SEX-SPECIFIC REGULATION OF AGING AND APOPTOSIS

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND

DEVELOPMENT

[0001] The present invention is made, at least in part, with the support of grants from. Department of Health and Human Services (AGl 1833, AG 11644). The government has certain rights in the invention.

CROSS-REFERENCE TO REIATED APPLICATIONS

[0002} This application claims an invention which was disclosed in

Provisional Application. Number 60/811,899 filed June 7, 2006, entitled "SEX-SPEOTFIO REGULATION OF AGING AND APOPTOSIS". The benefit under 35 USC §119(e) of the United States provisional application is hereby claimed. The above priority applications are hereby incorporated herein by reference. .

SEQXJENCB LISTING [0003] The present invention contains sequence listing.

FIELD OF THE INVENTION

[0004] The invention pertains to the field of senescence and evolution. More particularly, the invention provides mechanism, for sex-specific regulation of aging and apoptosis.

BACKGROUND OF THE INVENTION

[0005] Recent and classic observations suggest that the initochondria has an important, and ancient role in. dθtevrnining the distinction between gβvxnr line and soma, as well as sexual identity. In this regard, the fact that the

mitochondria genome is asymmetrioally inherited ift perhaps THE defining feature of the oocyte.

[0006] The asymmetric inheritance feature of mitochondrial genes ond sex chromosome gensβ promotes the evolution of sexually antagonistic gene functions (i.e. compromised gene function in one sex or both). The present invention is based on the premises that such genes will contribute preferentially to the aging phenotype.

SUMMARY OF THE EMVENTION

[0007] Genetic analysis of Drosophiln. mice and humans indicates that gene alleles, mutations and transgenes that affect life span tend to have different effects in an organism depending on the sex of the organism. The likely reason for this is that the sexes have different genotypes (e.g., ^" KJX. vs. X/Y) and face quite different environmental pressures (e.g., to reproduce, naαlefe have to mate with females and vice versa, but mate selection criteria for each sex may ^" be very different). That is to say, genes are subject to different genetic interactions and different gene-byenvironment effects in males than in females. The consequence is that through evolution certain genes are differentially selected and optimized for one ββx over the other. The mitOchondi'ial genome and the X chromosome are such differentially selected genes.

[0008] Both tliβ mitochondrial gβnoirte* and tiiβ X du'omosome are asymmetrically inherited in Drosophila and mammals . Through evolution, the mitochondrial spend relatively more time under selection in females and are therefore expected to be better optimized for function in the female than in the male. This hypothesis is supported by the fact that the DrasopJuIa X cthrαmαsom© ie A kotepot for β«x.unlly antagonistic fitnees vniάntion.

[0009] In. terms of the aging phenotype, £ ⁾ ra<topMIa and mairmialft femalets tend to Kve longer than males. This may be due in part to sub-optimal Mitochondrial function in males. One finds evidence for this hypothesis in the observation that old DrosqpMIa and old mammals exhibit apoptosis — an observation that is consistent with the idea that mitochondria are less functional during aging due to maternal -only inheritance.

[0010] Together, these data support the conclusion that a significant part of the aging phenotype is due to antagonistic pleiotropy of gene function ^" between the sexes.

[0011] With these considerations, the inventor of the present has devised a molecular model which describes the co 'regulation of sex determination, apoptosis and life span based on the on/off status of a single gene ^: SxI in Drosophjln xnelanogastev and Xist in humans (exemplary sequence of SxI is provided in SEQ ID^l ^• 2, and Xist in SEQ ID 3). In accordance with on this model, the present invention provides methods and products for utilizing the of/off mechanism in a subject to effect on aging related change in a subject.

[0012] In particular, one object of the present invention is to provide anti- apoptotic agents and therapies involving human Xist gene. Xist BNA. Xist gene product, antagonists of the above*mentioned nucleic acids and proteins, and small molecule minήcs of the above-mentioned nucleic acids and proteins. Another object of the present invention is to provide prophylαotio αuti-aging agents and therapies involving human Xist gene, Xist RNA ₁ Xist gene product, antagonists of the above-mentioned nucleic adds and proteins, and small molecule mimics of the above 'mentioned nucleic acids and proteins.

[0013] A further object of the invention relates to the u«e of the finite half -life gene segregation mechanism to produce in vitro evolution of genes and the directed evolution of genes with desired properties.

[0014] The above-mentioned and other features of this invention and the manner of obtaining and using them will become more apparent, and will be best understood, by reference to the following description, token in conjunction with the accompanying drawings. The drawings depict only typical embodiments of the invention and do not therefore limit its scope.

BRIEF DESCRIPTION OP THE DRAWINGS

[0015] Figure 1 Asymmetric segregation of the X and Y ohromosome and mitochond ^r ial genome CM). Drosophila and human males in generation 1 do not pass mitochondrial genes QV-D on to their offspring in generation 2, rather these gex-.ee coins n-om the female parent- (maternal inheritance) . Asymmetric segregation or maternal inheritance of the mitochondrial genome means the female gamete or egg contributes the functional mitochon<b.'ial genomes to the embryo while the male gamete or sperm does not. A, autosomes* M, mitochondrial genomes. SQ = Switch Gene and Sex- deterjoadnation Qβnβ..

[0016] Figure 2 Identification of dIAP2 mutation life span extension in male

Drosophila. (A) Diagram of PcIL insertion in the dIAPS gene. (B) dIAP2 mutation effect- on life span relative to Oregon R WT control chromosome. Survival curve for mole flies of control genotype y ac w ', + /+ \ ι>tTA(3)E2 /+ and experimental genotype yea w \ PdLdIAPS /4- ; rtTA (3)E2}λ- passaged on food containing βOμg/ml doxyoyeline from day 4 onwards, data re-plotted from (Landis, Bholβ et al. 2003). dIAJP2 mutant mean Me span = 84.S05 dnyo, variance = 265.367, Std. DθV. = lβ.200, St. Err. = 1.182. Or-R control #2 mean life span = 72.457 days, variance = 286.086, Std. DθV. = 16.914, St.

EiT. = 1.247. Mftan Difference = 11.849. impaired, two-sided t-teftt P < .0001. percent change = 100*(84.3-72.45)/72.45 = +16%.

[0017] Figure 3 Diagram of Drosophila dosage compensation and sex determination.

[0018] Figure 4 Diagram of human dosage compensation and proposed sex determination.

[0019] Figure 5 Iuvaaion of tins eukaryotie coll by the tt-itockoaclria. When the mitocliontlria (M) invaded the eukaryotic cell it created competition for inheritance between the mitochondria and the nucleus (N). The only way the M could be maintained is if it provided some advantage to the cell. In turn, the only way M could be maintained as an entity separate from N is to have a finite half life, i.e., ^" be lost at some rate by segregation or apoptosis ^■ this is the same thing as asymmetric segregation. The simplest way to accomplish this is two states in N, one state that prevents M lose, and one that does not.

[0020] Figure β Genes and replicators. Gene A encodes a single-subunit replicator that replicates gene A. A perfectly identical and symmetric copy of gene A has no selective advantage because it encodes the same replicator (by definition). One way a second gene B (such as an imperfect copy of A) can be maintained as a separate entity iβ if it has a shorter half-life than A (i.e., is lost at some rate). By definition, this creates two states for A' A alone and A+J9,* which is the same thing as asymmetric segregation. To be maintained A+Jθτxmst encode a better replicator ⁽ i.e.. have greater fitness).

[0021] Figure 7 Summary of Drosophila p53 gene and genetic alterations and life span effects. (A) Summary of p53 genetic effects on adult life span. (B) Diagram oipδS gene mutations and transgenic constructs.

[0022] Figure 8 Effect of p5B mutations on life span. CA). L cohort female survivals. (B). L cohort male survivals. (C). 100% oxygen survival. (D). Ionizing radiation survival.

[0023] FififUϊθ 9 Conditional over "expression of wild-type and dominant- mutant p53 transgenes and Baculovirus p<35 transgenes using Geneswitch system. A-E. p53 transgene over "expression and controls . E"H. Baculovims p35 over -expression and controls.

[0024] Figure 10 Diagram of transgenic constructs. CA) The "Tet-on" conditional transgene expression system. The rtTλ transgenic construct (or "driver") contains the tdssxie-general actiaδOjivoτaot-ev driving expression of the artificial transcription factor rtTA. The target constructs were generated by cloning the indicated cDNA fragments downstream of the DOX-inducible promoter in the USO 1.0 vector. The rtTA protein will bind to the 7 Tet-O sites in the target construct promoter and activate transcription only in the presence of DOX, (B) Diagram of the sequence and reading frames of the hUbbWT and hUbb ⁺ⁱ constructs. The number 1 indicates the A of the normal ATG start codon for translation of hUbbWT. Note that any translation framed from position 2 (the T of the ATG start eodoni or +1 reading frame) can produce the antigenic peptide (indicated by red asterisk), followed- by a stop codon at position 41. The amino acid sequence of the peptide used to generate the hϊTbb+1 antibody is indicated. (C) Diagram of the sequence and reading frames of the hAppWT and hApp ⁺¹ constructs. The QAGAG hotspot is located in hApp exon 9. The amino acid sequence of the peptide used to generate the hApp ⁺¹ antibody is indicated. The fcransgenio strains are given names designed to be informative, and include the name of the inserted con&truot (e.g., hUbbWT or h ^" Ubb ⁺¹ ), the chromosome of insertion in parentheses (e.g., chromosome 2 or 3 or X). and a unique number indicating the independent insertion event. For example,

hUbbWT(2)[118] ift an insertion, of the hT.TbbWT construct on the second chromosome, independent insertion event designated "118".

[0025] Figure 11 Northern and Western analysis of conditional transgene expression. Flies of the indicated genotypes were cultured for one week on food supplemented +/• DOX, as indicated. A-C Northern analysis. Total RNA was isolated from 30 flies, quantified by spectrophotometer, and δμg (IX) and lOμg (2X) amounts were loaded for each sample. The resultant blot was hybridized with the indicated gene-specific probes. A. Control flies and hUbbWT transgenic fly strains. B. hAppWT transgenic fly strains. C. hUbb ⁺¹ transgenic fly strain. D, E. Western analysis. Total protein was isolated from 30 male flies, diluted as indicated, fractionated using SDS- PAGE and Western blotted. D. Control and hUbbWT transgenic strain fly protein incubated with, antibody specific for hUbb. B. Control and transgenic strain fly protein incubated with antibody specific for hApp.

[0026] Figure 12 Western blot analysis using antibody specific for hUbb* ¹ .

Total protein was isolated from 30 male flies of the indicated genotypes, and 1/8 of the sample was ..assayed for the presence of protein that would be recognized by hITbb ⁺¹ antibody. Where indicated protein samples were diluted V2. V3. VQ or 1^10 to confirm sensitivity of the assay to relative protein concentrations. In panels B-P all samples ore diluted VB. A. Molecular weight markers were run alongside His "tagged hUbb ⁺¹ purified from E. coli cells as well as total protein isolated from 30 "young" (10 day old) and "old" (65 day old) male Or-E control flies, as indicated. B. υovmg" (10 day old) files of the indicated genotypes. O. Mies cultured + ^• / ^■ DOX for 26 days. D. Flies cultured +/ ^• DOX for 48 days. E. Flies cultured +/ ^■ DOX for G7 days. F. Hies cultured +/ ^■ DOX for 82 days. Where visible the gel protein front. (F) is also indicated. Solid arrowheads indioate two species of <20Kd. either of which might represent Ubb ⁺¹ monomer, which has an expected size

of ~HKd. Open arrowhead indicates ρpeeie« at expected position for TTbb ⁺¹ ligαted to one Ubb wild-type protein (~HKd + ~8.5Kd = ~19.6Kd). Single asterisk indicates species at expected position for IJbb ⁺¹ ligated to two ITbb proteins (^l IKd + ~17Kd = ~28Kd). Double asterisk indicates .species at expected position for Ubb+1 ligated to three ITbb proteins (~HKd + ~25,SKd =3 ~37Kd). Estimations of sizes of various species are presented in Supplemental Materials. Figure 13 Western blot analysis using antibody specific for hApp ⁺¹ .

Total protein was isolated from 30 flies of the indicated genotypes, and assayed for the presence of protein that would be recognized by hApp ⁺¹ antibody; "young" is 10 days old and "old" is 65 days old. A. Molecular weight markers were run alongside His-tagged hApp ⁺¹ purified from E calx cells, as well as the indicated dilutions of total protein isolated from flies in which the hApp ⁺¹ transgenic construct was expressed. B. Purified His- tagged hApp ⁺¹ protein from E. coli was run alongside protein from young and old Or-R control flies. C. Flies cultured +/ ^• DOX for 26 days. D. Flies cultured +/ ^■ DOX for 48 days.

Figure 14 Phenotypes of hUbb and hUbb+1 over-expression. A. Frequency of adult- flies of the indicated genotypes emerging from crosses where larval development was allowed to occur in the presence and absence of DOX. as indicated. In these experiments a threetransgene configuration was used to achieve tissue-general, DOX'dependent expression. The daughterless-Gal4 driver (Da-Gal4) yields tissue general expression of the yeast transcription factor Gal4, The Gal4 protein activates expression of the "901" bridge construct encoding rtTA[M2alt] under the control of a UAS- promoter. In the presence of DOX, the rt-TA will bind to the TetO sites in the target construct and activate expression of the tranegβne. Therefore DOX-dependent transgene expression can occur only in progeny that inherit

3

all three constructs (blue bars). In the croeeeft to either Ox-R wild-type or w[1118] flies, the target construct chromosome is replaced by a wild-type chromosome, thereby controlling for the effects of DOX itself. Arrows indicated reduced frequency of hUbbWT- expressing flies emerging due to DOX-dependent pupal lethality. B. Examples of pupal-lethal phenotype resulting from hITbbWT(70) transgenic line cultured +/ ^■ DOX, as indicated. C-F. Life span assays. Flies containing the indicated target construct insertions along with the Da-Gal4 driver and "UUl" bridge construct, as well as controls were generated as described above (A). The survival of flies of the indicated genotypes was assayed +λ DOX, as indicated. The Or-B control data and w[1118] control data is the same in each panesl.

[0029] Figure IS Transgenic Control-GFP reporter and MM-GFP reporter. A.

Diagram of the Confcrol-GFP and MM-QFP reporters, B. Flies containing the Control* QFP reporter and i'ύTλ(a?J£!& dxϊvev cultured for one week +/ ^• DOX. as indicated. C. Flies containing the indicated MM-GFP reporter insertion and i'tTA(3)E2 driver cultured +DOX were irradiated as 4-day old adults, or transferred to 100% oxygen atmosphere, and then photographed at the indicated number of days after treatment. Shown for each fly are an overlay of visible and GFP images, as well as the corresponding GFP image alone.

DETAILED DESCRIPTION

[0030] As set forth above, it is an unexpected discovery of the present invention that there exist an on/off switch mechanism at the genθtiσ/mσlθσvd.cii ^% level for oontx _' olliαfr the life span o£ an organism. In particular, it is an discovery of the present invention that the Xist gene in humans and tJie SxI gene in Dϊosophilα act as regulators for apoptosis and life span in the respective organism. In accordance with the discoveries of the present invention, there are provided methods for altering the aging

process and for treating aging related diseases by manipulating the genes and gene products of these two genes and their respective host organisms .

[0031J While not intending to be limiting in any way, the following theoretical discussion is provided to further facilitate a complete understanding and appreciation, of the present invention and its ramifications.

1. Aging and life span

[0032] Aging- in living ¹ orgαnism? is rnoro correctly termed senescence, and is generally described as a oumulative, irreversible process resulting in decreased function and increased risk of death. Aging of some kind appears to affect all living organisms, from bacteria to humans (Ackermann, Stearns et al., 2003; Stewart, Madden et al.. 2005). How long an individual lives — its life span — is churuuteristiu of different species (Finuh, 19θ0) (e.g. Di'osopMln can live 100 days, humans can live 100 years). Within each species, life span is typically quit© variable — even among individtiαls who are nearly genetically identical. Comparisons of life spans between groups are therefore often reported as mean and maximum life spans for the group or eoliαrt.

[0033] The characteristic life spans of different species, and the variable life spans of individuals within a species are determined by how their unique genetic inoke-ups and ©nviror-nients make them more or less s-usceptable to these mortality mechanisms. For example, in cold-blooded (poiltilothermic) animals like Orosophila, life span scales with temperature across a broad range in both sexes. This suggests that there is an irreversible, cumulative damage that leads to increased risk of death of the organism. In addition, certain interventions such. a» dietai.'y restriction CDR) CM&ir, Goymer et al., 2003; Partridge, Pletohev et al., 2005) or a inild heat stress (Tatar, Khazaeli et al., 1997) can cause a rapid and reversible shift in a population from a

higher mortality rate to a lower one, which. demonstrates that there are more acute mechanisms for regulating survival. Although the molecular nature of these mortality mechanisms is unknown, oxidative stress, hydrolytio stress _t and toxic metabolite stress have each been implicated (Busuttil, Rubio et al., 2003; HθMmi and G\ιarente, 2003! Gems and McElwβfc. 2005; Landifi and Tower. 200f>; Wallace, 2005).

2. Evolutionary theories of aging

[0034] Lake all things biological, aging and life span are shaped by genes and evolution (Kirkwood and Austad. 2000). It is now common understanding that deleterious mutations may be efficiently removed from the population through, natural selection. However, a mutation that causes a problem only at late ages is not efficiently removed. For example, a human gene allele that- predisposes individuals to Alzheimer's or Parkinson's tliseasβ is not efficiently removed from the population because by the time the disease v> manifested the gene has usually already been passed on to the next- generation (Finch and Sapolsky, 1999). The idea that such Inte ^r acting mutations accumulate in the genome and create the aging phenotype constitutes the "mutation accumulation" theory of aging.

[0035] The "antagonistic pleiotropy" model, on the other hand, siiggests that gene alleles with lαte-αcting deleterioxis effects are maintained in the population by active selection because these same gene alleles have benefits duringf the developmental and/or reproductive stages.

[0036] Significant experimental evidence exists in support, of both mechanisms (Hughes and Reynolds, 2005). For example, the life span of Di'osopkila eon be increased in the laboratory by selecting? populations for late-life reproduction (Lucldnbill, Arlting et al., 19841 Rose, 1984J Rauser, Tierney βt al., 2006).

H

3. Asymmetric gene iπiieritεuicθ

ϊ0037J Antagonistic pleioti'opy, as described above, refers to gene alleles that are beneficial, at an early age and deleterious at a late age. Another type of antagonistic pleiotropy is between the sexes (e.g. a gene allele that benefits one sex of the species can be relatively deleterious to the other sex) (Rice, 1992; Bice, 19985 Chippindale, Gibson et al., 2001). This is possible because the sexes have different genotypes (e.g., X/X vs. X/Y), different environments (e.g., unique genital tract microbial fauna) and different selective pressures (e.g.. childbirth). These sexually antagonistic εenes are expected to be more likely to contribute to the aging phenotype. That is, all other things being equal, a gene allele optimized for function in both sexes is less likely to cause a problem during aging than a gene allele that functions sub ^* optimally in one or both sexes.

[0038] For example, the Y chromosome and the X chromosome are asymmetrically inherited in both Drosoplizla and humans. In both species, females are genotype X/X and males are X/Y (Figure 1). These two genomes may be differentially optimized for each of the sexes and have different conti-ibutions to the aging phenotype.

[0039] Let's first consider the Y chromosome. Since the Y chromosome is inherited only through the male, it means that genes on the Y chromosome are optimized for function only in males. Evidence for the better fitness of Y to the male sex is found in the fact that genes on the Y chromosome are generally involved in male-specific functions such as spermatogenesis and male sexual differentiation (Charlesworth and Charlesworth, 2005).

[0040] In. contrast, the X du.-oinosoin.e exists in both the male and the female.

However, because females have two copies of the X chromosomes, it follows that females have two copies of each gene on the X chromosome whereas

males only have on© copy. Thi« means that through ©volution, genea on. the X chromosome spend more time under selection in females than they do in males. The difference in evolutionary time exposure in the two sexes suggests that there might be some skew in the distribution of genes with sβx'specific functions between the X chromosome and the autosomes.

[0041] Data from the genome projects appear to support this hypothesis. For example, in Orosophila, the X chromosome is about half the size of the 2nd and 3rd chromosomes (the estimated number of genes on the X is about 2309 (~16%). about 5688 (~40%) on the 2nd. and about 6302 Cor 44%) on the third, out of a total of about 14384. On the Drosophiln X chromosome, genes Involved in oogenesis appear to be over -represented whereas genes involved in spermatogenesis are under'represented, as might be expected for a chromosome better optimized for the female (Table 1).

[0042] The same skew exists for genes showing femalebiαsed or male -biased expression at the RNA level (Arbeitman, Furlong et αl., 2002; Parisi, Nuttall et al., 2003; Oliver and Parisi, 20041 Pariβi, Nuttall &t aL, 2004). In adilition. the X chromosome was also found to be a hotspot for sexually antagonistic fitness variation, i.e., naturally occιuτing X chromosomes often contain, gene alleles that benefit one sex more than the other in terms of traits like male reproductive success and female fecundity (Gibson. Chippindale et al. , 2002).

4. Mitochondrial asymmetric inheritance

[0043] Because mitochondria are asymmetrically inherited (maternal inheritance only), the force of natural selection acting on the mitochondrial genome Cmito genome or M) and the mitogeuome-r-uclθα-.- genome interactions is effective only in females (Figure 1) (Rand, Clark et αl., 2001; Rand, 2005; Rand, Fry et al., 2006). In other wordβ, the mitochondrial

genome ift optimized for function, in the female. The male IA inherently less fit because the highly beneficial mitochondrial genome is not optimized for his genome. Aa set forth above, this asymmetric fitness of the X genome will contribute to the observed aging phenotype, and perhaps do so more in males than females. This is one possible explanation for the observation that in many species, indudiag DvosopkUa and humans, males tend to have shorter life spans than females.

[00441 At the genome level, it was found that- genes involved in general mitoohondrial function were fairly evenly distributed (17% vs. 36% and 47%. respectively, ' Table 1). However it is interesting to note that genes involved in programmed cell death are reduced in abundance on the X chromosome, especially genes with onti-apoptotic function. Out of the 28 genes involved in programmed cell death, found on the X chromosome (Table 2), pro- apoptotic functions outnumber antrαpoptotie functions 26 vs. 3. The observation that (anti)apoptotic genes ore preferentially located on the autosomes (like spermatogenesis genes) suggests some degree of sexual antagonism with regard to apoptoeis regulation.

.5. Apoptosis

[0045] Apoptosis is a form of active cellular suicide involving characteristic morphological changes such as membrane blebbing. It functions to remove cells that- are otherwise unwanted, such aβ in the developmental sculpting of hτuxuui fingers and Droaophxla gut, or dangerous, such as virnlly "infected cells (Baehi-ecke, 2002; Baehreeke, 2003,' Caβhio. Lee et at.. 2005; Yin and Thummel. 2005).

[0046] An evolutionoxάly-conserved set- of cysteine proteases called the caspases carry out most of the cellular self-destruction (Abraham and Shaham, 2004). The oaspases exist in α relatively inactive state in virtually

all cells of eukaryotes where they are regulated by a balance of κpeoifi.o activators and inhibitors. The mitodhondria regulate apoptosis by releasing cytochrome C and other pro-apoptotio factors into the cytosol in response to various "death signals" (Adams, 2003) . These signals include nuclear DNA damage, pδ3 activation and the balance of Bel-family member activities. The released cytochrome O binds to Apaf'l protein which promotes assembly of a multiprotein complex colled the apoptoβome and activates the initiator caspαse-y and a "caspase cascade" (Adorns and Cory, 20025 Arama, Bader et al _M 2005).

[0047] Since apoptosis is essential to the development and function of both male and female animals, both sexes must be capable of regulating a basic cellular apoptotic machinery. β. The mitochondria and apoptosis in gametogenesiβ

[0048] Mitochondria play a central role in the differentiation of the gametes in Drosophil-a and other species. Mitochondrial rBNA appears to be an essential component of the germ plasm — the maternal, cytoplasmic determinant o£ germ-veil fate (Axnilεura, θuto et al., 2006! Kobαyashi, Sato et al., 2005).

[0049] During Dx'osopMIa oogenesis, ribosomal RNAs encoded by the mitochomlriα ore transported out ό£ the mitochondria into the cytosol o£ the oocyte where they are required for formation of the morphologically distinct germ plasm. The cells that inherit the germ plasm during the development of (male or female) embryos give rise to the germ cells in the adult. This is consistent ^, with an ancient role for the mitochondria in the evolution of sexual differentiation and germ'line/soma distinctions.

[0050] The observation that mitochondrial genes are almost never inherited through the male means one or both of two things (Nishimurα. Yoshinori et

al., 200β): (i) There exista a male-ftpecifiei for destruction of functional imtochondrial genomes, or (ϋ) the mitochondrial genomes that are delivered to the oocyte from sperm are non-viable in the oooyte or embryo envii'onment. In either event we can state that there is a female* specific mechanism for mitochondrial inheritance, and males either lack or for Borne other reason do not express this mechanism (Fi&ure 1).

[0051] The dramatic behavior of mitochondria in germ cello offers some clues to the underlying molecular mechanisms. For example, oogenesis in many species is characterized by a morphologically distinct aggregate of mitochondria and other cytoplasmic material called the Baϊbiani body (Kloe, Bilineki et al.. 2004; WiIk, Biltneki et al., 2000). During development, Di'osophiln oocyte is connected to its sister gernvline cyst cells via cytoplasmic bridges, and the Balbiani body and a specialized actin structure colled the fusome mediate early movement of mitochondria into the oocyte (Cox and Spradliαg. 2003). It may be that only this early population of oocyte mitochondria is incorporated into the germ plasm to be inherited by the next generation.

[0052] Later the oyst cells dump more mitochondria into the oocyte cytoplasm pilor to — or coincident ^, with — undergoing a form of programmed cell death (Buszczak and Cooley, 2000). Subsequently a significant number of oocytes and eggs may be destroyed and reabsorbed in the Drosophila ovary, in a process modulated by insulin -like signalinsr (Drummond-Barbosa and Spradling, 20015 Flatt, Tu et al., 2005).

[0053] Germ-line cysts, mitochondrial transport mechanisms and multiple αpoptoticlike processes also appear to function in mammalian oogenesis (Pepling and Spradling, 2001» Hvissein, 200G). La adult mammals, most female gerni cells are destroyed prior to fertilization in an apoptosis-like process colled atresia. It has been hypothesized that atresia is one

mechanism to remove oocytes carrying mutant mitochondria and thereby ensure the inheritance of functional mitochondria by the next generation (Kiakauer and Mira, 1999).

[0054] In auznmaiT. female inheritance of mitochondrial genomes appears to be acoompliehed by active transport and concentration of (probably a subset) of mitochondria into the oooyte, and perhaps the destruction of cells containing unwanted mitoαhontlria.

[0055] La the male germ line the mitochondria undergo a series of dramatic transformations linked to the morphological development of the sperm, and ultimately give riβe to highly derivative structures containing only a small fraction of the starting mitochondrial DNA (e.g., the mammalian sperm midpieee and the insect sperm, "nebenkern"). In DrosopJnJa an apoptosis- like process has been found to be essential for normal sperm development, in particular the spermatid individualizatlon step in which most of the cytoplasm and the majority of the mitochondria are eliminated from the developing spermatids (Fabrizio, Hame et- al., 1998 J Arama, Agapite et al., 2003; Arama, Bader et al., 2003; Casbio, Lee et al., 2005).

[0056] As a further hint for the underlying molecular mechanism, ectopic expression of the baculovirus caspase-mhibitor gene pS3 in the testes, or mutation of the Drosophilα homologs of Cytochrome C, Apaf or Caspase'9 are found to cause severe defects in this apoptosis-like process. These essential apoptosis events are attractive as a possible mechanism for spernv specific destruction of mitochondrial genomes. In the unicellular alga C rexnhardu and the Japanese pet fish O. ltitipes, the fate of the mitochondrial DNA has been examined in detail, and in each case what little male mitochonihrial DNA makes it to the egg is actively destroyed just after fertilization. (Nishimura, Yoshiαari et al., 200β).

7. Evolution —the benefit

[0057] The asjrmmθtric niheritoiice of the M. X and Y chromosomes creates abundant opportunities for antagonistic pleioti'opy of gene function between the sexes. This sets up a situation of balanoin&r competition and selection between the male and female which is thought to benefit both because it promotes genetio diversity — sometimes called a Red Queen situation (Nowak and Sigmund, 2004). One may envision this situation as a driving force in eukaryotio evolution as follows: The male is inherently less fit because he receives an M that is not optimized for his genome. Since selection cannot act in the male to improve M gene function, it acts to improve the fit of the male genome to the M. Because of this, there is a strong selection force in. the male to select for mutation of the X so as to compensate for Ms lack of fitness — as opposed to the autosomes, which they share equally. This leads to hypermutation of the X in the malβ» Such X" linked mutations will be heterozygous in his daughters and might benefit him and his grandsons. Since the male is characterized as having suboptimol mitochondrial function, it is likely that the hypermutation of the X in the male might proceed primarily through oxidative mechanisms.

[0058] StiOng selective pressure is predicted to act on the male to make spermatogenesis and sperm sviccess as dependent upon the mitochondria as possible, e.g., motile sperm, regulated apoptosis and the elaborate morphological changes, In this way the male "forces" the female to give him as good M genes as possible. In other words, the males have created a limit to the extent to which the female can make the mitochondria sxib-optimαl for bis genome, because if she makes it worse her eggs won't get fertilized. This is the likely explanation for the fact that across species males are found to produce large numbers of sperm, all of which appear to be marginally functional. Natural selection in the male and female will act on

IS

the X and on X-autosome interactions to create ever-more distinct gameto genesis mechanisms — in order to "force" the opposite sex into providing tnβm with, as good a set of genes as possible (e.g. natural selection acts in tiie female to make oogenesis as dependent upon the X and X- autosome interactions as possible to try to force males into giving her as good (and un 'mutated) X chromosomes as possible). This dance between the male and female through time drives the evolution of mulfcLcellularity and the separation of gernvline and soma. For example, natural selection acts in the male to make spermatogenesis as dependent upon the mitochondria as possible, including the elaboration of a separate and disposable soma that houses and supports spermatogenesis and is highly dependent on mitochondrial function.

[0059] The same general rules can be extended to mating choice for several species. For example female Drosophila select males based primarily on energetic (mitochondriadependent) traits — he chases her. In turn, males are predicted to select females based primarily on potential for maternal contribution (e.g., size of reproductive tissues) and X chromosome genetic diversity (e.g., odor). Consistent with this idea, X chromosome gene expression appears to be especially variable in human females (Carrel and Willard, 2005).

[0060] The evolutionary considerations set forth above may be used to make predictions as to what types of genes are more likely to exhibit antagonistic pleiotropy and be involved in limiting the life span of flies and mammals — specifically, genes controlling mitochondrial function and sex-specific functions such as gameto genesis, sex'dβterncdnation, sex-specific differentiation, behavior and metabolism.

8. Life span Quantitative trait loci (QTLs)

[0061] Quantitative trait loci (QTLP) are regioufi of the chromosome that are associated with differences in a scalable phenotype such as bristle number or life span. life span QTLs can be identified based on the general strategy of crossing a short-lived strain with a long-lived strain, deriving sub-strains of varying life span, and correlating specific chromosomal genetic markers with shorter or longer life span across strains. This strategy works quite well in organisms sxich as Drosophila, C elegans and mouse and QTLs affecting life span have been identified in several labs (Nuzhdin, Fasyulεova et al., 1997; Leips and Maclcay, 2000; Vieira, Pasyukova et al., 2000; Jackson, GaleoM et αL, 2002; Mackay, 2002; Ayyadevara, Ayyαdevarα et aL, 2003; VaLenzu&lλ, Forbes βt al., 20041 Wang, Lnzebny et αl., 2004." Hsu, Li et al., 20051 Nuzhdin, Khazaeli et αl., 2005).

[0062] One of the most striking observations from these studies is the degree of f?f»X"ftpf»oiαoity of tho QTLa — many or most of the life span QTLP identified in both Drosophila and mouse are sex-specific, and their effects can be modified by mating Gβeiwitoh and Nuzhdin, 2002). This has led. to the conclusion that antagonistic pleiotropy of gene function between sexes and developmental stages shapes life span (Vϊeira, Pasyukova et aL, 2000; Leipβ, Gilligan et aL. 200ό).

[0063] Although it is difficult to go from QTL to a specific gene, there have been some successes (De Luoa, Roshina et aL, 2003; Miller, 2005). For example the Drosophila gene DDC catalyzes the final step in the synthesis of the neurotransmitters dopamine and serotonin and affects both courtship behavior and life span.

9. Life span mutations and transgenes

[0064] A number of single-gene mutations have been identified that can increase Drosophila life span (HeIf and and Rσgina, 20035 Ford and Tower,

200β). Where tested, most of the mutations appear to affect both male and female, although there is often, a bias in effect for one sex or the other (Burger and Prσmislow. 2004).

[dϋβS] In one example, xibiquitous over 'expression of the antioxidant enzyme

Cu/ZnSOD in ωrosophϊln was found to increase life span in both male and female flies (Sun and Tower, 1099). Cu/ZnSOD is found in the cytoplasm and outer mitochondrial space in most eukaryotic cells (Landis and Tower, 200S). Using two independent huCu/ZnSOD transgenee, the preferential over-expression of human Cu/ZnSOD in DrosopMla motornewons, was also found to increase life span in males and females, (Farkes, Ella et al., 1998). Interestingly, a recent analysis of one of those huOu/ZnSOD transgenes in several long-lived genetic backgrounds found life span extension to be primarily in females (Spencer, Howell et al., 2003), This might indicate some sex bias in the mechanism of life span extension by huC/u/ZnSOD over "expression in Di'osophila niotorneiwous, or might represent a sex bias in the expression of that one particular transgene insertion.

[<Uϋl<j6J Another striking example of what could be sexually antagonistic gene function is a seminal fluid protein (produced in. the Dvosophila male) that may help his sperm compete against other male's sperm — yet at the same time shortens the life span of the mseminated female (Wolfner, 2002). The fact that genes can be expressed ha one sex but function in the other sex. either through insemination or maternal contribution to the embryo, provides ample opportunities for the evolution of sexually antagonistic gene functions.

[φHJ67J In yet another example, a conserved insuHn-like signaling pathway has been identified that negatively regulates life span in C. elegtuis,

Di'osophila and mice (Bartke and Brown-Borg, 20045 Kenyon. 2005). In

DxofuojiMIa, inhibition of the insulin-like pathway or transgenic over- expression of the target transcription factor dFOXO increases life span preferentially in females (Clancy, Gems et al., 2001; Tatar, Kopelman et al _M 2001; Hwangbo, Gersham et al., 2004). This suggests that in σ>rosopJuIa, iasuliti'likθ signaling normally limits life span more in females than in male«.

[0068] On© possible explanation for the negative-life span regulation of this pathway may be because this pathway regulates reproduction and metabolism and females invest more metabolic resources in reproduction than do males.

[0069] Dietary restriction (DR) also increases life span to α greater extent in

Di'osophiln females than it does in males (Magwere, Chapman et al., 2004). A mild stress applied early in life can sometimes increase the life span of an animal, an effect called hormesis (Cypser and Johnson, 2008). In Oϊosophila, mild heat and other hormetic stresses tend to benefit males more than females (Vieira, Pasyukova et al., 2000; Burger and Promislow, 2004).

[0070] Thθie are also a small number of interventions and genes that have been shown to increase life span in rodents (MiUer, 200S). DR increases both male and female life span, but may do so more in females (Masoro, 2005). Ames dwarf mouse, Snell dwarf mouse, and Little dwarf mouse represent mutations in the insulin-like signaling and growth hormone pathways and increase life span in both sexes, again with a preference for females (Bartke, 2005). Strikingly, in the Ames dwarf mouse, extension of life span correlates with an almost complete loss of gender dimorphism in the gene expression patterns observed in the liver (Amadox-Noguez, Zimmerman et al., 2005). This was interpreted to suggest that a reduction

in cofctly physiological investmente in reproduction, contributes to extended longevity.

[0071] Genes known to regulate human life span are rare (Perls and Terry,

2003; Martin. 2005). Importantly, a key regulator of nritoohondrial- dependent apoptosis pathways, p53, is implicated in life span regulation, in Dϊosophila, mice and humans (Tyner, Venkataohalam et al. ₍ 2002i Qaspari, Pedotti et al., 20031 Maier, Gluba et al., 2004,' Bauer, Poon et al., 2005,' van Heemst. Mooijaart et al., 20055 Gatza, Hiiikel et al.. 2006).

[0072] Regulation of life span by the msulin-lilce pathway in the hermaphrodite nematode C θlθgans correlates with levels of oxidative stress resistance (Larsen, 1993). Life span extension occurs in the adult and is mediated by a set of genes including small heat shock proteins and ones similar to the classic Phase II response involved in detoxification and exoretlon of lipophilic metabolites (Walker, White et al., 2001; Lee, Kennedy et al _M 2003J Murphy, McCarroll et al., 2003; An, Vranas et al., 2005; Gems and McElwee, 2005).

[0073] Interestingly, one o£ the major targets o£ redxicetl insτιlm.-Hls© signaling is the mitochondrial antioxidant MnSOD (Honda and Honda, 1999) — which, has been shown to be sufficient to increase life span in adult flies (Sun, Folic et al., 2002).

[0074] The ability to inhibit specific gene expression in C. elegans by simple feeding of dsBNA has allowed for genome *wide screens for negative regulators of life span, and the assessment of when during the life cycle these genes function to inhibit life span. In addition to the insulin-like signaling pathway, a major class of genes identified were ones with

> mitochondrial functions (DiUin, Hsu et al., 2002; Lee, Lee et al., 2003). The data sxiggest that α large number of mitochondrial genes. onU presumably

tlL© mitochondria itself, function during C. elegant* development to limit the life span of the subsequent adult. Taken together, the data suggest that in C. elegans the mitochondria can function during development to limit subsequent adult life span, and can function in the adult to promote life span.

[0075} So for there is no indication that these life span effects involve apoptotic-lifcθ mechanisms. Virtually all experiments were done in. hermaphrodites, so few male/female comparisons are available (McCullooh and Gems. 2003).

[00761 In summary the genetic and transgenic studies clearly support a role fox* mitochondria-related genes and functions in aging and life span regulation across species, with hints of important sex ^# specMo differences. The predicted importance of other sex-specific genes and pathways is indicated by the QTL studies, but remains to be confirmed by the identification of specific genes with differing effects on male and female life span. The trends that have emerged so far ore that female life span may be inore limited by the insulin-like signaling pathway and DR, while male life span may be more limited by (oxidative) stress.

10. Oxidative stress and apoptosis in old animals

[0077] A lai'ge body of data demonβtrλtes a eori'elaticm between mitochondrial misfunction, oxidative stress and aging across species (Walter, Murasko βt al., 1998J Hekήni and Guαrente. 2003; Fridovich. 2004J Landis and Tower. 200S; Wallace, 2005). During aging, the concentration of oxidatively damaged macromolecules and abnormal mitochondria are increased and the oxidative stress-response* genes ai'e expressed, in. f-iseue-speeific patterns. These observations appear to apply generally to both males and females of Di'osophiln, rodents and humans, As specific molecular markers for apoptosis become available, it has become apparent that apoptosis is also

occurring dm-ing aging in tissue -specific patterns in DronopMln and mouse, however there has been little if any comparison of male vs. female patterns (Kujoth; Hiona et al., 2005; Zheng. Edelmαn et al., 2005).

11. Bole of apoptoβia in ϊθ&ulating life span

[0078] The observation of apoptotio events in. old animals begs the question of whether this process limits life span. Results of a genetic screen support a role for apoptosis in DrosopMla life span regulation (Figure 2).

[0079] Previously, 10,000 male flies were generated where each fly had at least one new insertion of an engineered F transposαble element called PdL (Landis, Bholβ et al., 2003). P<1L contains an outwardly directed, doxj ^r cycUneCDOX)-regulatecl promoter at its 3' end, that can chive over- expression, of u gene downstreum σf the insertion site. The longesfc-lived o£ the 10,000 male flies contained a single PdL insertion causing over* expression of dIAP2 — a known antrapoptotic caspase inhibitor with conserved function in humans (Figure 2A). One hundred and nine (109) strains were derived from the longest-lived flies and the strains were re* tested for life span in cohorts of ~400 mule flies, +/ ^• DOX. dIAP2 over- expression in the presence of DOX yielded the second-longest life span of all 109 lines and a +16% life span increase relative to the control chromosome (Figure 2B).

[0080] The dIAP2 mutation had not previously been pursued because there was only a small difference between the +DOX and -DOX life spans (Landis, Bhole et oL, 2003). It now appears that this is due to the leaky nature of the mutation and the potency of the gene product for life span effects (Yield Li and -LT., -irapubliβked observations) . A similar screen for life span- extending mutations in Di'όsopMla identified the dPOSH gene,

which may also be involved in apoptosis regulation (Aigalri, Reong et al., 2002).

[0081] As demonstrated in Example 1, the apoptosis regulators p53 and baoulovirus p35 also regulate adult JDrosopJbila life span. Finally. Seroude and coworkers have recently found that inhibiting apoptosis in DrosopJula muscle tissue by over 'expression of easpase inhibitors dIAPl or baculovirus p3δ increases both muscle function and life span (Personal commimicat-ion ^* _' Tissue-specific inhibition of apoptosis extends Dvosophila life span, J. Zheng, J. Yeimεr and L. Seroude, submitted). Taken together the data suggest that, in Drosophiln at least, apoptotic-like mechanisms aot in "tissue* and developmental stage-specific ways to regulate life span. However it- should be noted that other studies indicate that pό3 can affect Orosophila life span via a mechanism other than apoptosis {Bauer, Poon et al.. 2005). Some preliminary data suggest intriguing sex-specific differences in the way αpoptotάσ regulators affect Dvosopkila life span CWaskar et al, unpublished observations) and this shoxύd be a particularly interesting area for future research.

12. A binary switch model for sex determination, apoptosis and life span

[0082] The inventor has devised a molecular model consistent with the data and evolutionary theories using α binary switch metaphor— the on/off status of a gene that regulates mitochondrial genome maintenance.

[0083] Because the mitochondrial genome is aβymmetrically inherited, it- follows that there must exist some mechanism to ensure that the mitochondrial genomes ore inherited through the cytoplasm of the oocyte and are (almost) never inherited thxoiigli tlie sperm, αβ discussed above. It- is most likely that the asymmetuio segregation iβ accomplished by a mitochondrial inheritance system expressed in the oooyte that is not

oyn-owrfM in the evperm. i.e.. a mitochondrial inheritance syetem of the female gerπrline sex determination pathway (Figure 1).

[00841 One possible xinderlying molecular mechanism for this female-specific mitochondrial inheritance is that only the mitochondrial genoinee present in the oocyte are licensed for replication — therefore any mitochondrial genes coming in from the male would be diluted out, as appears to be the case. Similarly, the mitochondria in the oocyte could be protected by a female- specific anti-apoptotio mechanism. Mitochondria actively turn-over in many cell types. Moreover, apoptosis is reported to be the default ^, state for the mitochondria (Jones, 2000J Brookes, 2005), which means that in the absence of some antl-apoptotic signal, the mitoohondria and its genome will tend to self* destr uct.

[0085] Regardless of the precise molecular nature of the female-specific mitochondrial inheritance mechanism, it represents a mitochondrial maintenance signal downstream of the female-sex determination pathway (Figure 1), and is most simply thought of as an anti-apoptotie signal sent to the mitochondria.

[008<>] iα DrosopMlei _f it has been found that both, germ-line and somatic sex determination as well as dosage compensation are controlled by the on/off status of the SxI (Sex lethal) gene (Birchler, Pal-Bhadra et al., 2003; Graham, Penn et al., 2003; Bhadra, Bhadra et al., 2005, the entire content of which are incorporated herein by reference). Sxl-on controls female differentiation and therefore production of this theoretical anti-αpoptotic signal (Figure 3).

[0087] How then are mitochondria maintained in the male soma and in sperm precursor cells in the absence of this anti-apoptotio signal? There are two possibilities '• The _. first, and simplest, is maternal contribution of the anti-

apoptotio Aigual. The; female would deposit in the* egg enough of the anti- aiDoptotio signal to support male development and spermatogenesis, however the male is incapable of synthesizing the signal. The second possibility is expression of the antvapoptotic signal (or some compensatory signal) in the male soma and sperm precursor cells — but this requires another pathway for production of the signal and it ia not clear why the male would not utilize the same mechanism in the sperm.

[0088] The first model seems most consistent with female control over mitochondrial gene function. Perhaps the most mtϊiguing prediction of this model is that to a significant degree male mitochondrial function and life span in flies (and humans) might be determined by the amount of anti* αpoptotic signal that he inherits maternally. A number of Drosophila gen© products are maternally supplied in quantities sufficient to produce and function in the resulting adult animals — as evidenced by maternally rescued mutations (Table 3). These genes are good candidates for encoding the anti-apoptotlc signal and include SxI itself, the SxI target gene daughterless and the anti- apoptotio gene Aktl.

[0089] Interestingly, ωvosophila genes with maternally-rescued phenotypes appear enriched on the X chromosome (Table 3), and maternal -effect genes have recently been proposed to participate in sexual conflict in species using ZW sex determination (Miller, Gavrileta et al., 2006).

[0090] In. hαimαns, there exists a gene that, like Drosophilπ SxI, is on only ia females and that controls dosage compensation — the Xist gene (Figure 4) (Chow, Yen et al., 200i5, the entire content of which is incorporated herein by reference). Xist (or some other human female-specific gene) could control an analogous female -specific anti-apoptotiσ pathway for mitochondrial maintenance. The hxinian female hormone estrogen has anti-apoptotic properties and cotild be part of such α mechanism (Nilsen and Brinton,

2004'» Vina. Borraps et al., 2005). and interestingly the imtoohondrial enzyme 17-β-estradiol dehydrogenase shows up in several model organism studies of aging (Lαndis et al, submitted).

13. Why is apoptosie the default state for the mitochondria?

[0091] A variety of genes, both nuclear and mitochondrial, eo- exist in the cell to their mutual benefit and thereby optimize their survival, replication and transmission to the next generation. Genetic variation and selection are the basis for evolution as we know it. For variation and selection to occur, genes must give rise to new alleles and these alleles must in turn segregate or otherwise re-assort —i.e., come apart and re-unite in different combinations. From the point of view of any given gene in the cell (Dawldns, 1976), it is beneficial for its partners to vary, i.e., leave and return, so that natural selection can act to optimize its set of partners. The genes collaborating in the nucleus have evolved an elegant and rather egalitarian mechanism to accomplish this based on the spindle-' independent assortment and recombination. But how do the genes in the nucleus accomplish this segregation relative to the genes in the mitochondria, and vice-versa? - Natural selection has acted to create a different mechanism by which the genes in the nucleus and the genes in the mitochondria separate and reunite over evolutionary time — sex and asymmetric inheritance: In the sense of natural variation and selection, the mitochondrial genes and nuclear genes are together in the female and apart in the male.

[0092] Several observations demonstrate that the mitochondria mid mitochondrial genomee generally have a shorter functional ha If- life than does the nucleus or cell. First, initoohondria ore known to nutively turn ovm» in many non-dividing cell types (Speee, Olήott et rti.» 2OJJ(J). fføcϋttd, t\* discussed above, the male κ@rm lino initially has »#*1U with nbumlwnt functional mitochondria, but ultimately κivo* vino to colli* whale I ho

2S>

mitochondria are absent or non-functional in terms of inhe ritance. Clearly modern-day mitochondria are dependent upon the nucleus and cellular milieu for growth, and replication, but why should mitochondrial apoptosis (self-destruction) be the default state?

[0093] From the point of view of the eukaryotic female cell this may be the simplest way to control mitochondrial abundance and gene inheritance — to engineer the mitochondria with an apoptotio mechanism and ration the antidote. In other words, engineering the mitochondria with a shorter half- life and rationing a survival/growth factor. From the point of view of the mitochondria, this may be the simplest way to accomplish two things: first to be maintained hx the cell, and second, to toe maintained in the cell as an entity separate from the nucleus.

[0094] Li general, the current state of affairs can be thought of in terms of game theory as an evolutionarily stable strategy (ESS) for the cooperation of the nucleus and the mitochondria (Nowak and Sigmtind, 2004; Burt and Trivers, 2006). As is typical of many game -theory strategies for cooperation, one party (in this case the mitochondria) must sometimes leave or defect. What does leaving or defecting amount to in a biological context? Cellular apoptosis, organellar apoptosis, and asymmetric segregation (α failure to be inherited) seem to be likely mechanisms. With regard to inheritance and function, the mitochondria defects in the male.

[0095] When the mitochondria invaded the eτdεαryotiσ cell (Gray, Burger et al.. 1909; Lang. Gray et βl., 190DJ Seorey, 2003,' Timmis. Ayliffe et al.. 2004) it created competition between the nucleus and the mitochondria for inheritance, as well as the potential opportunity for mutually beneficial cooperation (Figure 6). This sets up a situation similar to a "prisoner's dilemma" in game theory (Nowak and Sigmund, 2004! Burt and Trivers,

200β): If the mitochondria always stays with the nucleus the nucleus will

absorb the mitochondria and it will cease to bf> a separate, multd-oopy entity. However, if the mitochondria sometimes leaves ^• i.β _M is lost at some finite rate, either by segregation or apoptosis ^■ the nucleus must actively maintain the mitochondria and. this allows it to remain an independent entity. In other words, shorter half-life and asymmetric inheritance for the mitochontli'ia represents an evolutionarily stable strategy (ESS) for the cooperation of the nucleus and mitochondria. The only way the mitochoncu'ia con be maintained as a separate entity from the nucleus is to have a finite half-life, i.e., be lost at some rate by segregation or apoptosis. This is the same thing as asymmetric segregation* there are two states of the nucleus, with functional mitochondria (e.g., egg) and without (e.g., sperm). This requires the existence (or drives the evolution) of two states in the nuclexis ^• one state that prevents mitochondria loss and one that does not (e.g.. Switch Gene (SG)"on/off). In other words, the powerful selective advantage of the mitochondria creates the sex determination gene and chromosome in the nucleus: A successful and continued infection by the mitaehandida would require the existence of SG-on/off to establish and maintain the ESS. Ia this model any asymmetrically inherited gene(s) with a large selective advantage flilce the mitochondrial genome) would define the female (more fit), and the male (less fit). It is possible to see X chromosome hypermutation in the male as an attempt by the male to either activate or destroy the gene (SG) that limits mitochondrial gene inheritance to the female, a process that might in turn be hypothesized to drive the dynamio deterioration and evolution of sex chromosomes (Charlesworth and Charlesworth, 2006, Graves, 2006). Consistent with this idea, the gene at the top of the sex determination pathway appeal's to mutate rapidly and change in identity often through evolution (Graham, Penn et al., 2008) (SxI in Dϊosophϊla melaaogastei; tra

• in OerntitiA capitate, and Xist in humanfi), and these genep ore predicted to exMbit antagonistic pleiotrαpy and function in regulating- life span. A change in the identity of the SG- might he a handy mechanism for speciation.

[0097J Interesting parallels can be seen between this model and what happens when a largely detrimental genome such as the intracellular parasite Wolbaαhit) pipientJs infects the Di'osopMla egg cytoplasm (Fry and Rand, 2002J Starr and Cline, 2002; Fry, Palmer et al _M 2004) — successful infection con be dependent on the particular allele of SxI.

14. Asymmetric segregation of genes aβ an evolutionary force

[0098] The general strategy of finite half-life creating asymmetric segregation cσttld be an ancient and important one in evolution. Oonsider u primσrdiwl gene A that encodes a replicator molecule that replicates gene A (Figure β). A and its product might be floating oround free in the primordial soup, or be surroxuided by the membrane of a proto"cell (Szathmary, 2000! Hogeweg and Takeuchi, 2003J Seheuring, Ozarαn et al.. 2003; Line, 2005). Another gene B could cooperate with and be linked to A (either .uovalently or by- inclusion in the same cell) btit to be selected for and maintained A+B must- have greater fitness than A alone, such as by encoding a better replicator. It is easy to see how this might work, but if A and B are always linked together they are not separate genes. How can A and B cooperate yet still exist and evolve as separate entities? As mentioned above, fox- evolution to occur, a genes' partner(s) must somehow vary as a function of time. One simple way for this to be accomplished is if gene B has a shorter half-life than A (i.e., is lost at some finite rate, i.e., ages). By definition, this creates two states for A« A by itself and A+B.

[00.99] Ia summary, a beneficial new gme with a shorter half-life by definition creates asymmetric segregation, and asymmetric segregation by definition creates increased complexity' of the system. This BSS model suggests that finite half -life (aging or senescence) is the consequence of natural selection for increased, complexity (evolution).

[00100] Is there any evidence that genes exist in such an ESS today? It is interesting to note in this regard that the gene sequences with the longest half-lives (i.e., most conserved through evolution) include many polymerases, translation components, motor molecules and transporters — perhaps representing the ancient. master replicators. In contrast, the most rapidly evolving genes include ones involved in reproduction, especially male gametogenesis (Good and Nachman, 2005! Nielsen. Buβtamante et al., 2005; Richards, Liu et txh, 200δ). It also seems possible that the DNA-end replication problem. (Olovnikov. 1973i ^* OhId, Tpurimoto et al., 2001) represents a strategy by which the (ancient) DNA polymerase gene ensures that more distal genes on the chromosome have a shorter half -life.

15. The mitochondrial apple

[00101] In Biblical history, the snake tempts Eve into eating an apple from the forbidden tree of knowledge. Adam and Eve become aware of their nakedness and in retribution God casts them out of the Garden of Eden forever. When the proto-eukaryotio female ingested the highly beneficial mitochonth'ial genome and maintained it through asymmetric inheritance, she introduced an asymmetry in fitness between the sexes. The resultant antagonistic pleiotropy of gene function between male and female helped drive the evolution of multicellularity and xiltimately self-awαreness, but came at a cost of aging phenotypes and limited Mf e span.

100102] Models for the co -evolution of sex and. asymmetric inheritance are not- new, and include, fascinating ones where sperm dynamics represent the vestiges of the movement of the mitochondria's Rickettsia "like ancestor from one cell to another (Fabrizio. Hone et al., 1998J Bazinet and Rollins, 2003; Bazinet, 2004). Space considerations preclude discussion of prokaryotic to-dαα/αntitosd-α systems «3erdes, Ohristenseu. et al.. 2005) which seem eerily similar to the systems for mitochondrial inheritance discussed here, or Honeybees — where expression of mitochondrial genes distinguishes the long-lived Queen fL'om the genetically identical short-lived workers (Corona, Hughes et al., 2005),

[00103] Apoptotio cell death Ie implicated In many human aging-related diseases, such as Alzheimer's disease and Parkinson's disease. However, apoptoβiβ has sometimes been discounted as a likely species -general mechanism of aging based on the lack of detectable apoptotio cell death in old C elθgans and the lade of effect of critical apoptosis genes such as ced-3 oaβpase on O. elegtms life span (Gailgαn, Hsu et al _M 2002; Herndon, Schineissner . et al _M 2002). The current results suggest that those conclusions should be reexamined in light of the fact that C. elegans is a hermaphrodite, and predict that- apoptosis might limit life span in O. elegans males.

[00104] It has generally been assumed that mitochondria and oxidative stress are consistently implicated in life span regulation (Fridovich. 2004) implies that- oxidative damage is inherently more toxio than the many other damages and challenges cells suffer over time. However, In light of the discovery of the present invention, the involvement of mitochondria and oxidative stress in life span regulation may be explained by the uβymmβti'iύ inherited of mitochondrial genes which venders mitochondrial fιmøtion» more prone to antagonistic pleiotropy.

[00105] Ia view of the* above, the model of the present invention provides a basis for devising method for modulating agiαg and/or treating aging related diseases such, as Alzheimer's disease, Parkinson's disease, cancer, Huntington's diseases, or any other aging related diseases known in the art.

[00106] Additionally, anti-aging pharmaceutical products may also be identified using methods of the present invention.

[00107] Last but not least, methods for in idtro evolution of genes or products, diagnostic tools, and tools for performing aging related research may also be advantageously devised.

[00108] Accordingly, in one aspect. embo(liments of the present invention provide a method for identifying a human gene sequence useful for developing εui αnti* aging pharmaceutical product or a pharmaceutical product for treating aging related disease, comprising obtaining XLst gene sequences of a population of long-living individuals! and correlating the Xist gene sequences to sex and age dependent characteristics, wherein sequences having high correlation to sex and old" age define template seqtiences for designing sεiid pharmaceutical products.

[00109] It is an unexpected discovery of the present invention that the Xist gene plays a role in regulating the life-span of an individual. Accordingly, an agent that is capable of αutivat&αgr the XLst- gene in an individual may be used as a therapeutic to prolong life or to treat aging related diseases. By correlating variations in the gene sequence to α population of long-living individuals, sequences or subsequences of the gene that are correlated to long life span may be identified.

[00110] Ih α preferred embodiment, the population for performing such a correlation analysis should consists of only individuals of age 80 and above, more preferably 100 and above. Other characteristics may also be selected

for correlation analysis . Exemplary characteristics* may include, but not limited to disease history, behavioral characteristics, or any other characteristics of interest.

[00111] Exemplary aging related diseases may include, ^" but not limited to -Alzheimer's disease, Parkinson's disease, cancer, Huntington'β disease, or any combinations thereof.

[00112] Exemplary native Xist gene sequence that may be used for the correlation analysis is as provided in SEQ ID: 3, or any other fragments thereof, alternate splicing products thereof, or any combinations thereof.

[00113J In another aspect, embodiments of the present invention provide a method for manipulating the aging process or treating an aging related disease, comprising: ^• administering a pharmaceutically active composition comprising a Xiβt RNA, alternate splice forms of the RNA, a fragment- thereof, or an analog thereof to a subject. a method in accordance with the present invention for treating aging in a subject generally comprises the steps of administering to a subject an agent capable of activating the expression o£ Xist- gene in the smbjout-.

[00114] Exemplary means of administering the pharmaceutically active agent may include, but not limited to direct inject, oral ingestion, or by way of α biological delivery vector. Exemplary vectors may he any suitable vector generally known in the art so long as it is capable of delivering the Xist gene product to a host cell.

[0011?] Bi yet another aspect, embodiments of the present invention provides a method for treating aging or aging related diseases, comprising administering to a subject an agent capable of activating the expression of Xist gene in the subject.

[©©116] Exemplary agents capable of activating the expression of the Xist gene may include, but not limited to a nucleic add, a polypeptide, a protein, a nucleic acid mimetic, a small organic molecule, or a combination thereof. Given a Xist gene sequence (as exemplified by SEQ ID' 3), the design of an agent capable of activating the gene may be achieved by molecular biology techniques commonly known in the art. La one preferred embodiment, the agent is S-azacytadine or an analog thereof.

In yet another aspect, embodiments of the present invention provides a method for in viva evolution of genes to obtain genes having desired properties, comprising^ selecting a starting set of genes with high rates sequence variation, wherein at least one gene is capable of cleaving itself at a predetermined rate? replicating the genes via in xrivo replication to evolve . the genes; and testing the properties of the genes at predetermined intervals for the desired property.

To implement finite half-life of genes for in vivo evolution of genes with desired properties, the staring gene would be engineered to both be able to replicate itself with an significant, rate of sequence variation, and to also have short half-life by being able to cleave itself at a finite rate. Alternatively the substance of whion the gene is composed would be designed to have a short half-life due to dissolving in the aqueous media, or by rapid thermal denaturation. The gene may be composed of RNA, DNA, protein, sugar/carbohydrate, lipid, or some modification or combination of those compounds. One typical example is a catalytic BNA that can both replioαte itself and cleave RNA and that contains its own recognition site for cleavage. Another example is a protein that can replicate itself, alone or in. combination with other proteins, and that can also cleave protein and that contains its own recognition site for cleavage.

[00119] Ih yet another aspect, embodiments of the present invention provides a microaviay useful for studying genetic regulation of aging, comprising- a plurality of nucleic add sequences wherein at least one sequence comprises a Xlst gene sequence, a SxI gene sequence, or a mutant thereof.

[00120] General methods for manufacturing of mieroarrays are known in the art. Mieroarrays according to embodiments of the present invention may contain specific Xist gene sequences or SxI sequences identified from sex/age population analysis such as described in the methods above. The mieroarrays may be useful both as a research tool and a clinical diagnostic tool.

[00121] To assay the specific sequence and expression pattern of various splice forms of Xist in individuals, sub -sections of Xist grene sequences can be affixed to a solid support, such as a glass slide or other material, in the form of DNA or oligonucleotide, to generate a micro-array. DNA and/or BNA samples obtained from individual patients can then be chemically labeled and hybri<lized to the micro-array to allow for rapid screening and ■ identification of the individuals Xist gene sequence and expression pattern.

[00122] Patient samples might be from blood or serum or other tissues. This should allow for rapid assessment ^, of the individuals aging rate and predisposition for specifics aging-related diseases.

[00123] In yet another exemplary embodiment, there is provided A kit useful for studying genetic regulation of aging, comprising ¹ at least one vector comprising a Xist gene sequence, a SxI gene sequence, or a mutant thereof. Similar to the mieroarrays, the kit may comprise specific Xist sequences or SxI seςiuences identified from sex/age popviltttiσn unulywis, Purthemiσre, kits according to embodiments of the present invention may also be in the

form of a library of vectors contaϋtLg Xiftt gene sequence or SxI gene sequences.

[00124] To further illustrate the present invention, the following specific examples are provided.

EX-AMPLES Example l: JDrosophila m&lanogast&r p53 acts to limit life span

[00125] The pδ3 gene encodes a transcription factor that regulates apoptosis and metabolism and is mutated in the majority of human cancers. Dvosophila contains a single p53 gene, with conserved structure, and expression of α do:miiumt-negativ© p53 isoform in nervous tisaτie hαa been shown to extend fly life span. Here analysis of multiple Drosopkilα pβ3 mutant genotypes and conditional over-expression of wild-type and dominant-mutant transgenea revealed that pS3 limits the life span of both male and female flies, but acts to do so preferentially during male development and in female adults. In contrast, wild-type p53 function favored survival of both male and female adults under stress conditions. Strikingly, over-expression of pδ3 or baoulovirua p3S during development was preferentially toxic to males, but in females produced a sub -set of flies with increased longevity. Taken together, the data demonstrate that Oϊosophiln p)53 Has developmental stage-specific and sex-apecifio effects on adult life span indicative of sexually antagonistic pleiotropy, and support, a model in which sexual selection maintains the aging phenotype in both Dϊosophila and human populations .

Experiments

[00126] To test how p53 might affect Drosophila life span, flies that had a deletion of the endogenous pδS gene were examined CPigλU. _' β 7). Various trans-heterozygous pδ3 wild-typ ^e and mutant allele combinations were

assayed for life* span simultaneously to help control for genetio background effects. Experiments were done using a dextrose'containing food that yields long life spans (L cohort), as well as on α food rich in yeast and sugar that yields shorter life spans (W cohort). In both experiments mill mutation ( ^■ / ^■ ) of the p53 gene increased male life span by about 30% relative to wild -type C+/+) controls, while heterozygous (+/ ^• ) male flies had a. smaller but significant increase (Figure 8), Life span was also increased in female pδ3 null mutant (-/ ^■ ) and heterozygous (+/ ^• ) flies relative to wild'type controls (+/+), however the effect was less dramatic on rich food. Taken together these data suggest that p58 acts at some point in the lif e cycle to limit the adult life span of both male and fenαale flies, with greater effects typically observed in males. In contrast, pό3 gene function was ftmnd to favor the survival of both male and female adult flies subjected to conditions of oxidative stress (100% oxygen atmosphere) (Figure 8C) and ionizing radiation (Figure 2D). This is consistent with previous reports that wild type piSS gene funeticm. oaa protect JXrasqphzIa tissues from ionizing radiation and ITV toxicity during development.

[00127] . ^■ • ^■ ■ To conti'ol for possible maternal effects and X chromosome effects, several life span assays were repeated with the crosses done in both directions simultaneously, i.e., varying which strain serves as mother or father for tne cross. An increase in life span of p63 null mutant (•/•) flies relative to wild-type (+/+) controls was obtained in female progeny regardless of cross direction, thereby ruling out a primary effect of maternal genotype. Strikingly the p53P mutation is a P element insertion predicted to disrupt expression of only the A isoform of p53 (Figure 7), and was associated with increased life span only in females.

[00128] The po3 protein functions as a quatramer with various protein domains mediating mtdtimerization, DNA binding and transcriptional

tϊan«a<vtivation. Mutant forms of pβS lacking function of a particular domain can have powerful dose-dependent effects that can either promote or antagonize the activity of wild-type pθ3 referred to here as dominant mutations. Several Drosophila p5S dominant mutations (M) were examined and found to have complex effects on adult life span, depending upon the particular allele, whether or not a wild-type copy o£p5S was present in the background, as well as the food composition. Some of the variability in life span across genotypes is expected to result ivoxα differences in genetic background. However, when considered as a group the dominant mutations tended to decrease life span in males, and to increase life span in females (Figure 8 A, B): Since the dominant mutations should generally' antagonize wild type p53 functions, these results are consistent with the results obtained above suggesting that pδtf acts in during male development and in adult females to limit adult fly life span. ] To confirm the effects of pδ3 on fly life span, the conditional transgenic system Geneswitch (Ford et al. 2007, the entire content of which is ^• incorporated herein by reference) was used to over-express both wild"type and mutant forms of p53. Over-expression of wild-type p53 in adult flies had a strong negative effect on life span in females, but not males (Figure 9A), In contrast, over-expression of dominant mutant pδ3 did not have a negative effect, and in fact female life span tended to be increased (Figure 9 C, D). TMs is consistent with the previous report, that over-expression of the p53 dominant allele using a non-condition system increases adult female life span. Similar effects on adult female life span were obtained uaing the FLP-out conditional system to over-express wild-type and dominant p53 transgenβs. Taken together, the over-expression data suggest that p53 acts in adult females to limit life span, with less effect observed in adult males. One possible mechanism by which pS3 might act in adults to preferentially

limit- adult female* life apan might- b& by β1±mulatinκ rnsultn/IOF-l-lilce signaling (HB), since US appears to preferentially limit life span in females of Di'osophUa and other species. Another possibility might be that p53 interacts with the dietary restriction (DR) mechanism, since DR preferentially increases female life span in Drosophila and other species. Consistent with an interaction between pδ3 genotype and DR pathway, here .the effect ^, of dominant p53 mutations was markedly different in females depending on food composition.

[00130] Almost opposite effects on adult life span were observed when p63 ti-ansgenes were expressed during larval development. Over-expression of wild-type pG3 during development was toxic to males and limited thelϊ subsequent adult life span, but had less effect on females (Figure 9). Strikingly, titration of wild'typβ p53 over -expression during female development produced some adult- females with, unusually, long life spans, demonstrating that p53 can sometimes act during female development to promote the life span of the subsequent adults. Taken together the data suggest that during development p53 acts preferentially in males to limit the survival of the subsequent adults.

{00131] One mechanism by which pi5S might act during development to affect subsequent adult life span is by regulating apoptotic pathways. As such the caspase inhibitor baculovxxus p<S5 was tested to determine if any similar effects on life span might be observed. When expressed during development the baculovii'us p35 gene was found to be preferentially toxic to males and to dramatically limit sxibsequent adult male life span, similar to the phenotypes observed with, wild-type p53 above (Figure 9). Moreover, over- expression of baculovirus p35 during female development resulted in a bi* phasio survival curve and a sub-population of female adults with increased life span, again analogous to the results obtained above with p 53. Therefore

the over-exprewdon phenotypes of p53 and the» caspase inhibitor baeulovirus pS5 during development are similar, suggesting that it may be an apoptotio pathway through which these genes act during development to affect subsequent adult longevity in a sex-specific manner.

[00132] In these experiments the p53 gene was found to favor the survival of both sexes under oxidative stress conditions, yet to act at different- developmental stages to limit the life span of both sexes under normal conditions. The female-specific longevity effect of the P element insertion in the B -variant suggests that this isoform may preferentially limit life span in females. It will be of interest in the future to determine if the A variant might correspondingly aot more to limit male life span, and to determine if these variants display any corresponding sex-specificity in expression patterns. Taken together the data are consistent with a sexual antagonistic pleiotrσpy model in which p53 functions are maintained by positive selection for survival benefit in each sex, despite having negative effects at another stage of the life cycle in the other sex.

Methods and Materials

[00133] Di'osophβa culture and life span assays were performed as previously described (Ford et al., 2007). Drosophila culture media for the W cohort life spans used an older recipe including molasses, while all other experiments used a newer recipe containing dextrose (data not shown).

[00134] ^" WlSP'Oiit strains, heat pulse protocols and life span assays are as previously described OStruhl, 1993; Basler, 1994; Sun. 2004; Sun. 2002, the entire contents of which are incorporated herein by reference). Gβneswitch strains and protocols are as previously described (Oβterwαlder, 20011 Roman, 2001; Ford, 2007). Fat Body (FB) expression driver genotype wi PiSwitύhli 'J 06 (S 1-106), and pannexu'al-expression (ELAV) driver genotype

y TT-/ +; PfELAV-GeneSwitchj (GSG3ni). RTT486 (Mifepristone, Higina) was fed to adult flies or developing larvae by adjusting the food to δOOμ/M final concentration. Jn certain experiments R1T486 concentrations were titrated as indicated. All ages are expressed as days from eclosion at 25°G. Wild- type and DN pB3 transgene stocks were obtained from Miohael Brodsky (Brodsky. 2000) and Bloomingfcon Drosopliila Stock Center. p53 mutant strains were obtained from Kent Golic and Bloomington DvosopMIn Stock Center (Xie, 2U04). PtøUS-p5»)ODM2«, p5ϋ WT, chromosome 2 WT). P{GUS-p53. Ct)AFSl, CHerminal fragment AA2SS-385, chromosome 2 (DN). P{GUSp53. Ct}B440, C-terminal fragment AA28δ-38o. chromosome 3 (DN). P{GUSpδ3.2δ9H>. AA substitixtion. chromosome 3 (DN). Df(3E)slo3 is deletion of entire pδβ gene (Null). Df(3E)Exel. P(XP-U}-Exel is «ieletάon of entire pδ3 gene (Null). pβaCSA-1-4] is 3.3kb internal deletion (DN). pβ3L\\' lB'l] point mutation introduces stop codon at nucleotide residue 211. yields 70AA truncated protein (DN). _. p&Sfl] is the [όA-1-4] 3.3kb internal deletion ill a different genetic baclcgr-mncl (DN). Varying genotypes were generated by appropriate ci'oeees to (double) balancer stocks obtained from Blooniington DvosopMIa Stock Center.

[00135] WISP- out heat stress protocol. Aere'synchiOxάzed cohorts of females of each genotype were collected and maintained at 25°O in grotips o£ 20 flies per vial. The females were subjected to heat shock at 3'7'C for 90 mi-n for either one day or two consecutive days at &ge> 5-6 days, as indicated. The females were combined with.5 young male flies (to stimulate egg production) and tα'anfiferrftd to fresh fly food vialft every other day and maintained at

Analysis

[00136] Musiinxun life spun was estimated as the πumLer o£ days -until 90% of the. cohort had died. A non-parametric Welch t-test was used to compare

the mean life ppan data between the different groups of p£>λ deletion genotypes (data not shown). Differences in the shape of survival functions and patterns of mortality were analyzed using a statistical framework described by Pletcher. Individual life spans of p53 deletion genotypes were fitted to OSomperte model: with probability density function

[00137] The parameter lambda represents demographic frailty or baseline mortality and gaxnmα represents the rate of change in mortality with age. the demographic rate of aging. To compare parameters among genotypes, variables based on the Gompertz model were estimated by maximum likelihood. To compare survivals curves, a likelihood ratio test was used: The likelihood Lo under the assumption of a common lifetime distribution is compared to the likelihood Li when two different Gompertz curves are assured. Under thø hypothesis of common lifetime distribution '2 log Lo / Li is approximately ahP— distributed with 2 degrees of freedom. Following this pi'oeedure, most j>53 deletion genotypes were found to differ from (w /+ \ + /+) controls (data not shown).

[00138] Unpaired, two-sided t-tests were used to compare mean life spans between control and treated fly cohorts. One- and two-factor ANOVAs and Welch's t-tests were used to ascertain whether pδS expression significantly uffeut-s life span and feuu-adity (data not shown).

[00139] For YlSP- out experiments mean life spans for females were compared between control and heat pulsed popxtlαtions using α two-factor fixed-effects ANOVA model with main, effects of genotype and heat pulse. FLP-σ«£over- expression of wild-type pόS had a significant negative effect ^, on mean life span (data not shown). To address FLP- out strain effects on estimated

rn.axim.um life span, nonparametrio 95% confidence intervals (CD were calculated for 90% life span foi ¹ flies in the control (noheat shock) cohorts for each strain. Wild type p«53 had [70, 78] 95% GI, AF51 had [78, 80], B440 • [80, 82], 2S9H ^■ [79, 80] and control GI was found to be [74, 76]. Each dominant, negative strain (AFSl, B440, 2S9H) exhibited CIs that do n ^; bt ovβi'lap with OI o£ control 90% suiλάval age. The 90% siu'vival age is significantly different in each dominant negative strain from control (p- value < .005) using a permutation test (data not shown) .

Example 2- Molecular misreading in DvosQphila xnelanogaatov Moleoular Misreading (MM) iβ the inaccurate conversion of genomic inforαtttαtion into aberrant proteins. For example, when BNA polymerase II transcribes a GAGAG lnotif, it sometimes synthesizes BNA with a two-base deletion. If the deletion occurs in a coding region, translation can result in production of misframed proteins. Certain misϋamed proteins increase in abundance during mammalian aging, and misframed versions of human amyloid precursor protein (hApp) and ubiquitin (hUbb) accumulate vx neurodegenerative disease tissue. Here cDNA clones encoding wild-type hApp and hUbb as well as frame-shifted versions ChITbb ⁺¹ and hApp ⁺¹ ) were expressed in transgenic Dvosophihτ using the doxy oycϋne -regulated system. Misfi'amed proteins were abundantly produced, both from the transgenes and from endogenous Dvosophilα ubiquitin-encoding genes, and their abundance increased during aging. Over -expression of hUbb was toxic during fly development, yet favored survival when expressed in adults, while hTJbb ⁺¹ did not have these effects. The data suggest that MM iβ an evolutionorily conserved aspect of gene expression and aging, with specific phenotypic consequences.

Results , Generation and conditional expression of transgenic constructs

To determine if MM could be studied in Drofioj-iMla, oDNA clones encoding wild-type and frame'shifted versions of the human proteins, hUbb and hApp, were expressed in Di'osopJ∑iJn using the conditional doxj'cyclineCDOX) -regulated system ("Tefon") (Bieschke et al. 1998; Ford et al. 2007). In the DOX-regulated system, the control and experimental animals have identical genetic backgrounds, and transgene expression is induced in larvae or adults by feeding the drug DOX. In this way any possible toxic effects of the RNAs or proteins could be avoided since expression, should occur only in the presence of DOX. Human oDNAs encoding wild-type proteins, and cDNAs engineered with the appropriate dinualeotida deletions adjacent td ox* within tke QAQAQ motdf wei'ή ekmβd downstream, of the DOX-regulated promoter (Figure 10). These sequences were introduced into Dvosophila using P element mediated transformation and multiple independent transgenic strains were generated for each construct. In. all the experiments presented, the strains homozygous for the transgenic target constamets were ci-αssed to the 2-tTλ(S)ε2 driver stx-nin (or other driver strains, as indicated), to generate hybrid progeny containing both constructs. In the TtTλ constααict the powerful, tissue-general cytoplasmic actin (aetinδO) promoter drives expression of the artificial transcription factor rtTA. Upon DOX feeding the rtTλ protein xindergoes a conformation change and binds to specific sequences (colled TetO) in the target construct, thereby activating transgene expression in all tissues except for the gernrline. For controls, the i'£Z14(3)E2 line was crossed to Oregon-R wild type flies to generate hybrid progeny containing only the rύTA(3)ε2 driver construct and no target construct, and for simplicity these controls are referred to hereafter as "Or-R control" flies. Conditional (DOXdependent) expression of the transgenes at the level of BNA transcripts waβ confirmed by Northern blot (Figure HA, B).

[00142] The human ubiquitin-B gene encodes three direct repeats of ubiquitin protein that is subsequently processed into mature monomers. The GAGAG hotspot for MM is located at the ό ' ' end of each repeat, such that MM causes an almost fulHength ubiquitin moiety to be fused with part the next repeat- in the +1 frame, thereby creating a altered ubiquitin species with a O tørmiαal extension, of the protein, called IT-Jb ⁺¹ GPigurβ lOB). The hUbbWT construct contains a single repeat designed to encode a wild"type hUbb monomer. The bXTbb ⁺¹ construct contains two bXTbb repeats, with, the appropriate dinucleotidθ deletion engineered at the GAGAQ hotspot at the end of the first repeat, thereby constitutLvely encoding hUbb ⁺¹ . The endogenous JDj'onopJiiljs IXb ^" b-©iiβocLbαgj genes include a polyubiφαitii-L (Lee et al. 1988) and fusions of Ubb to other coding sequences that are conserved in mammals (Barrio et al. 1994).

2. Western analysis of hUbbWT expression

[00143] Westex'n blot analysis with a specific antibody was used to assay for expression of the hUbbWT protein in flies. The human and hi'osopMIa Ubb proteins are identical in amino acid sequence, so it was expected that antibody raised against hCIbb would cross-react with endogenous Drosoptela protein. Consistent with this expectation, the hXTbb antibody recognized a series of. protein bands in Or-R control fly extracts, although notably no band was detected at the "8.5Kd size calculated for monomelic Ubb (Figure HD, and additional data not shown). The lack of a detectable Ubb monomer species is likely due to its rapid ligation to other proteins. A scarce and limiting pool of nee Ubb has previously been suggested to explain the low abundance of Ubb monomers relative to multήners in mammalian cell cultαu-e stαidies (Dantuma et al. 2006). The antibody specific for TJbb recognized a series of high -M W proteins in the fly extracts, several of which are indicated by a bracket (Figure 10D). These species are

interpreted to represent endogenous Ih'Oftophila Ubb ligated to various proteins in the cell. Importantly the abundance of these protein species was not altered by DOX treatment in the Or-R control flies, indicating that DOX itself does not have a detectable effect on ubiquitin expression. A similar pattern of Mgh-moleoular-weight species were also present in the extracts of trans genie flies where hUbb was being expressed, and notably the abundance of these species was induced by DOX in each of the three independent transgenic lines tested. These results are consistent with DOX'dependent expression of hUbb from the transgenes that is then rapidly ligated to fly cellular proteins.

3. Western analysis of Ubb molecular misreading

[00144] To determine if expression of the misframed (+1) version of the hITbb protein could be detected, antibody specific for hUbb ⁺¹ was used in Western blot- assays. This antibody had been previously characterized and shown to be highly specific for hUbb ⁺¹ (van Leeuwen et al. 1998). As expected this hUbb ⁺¹ antibody strongly recognized purified His-tagged hUbb ⁺¹ protein purified from E. coli cells (Figure 12A). Strikingly, the Ubb ⁺¹ antibody also recognized a complex pattern of bands in extracts of Or-R control flieβ that became more abundant, with age, including large amounts of -liigh-MW material, as well as several small species migrating at an apparent 3NdW of <20Kd (Figure 12A). These species are interpreted to represent. ITbb ⁺¹ protein produced from the endogenous Drosophila Ubb-encodinsf genes for two reasons: Ci) the almost perfect conservation of ubiquitin gene sequences between the fly and human, including the GAGAQ hot-spot for MM, means that the endogenous fly gene encodes the same Ubb ⁺¹ protein as does the human gene, Gi) a similar pattern of DOX'inducible species was produced by both the hUbb ⁺ * and hUbbWT transgenes (Figure 12B-F). The htTbb ⁺ i transgene produced a series of bands that cross-reacted with the hUbb ⁺¹

antibody, both small MW fspeoies as well as higher MW «pecie«. This pattern of proteins was highly similar to that observed in the Or-R control flies, and also appeared to include several additional species. The calculated, size for the Ubb ⁺¹ monomer is ~llKd, and this may correspond to one of the DOX-induoiblβ species migrating at an apparent MW of <20Kd (indicated, with black arrowheads ύα Figure 12; estimation of sizes not shown). Ubb ⁺¹ is itself known to be a target for (poly)ubiqitination by wild" type Ubb (monomeric MW -"8.5Kd). and notably a DOX-inducibte species was present at the MW predicted for Ubb ⁺¹ h'gαted to one Ubb moiety (~19.δKd. indicated by an open arrowhead), as well Ubb ⁺¹ ligated to two Ubb proteins ('-28EId. indicated, by asterisk) autl Ubb+1 ligated to three Ubb proteins (~37Kd, indicated by double asterisk) (estimation of apparent MW not shown). Strikingly, the hUbbWT transgenic strains produced a similar series of bands whose abundance was induced by DOX and that cross "reacted with the hUbb ⁺¹ antibody (Figure 12B), consistent with MM events. These included apparently the same small MW species described above, as well as a similar series of higher MW species. The abundance of DOX-inducible proteins cross -reacting with the Ubb+1 antibody was observed to increase during aging of flies expressing both the hUbbWT and hUbb ⁺¹ transgen.es (Figure 12B-F). For example the ~19.5Kd species was more readily detected in old fly extracts (open arrowhead). Taken together the data suggest that- Ubb ⁺¹ is abundantly produced in transgenic flies from the hUbbWT transgene, consistent with MM, and moreover that the abundance of these* inisframed hUbb protein species increases with age of the flies. Notably for lϊUbbWT these MM events cannot be occurring at the QAGAQ hotspot (position 219 of the OBF), as it is located downstream of the relevant epitope ia this construct, (indicated with red asterisk) (Figure IB).

4. Western analysis of hApp expression, and molecular misreading

[00146] Expression of hApp WT was assayed using a specific antibody (CTp state

Gat. #07-667), and no DOX-inducible species could be detected at the calculated βize of ~79Ivd. or at other sizes (Figure HE), suggesting that the hApp WT protein is not being expressed at a detectable level and/or is not- stable. Other studies have reported that hApp WT could be expressed in adult flies and detected by Western blot at an apparent MW of ~110Kd (Luo et al. 1992; Greeve et al. 2004). One possibility is that hApp WT is being expressed at low levels in the experiments presented here, but is being obscured by a background band such as that running at ~100Ivd (Figure HE? indicated with asterisk). However DOX inducible expression of AppWT was also not detected rising mouse monoclonal antibody 22cll, which yielded a different- pattern of backgroxind bands (data not shown). We conclude that AppWT is either not being expressed at a detectable level from this construct in adult male flies, or that the protein is unstable. These hApp WT constructs are indeed being expressed in a DOX-dependent manner at the RNA level, as confirmed by Northern blots (Figure HB), and as indicated by the fact that they give rise to hApp ^+l via apparent MM events, as described next.

[00147] To determine if the misuramed version of hApp coxύd be detected in flies. Western blots were performed using antibody specific for hApp ⁺¹ . The hApp ⁺¹ antibody readily detected His-tagged hApp ⁺¹ protein purified from E, cab' cells, as well as highly abundant protein produced in flies transgenic for the hApp ^rl transgenic construct at the same size, consistent with efficient expression of hApp ⁺¹ in adult flies (Figure 13A; indicated by black arrowhead). Notably, both the His-tagged hApp ⁺¹ and the hApp ⁺¹ produced in transgenic flies ran in the gel at a position equivalent to an apparent MW of ~58Kd, which is the reported mobility for hApp ⁺¹ under these conditions

CHoI βt al. 200ft) . This i« despite the fact that the calculated MW for the 348 amino acid residue hApp ⁺¹ protein is ~39Kd. This unusual retarded mobility in SDS-PAGE gels obsei'ved for hApp ⁺¹ (as well as hApp) has been observed in several previous studies (Weidemann et aL 1989; HoI et al. 2008), and is attributed to the acidic region of the protein between positions 230*260 that contains many glutamαte and aspartate residues. In transgenic flies expressing hAppWT transgene, a DOX'inducibl© bond at the same apparent MW of —138KD was detected, consistent with. MM of the hApp transgeno (Figure 13C, D). It is also interesting to note that there were several species in the Or-R control fly extracts that cross-reacted with KApp ⁺¹ antibody, including- one of a similar size as hApp ⁺¹ (indicated by an asterisk), and that these species became more apparent with age (Figure 13B). Despite this background, the fact that the apparently *°i38Kd species was produced in a DOX-inducible manner in two independent hAppWT transgenic strains, but not in the controls, suggests that ^' MM is indeed occurring, and moreover titat this KApp ⁺¹ protein, is more readily detected in old flies.

5. Phenotypic consequences of expression of hXJbbWT and hUbb ⁺¹

[00148] It was next ^, asked if expression of wild'type and +1 versions of hXTbb transgenes would have phβnotypio consequences for the flies. Over- expression of the highly-expressed hUbbWT(70) trαnsgene during larval development was found to be toxio to flies at the pxxpal stαεe, especially in males (Figure 14), however no significant lethality was associated with, the less strongly expressing line hITbb WT(SO). To confiian that high-level expression was toxic, a strain was constructed containing two copies of the hUbbWT(118) transgene along with the rtTA(3)E3 ubiquitous driver, and this combination resulted in pupal lethality that was DOX-dependent and completely penetrant. The lethality caused by hUbbWT over-expression

waβ associated with a dromatio disruption of normal pupae βtvuβtureft and large melanotic inoluβions indicative of extensive cell death (Figure 14B). In contrast- there was no evidence of pupal lethality when the ϋUbb ⁺¹ trans genes Wθϊθ expressed during development, using a variety of drivers. A different result was obtained when the same transgenes were expressed in adult flies. Ia adults hUbb ⁺¹ was found to have neutral or slightly negative effects on survival, particularly in nαale flies (Figure 140, D). In contrast, hUbbWT did not have these negative effects _^ and. instead was associated with slightly increased life span (Figure 14E, F). Notably the DOX-depeiident lifø span increase was greater in males, and was greater in the more highly -expressed of the two Hues, UbbWT(2)70. Moreover, in the UbbWT{2)70 line a particularly long lifespan was observed even, in the absence of DOX, perhaps due to some leaky expression of the trαnsgenel Interestingly, in adult flies over-expression of hUbb was found to caxise increased expression of ribosomal protein 49 gene (Rp 49) (Figure 11).

6. A molecular misreading GFP reporter construct

[00149] • The conditional DOX-regulated system was also used to express the fluorescent protein GFP (the "Control- GFP" reporter), as well as a reporter construct in whien the GFP protein is frame -shifted to encode a nonfunctional protein (the "RtM-GFP" reporter) (Figure IS). The MM-GFP reporter contains 3 copies of a GAQAGA hotspot motif such that any MM events should cause production of functional GFP. The Control-GFP construct yielded abundant D OX- dependent expression of GFP throughout, the somatic tissues of tne fly, as expected (Figure 15B). Little or no expression of GFP could be detected with the MM* GFP reporter in young: flies or during noiuiuil aging (data not shown). However, one possibility is that the expression level was present but simply too low to detect. To ad<uress this possibility strains ore being generated with multiple copies of

the reporter in hopes of increasing the signal. Significant expression of the single-copy MM'GFP reporters could be observed in leg muscle, flight muscle and other tissues when adult flies were challenged with Ionizing radiation or 100% oxygen atmosphere (Figure 15C). These are strong oxidative stresses that are known to produce acute phenotypes with some similarities to aging. Notably the expression often occurred in isolated patches of tissue, which is reminiscent o£ the cell-bycell accumulation of misframed proteins previously observed in the Brattleboro rat magnocellular ne\τrons euad human AD disease tissue (<1θ Pril et al. 2006). The data are consistent with MM events, and suggest the reporter may be useful for studying MM in Drosophila longitudinal asβayft in the future.

Discussion

[00150] La these studies wild-type and misframed versions of ITbb and hApp proteins were identified based on their apparent MW in SDS-page gels, co- inigrαtion with proteins purified from E. coli, DOX-inducible expression from ti'ansgenio constructs, and oross-reaetivity with specific antibodies. The Western blot analyses suggested that wild-type and misframed versions of htϊbb and misframed hApp proteins wei*e successfully expressed from the trαnsgenes designed to encode these proteins. For both, the hUbbWT and hApp WT transgenes there was ample evidence of MM ₁ as these constructs produced DOX-depandent proteins that were recognized by hUbb ⁺¹ and hApp ⁺¹ antibodies, respectively. Importantly these hUbb ⁺¹ and hApp ⁺¹ speoiea were more readily detected in extracts from old flies, supporting the connection between MM and aging.

[00151] It was striking that the hlϊbb ⁺¹ antibody recognized a series of abundant ^, protein species in control flies. The fact that several of these species appeared to co-migrate with DOX -inducible bands produced by the

KUbb ⁺¹ transgene (and hUbbWT transgene) supported their identification

aft containing bonα fide TJbb ^+l protein. This suggests that the endogenous Dϊosophila Ubb 'encoding gene(s) are undergoing MM and producing abundant TJbb+1 protein of various sizes, lilcely involving cross -linking to other cellular proteins such as TJbb, and moreover that these species become more abundant, dui'ing aging. Finally, the production of functional GFP protein froxn. the xxύsframed reporter construct suggests that MM events take place in. the tissues of flies challenged with oxidative stress.

[001S2] The ability of the hUbbWT tmnsgene to yield expression of DOX- inducible species that cross react with Ubb ⁺¹ antibody is consistent with abundant MM, however these events eannot be occurring at the GAGAQ hotspot as it is located only downstream of the relevant epitope to. this construct (Figure lOB). This suggests that one or more other DNA sequence elements located in the 5' end of the wild-type human ubiquitin gene are leading to MM, at least under the conditions assayed here. The nature of these MM events is not clear at this time, as the largest ORF containing the <+l) epitope in the hUbbWT construct does not contain an ATG start codon, and would encode ά protein, of only 45 amino βcid residues (~ δKd). One interesting possibility is that the D OX* inducible expression of the transgenes is affecting- the expression and MM of the endogenous genes and/or the stability and cross-Unking of endogenous Ubb proteins.

[OH5I53J The faint pattern of endogenous JDrosopJula species cross -reacting with the hApp ⁺¹ antibody most likely represents non-specific, cross-reacting proteins, however it is not clear at this time why such cross reactivity is more apparent in old fly extracts. The DrosopMla genome contains at least one gene related to hApp, the Appl gene, however it is not obvious how it could encode a cross-reacting epitope or an appropriately sized protein based on its known sequence (Luo et al. 1992). Analysis of fly strains mutant for Appl will be required to test the intriguing possibility that Appl

encodes proteins that orofts-react with, antibodies directed against hApp and hApp ⁺¹ .

[00154] One line of evidence in support of α phenotypic consequence for MM is the effect of the over-expressed genes. While high-level expression of hUbbWT was toxic to developing pupae, over -expression of hUbb ⁺¹ was not, consistent with, different- functions for the two proteins. Moreover, kUbbWT appeared to have benefits for survival of adult male flies, while htTbb ⁺¹ had no benefit, or was slightly toxic. The ability of htTbbWT ovex-expression to induce riboβomαl protein. 49 CRp 49) gene expression and favor survival in adult mala JDrosopJv'Ja is interesting in light of recent reports that decreased translation can favor longevity In DvosopJiiln (Kapahl et al. 2004), O. elegous (Hansen et al. 2007) and yeast (Chiocchetti et al. 2007). To what extent endogenous Ubb ⁺¹ may function in normal cell physiology will be an interesting area for future study.

[00155] The association of misframed proteins with AD and other disease states and the ability of hUbb ⁺¹ to inhibit proteoβome activity in cultured cells in a dose-dependent manner is consistent with the idea that accumulation of misframed proteins may be detrimental to the aging animal. It will be important to determine if the increased abundance of misframed proteins in old flies is due to increased rates of MM. decreased cleax'anc© of the abnormal ENA species by NMD, decreased turnover of the πύsfrαmed ^" proteins, or some combination of these processes. Consistent with a toxic effect of accumulated protein damage dtiring aging, old flies are more sensitive to proteosome inhibitors (Vernace θt al. 2007), and over- expression of certain enzymes implicated in protein repair such as protein corboxyl methyltransferase (Chavous et al. 2001) and methionine sulfoxide reductase A (Ruan et al. 2002) are reported to increase fly life span under appropriate conditions,

[00156] The fact that mift&amed proteins can have toxio effect** and appear to increase in abundance during aging in mammals and in flies is consistent with an error catastrophe model, however other explanations exist. For example the apparently abundant expression of TTbb ⁺¹ in young, wild-type flies may indicate a normal physiological function. Epigenetic regulation of gene expression and phenotypes is increasingly apparent across species (Goldberg et al. 2007). Bistable switches are common and appear to allow phenotypic plasticity on various timescales (Rando and Verstrepen 2007)» Interesthigly repeated DNA sequence motifs are ^" commonly associated with such epigenetic mechanisms. Stress response genes, particularly oxidative stress response genes suϋh as lisps, are induced during novmnl aging of flies as well as in human aging-related disease states like AD (Landis et al. 2004! de Pril et al. 2006). The genes encoding ubiquitm are induced in response to stress in flies (Niedzwieelά and Meming 1993) and mammals (GriUari et aL 2006), and perhaps MM and the conserved GAQAQ hotspot motifs represent on evolutionai'ily conserved epigenetic mechanism by which ubiquitin genes encode alternate proteins with alternate functions expressed in response to certain ldnds of stress. For example altered chromatin structure, altered BNA polymerase structure, or low nucleotide concentrations might each be predicted to increase rates of MM. The increased abundance of MM in old flies might therefor© represent a compensatory stress response with a benefit for continued function of ceEs or the animal. Consistent with this idea, in mammalian cells the expression of hUbb ⁺¹ caused induction of hsp70 and increased resistance to oxidative stress (Hope et al. 2003).

[00157] Alternatively, even if MM might serve some conserved benefieml role earlier in the life cycle, such as in response to stress, its chronic activation during aging might be coxmterproductive. The ability to observe MM in the

fly should facilitate* the further study of this intriguing phenomenon, including its possible relevance to human aging-related diseases.

Methods and Material

[00158] X)i ^m asar>liila strains. All Di'osσphila melanogaster strains are as described (Lindslβy and Zimm 1992; Bieschke et al. 1998; Landis et al. 2001, the entire contents of which are incorporated herein by reference).

[00159] Plasmid construction. Transgenic constructs were generated by POR amplification of inserts with a Pstl site engineered at the 5' end and an EcoRI site at the 3' end, and these fragments were cloned into the unique Pstl and EcoRI sites of USC 1.0 vector, as previously described CAUildan et al. 2002). All construct sequences were confirmed by sequencing. For hITbbWT construct. POB products CUBBwtrl. UBBwt'2) λvere obtained aising a pcDNA3 vector containing the UBBwt cDNA as a template. UBBwt- 1 was generated using primers Uwt-lP (5'

GGCTGCAGGAATTCGATATCAAGGT 3') and Uwfl E (δ ^* TTTATTAAGGCACAGTCGAGGCTGATCAGCGA 30. UBBwt-2 was generated using primers Uwt"2P ⁽ JS'

TGCAGGCTGCAGGAATTCGATATCAAGCT 3') and Uwf2R (5 ^* AATTTTTATTAAGGOACAGTCGAGGCTGATCAGCGA 3 ¹ ). Both products were generated using pfu DNA polymerase (Stratagene). Products ITBBwtland UBBwt" ³ were boiled for 10 min at 96oC and cooled to room temperntwe to generate a renrmenled UBBwt gene with a Pstl site engineered at the S' end and an EooRI site at the 3' end. This fragment was cloned into the Pstl and EcoRI sitea of USC1.0 CAllilrian et al. 2002) to generate the construct USCl.O-ITBBwt. The following constructs, USCl.0- ITBB ⁺ I, USCl.O-APPwt, and USC1.0-App ⁺¹ were generated by using the procedure above. UBB+1-1 was generated using primers 1T+1-1F (S'

GATCCATGCAGATCTTCGTGAAAAC 30 and U+1- 1R (5'

53

TTTATTOOAGTGTGATGGATATCTGCAGAAT .V). TTBB+1-2 wα« generated using primers U+1-2F (S' TGCAGATCCATGCAGATCTTCGTGAAAAC 3') and IT+1-2R <5' AATTTTTATTCCAGTGTGATGGATATCTGCAGAAT 3'). APPwt-1 was generated using primers Awt-IF (5' GTGCTGGAATTCTGCAGATATCCAT 3') and Awt-IR (5'

TTTATTCGAGGTCGACGGTATCGATTaTTAA 3 ^* ). Appwt-2 was generated tising primers Awt-2P CTGCAGT<XJTGGAATTCTGCAGATATCCAT 3') and Awt-2B (5 ^* AATTTTT ATTOGAGGTOGACGGTATCGATTOTTAA «'). App+l"l was generated using primers A+l-lF (5' TAGAACTAGTGGATCCCCGGaGAGA 3') σnd A+l-lB (5 ^* TTTATTCTCGTTGGCTGCTTGCTGTTCCAA 3 ¹ ). App+1-2 was generated xising primers A+1-2F (5'TGCATAGAA.CTAGTGGATCCGCCGGGAGA 3') and A+1-2R (S ¹ AATTTTTATTCTCGTTGGCTGCTTCCTGTTCCAA 3 ^* ). Molecular misreading reporter constructs. PCB prodxicts (GFP" 1. GFP-2) were obtained using pGreen Pelican plasmid containing the eGFP gene as a template. GFP* 1 is generated using primers PGlF

(δ'GTGAGCAAGGGCGAGGAGCT 3') and PGlR

(S'TTACTTGTAUAGUTUGTCCA 3'). GFP-2 was generated using primers PG2F containing 5'Sac I overhang (S' AGCTC GTGAGCAAGGGCGAG GAGCT 3') and PG2R containing. 3'EcoRI overhang (S'AATTTTACTTGTACAGCTCGTCCA 3'). Both, products were generated using pfu DNA polymerase (Stratagene). Products GFP-I and GFP-2 are then combined and boiled for 10 min at 95"(J and cooled to room temperature to generate eGFP, a reannealed GFP gene with a Sao I site engineered at the S' end and an EooRI site at the 3' end. This fragment is then ligated to MM3X, which is a rβaixnealed synthetic oligo* of MMF (S'ATGGAGAGAGAGAGAGAGAGATC GAGCTC 3') and MMR (5'CGATCTCTCTCTCTCTCTCTCCATTGCA 3 ^* >. MM3X when annealed contains a G' Pst'I site and a 3' Sac I site which is complimentary to the

β'eGFP. MM3X containa three copies of the GAGAGA molecular misreading hotepot. MM3X was ligαted to eGFP at 4° overnight and then USC 1.0 was added and ligatθd at room temperature for 4 hrs to generate the construct USC1.0-MMGFP. T4 DNA ligase (Fromega) is used in all the ligation reactions. A control construct- USC1.0-MMCGPP was generated by first ϊigating eGFP gene to MM3X0, a rβannealed synthetic oligos of MMFG (5 ¹ ATGGAGAGAGAGAGAaAGAGAGAGCTC 30 and MMRC «5' CTCTCTCTCT CTCTCTCTCCATTGCA »'). The ligated product was then cloned into Pstl and EcoBI sites of USO 1.0. P element mediated transformation. Pour independent- gernvline transformants of the USOl.0" UBBwt construct ChUbWWT-8. -118. -80 axud -70) were generated iisinfr standard methods CR-ubin and SpratUing 1982), using the yαcw injection strain (Patton et al. iyt)2). AU four lines integrated onto the 2nd Chromosome. Six independent gernvline transformants were generated for the USCl.O-hUbb+i consti'uct. UBB+1 -4, -1, and -11 integrated onto the 2nd chromosome while KLTbb ⁺¹ -6, -SO, and "Id integrated onto the 3rd chi'omoeonte. Southern analysis indicated the presence of single inserts for all the lines. Four independent germ- line transformants were generated for the USCl.OhAppWTconβtruct (hAppWT -16, -24, -1, and -20). hAppWT -16, - 1 and -20 integrated onto the 2nd ehromosonie while hAppWT '24 integrated onto th.β 3rd. ehi'QiϊiQfioiiie. Foiu. ¹ iiidependόnt gcei'iϋ-litiό transformants were generated for the USC1.0-hApp ⁺¹ construct ChApp ^{+1 %} 7, • 24, -16 and -30). hApp ^+l -16, and -30 integrated onto the 2nd chromosonte while hApp ⁺¹ -7 and -24 integrated onto the 3rd chromosome. Six independent- germ-line traneformants were generated for the USC1.0-MM* ATG-GFP consti'uct (abbreviated "MM-GFP") (MM-ATC SSA, 46A, 34A. 8A, 4βB, and 8B). MM-ATG 58A, 4θA, and 34A integrated onto the 3rd chromosome and 4θB and 8B integrated onto the 2nd chromosome. Two independent ^, germ-line transformants were generated for USOl.OMMC-

ATG-GFP construct ("Control- GFP") CMMC-ATG- GFP- 16. -8). DrofiopMIn culture and life span assays. Drosophila were cultured on standard agar/dextrose/corn meal/yeast media (Ashbumer 1989). Where indicated, flies were cultured on food supplemented to a final concentration of 640μg/ml DOX for the experimental group. Each of the hUbbWT(70,80), and hITbb ⁺¹ (l.ll) transgenic strains, and Oregon R wild-type flies (provided by Bloomington Drosophila stock center) was crossed to the "TO 'daughter less" driver Hue, which contains the daughterless"GAL4 driver and the "UOl" bridge construct where a UAS -promoter drives expression of rtTAM2alt (Stebbins et ol. 2001; Ford et al. 2007). Crosses were performed at 25 ⁰ O in xu'ine specimen bottles. Prior to eclosion of the majority o£ pupae, bottles were cleared of adult parents and newly eclosed flies were allowed to emerge over the next 48 hoiu's. Moles and females each containing both the target transgene and the driver constructs were scored and collected. At day 4, the males and females were split into experimental and control groups, eααh group containing 75-100 flies. These were mtiititamed at 2QaC at 25 flies per vial. All flies were transferred every two days into fresh media for the first month and then every day for the following months. The number of dead flies was counted at each tossing and used to calculate mean and median life spans for the experimental (+DOX) and control (- DOX) groups. The statistical βiguifLt-juaco of the difference in median, life span was calculated for each experiment using log rank tests. Northern analyses. Each of thet indicated hUbbWT(70,80,118), hAppWT(l,24), hUbb ⁺¹ (l,ϊl) and Oregon R control strain was crossed to the rtTA(3)E2 driver line (Bieschke et al. 1998) and cultured at 25oC in urine specimen bottles. Males containing both the transgene and the rt.TA(3)E2 driver were scored and collected. The males were then split into experimental and conti'ol group, each containing 100 flies. These were maintained at 25°O at 2δ flies per viαl. Flies were cultured on phis and minus DOX food for two

weeks, and total RNA was isolated from. 30 adult Dvosophila males using the ENAqueous ldt O^mbion), fractionated on. 1.0% agarose gels and transferred to GenβScreen membranes (DuPont/NEN). IX = 5 vs. and 2X - 10 μg.

The PCR product UBBwt-1 was used as a specific probe for the hUbbWT gene. The PCR product AFFwt'l was used as a specific probe for the liAppWT gene. Blots were also hybridized with, probe specific for riboaoinal protein, gene Rp49 (Q'Connell and Rosbaβh 1984). DNA probes were ³² F- labelled using the Prime-It II DNA labeling ldt (Strata gene). Hybridization was carried out in. Church- Gilbert solution- at 65°C overnight. Hybridization signals were visualized and quantified using the phoepho±mager and ImagβQxumt soft-wore (Molecular Dynamics). Developmental effects of hUbbWT and hUbb* ¹ overexpression on life span. Mies were cultured on food supplemented to a final concentration, of 640xιg/ml Doxycycline for the experimental group. Each Hue of hUl)bWT(70.80)and hUbb ⁺¹ (1.11) moles were mated to virgins of the "TO'daughteiiess" driver described above, in food bottles plus dox or minus DOX. The progeny were allowed to develop in the plus and minus dox conditions. Prior to eclosion. bottles were cleared of adult parents tm<l newly edosecl flies were allowed to emerge over the next 72 hotu's. The pupae from both plus and minus DOX bottles were scored for any noticeable phenotype. At eclosion, all the possible combinations of phenotype were scored for each cross and condition. Progeny containing both the trαnsgene and the drivers were screened and collected. Progeny from the plus DOX bottles were ρer>arated into males and females and lifespan aseay was carried out for these two groups on minus DOX vials. Progeny from the minus DOX bottles were also separated Into males and females and put on both plus DOX and minus DOX vials to generate four groups. Therefore a total of six groups were generated per Hue. The flies

were* transferred into frefth viαlft of plus DOX and minus DOX food at 29oO every other day for the 1st month and then every day until zero survival. Molecular misreading reporter lines irradiation treatment assay. MM-ATG 58A, 4GA ₁ 84A, 8A, 46B, 8B _» MMC-ATQ X, and X2 males and females were cultured for one month on food containing plus dox (640ug/ml doxycycline) for the experimental, experimental control and minus dox (G40ug/ml ampicdllin) for the negative control. The negative and experimental control groups ore not exposed to the irradiation. Each of the experimental lines was irradiated for 9 hours (total 50.000 rads). The flies were transferred into fresh vials of appropriate plus and minus DOX food each day until zero survival. At every five days after the irradiation, each, of the experimental and control lines were observed under a GFP fluorescent microscope (Lβica) for GFP expression. Molecular misreading reporter lines 100% oxygen survival assay. From each of the lines MM-ATO 68A. 4βA. 34A. 8A. 46B. 8B, MMC-ATO X, and X2. males and females were cultured for one month on food containing plus DOX (θ4θμg7ml DOX) for the experimental. Experimental groups were then transferred to an enclosed chamber with 100% oxygen gas flow (Landis et al- 2004). The flies were transferred into fresh λάals of appropriate plus and minus DOS each day until zero survival. Every 24 hrs each of the experimental and control lines were observed under a QFP fluorescent microscope (Leica) for GFP expression. Western analyses. Several antibody reagents were purchased from Upstate cell signaling solutions, including Anti-App ⁽ Catalog #07-667) and Anti-Ubb (Catalog #07-37(1). as well as antibody specific for hApp ⁺¹ ("Amy-0") and antibody specific for hUbb ⁺¹ ("Ubi2a"), both characterized previously (van Leβuwen et al. 1998). For each of the lines, SO flies from th© experimental group (+DOX) and 30 flies from, the control group (DOX) were collected at 26 days (Time point 1), 48 days

(Time point 2). 67 daye (Time point 8), 82 days (Time point 4) and 105 days (Time point 5) for Western analyses. Thirty άdult flies were homogenized in Laemmli sample buffer (Bio-Rαd) and dilutions were made from the supernatant- The samples were boiled for lOmins, cooled and fractionated on SDS-PAGE. Stacking gel was 4% and the running gel was 12% for the ITbb+1 and 7.δ% for the App ⁺¹ . The samples were transferred to the nitrocellulose membrane (Bio'Rad) and ^" the membrane was blocked overnight at 4oC in PBST supplemented with δ% Non-Fat Dry MiIIt (Bio* Rad). Next the nitrocellulose membrane was incubated with 1-2000 of primary antibody specific to Ubb+1 or specific to the App ⁺¹ . The antibody diluent was made ivesϊx each, tune in 1% BSA /PBST and incubated ovei'xiigiit at 4 ^φ O. Horseradish peroxidase "conjugated goat onti-rabbit secondary antibody (Amershαm) was diluted to lηUUυ in 1% BSA/PBST and iαcxibated at room temperature for 2 hours. After washing steps, the samples were briefly incubated in cjhemiluniinescence reagent plus (Pβrlrin Elmer) and the bands were detected using Kodak Image Station. Additional Western control experiments utilized mouse monoclonal antibody 22oll C-Vli-lipore/Ohemioon) , specific for the N-terminus of hApp, and cortical neuron lysates as a positive control for App (data not shown). Although the present invention has been described in terms o£ specific exemplary embodiments and examples, it- will be appreciated that the embodiments disclosed herein are for illustrative purposes only and various modifications and alterations might be made by those skilled in the art without departing from the spirit and scope of the invention as Ret forth in the following claims.

REFERENCES

Abraham, M. C. and S. Shahαm, 2004. Death without caspases, caspases without death. Trends CeU Biol. 14, 184-93.

Ackermann, M., S. C. Steams and U. Jenal, 2003. Senescence in a bacterium with asymmetric division. Science 300, 1920.

Adaxns. J. M.. 2003. Waya of dying: multiple pathways to npoptosis. Genes Dev. 17, 2481-95.

Adorns. J. M. and S. Cory, 2002. Apoptosomes: engines for caspase activation. CiUT. Opin. Cell Biol, 14. 715-20.

Aigαld. T., K- H. Seong and T. Matsuo. 2002. Longevity determination genes in Droaophila mehma&aatev. Mβch. Ageing- Dev. 123. 1531-41.

Amador-Nσguez, D., J. Zimmerman, S. Venable and G. Darlington, 2005, Gender-specific alterations iα gene expression and loss of liver sexual dimorphism, in the long-lived Ame* dwarf mice. Biochem. Biophys. Res. Coxnπrun. 332. 1086-100.

Aπnkura, R., K. Sato and S. Kdbayashi, 2005. Role of mitochondrial l-ibαs-vmό-dόpendent translation in germ-line fαi-mntiαn. in Drαsαpnila embryos. Mech. Dev 122, 1087-93.

An, J. H., K. Vranαs, M. Lucke, H. Inoue, N. Hiβamoto, K. Mαtsumoto and T. Iv. Blaokwell, 2005. Regulation of the Cαenorhαbclitis eleguns oxidative stress defense protein SJKN-I by glycogen synthase ldnase-3. Pi'oc. Natl. Acad. Sci. U S A 102, 1G27S-8O.

Aroma, E _M J. Agapite and H. Steller, 2003. Cαspαse activity and a specific cytochrome CJ are required for sperm differentiation in DrosopMla. Dev. CJeU 4, 687- 97.

Aroma, E., M. Bader, M. Srivastava, A. Bergmann and H. Steller, 2005. The two Drosophila cj'tochrom.θ C proteύis can function in both respiration and caspαs© activation. Embo J.

Afbeittnan. M. N., E. E- Furlong. F. Imam, E. Johnson. B. H. Null, B. S. Baker, M. A. Krasnow, M. P. Scott-, R. W. Davis and K. P. White, 2002. Gene expression during the life cycle of Dvosophila Science 297, 2270-5.

Ayyadevara, S., R. Ayyadevara, A. Vei'tino, A. Galeeld, J. J. Thaden and R. J. Shmookler Rβis, 2003. Genetio loci modulating fitness and life span in Caenorhabditis elegcms: categorical trait interval mapping in OL2a x Bergerac-BO recombmant-inbred worms. Genetics 163, 557-70,

Baehrecke, E. H.. 2U02. How death shapes life during development. Nat. Rev. MoI. Cell Biol. 3. 779-87.

Baehrecke. E. H-, 2003. Autophagic programmed cell death in Drosophila. OeIl Death Differ. 10. 940-δ.

Bartke, A- 2005. Minireview: role of the growth hormone/insvilin-like growth factor system in mammalian aging. Endocrinology 14(3, 3718-23.

Bartkβ, A. and H, Brown-Borg, 2004. life extension in the dwarf mouse. QUIT. Top. Dev. Biol. 63. 189-225.

Bauev, J. H., P. G. Poon, H. Glatt-Deeley, J. M. Ahrams and S. L. Helfkmd, 2005. Neuronal expression of p53 dominant-negative proteins in adult Droaojihila melanogctάtor extends life span. Uurr. Biol. 15, 2063-8.

Bazinet, C, 2004. Endosymbiotio origins of sex. Bioessayβ 26, 558-66.

Bazinet, O. and J. E. Rollins, 2003, Rickettsia-like mitochondrial motility in Drαsαphϋα spex-mlo genesis. Evαl. Dav. S, S79-BG.

Bhadra, M. P., U. Bhadra, J. Kund\i and J. A. Birchler, 2005. Gene expression analysis of the function of the male-specific lethal complex in Droβophila. Genetics 169, 2061-74.

Birchler, J. A., M- Pal-Bhαdra and U. Bhadra, 2003. Dosage dependent gene regrulatioxi. σud the compensation of the X chromosome in Drofsophϋa males. Genetica 117. 179-90.

Brookes. P. S.. 2005. Mitochondrial H(+) leak and ROS generation; an odd coiiple. Free Radic. Biol. Med. 38. 12-23.

Burger. J. M. and D. E. Promiftlow. 2004. Sex-speeifio effects of mterventionft that extend fly life span. Sci. Aging Knowledge Environ. 2004, pe30.

Burt, A. and R. Trivers, 2006. Genes and Conflict. Harvard Press, Belknαp. Buβuttil, R. A., M. Rubio, M. E. Dolle, J. Campisi and J. Vijg, 2003. Oxygen accelerates the accumulation of mutations during the senescence and immortalization o£ murine cells in culture. Aging Cell 2. 287-94.

Buszczak, M. and L. Oooley, 2000. Eggs to die for: cell death during Drosophila oogenesis. Cell Death Differ, 7, 1U71-4.

Oarrel, L. and H. F. Willard, 2005. X-hiactivatiσn profile reveals extensive variability in X-linked gene expression in females. Nature 434, 400-4.

Oashio. P-. T. V. Lee and A. Bergnaairn . 2005. Genetic control α£ programmed cell death in Dvoaophila melanogaste.r. Semin. Cell Dev. Biol, lθ, 225-35.

Oharlesworth, D. and B. Charlesworth, 200S. Sex chromosomes: evolution of the weird and wonderful. CWr. Biol. 15, R129-31.

Chippindale, A- K., J. R. Gibson and W. R. Rice, 2001. Negative genetic correlation for adult fitness between sexes reveals ontogenetic conflict in Drasopniln. Proo. Natl. Acad. Soi. U S A 98, 1671-3.

Chow, J. (J., Z. Yen, iS. M. Ziesdhe and ϋ. J. Brown, 2005. Hilencing of the mammalian X chromosome. Annu. Rev. Genomics Hum. Genet. 6, 69-92.

Clancy, D. J., D. Gems, L. G. Harshman, S. Oldham, H. Stoeker, E. Hafen, S. J. Leavers and L. Pαrtridg _f β, 2001. Extension of life-span by loaa of CH3CO, a Drosophila insulin receptor substrate protein. Science 292, 104-106.

Corona, M., K. A. Hughes, D. B. Weaver and G. E3. Robinson, 2005. Gene expression patterns associated with queen honey bee longevity. Mech. Ageing Dev. 126, 1230-8.

Oos, R. T. and A. O. Sprαdling, 2003. A Balbiani body and the fuβome mediate mitochondrial inheritance during Drosophila oogenesis. Development 130. 1579-90.

Oypfiβr, J. R. and T. E. rTohnfton. 2003. Hormefiift in CJaenorhabditift elegant* dαuθi'dθfeotivθ mutants. Biogerontology 4, 203-14.

Dawk±ns, R., 197G. The selfish gene. Oxford University Press, Oxford.

De Luca, M., N. V. Roshina, Q. L. Geiger-Thornsberry, R. F. Lyman, E. Q. Pasyukova and T. F. Mackay, 2003. Dopa decarboxylase CDdc) affects variation in Drosophila longevity. Nat. Genet. 34. 429-33.

Dϊllin, A., A. L. Hsu, N. Arantes-Oliveira, J, Lehrer-Graiwer, H. Hsin, A. G. Fraser, R. S. Kamath, J. Ahringer and O. Ivβnyon. 2U02. Rates of behavior and aging specified by mitochondrial function during development. Science 298, 2398- 401.

Druxnxnon.d-Barbosa. D. and A. O. Spradling. 2001. Stem cells and their progeny respond to nutritional changes during Drosophila oogenesis. Dev. Biol. 231, 265-78.

Drysdale, R. A. and M. A. Crosby. 2005. PlyBase: genes and gene models. Nxicleic Acids Res. 33, D390-6.

Fαbriziα, J. J., Q. Hime, S. K. Lemmcm and C. Bazinβt, 1998. Genetic dissection of sperm individualization in Drosophila melanogaster. Development 123, 1833-43.

Finch, C. E., 1990. Longevity, Senescence and the Genome. University of Chicago Press, Chicago.

Fiach, C. E. and R. M. Sapolβky, 1999. THe evolution of -Alzheimer disease, the reproductive schedule, and apoE isoforms. Neurobiol. Aging 20, 407-28.

Flatt, T., M. P. Tu and M. Tatar, 2005. Hormonal pleiotrαpy and the juvenile hormone regulation, of Drosophila development and life history. Bioeesays 27, 999- 1010.

Ford, D,, θt al.. Alteration of Drosophila life span using conditional, tissuespθcific expression of trans genes triggered by doxycyline or RU48β/Mifepristone. Exp Gerontol, 2007.

Ford, D. and J. Tower. 2006. Genotio manipulation of life apan in Droβophila melanogaater. Handbook of he Biology of Aging. E. J. Mαsoro and S. N. Austad. Burlington, MA, Elsβvier: 400.412. ϊYidovich, I., 2004. Mitochondria: are they the seat of senescence? Aging Cell 3. 13-6.

Fry. A. J.. M. R. Palmer and D. M. Rand. 2004. Variable fitness effects of Wolbachia infection in Drosophilα melanogaater. Heredity 93, 379-89.

Fry. A. J. and D. M. Rand, 2002, Wolbachia interactions that determine Drosophilα melanogaster survival. Evolution Int. J. Org. Evolution 56, 197θ-81.

Garigan, D., A. L. Hsxi, A. G. Fraser, R. S. Kamαth, J. Ahringer ond O. Ivenyon. 2002. Genetic analysis of tissue aging in Cαenorhαbditia βlegcnia: a role for heat-shock factor and bacterial proliferation. Genetics 161, 1101-12,

Gaspari, L., P. Pedotti. M. Bonafe, O. Franeesehi. D. Marinelli. D. Mari, S. Gai'te and E. Taioli. 2003. Metabolic gene polymorphisms and p53 mutations in healthy centenarians and younger controls. Biomarkers 8, 622-8.

Gatza, C, G-. Hinksl, L. Moore, M. Duinble and L. A. DonelαcKver, 2006. piS3 and mouse aging models. Handbook of the Biology of Aging. E. J. Maβoro and S. N. Auβtad. Burlington, MA, Elsovier: 149-171.

Gems, D. and J. J. MoElwee, 2005. Broad spectrum detoxification: the major longevity assurance process regulated by inβulin/IGF-l signaling? Mech. Ageing Dfiv. 12fi, 381-7.

Gerdes, K _M S. K. Christensen and A. Lobner-Olesen, 2005. Prokaryotic toxin- antitoxin stress response loci. Nat. Rev. MierobioL 3, 371-82.

Gibson. J. R.. A. K. Ohϊppindale and W. R. Rice, 2002. The X chromosome is a hot spot for sexually antagonistic fitness variation. Proc. Biol. Sci. 269, 499-505.

Good, J. M, and M. W. Naehtnan, 2005. Rates of protein evolution are positively correlated with developmental timing of expression during mouse spermatogenesis. MoI, Biol. Evol. 22, 1044-52.

Graham, P.. J. K. Perm, and P. Ftahedl. 2008. Master* ch.aa.gft, slaves remain. Bioesaays 25, 1-4.

Graves, J. A., 2006. Sex ohromosoine specialization and degeneration in mammals. Cell 124, 901-14.

Gray, M. W., G. Burger and B. F. Lang, 1999. Mitochondrial evolution. Science 283. 1476-81.

Hθkimi, S. and L. Guarente, 2003. Genetics and the specificity of the aging process. Science 2UU, 1851-4,

Helfand. S. L. and B. Rogina, 2003. Genetics of aging in the fruit fly, Drosophila mchmogaster. Annu. Rev. Genet. 37, 329-48.

Heradon. L- A.. P. J. Selimeissiaei. ¹ , J. M. Dutlarcmelε. P. A. Brown. K. M. Listαer. Y. Sakano. M. O. Paupαrd. D. H. Hall and M. Driscoll. 2002. Stochastic and genetic factors influence tissue-specific decline in ageing C elegans. Nature 419, 808-14.

Hogeweg. P. and N. Takeuchi, 2003. Multilevel selection in models of prehiαtio evolution: compartments and spatial self-org-inization. Qrig. I. rife Evol. Biosph. 33, 373-403.

Honda, Y. and H. Honda, 1999. The cJaf-2 gene network for longevity regulates oxidative stress resistance and Mu-άuperoxiάe clismutaάe gene expression in Caenorhabditia elegcms. FASBB J. 13, 1385-1393.

Hsu, H. C, L. Li, H. G. Zkangf and J. D. Mαuntz, 200S. Genetics regulation of thymie involution. Meoh. Ageing Dev. 126, 87-97.

Hughes, K. A. and R. M. Reynolds, 2005. Evolutionary and mechanistio theories of aging, Annu. Rev. Entomol. 50, 421-45.

Hussein, M. R.., 2005. Apoptosis in the ovary: molecular mechanisms. Hum. Rθprod. XTpdatθ 11. 162-77,

Hwangbo, D. S.. B. Gershom, M. P. Tu. M. Palmer and M. Tatar. 2004. Drosophila dFOXO controls lifespan and regulates insulin signaling in brain and fat body. Nature 429, 562-6.

Jαokfton. A. IT.. A. T. Galeelri. D. T. Burke and R. A. Miller. 2002. Mouse looi associated with life span exhibit sex-speeifio and epistatie effects. J. Gerontol. A: Biol. Soi. Med. Sci. 57, B9-B15.

Jones, A., 2000. Does the plant mitochondrion integrate cellular stress and regulate programmed cell death? Trends Plant SeL 6, 225-30.

KenyonrO.. 2005. The plasticity of aging: insights from long-lived mutants. CeU 120. 449-60.

KMtwood. T. B. L. and S. N. Austαd, 2Uϋϋ, Why do we age? Nature 40«, 283- 238,

Kloc. M.. S. Bilinski and L. D. Etkin. 2004. The Balbioni body and germ cell determinants: 150 years later. OUIT. Top. Dev. Biol. 59. 1-36.

Kobayashi. S., K. Sato and Y. Hayashi. 200i5. The role of mitochondrial rRNAs and nanos protein in germ-line formation in Drosophila embryos. Zoolog. Sci. 22, 943-04.

Krakauer. D. O. and A. Mira, 1999. Mitochondria and germ-cell death. Nature 400, 123-C3.

Kujoth, Q. C, A. Hiona, T. D. Pugfh, S. Someya, K. Panzer, B. E. Wohlgemuth, T. Hofer, A. Y. WθO, R. JSullivan, W. A. Jobliπg, J. D. Morrow, H. Van Remmen, J. M. Sedivy, T. Yamasoba, M. Tanokura, R. Weindruch, C Leeuwenburgh and T. A. Prolla, 2006. Mitoohondi'ial DNA mutations, oxidative stress, and apoptoβis in mammalian Aging. Sciienee 309, 481-4.

Landis, G. N _M D. Bholβ and J. Tower, 2003. A search fox* doxycychiie- dependent mutations that- increase Droaophila melanoga&tβr life span identifies the VJwSFD, Sugar baby, filamin, fii'd and Cctl genes. Genome Biol 4, R8.

Landis, G. N. and J. Tower, 2003. Superoxide dismutase evolution and life span ϊβgτilαtiσn. Mech. Ageing Dev. 126, 385-79.

Lang, B. P., M. W. Gray and G. Burger, 1999. Mitochondrial genome evolution and the origin of eukaryotes. Annu. Rev, Genet. 33, 851-97.

P. L.. 1993. Aging and resistance to oxidative damage in Caenorhabάitϊa elegmtβ. Proc. Natl. Acad. Sci. U S A 90, 8905-9.

Lθθ, S. S., S. Kennedy, A. C. Tolonβn and G. Ruvkun, 2003. DAF- 16 target genes that control C. elegans life-span and metabolism. Science SOO, 644-7.

Lee, S. S., R. Y. Lθθ, A. G. Fraser, R. S. Ivamath, J. Ahringer and G. Ruvkun, 2003. A systematic RMAi screen identifies a critical role fox* mitochondria in. Q. elegaus longevity. Nat. Genet. 33, 40-8.

Leips, J,, P. Gilligan and T. F. Mαckay. 2005. Quantitative Tϊait LodL with Age-Specific Effects on Fecundity in Drosophilσ melanogaster. Genetics.

Leips, J. and T. F. Mackay. 2000. Quantitative trait loci for life span in ωi'oaaphila mβlauagaatβr: interactions with, genetic background and larval density. Genetics 155. 1773-88.

Line, M. A., 2005. A hypothetical pathway from the RNA to the DNA world. Orig. life Evol. Biosph. 35. 395-400.

Luelrinbill, L. S., R. Arking, M. Clare, W. Cii'ocoo and S. Buck, 1984. Selection for delayed senescence ho. Dvosαphilu midαiiαgαstαr. Evolution SS, θ96-100S.

Maokay, T. F. C, 2002. The nature of quantitative genetic variation for Drosophilα longevity. Mech. Ageing Dev. 123, 95-104.

Magwere, T., T. Chapman and L. Partridge, 2004. Sex differences in the effect of dietary restriction on life span and mortality rates in female and male Drct≤αphilα nielαnαgαάt&r. J. Gerontol. A: Biαl. Sci. Med. SdL. 59, 3-9.

Maiei'i B., W. Gluba, B. Bernier, T. Turner, K. Mohammad, T. Guise, A. Sutherland, M. Thornev and H. Her able, 2004. Modulation of mammalian life span by the short isoform of p53. Genes Dβv. 18, 306-19.

Man*. W., P. Goymer, S. D. Pletcher and L. Partridge, 2003. Demography of dietary restriction and death in Drosophila. Science 301, 1731-3.

Martin, G. M.. 2005. Genetic modulation of senescent phenotypes in Homo sαpkms. Cell 120, 523-32.

Maftoro. E. J., 2005. Overview of eolorio restriction and ageing. Mean. Ageing

McCulloch, D. and D. Gems, 2008. Evolution of male longevity bias in nematodes. Aging Cell 2, 165-73.

Millei\ P. M.» S. Gavrilβts and W. B. Rice, 2006. Sexual oonfliot via maternal- effect genes in ZW species. Science 312. 73.

Miller, R. A., 2005. Genetic approaches to the study of aging. J. Am. Geriatr. Soc. 5». S2»4-«.

Murphy. 0. T., S. A. MeCarroll, O. I. Bargmann, A. BVasβr. R. S. Ivtunαth, J. Ahringer, H. Li and G. Kenyon. 2003. Genes that act downstream of DAP-lβ to influence the lifespan of Caenorhabditia elegαna. Nature.

Nielsen, R., C Bustaniante, A. G. Clark, S. GlanowskL, T. B. Sackton, M. J, Hubisz, A. Medel-Alon, D. M. Tanenbaum, D. Civello. T. J. White, J. S. J, M. D. Adams and M. Cargill, 200δ. A scan, for positively selected genes in the genomes of humans and chimpanzees. PLoS Biol. 3, el70.

Nilsen, J. and R. D. Brintαn, 2004. λϋtechondi'ia as tbevapeutia targets of eβtrogen aotion in the central nervous βyβtβm. Curr. Drug Targets CNS Neurol. Disord. 3, 297-313.

NisMmura, Y., T. YoβMnari, K. Naruse, T. Yamada, K. Sumi, H. IS'iitani, T. Higashiyama and T. Kuroiwa, 2006. Active digestion of sperm mitochondrial DNA in fitαgle living sperm revealed by αptiαal tweezers. PLΌQ. Nαtl. Acad. Scά. I.T S A.

Nowak, M. A. and K. Sigmund, 2004. Evolutionary dynamics of biological games. Science 303, 793-9.

Nuzhdin, S. V., A. A. Ivhazaeli and J. W. Curtsinger, 2005. Survival analysis of life span quantitative trait loci in Dvosophila melanogaatβr. Genetics 170, 719-31.

Nuzhdin. S. V., E. G. Pasyukova, G. L. Dilda. Z.-B. Zeng and T. F. C. Mackay. 1997. Sex-specific quantitative trait loci affecting longevity in Droβophilα melcmogαster. Proc. Natl. Acad. Sci. USA 94, 9734-9739.

OhM. R.. T. Tfturimoto and F. Ifthϊkawa, 2001. Iia vitro reoonfttitution of the end replication problem. MoI. Cell Biol. 21, 6763-66.

Oliver, B. and M. Parisi, 2004. Battle of the Xs. Bioessays 26, 543-8.

Olovnikov, A. M., 1973. A theory of margiαotomy. The incomplete copying of template margin in enzymio synthesis of polynucleotides and biological significance of the phenomenon. J. Theor. Biol. 41. 181-90.

Parisi, M.. B. Nuttoll. P. Edwards, J. Minor, D. Nαiman, J. Lu. M. Dσctolero. M. Vainer. C Chan. J. Malley, &. Eastman and B. Oliver, 2U04. A survey of ovary-, testis-, and somα-biαsed gene expression in Di'osophilσ nwlauogaater adults. Genome Biol. 5, R40.

Pax-isi. M.. R. Nuttall. D. Nπimαn, Ck Bouffαrd. J- Malley. J. Andrews. S. Eastman and B. Oliver, 2003. Paucity of genes on the Drosophila X chromosome showing molebiased expi-ession. Science 295J, 697-700.

Parkβs. T. L.. A. J. EHa, D. Dickson. A. J. Hϋliker, J. P. Phillips and G. L. Boulianne, 1998. Extension of Drosophila lifespan by overexpression of Inunan SOOl in matornaurona. Nature Genet. 19, 171-174.

Partridge, L., S. D. Pletoher and W. Mair, 2005. Dietary restriction, mortality trajectories, risk and damage. Mech. Ageing Dev. 126, 35-41.

Pepling, M. E. and A. C Spradling, 2001. Mouse ovarian germ cell cysts undergo programmed breakdown to form primordial follicles. Dev. Biol. 234, 339-51.

Perls, T. λaad D. Teiα'y, 2003. Geneties of exceptional longevity. Exp. Gerontol. 38, 725-30.

Rand, D. M _M 2005. Mitochondrial genetics of aging: intergenomio conflict resolution. Sci. Aging Knowledge Envii'on. 2005, re(5.

Rand, D. M., A. Q. Clark and L. M, Kann. 2001. Sexually antagonistic eytonuclear fitness ύateractionβ in Drosophila malanogaster. Genetics 159, 173-87.

Rand, D. M.. A. Pry and L. Sheldahl, 2006. Nuelear-mitochondrial epistasis and Drosophila aging: inti-ogi-ession of Droβophiϊa simulaiiβ mtDNA modifies longevity in D, mehmogaster micleαr baclεgrounds. Genetics 172. 329-41.

Bauft<?r. CJ. L., J. J. Tierney, S. M. Gunion. G. M. C!ovarrubia«, L. D. Mueller and M. R. Rose, 2006. Evolution of late-life fecundity in Dvoaophila melcntogaβter. J. EvoL Biol. 19, 289-301.

Reiwitch, S. G. and S. V. Nuzhdin, 2002. Quantitative trait loci for lifespan of mated Drosophila mehmogaster affect both sexes. Genet- Res 80, 225-30.

Rice. W. R.. 1902. Sexually antagonistic genes: experimental evidence. Science 2(56, 1436-9.

Rice, W. R., 11)1)8. Male fitness increases when females are eliminated from gene pool: implications for the Y chromosome. Proc. Natl. Acad. Sci. U S A 95, 6217- 21.

Richards. S.. Y. Liu. B. R. Bettencourt. P. Hradecky. S. Letovsky. R. Nielsen. K. Thornton, M. J. Hubisa, R. Chen, R. P. Meisel, O. Couronne, S. Hua. M. A. Smith. P, Zhang, J. Liu, H. J. Bxissemaker, M. F. van Batenburg, S, L. Howells, S. E. Scherer. E. Sodergren, B. B. Matthews, M. A. Crosby, A. J. Schroeder, D. Ortiz- Barrientos. O, M. Rives, M. L. Metzker, D. M. Muzny. G. Scott. D. Steffen. D. A. Wheeler, K. C. Wαrlay, P. Havlalc, Iv. J. Durbiu, A. Egan, R. Gill. J. Hum©, M. B. Morgan, G. Miner, G. Hamilton, Y. Huang, L. Waldron, D. Verduzco, Iv. P. Clere- Blankenburg, I. Dubchak, M. A. Noor, W. Anderson, K. P. White, A. CJ. Clark, fS. W. Sohaeffer, W. Gelbart. Q. M. Weinstoek and R. A. Gibbe, 2005. Comparative genome sequencing of Drosophila paeudoobsciircr. chromosomal, gene, and cis -element evolution. Qenoina Res. 15, 1-18.

Rose, M. R., 1984. Laboratory evolution of postponed senescence in Dj'osopJiilα rnelcmogαάter. Evolution 38, 1004-1010.

Scheuring, L ₄ T. Czaran, P. Qzabo, Q. Karolyi and Z. Toroezkαi, 2003. Spatial models of prebiotdc evolution: soup before pizza? Orig. Life Evol. Biosph, 33, 319-55.

Searcy, D. Gr., 2003. Metabolic integration drøiαg the evolutionary origin of mitochondiia. Cell Bes. 13, 229-38.

fjpees. J. L.. S. D. Olson. M. J. Whitney and D. J. Proekop. 2006. Mitochondrial transfer between cells can rescue aerobic respiration. Proe. Natl. Acad. Sci. U S A.

Spencer,- C. C, C. E. Howell, A. R. Wright and D. E. Promislow, 2003. Testing an 'aging gene' in long-lived Drosophila strains: increased longevity depends on sex and genetic background. Aging Cell 2, 123-30.

Starr, D. J. and T. W. Gline, 2002. A host parasite interaction rescues Drosophila oogenesis defects. Nature 418, 76-y.

Stewart, E. J.. B. Madden, G. Paul and F. Taddei, 2005. Aging and death in an organism that reproduces by morphologically symmetric division. PLoS Biol. 3, e4δ.

Sun. J., D. Folk, T. »J. Bradley and _* J. Tower, 2002. Induced over expression of mitochondrial Mn-euperoxide dismutase extends the life span of adult Dvoaophila melanσgaster. Genetics 161, βθl-72.

Stin. J. and J. Tower, 1999. FLP recombmase -mediated induction of Cvi/Zn- superαxide dismutase ti-ansgena expression can extend tlia life span of adult Drosophila mehmogaster flies. MoL Cell Biol. 19, 216-28. yzathmary, E., 2000. The evolution of replicators. Philos. Trans. R. Boo. Lond. B: Biol. vSci. 355, 1669-76.

Tatar, M., A. A. Khazaeli and J. W. Curtsinger, 1997. Chaperoning extended life. Nature 3Q0, 30.

Tatai', M., A. Kopelman, D. EJpstein, M. P. Tu, C. M. Yin and R. S. Garofalo, 2001. A mutant Di'osopnila insulin receptor homolog that extends life-span and impairs neuroendocrine function. Science 292, 107-10.

Timmis, J. N,. M. A. Ayliffe. O. Y. Huang and W. Martin. 2004. Endosymbiotic gene trαnsfev: oi'gonelle genomes forgra eτikaryotie chromosome©. Nat. Eev. Genet, ό. 123-35.

Tyner, S. D., S. Venkatachalam, J. Choi, S. Jones, N. Ghebranious, H.

Igehnann, X. Lxi, G. Soron, B. Cooper, O. Brayton, S. Hee Pork, T. Thompson. G.

Karββnty, A. Bradley and L. A. Donehower. 2002. p5ft mutant mice that display eaiiy ageingassociated phenotypes. Nature 415, 45-53.

Valenzuela, R. K _M S. N. Forbes, P. Keim and P. M. Service, 2004. Quantitative trait loci affecting life span in replicated populations of Droaophila nieUmogttsTer. EL Response to selection. Genetics 168, 313-24. van. Heβrαst. D.. S. P. Mooijaavt. M. Beekmaiα. J. Schreuder. A. J. dθ Oraen. B. W. Brandt. P. E. Slagboom and R. G. Westendorp, 2005. Variation in the huinan TP53 gene affects old age survival and cancer mortality, Exp. Gerontol. 40, 11-5.

Vieii'a, C. E. G. Pasyukova. Z. B. Zeng. J. B. Hackett. B. P. Ljinan and T. F. Mαckαy, 2000, Genotype -environment interaction for quantitative trait loci affecting life 'span in Droaophila melauogσater. Genetics 154. 213-27.

Vina, J.. O. Bσrras, J, Gambini. J. Sastre and P. V. Pallardo. 2005. Why females live longer than males: control of longevity by sex hormonea. Sci. Aging Knowledge Environ. 200δ. pβl7.

Walker, G. A, T. M. White, G. McCoU, N. L. Jenkins, S. Babioh, E. P. Candida, T. E. Johnson and G. J. Litiigow, 2001. Hent ghoύlc protein accumulation is upregulated in a long-lived mutant of Caβnovhabditis etegans. J. Gerontol. A: Biol. Sei. Med. fc3ci. 56, B281-7.

Wallace, D. C, 200t5. A Mitoohondi-ial Paradigm of Metabolic and Degenerative Diseases, Aging, and Cancer: A Dawn for Evolutionary Medicine. Aimu. Rev. Genet.

Walter, R _M D. M. Muraβko and F. Sierra, 1998. T-kininogen iβ a biomarkβr of senescence in rats. Mech. Ageing DθV. 106, 129-44.

Wang, M. H., O. Lazebny, L. G. Harshman and S. V. Nuzhdin, 2004. EnλTronment-dependent sux^lval of Droβophila melanσgaβteπ a quantitative genetic analysis. Aging Cell 3, 133-40.

WiIk. K. S. BiKnski. M. T. Dougherty _ou d M. Ivloc, 2005. Delivery of germinal granules and localized BNAs via the messenger transport organizer

pathway to the vegetal cortex of Xenopus oocytes occurs through directional expansion of the initochondrial cloud. Int. J. Dev. Biol. 49, 17-21.

Wolfiaer, ]\'I. F., 2002. The gifts that keep on giving: physiological functions and evolutionary dynamics of male seminal proteins in Droaophila. Heredity 88, 86- 93.

Yin. V. P. and O. S. Thvuumβl. 2005. Mechanisms of steroid-triggered programmed cell death, in Drosophila. Seniin- OeU. Dev. Biol, lβ, 237-43.

Zheng. J.. S. W. Edehnan, G. Thαi'mαrαjoh. D. W. Walker, S. D. Pletcher and L. Seroudø. 2005. Differential patterns of αpoptosis in response to aging in Drosophila. Proc. NαtsL Acad. Sci. XT S A 102. 12083-8.

so

Sl