were covered with parafilm to avoid any evaporation loss during incubation, were incubated in a shaking water bath (40 rpm) at 37°C for 4 h. [000109] Following incubation, 4 niL of ether: acetone (9: 1) was added to each tube and gently vortexed to extract newly synthesized steroids. The tubes were allowed to sit at room temperature for about 10 min to separate the aqueous and organic layers. The upper, organic layer was gently collected without mixing the two layers using a Pasteur pipette and transferred to a new glass tube. The remaining reaction mixture was again subjected to organic solvent extraction. The extracted organic solvent layers were then mixed with 4 mL of basic water (0.01M NaOH), vortexed gently and allowed to remain for 15 min at room temperature to separate the layers. The upper organic solvent layer was collected in a fresh 5 mL glass tube (VWR international, 12x75mm) and air-dried. A cold testosterone: estradiol mixture was added to the completely dried reaction tubes at a final concentration of O.lmM resuspended in ethanol. The tubes were gently rolled to dissolve all the dried steroids, and 2 iL was counted in 2.5 mL of scintillation cocktail (Beckmann Coulter, Beckman, CA) in triplicate. Each sample was counted for 2 min, and 5000 counts of each sample were then spotted on a silica-coated glass plate (20x20cm, 60W F254S, Millipore, Billerica, MA). The silica plate was run in chroloform:ethylacetate (3: 1) for 1 h and dried in a 45 °C air incubator before exposing it to a ³ H screen.

[000110] The complete process of TLC separation can be avoided by reducing the 12 hour time into an 8-10 minute separation in HPLC with a radioactive-detector, which does not require the steroid extraction procedure and use of organic solvents. For characterization of the steroids by gas chromatography-mass spectrometry (GC-MS), spots matching with the autoradiogram were scraped from the silica plates and extracted in ether-chloroform (3: 1). The solvent was evaporated under N ₂ , and the dried steroids were analyzed on an Agilent 7890 GC/ 5975C mass spectrometer with a Phenomenex Zebron ZB-5MS column (30 m; 0.25-mm ID) of 0.25-μιη film thickness. Samples were dissolved in 50 of dichloromethane, and Ιμί was injected onto the column using a 5 : 1 split injection with the injection inlet temperature set to 250°C. Helium was used as the carrier gas at a flow rate of 1 mL/min. The temperature program was as follows: 80 °C (no hold time) and then ramp at 20°C/min to 325 °C (hold for 4 min). Spectra were collected in full scan mode with 70-eV ionization over the mass range of m z 30 to 500 to facilitate the comparison of the MS spectra with the NIST/EPA/NIH NIST08 mass spectral library. Co-immunoprecipitation (CoIP) analysis

[000111] Specific antibodies were pre-incubated with protein A-Sepharose CL 4B (0.5 μg/μL, Amersham Biosciences, Sweden) in 100 of lx co-IP buffer (1% Triton X- 100, 200mM NaCl and 0.5% sodium deoxycholate). After mixing for 2 h at 4°C, the Sepharose beads were washed with lx CoIP buffer five times and then incubated again with rabbit IgG control antibody (Sigma) for 1 h. After another wash series, freshly isolated mitochondrial pellets (25 mg/sample) were resuspended with ice cold lysis buffer (20mM Tris HC1, pH 8.0, 137mM NaCl, 10% glycerol, 1% Triton X-100, 2mM EDTA) at 4°C for 15 min. Insoluble material was removed by ultracentrifugation (30 min at 100,000xg). The supernatants were incubated overnight at 4°C in the presence of antibodies prebound to protein A-Sepharose beads. The protein A-Sepharose pellets were washed with lx CoIP buffer and lOmM HEPES (pH 7.4), resuspended, and vortexed with lOOmM glycine (pH 3.0) for 10 seconds. A pre-titrated volume of 1.0M Tris (pH 9.5) was added, and the beads separated from the soluble material by centrifugation at 2000xg for 2 min. The supernatants (immune complexes) were analyzed by western blotting.

Transmission Electron Microscopy (TEM)

[000112] MCF12A or T47D cells (6xl0 ⁶ ) were washed with PBS, gently scraped in the presence of PBS and transferred to 50 mL plastic disposable Corning tubes. Following centrifugation at 3500 rpm (Beckman Allegra 22R and rotor F630) for 10 min, the cells were fixed in 4% paraformaldehyde and 0.2% glutaraldehyde in 0.1M sodium cacodylate buffer, pH 7.4, dehydrated with a graded ethanol series through 95%, and embedded in LR white resin. Thin sections of the patient's breast or unaffected breast tissue of 75 nm thickness were cut with a diamond knife on a Leica EM UC6 ultramicrotome (Leica Microsystems, Bannockburn, IL, USA) and collected on 200 mesh nickel grids. The cut sections were blocked in 0.1% BSA in PBS for 4 h at room temperature (RT) in a humidified atmosphere and incubated with Tim50 (1:100), Aromatase (1:1000), SAM-1 (1: 100), and GRP78 (1:1000) antibodies in 0.1% BSA overnight at 4°C. The sections were then washed with PBS and floated on drops of anti-primary specific ultra-small (<1.4 nm) NANOGOLD reagent (Nanoprobes, Yaphank, NY, USA) diluted 1:2000 in 0.1% BSA in PBS for 2-4 h at RT. After PBS and deionized H ₂ 0 washes, the sections were incubated with HQ SILVER (Nanoprobes) for 8 min for silver enhancement, followed by washing in deionized H ₂ 0. [000113] For double immunolabeling, sections of the patient's testis and mouse hippocampus were first labeled with Tim50, Tim23, and StAR antibodies overnight at 4°C, followed by, incubation with primary specific NANOGOLD reagent, then enhanced with HQ SILVER. The sections were then incubated with the SCC antibody (1:2000), then primary specific NANOGOLD reagent, then enhanced with HQ SILVER. Because the HQ SILVER enhancement of the gold particles labeled with the first primary antibody was enhanced for twice as long as the gold particles labeled with the second primary antibody, two different sizes of gold particles were produced. Following a final wash, the grids were stained with 2% uranyl acetate in 70% ethanol to increase the contrast. The grids were washed with deionized ¾0 and air-dried. The large gold particles were an average of 55 nm in diameter with 90% of the gold particles being between 45-65 nm in diameter. The small gold particles were an average size of 15 nm with 90% of the gold particles being <25 nm in diameter. All sections were observed in a JEM 1230 transmission electron microscope (JEOL USA, Peabody, MA, USA) at 110 kV and imaged with an UltraScan 4000 CCD camera and First Light Digital Camera Controller (Gatan, Pleasanton, CA, USA).

RESULTS

Establishment of expression of a new protein

[000114] The conversion of testosterone to estradiol is catalyzed by endoplasmic reticulum (ER) resident enzyme cytochrome P450 aromatase is shown in FIG. 1A. To understand the factors or mechanism regulating higher estradiol production in affected patients, unaffected and affected breast tissues from the same patients as well as tumorigenic cell line, T47D, and non-tumorigenic cell line, MCF12A were selected, and the metabolic activity was measured by determining testosterone to estradiol conversion. The affected tissues and cells from both cell lines were collected and homogenized in HEPES and the cell debris was removed. The collected supernatant was incubated with both radiolabeled testosterone and androstenedione and reaction was initiated with cytochrome P450 and NADPH. The result of the metabolic conversion is shown in FIGS. IB and 1C which indicated a very high level of estradiol production in the affected breast tissue, but not in the unaffected tissue of the same person. Identical results were observed with the tumorigenic and non-tumorigenic cells, confirming the accuracy of the determination of metabolic activity in the unaffected and affected breast tissues. The experiment further suggested a specific factor or protein might be present in the unaffected breast causing the reduced activity of P450 aromatase resulting in less testosterone being converted to estradiol or alternatively a specific factor or protein being absent in the affected breast tissue resulting higher aromatase catalytic capacity generating increased synthesis of estradiol, which is an essential requirement for post-menopausal women.

[000115] Since a non-tumorigenic cell line, MCF12A showed a higher estrogen production than a tumorigenic one, T47D, it was hypothesized that aromatase may not be the only factor regulating or producing estradiol in breast tissue. To investigate factors other than aromatase for estradiol production, both unaffected and tumorigenic breast tissue specimen from females breast were collected, The tumorigenic tissue samples were divided into three groups; ER ⁺ /PR ⁺ /Her ^2~ ; ER7PR7Her ²⁺ ; and triple negative. P450 aromatase is an endoplasmic reticulum protein so the endoplasmic reticulum from all these patients were isolated and differential expression using mass spectrometry of the isolated endoplasmic reticulum was performed and analyzed through LC-MS/MS on a nanoAcquity UPLC coupled with a Q-TOF- Premier Mass Spectrometer. Two specific peptides, LEVVVDQPMERL (SEQ ID NO:3) and LYEELVER (SEQ ID NO:4) were found, which matched the sequence of StAR protein. However, this protein sequence was not observed with the tissues from any patients. Subsequently robotic technology developed by Taylor' s group (Taylor, 2002) was applied, where the gel from SDS PAGE was divided into 20 kDa fragments to identify the presence of the specific sequence. The same protein sequence was found in 3 unaffected patients below the molecular weight of 20 kDa, but the peptide sequence was absent in all 12 affected tissues.

Cloning of the full-length protein

[000116] To characterize the entire sequence for these two peptides (SEQ ID NO:3 and 4), 5' and 3'RACE from unaffected breast was performed. For 3'RACE (Rapid Amplification of cDNA ends), starting with a generic 3 '-primer called adapter primer (GGC CAC GCG TCG ACT AGT ACT TTT TTT TTT TTT TTT T, (SEQ ID NO:5)) obtained from Invitrogen/Life Technology) and prepared first cDNA strand from total RNA of unaffected breast tissue. Using first cDNA strand as the template, the second strand was amplified using primer (CTG GAG GTC GTG GTG GAC CAG CCC ATG GAG AGG CTC (SEQ ID NO:6)) and AP (FIG. ID), which generated a 600 bp fragment, and cloned into SP6 vector at the Bgl II and EcoRl sites (AGCT AGATCT ACC CTG GAG GTC GTG GTG GAC CAG CCC ATG GAG AGG CTC (SEQ ID NO:7); AGCTA GAATTC TCA ACA CCT GGC TTC AGA GGC AGG (SEQ ID NO:8)). The sequencing result showed a completely new cDNA sequence with a new early stop codon at 361 bp.

[000117] The 3 'RACE from unaffected breast proceeded to the 5 '-RACE of the unaffected breast RNA and cDNA. The cDNA was tail labelled with dCTPs and was amplified using 5 '-Abridged anchor primer (GGC CAC GCG TCG ACT AGT ACG GGI IGG GII GGG IIG (SEQ ID NO:20)) and (GAG CCT CTC CAT GGG CTG GTC CAC CAC GAC CTC CAG (SEQ ID NO: 11)) generating 450bp fragment (FIG. IE). The combined 5' and 3' RACE amplified sequence was cloned (FIG. IF), which showed a 207 amino acid sequence not present in the open reading frame (FIG. 1G). This protein was named SAM-1 for Savannah (location of the lab), Anderson (Philanthropic support) and Mercer (University support).

[000118] The SAM-1 was present in a very short form 22.2 kDa protein in the affected breast tissues and also with the tumorigenic breast cells. Thirteen of the tissues were analyzed, including seven that were ER7PR7Her ²⁺ , three that were ER ⁺ /PR ⁺ /Her ^2~ , and the three triple-negative tumors as well as two control breast tissue samples, which were obtained from the mirror image quadrant of the unaffected breast. Western blot analysis of the endoplasmic reticulum fraction showed a high level of SAM-1 expression in the control samples. However, SAM-1 was absent in the endoplasmic reticulum samples obtained from ER ⁺ /PR ⁺ /Her ^2" and ER /PR7Her ²⁺ tumors even after loading up to 20 μg of total protein.

Distribution pattern of SAM-1 Protein

[000119] To understand variation in expression of SAM-1 protein in breast tissues; ER7PR7Her ² , ER /PR /Her ^2" , ER ⁺ /PR ⁺ /Her ^2~ , and ER7PR7Her ²⁺ breast tissue samples were probed and compared with the unaffected breast tissue. The results showed that the expression in tumorigenic and non-tumorigenic tissues was similar, showing a protein migrating about 22 kDa and a smaller about 17 kDa (FIG. 1H). The expression level of aromatase in all the tissues were similar, but an increased expression of 22 kDa region was observed in the ER ⁺ /PR /Her ^2~ and ER /PR /Her ^2- patients. To confirm this observation western staining of six additional patients of -/-/- was performed revealing a higher expression level in the tumorigenic breast as compared to the unaffected breast (FIG. 1H). This observation was confirmed by determining the expression pattern in non-tumorigenic (MCF12A) and tumorigenic T47D cells and comparing with the monkey kidney, COS-1, cells. The result showed a very similar level of expression in both the cell types, but no expression in COS-1 cells (FIG. II).

Homology modeling

[000120] Through Blast search and homology modeling SAM-1 protein was found to only have a homology with the first 42 amino acids of StAR protein and the remaining 165 amino acids have no homology with the rest of the StAR sequence. The determined homology comparison with ClustalW program is shown in FIG. 2.

[000121] Due to SAM-1 protein having an N-terminus overlapping 15 amino acids with StAR protein, a StAR protein antibody targeting this region was applied as a SAM- 1 antibody (hereinafter merely referred to as "SAM-1 antibody") (FIG. 2). A commercially available StAR antibody raised against StAR protein from amino acids 130 to 180 (Abeam, Cambridge, MA; Product code ab203193), and thus has no overlapping region with SAM-1, was used to confirm SAM-1 recognition and to rule out the possibility of any artifact of SAM-1 antibody. Staining with the commercial StAR antibody did not recognize SAM-1 protein, whereas the applied SAM-1 antibody did recognize SAM-1.

Transcriptional regulation

[000122] To understand whether the protein was responsible for acute regulation, the non-tumorigenic MCF12A cells were stimulated with cAMP with two different concentrations of tenfold difference in concentration 0.1 and 10 mM. The incubation was continued from 4 to 12 hours to have optimum expression and determined the expression by western staining with SAM- 1 antibody. However, the result showed an unchanged expression of SAM-1 protein, suggesting that the expression was not acutely regulated (FIG. II). The calculated molecular weight was 22.2 kDa but its migration was similar to the 17-18 kDa level. A similar pattern has been observed on a prior mitochondrial translocase protein, Tom22, which migrates as a 18 kDa protein having calculated molecular weight of 22 kDa (Rajapaksha, 2016). To understand the role of transcriptional regulation of SAM-1 protein, the MCF12A cells were incubated with cyclohexamide

(CHX) for 4 and 12 hours, in the presence of tenfold difference in cAMP concentrations. Western staining showed unchanged expression (FIG. II) confirming that the newly cloned protein SAM-1 protein is not an acute regulator and might possibly be playing the role of a catalyst.

Cellular localization

[000123] Other cellular compartments were analyzed to determine if the cellular structure was compromised in general using transmission electron microscopy (EM). Analysis of the rough endoplasmic reticulum (RER) of the breast showed that its structural organization appeared normal (FIG. 3A) with ductal lobule. However, a closer look at the EM showed that the mitochondria had a significant amount of lipid close to the nucleus (FIG. 3A) with a large empty space surrounding each, which may be due to the presence of lipid vesicles a typical characteristics of breast tissues. Staining with SAM-1 antibody showed SAM-1 protein mostly localized in the endoplasmic reticulum region and a very minor localization in the mitochondria (FIGS. 3A-3C). As expected staining with ER resident cytochrome P450 aromatase showed its presence mostly in the ER region shown in FIGS. 3D and 3E, with an enlarged view is shown in FIG. 3F. This was confirmed by immuno-staining breast tissue sections with GRP78 independently (data not shown). The colocalization of the SAM-1 and aromatase in the ER was also observed in the non- tumorigenic MCF12A breast cells (FIG. 3G-3I).

Down regulation of SAM-1 in breast tumors is mediated by proteases

[000124] It has previously been observed that blocking mitochondrial VDAC1 activated cysteine proteases (Bose, 2008) resulting in the degradation of cytoplasmic StAR, but the specificity was not known. Also, preliminary results show that when the T47D cells were incubated with the different inhibitors, only 22 inhibitors from a pool of 54 serine and cysteine protease inhibitors rescued SAM-1 expression (FIG. 3J), but the kinetics of the inhibitors is currently unknown. Indicating that cysteine proteases inhibitors mediate SAM-1 degradation in breast cancer cells.

Compartmental localization of SAM-1

[000125] To understand the compartment specific location of SAM-1 organelle fractionation of the breast tissue was performed and stained with the SAM-1 antibody. The result showed (FIG. 3K, top panel) that SAM-1 is present in the ER fraction and almost no expression in the ER-associated mitochondrial membrane (MAM) fraction, but a significant portion of the SAM-1 was present in the mitochondrial fraction in many discrete bands. This was confirmed by performing similar organelle fractionation of non- tumorigenic MCF12A breast cells which showed identical results (FIG. 3K, bottom panel). These results confirm that SAM-1 is mostly localized in the ER as a full-length protein, minimally at the MAM, and is finally degraded through the mitochondria. Analysis and probing with the SAM-1 antibody showed (FIG. 3L) that a significant portion of SAM-1 was present in the peroxisome (FIG. 3L, right hand panel), confirming that SAM-1 remains at the MAM.

[000126] Analysis of unaffected breast tissue showed that all the organelles are structured (FIG. 4A) with the mitochondria having outer and inner membrane (FIG. 4A). The analysis of tumorigenic tissue (FIG. 4B) showed both the organelles of the mitochondria (FIG. 4B) and ER are enlarged/swollen (FIG. 4B right hand panel). Additionally, using NANOGOLD labeled aromatase antibody (FIG. 4C), showed no aromatase in the mitochondria (FIG. 4C), but rather localization in the ER (FIG. 4C). Similarly, labeled SAM-1 antibody showed localization primarily in the MAM region and minimally at the ER. To confirm SAM-1 and aromatase presence in tumorigenic cells, colocalization experiments with SAM-1 and aromatase antibody together was performed. As expected, SAM-1 and aromatase were primarily localized in the MAM region, but some aromatase localized in the ER (FIG. 4D), confirming that the SAM-1 is processed primarily in the MAM region and thus aromatase and SAM-1 possibly interact directly in the MAM region.

[000127] To understand the compartmental localization of tumorigenic tissues, the tissue organelles were fractionated into the ER, MAM, and mitochondrial fractions and stained. The results showed that most of the proteins were in discrete patterns in all the three organelles, with SAM-1 distributed in multiple bands in the ER (FIG. 4E) and two bands of molecular weight 22 kDa and 17 kDa present in the MAM fraction (FIG. 4E). High expression levels of SAM-1 having both high and low molecular weight was observed, with the majority of SAM-1 being present at very low molecular weight (FIG. 4E). Identical results were observed of the organelle fractions from the tumorigenic T47D (ER ⁺ /PR ⁺ /HER ^~2 ) cells stained with SAM-1 antibody confirming accuracy of localization the tumorigenic breast tissue. [000128] Large expression levels of SAM-1 was observed in the mitochondrial fractions in discrete patterns. TEM staining of specific organelles with SAM-1 (55 nm) and aromatase (15 nm) antibody independently or together, showed that a small amount of SAM-1 and aromatase was present in the peroxisome (FIG. 4F). An enlarged version clearly depicts peroxisomal localization of the antibodies, which is a cellular degradation mechanism and thus SAM- 1 and aromatase.

Role of SAM-1 in regulating aromatase activity

[000129] To understand the role of SAM-1 in regulating testosterone to estradiol conversion, aromatase activity was determined by knocking down SAM-1 expression. Synthesized siRNA was used to knockdown SAM-1 expression. Measurement of estradiol from testosterone showed that transfection with siRNA reduced SAM-1 expression significantly (FIG. 5A). A quantitative analysis showed that the 30 pmol of siRNA reduced the expression almost 80% and using 60 pmol siRNA the reduction was increased to almost 88% (FIG. 5A) in MCF12 and T47D cells. The metabolic conversion of testosterone to estradiol following incubation of 30 pmol of siRNA 1 and siRNA 2 with either MCF12A or T47D cells was determined. No appreciable metabolic conversion was observed in the absence of siRNA or addition of negative siRNA in MCF12A cells (FIG. 5B). Minimal conversion was observed in the absence of siRNA with the T47D cells (FIG. 5B). However, a significant conversion of estradiol was observed with the addition of siRNA in both MCF12A and T47D cells (FIG. 5B). A quantitative analysis showed in the absence of siRNA the synthesis was about 11 ng/ml, and following incubation with negative siRNA 7 ng/ml estradiol was synthesized in T47D cells (FIG. 5C). However the estradiol conversion was increased to 44 ng/ml with the addition of siRNA. Under identical conditions following incubation of siRNA the MCF12A synthesized about 19ng/ml estradiol (FIG. 5D). The reduction in SAM-1 expression increased estradiol synthesis in both the tumorigenic and non-tumorigenic cells. Western blot results showed a very limited difference in aromatase expression between the MCF12A and T47D cells (FIG. 5D). A further quantitative analysis showed minimal difference in expression of aromatase (FIG. 5E). The presence of SAM-1 reduced estradiol conversion, while aromatase levels remained the same. Inter action between SAM-1 and aromatase

[000130] To understand the reason for increase in aromatase activity due to the reduction in expression of SAM-1 protein-protein interaction by co-immunoprecipitation, followed by independent staining with SAM-1 and aromatase antibodies, was determined. Co-immunoprecipitation of the tumorigenic cells pulling with SAM-1, Aromatase, VDAC2, rat IgG and COX IV antibodies, followed by staining with SAM-1 (FIG. 6A) showed a 22 kDa protein being pulled down, but not the COX IV, VDAC2, or rat IgG. Similarly, aromatase (FIG. 6B) antibody bound to a 57 kDa protein but not the COX IV, rat IgG, or VDAC2. These results are consistent with SAM-1 and aromatase interacting with each other.

REFERENCES

1. Bocchinfuso, W. P. (1999). A mouse mammary tumor virus-Wnt-1 transgene induces mammary gland hyperplasia and tumorigenesis in mice lacking estrogen receptor-a. Cancer Res. , 59: 1869-1876.

2. Bose, M. e. (2008). Steroidogenic activity of StAR requires contact with mitochondrial VDAC1 and phosphate carrier protein. /. Biol. Chem. , 283: 8837- 45.

3. Fisher, E. R. (1977). Lobular carcinoma of the breast: an overview. Ann. Surg. , 185: 377-385.

4. Friedman, E. B. (2013). Screening prior to Breast CancerDiagnosis: The More Things Change, the More They Stay the Same. . Int. J. Breast Cancer, 327567.

5. Henderson, B. E. (1988). Estrogens as a cause of human cancer: the Richard and Hilda Rosenthal Foundation award lecture . Cancer Res. , 48: 246-253.

6. Miller, W. L. (2011). The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. , 32: 81-151.

7. Prasad, M. e. (2015). Mitochondria-associated endoplasmic reticulum membrane (MAM) regulates steroidogenic activity via steroidogenic acute regulatory protein (StAR)-voltage-dependent anion channel 2 (VDAC2) interaction. /. Biol. Chem. , 290: 2604-16. Rajapaksha, M. J. (2016). An outer mitochondrial translocase, TOM22, is crucial for inner mitochondrial steroidogenic regulation in adrenal and gonadal tissues. Mol. Cell Biol, 36: 1032-47.

Santen, R. J. (2015). Estrogen metabolites and breast cancer. Steroids, 99: 61-66. Simpson, E. R. (1994). Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr. Rev., 15: 342-355.

Simpson, E. R. (2002). Aromatase - a brief overview. Annu. Rev. Physiol , 64: 93- 127.

Taylor, S. W. (2002). An alternative strategy to determine the mitochondrial protepme using sucrose gradient fractionation and ID PAGE on purified heart mitochondria. /. Proteome Res., 5: 451-58.

Walter, P. e. (1981). Translocation of proteins acrosss the endoplasmic reticulum I. Signal recognition protein (SRP) binds to in-vitro assembled polysomes synthesizing secretory protein. /. Cell Biol, 91: 545-50.