Background to the Invention Vectors are frequently used to clone and express genes. In particular, the polymerase chain reaction (PCR) is often used to extend a partial clone of a gene in order to obtain the full-length coding sequence of that gene. Those sequences can then be cloned into vectors for their expression in a suitable host cell. In general, it is desirable that genes are inserted in the correct orientation in the vectors and with high efficiency. The genes must then be expressed at appropriate levels from the vectors.

Marker genes have typically been used to enable screening of host cells, to identify those cells which have been transformed with a suitable vector. There are a number of ways in which proteins expressed from vectors may be analysed. In addition, it may be desirable to express such a protein fused to a suitable tag to aid in the identification and/or purification of the protein.

Summary of the Invention According to the invention there is provided a vector for the cloning and expression of a polypeptide-encoding polynucleotide, which vector comprises: (a) a promoter; (b) a ligation-independent cloning (LIC) site; (c) at least one nucleic acid sequence encoding a tag; and (d) a nucleic acid sequence encoding a first reporter polypeptide, wherein a polypeptide-encoding polynucleotide cloned into the LIC site, when expressed, is expressed as a fusion polypeptide with the tag (s) and transcription of a

polypeptide-encoding polynucleotide cloned into the LIC site is coupled to transcription of the nucleic acid sequence encoding a first reporter polypeptide.

The invention also provides: -a vector of the invention which vector further comprises a polynucleotide- encoding polypeptide located at the LIC site; -a cell harbouring a vector of the invention or a vector of the invention which vector further comprises a polynucleotide-encoding polypeptide located at the LIC site ; -a method for cloning a polypeptide-encoding polynucleotide, which method comprises: (a) providing a vector of the invention; (b) treating the vector with a restriction enzyme to cut the vector within the LIC site; (c) treating the vector with an enzyme that has exonuclease activity; (d) amplifying the polypeptide-encoding polynucleotide by PCR using a primer which comprises a nucleotide sequence complementary to one end of the said polynucleotide and a nucleotide sequence complementary to one of the linear overhangs of the vector obtained in step (c) and a primer which comprises a nucleotide sequence complementary to the other end of the said polynucleotide and a nucleotide sequence complementary to the other linear overhang of the vector obtained in step (c); (e) treating the PCR product obtained in step (d) with an enzyme having exonuclease activity; annealing the vector obtained in step (c) and the PCR product obtained in step (e); and (g) introducing the vector obtained in step (f) into a cell.

-a method for the expression of a polypeptide fused to at least one tag, which method comprises maintaining a cell harbouring a vector of the invention which vector further comprises a polypeptide-encoding polynucleotide located at the LIC site under conditions suitable for the expression of the polypeptide fused to the tag (s); and

-a method for the preparation of a polypeptide fused to at least one tag, which method comprises expressing a polypeptide fused to the tag by use of a method of the invention for the expression of a polypeptide fused to at least one tag and recovering the polypeptide fused to a tag (s).

Description of the Figures Figure 1 is a schematic drawing of an illustrative vector according to the present invention.

Brief Description of the Figures SEQ ID NO. 1 sets out the DNA sequence of the parent vector 905.2.

Detailed Description of the Invention We have constructed a family of vectors which allow for easy and rapid cloning of substantially any polynucleotide which encodes a polypeptide, for example the full-length coding sequence of a gene of interest. Furthermore, a vector of the invention allows for the expression of a polypeptide encoded by a polynucleotide cloned into a said vector in a variety of different cell types.

A vector of the invention comprises a promoter, ligation-independent cloning (LIC) site, one or more nucleic acid sequences which encode tags and a nucleic acid sequence encoding a first reporter polypeptide. When a polynucleotide which encodes a polypeptide is cloned into the LIC site and subsequently expressed, the polypeptide so-expressed is expressed in the form of a fusion protein, fused to the tag or tags. In addition, transcription of the polypeptide-encoding polynucleotide cloned into the LIC site is coupled to transcription of the nucleic acid sequence encoding a first reporter polypeptide.

Typically, a vector also comprises a nucleic acid sequence which encodes a a second reporter polypeptide. If two reporter polypeptide-encoding nucleic acids are used, the two nucleic acids will typically encode different reporter polypeptides.

Expression of the first reporter polypeptide can be used to identify cells which harbour a vector of the invention. For example, the reporter polypeptide may confer resistance to an antibiotic on cells in which it is expressed.

A nucleic acid sequence encoding a second reporter polypeptide is typically located in a vector such that introduction of a polypeptide-encoding polynucleotide (e. g. the full-length coding sequence of a gene of interest) into the LIC site leads to elimination or inactivation of the nucleic acid encoding a second reporter polypeptide. Typically introduction of the polypeptide-encoding polynucleotide is such that it replaces all or part of the nucleic acid sequence encoding a second reporter polypeptide. Thus, introduction of a polynucleotide of interest may be detectable by the loss of activity of the second reporter polypeptide. This may allow for quick and easy screening of candidate cells which may contain vectors into which a polynucleotide of interest has been cloned. For example, if the reporter polypeptide is Green Fluorescent Protein (GFP), loss of fluorescence may be used to indicate the presence of a polynucleotide of interest at the LIC site.

All of the elements of a vector of the invention are positioned so as to be operably linked. The term"operably linked"refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. For example, a promoter,"operably linked"to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.

A vector of the invention may be any type of vector known to those skilled in the art. However, the vector will typically be a circular vector, for example a plasmid, cosmid or binary vector. Viral and phage vectors may be vectors of the invention, but the efficiency of ligation-independent cloning may be reduced in such linear vectors as compared with circular vectors. A vector of the invention may be used in vitro, for example for the production of DNA or RNA corresponding to the polynucleotide cloned at the LIC or may be used to transfect or transform a host cell, for example, a mammalian host cell.

A promoter for use in a vector of the invention may be any suitable promoter. Generally, the choice of promoter will depend on the host cell to be used for expression of the polynucleotide of interest. For example, if a bacterial protein is being studied, expression in bacterial cells is likely to be required and therefore the promoter will typically be a bacterial promoter. Alternatively, the study of mammalian proteins is likely to require expression in a mammalian host cell and

thus, a mammalian promoter will be preferred. Mammalian promoters include the metallothionein promoter which can be induced in response to heavy metals such as cadmium. Viral promoters such as the SV40 large T antigen promoter or adenovirus promoters may also be used. All these promoters are readily available in the art.

Mammalian promoters, such as p-actin promoters, may be used. Tissue- specific promoters may be used. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR). Viral promoters are readily available in the art.

In any host cell, constitutive promoters, for example the CMV promoter in the case of mammalian cells, are preferred.

A ligation-independent cloning (LIC) site is used to insert a polypeptide- encoding polynucleotide (i. e. a polynucleotide of interest) which has been amplified by polymerase chain reaction (PCR). The use of ligation independent cloning is described in, for example, Aslandis & Jong (NAR 18,1990,6069-6074). A vector of the invention is provided with a LIC site which allows for the introduction of the amplified polynucleotide of interest at an appropriate position in the vector. Thus, a vector of the invention will typically comprise an LIC site located 3'to the promoter.

An LIC site comprises one or more, for example two, recognition sites for a restriction enzyme. However, preferably the LIC site comprises two restriction enzyme sites. If the LIC site comprises two restriction enzyme sites, typically the restriction enzyme sites will be recognized by the same restriction enzyme. For example, the LIC may comprise two FseI or BsgI sites. In order to clone a polynucleotide of interest into the LIC site, the vector is linearised, if the vector is a circular vector, by treating the vector with a restriction enzyme (s) which cuts the restriction site (s) making up the LIC. Following linearisation, the linearised vector is treated with an enzyme which has exonuclease activity. The enzyme may have 3' to 5'or 5'to 3'exonuclease activity. Suitable enzymes include T4 DNA

polymerase, exonuclease III and any proof reading enzyme, for example DNA polymerase from Pyrococcusfuriosus. T4 DNA polymerase is preferred. The exonuclease treatment results in the formation of single stranded overlaps at each end of the linearised vector. 5'-or 3'-extending single-stranded overlaps, depending on the exonuclease activity of the particular enzyme used will result.

Preferably T4 DNA polymerase is used in the presence of a specific dNTP, leading to the generation of a vector with 5'-extending single-stranded overlaps, potentially, of a defined sequence and length.

The two extending single-stranded overlaps will typically have different sequences that are not capable of annealing to each other. This has two consequences: (i) the vector-ends will not reanneal to reform a vector which does not comprise a polypeptide-encoding polynucleotide; and (2) the polypeptide- encoding a polynucleotide can only be inserted in one orientation in the vector.

The polynucleotide of interest is amplified using a suitable amplification technique, for example PCR. Typically, two oligonucleotides are used to carry out the amplification step. Both comprise nucleic acid sequence complementary to that of the polynucleotide of interest and nucleic acid sequence complementary to that of the overhangs of the vector. The resulting PCR product is treated with an enzyme which has exonuclease activity, in the same way as the vector is treated.

One oligonucleotide comprises sequence complementary to one end of the polynucleotide of interest and sequence complementary to one of the overhangs of the vector. The second oligonucleotide comprises sequence complementary to the other end of the polynucleotide of interest and sequence complementary to the other overhang of the vector.

The design of suitable oligonucleotides for use in LIC will be apparent to those skilled in the art. Suitable oligonucleotides suitable for use in the may be of any convenient size, for example up to about 50 nucleotides in length or up to about 40 nucleotides in length and for example at least 15 nucleotides in length, at least 20 nucleotides in length or at least 30 nucleotides in length, such as from about 20 to about 50 nucleotides in length or from about 25 to about 40 nucleotides in length.

Suitable oligonucleotides typically comprise sequence complementary to the polynucleotide of interest and sequence complementary to the vector. Typically

about half of the nucleotides of an oligonucleotide will be complementary to the vector and the other half will be complementary to the polynucleotide of interest.

However, if required, one or more, for example up to about 3, up to about 5, or up to about 8 mismatches may be introduced, provided that the oligonucleotide retains the ability firstly to amplify the polynucleotide of interest and secondly to provide an overhang which has a high enough degree of complementarity to anneal to the vector.

The PCR product and vector, which have complementary single-stranded overhangs at each of their ends, are contacted with each other, such that they anneal to each other. A vector is thus formed which comprises the polynucleotide of interest at the LIC site. The invention therefore also provides a vector which comprises a polypeptide encoding polynucleotide or, to put it another way, a polynucleotide which encodes a polypeptide of interest. Annealed vectors may be introduced into host cells for multiplication of the vector and/or expression of the polypeptide encoded by the polynucleotide of interest. The promoter of a vector of the invention will typically be capable of driving expression of the polypeptide- encoding polynucleotide cloned at the LIC site.

Vectors of the invention also comprise at least one nucleic acid sequence which encodes a tag, for example an affinity tag and/or an epitope tag. A nucleic acid sequence encoding a tag is positioned within the vector such that a polynucleotide inserted at the LIC site, when expressed, is expressed as a fusion protein together with the tag or tags. A tag may be located 5'to the LIC and 3'to the promoter (i. e. between the promoter and the LIC site) site or may be located 3' to the LIC site. In addition a tag may be provided both 5'and 3'to the LIC site.

These vectors will allow for the expression of a fusion protein in which the tag is at the N-terminus of the protein, the C-terminus of the protein or both respectively.

Furthermore, more than one nucleic acid sequence encoding a tag may be placed 5' and/or 3'to the LIC site. For example, 2, up to 5, up to 8 or up to 10 tags may be placed 5'and/or 3'to the LIC site. Different numbers of nucleic acid sequences encoding tags may be placed 5'and 3'of the LIC site. When two or more nucleic acid sequences encoding tags are used 5'and/or 3'to the LIC site, they may be different, or oligomers or concatamers of a particular tag.

A tag may provide for easy identification of an expressed polypeptide for example by use of an antibody if the tag is an epitope that can be recognised by an antibody. Alternatively, the tag may facilitate purification of the expressed polypeptide, if the tag may be bound to a solid support matrix for example. Any suitable tag may be used. Examples of suitable tags include a HA tag, a myc tag, a His8 tag, a His6 tag, a ZZ tag, an eGFP tag, an EGFP tag, a calmodulin binding protein, thioredoxin, glutathione S-transferase, a strep tag, a biotinylation sequence, a FitG epitope, a KT3 epitope, a FLAG epitope, an EEF epitope or a concatamer or oligomer of any thereof. Oligonucleotides used for the amplification of the polynucleotide of interest are designed such that the cloning of the polynucleotide into the LIC results in an in-frame fusion to any nucleic acid sequence encoding a tag that is present 5'and/or 3'of the LIC site.

A vector of the invention also includes a nucleic acid which encodes a first reporter polypeptide. Typically, the first reporter polypeptide allows selection of host cells which harbour a vector of the invention. For example, the reporter polypeptide may confer antibiotic resistance on a cell which expresses the said polypeptide. Suitable polypeptides include those that confer resistance to antibiotics, for example neomycin, hygromycin, zeocin or bleomycin.

A polynucleotide encoding a first reporter polypeptide is typically 3' to the LIC site and 3'to a nucleic acid sequence encoding an N-terminal tag, if such a tag-encoding nucleic acid sequence is present. The arrangement is such that the transcription of a polynucleotide inserted at the LIC site (and of a tag-encoding nucleic sequence located 3'thereto, if present) is coupled to transcription of the nucleic acid sequence encoding a first reporter polypeptide. Translation of the sequence cloned at the LIC (with its tag or tags if present) and translation of the first reporter polypeptide are typically independent. Therefore, a nucleic acid sequence is typically present 5'to the first polypeptide-encoding nucleic acid sequence which is a ribosome binding site (RBS). Any suitable RBS may be used. A preferred sequence is the internal ribosome entry site (IRES), see for example: Rees et al.

(1996) Biotechniques, 20,102-110; Jackson et al. (1990) Trends in Biochem. Sci.

15, 477-483; and Jang (1998) J. Virol. 62,2636-2643.

Preferably, an intron, for example an artificial intron, is provided immediately 5'to the IRES if one is present, or immediately 5'to the nucleic acid sequence encoding a first reporter polypeptide. Such an arrangement has been found to assist in the expression of the first reporter polypeptide In a preferred aspect of the invention, vectors are provided with a nucleic acid sequence which encodes a second reporter polypeptide. The second reporter polypeptide may be used to indicate vectors into which a polynucleotide of interest has been successfully incorporated at the LIC site. A second reporter polypeptide- encoding nucleic acid sequence may be used in vectors which have an LIC site comprising two restriction enzyme sites. The second reporter-polypeptide encoding nucleic acid sequence is typically located between those two restriction enzyme sites. Digestion of the vector comprising a nucleic acid encoding a second reporter polypeptide with restriction enzymes specific for the LIC will result in loss of that nucleic acid sequence. When reannealing takes place with a polynucleotide of interest, the vector will be reformed, but will lack the second reporter polypeptide activity. Thus, introduction of a polynucleotide of interest at the LIC site will generally result in loss of the nucleic acid sequence encoding a second reporter polypeptide. Therefore, loss of activity of the reporter polypeptide may be used to indicate successful cloning of a polynucleotide of interest.

Typically, the polynucleotide encoding a second reporter polypeptide is provided as a construct such that expression of the second reporter polypeptide is under the control of a promoter i. e. a promoter placed immediately 5'to the nucleic acid sequence encoding a second reporter polypeptide. Usually, a bacterial promoter is used, so that the results of cloning experiments may be screened using bacterial cells. Suitable bacterial promoters, for example a constitutive promoter will be well-known to those skilled in the art.

Preferably, the second reporter polypeptide is one which may be identified by fluorometric or colourimetic analysis. Examples of suitable reporter polypeptides include green fluorescent protein (GFP), cytochrome B5 ß- galactosidase.

Optionally, a vector of the invention may comprise further elements. For example, a vector may comprise a nucleic acid sequence located between a

polynucleotide of interest cloned at the LIC site and any tag located 5'and/or 3' thereto, which nucleic acid sequence encodes a peptide sequence which is recognised by a proteinase. Thus, the tag or tags can be cleaved from the polypeptide of interest by contacting the expressed polypeptide of interest fused to a tag or tags with a proteinase. If two or more sequences encoding tags are present 5' and/or 3'of the LIC site, nucleic acid sequences encoding proteinase cleavage sites may be present between the tag encoding sequences. If different proteinase cleavage sites are used in a single vector, this may allow for the specific removal of one or more tags from a polypeptide of interest. Any sequence which codes for a proteinase cleavage site may be used. Examples of suitable proteinase cleavage sites include those cleaved by the tobacco etch virus NIa proteinase or thrombin.

Optionally, a vector of the invention may comprise sequences which permit control over the expression of the polypeptide of interest. Such control may be useful, for example, if the production of a toxic protein is required. Control over expression is useful in such circumstances because production of the polypeptide of interest can be delayed until desired. Thus, vectors of the invention may comprise a reverse transcript of an inducible translational-regulator, for example the iron- responsive element (IRE) region of ferritin light chain mRNA and a reverse transcript of a stabilizing element, said stabilizing element being, for example, the message-masking element (MME) of the ferritin light-chain mRNA. The two elements, if present, are located 5'to the LIC site or 5'to a nucleic acid sequence encoding a tag located 5'to the LIC site, should such a sequence be present. The two elements mentioned, the IRE region of ferritin light chain mRNA and the message-masking element (MME) of the ferritin light-chain mRNA can be used to control expression of a polynucleotide of interest cloned at the LIC site. The IRE can be induced in the presence of ions. In the absence of iron ions the IRE sequence binds a repressor protein, but in the presence of iron the repressor protein no longer binds the IRE and the translation is derepressed. The de-repression is believe to occur thorough the inactivation of the repressor protein. The MME element stabilizes an RNA in which it is contained and protects it from degradation, i. e. it is a stabilizing element. This iron-inducible control system is described in detail in, for example, US-A-5,342,782.

The invention further provides a vector which comprises a polypeptide- encoding polynucleotide cloned into the LIC site. Substantially, any polypeptide- encoding polynucleotide can be cloned at the LIC site. Suitable polynucleotides include genomic DNA sequences (for example comprising intronic sequences) cDNA sequences and other coding sequences. Full length sequences or fragments thereof are suitable. A vector of the invention may comprise the human glucocorticoid receptor sequence or the human presenilin 1 full length coding sequence.

The invention also provides a cell which harbours a vector of the invention or a vector of the invention which comprises a polypeptide-encoding polynucleotide. Such cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast or prokaryotic cells such as bacterial cells, for example Escherichia coli cells.

Particular examples of cells which may be modified by insertion of vectors according to the invention include mammalian HEK293T, CHO, HeLa and COS cells. Preferably the cell line selected will be one which is not only stable, but also allows for mature glycosylation and cell surface expression of a polypeptide.

Expression may be achieved in transformed oocytes. A polypeptide of the invention may also be expressed in Xenopus laevis oocytes or melanophores.

A cell of the invention may be use to produce a multicellular organism.

Therefore, a polypeptide of the invention may be expressed in cells of a transgenic non-human animal, for example a rodent, such as a mouse. A transgenic non- human animal expressing a polypeptide of the invention is included within the scope of the invention.

The present invention also provides a method of cloning and expressing a polynucleotide of interest as a fusion protein, i. e. fused to a tag sequence (s). A vector of the invention comprising a promoter, a ligation independent cloning site and at least one nucleic acid sequence encoding a tag and a nucleic acid sequence encoding a first reporter polypeptide is treated with a restriction enzyme to linearise the vector at the ligation independent cloning site. If the LIC site comprises two restriction enzyme sites, the vector may have to be digested with two restriction

enzymes. If both restriction sites are recognised by the same restriction enzyme, clearly only one restriction enzyme is required.

Following linearisation, in the case of a circular vector, the vector is treated with an enzyme which shows exonuclease activity. This treatment leads to single- stranded overlaps, either 5'or 3'overlaps depending on the enzyme used, at the ends of the linear vector fragment. Any suitable enzyme which has exonuclease activity may be used. If T4 DNA polymerase is used, a specific dNTP i. e. dGTP, dCTP, dATP or dTTP may be included in the exonuclease reaction. The appropriate choice of dNTP, if one is to be used, will depend on the specific sequence to be recessed and will be apparent to those skilled in the art.

A polynucleotide of interest is amplified, by PCR for example, using suitable oligonucleotides and is treated with an enzyme which shows exonuclease activity. Suitable oligonucleotides are described above. Any suitable exonuclease may be used. Again, if T4 DNA polymerase is used, a specific dNTP, may also be included in the exonuclease reaction.

In this way, a polynucleotide of interest is amplified and single stranded overlaps generated at the ends of the polynucleotide of interest. The overlaps will be such that they can anneal to the single stranded overlaps of the linearised vector.

The oligonucleotides used to amplify the polynucleotide of interest are designed so as to ensure that this is the case. The linearised vector and amplified polynucleotide of interest are then contacted and left to anneal to reform a vector.

The annealed vectors are then introduced into a suitable strain of host cells, such as a bacterial cell strain, for example E. coli. Alternatively, the DNA may be transfected into a suitable mammalian cell. Colonies which harbour a vector of the invention may be selected by selecting for the presence of a nucleic acid sequence which encodes a first reporter polypeptide. For example, where the first reporter polypeptide confers antibiotic resistance on a cell, the host cells are selected by culture in the presence of the appropriate antibiotic. Surviving cells are those which have been successfully transformed with the vector.

Where a second reporter polypeptide-encoding polynucleotide is incorporated at the LIC site, vectors may be transformed into a host cell such as a bacterial cell, for example E. coli. The second reporter polypeptide may be used to

identify those cells which harbour a vector comprising a polynucleotide of interest.

Therefore, cells are selected which do not show activity of the second reporter polypeptide, for example, by assaying for the absence of fluorescence, if the second reporter polypeptide is a fluorescent polypeptide such as GFP.

The invention also provides a method for expressing a polypeptide encoded by a polynucleotide of interest fused to a tag or tags. The method comprises maintaining a cell or cells harbouring a vector of the invention which vector comprises a polypeptide-encoding polynucleotide at the LIC site, under conditions suitable for obtaining expression of the polypeptide. Optionally, the fusion polypeptide so expressed may be purified. Thus, the invention also provides a method for the preparation of a polypeptide encoded by a polynucleotide of interest fused to a tag. If the vector gives rise to a proteinase recognition sequence located between the polypeptide of interest and tag, the tag may be removed by contacting the fusion polypeptide with a suitable proteinase. Optionally, the tag may then be separated from the polypeptide of interest, by solid-phase chromatography for example. If more than one tag is present, one or more of the tags may be removed individually, should more than one type of proteinase cleavage site be present.

The following Examples illustrate the invention: Examples Example 1: Construction of the vectors Materials The expression vector pIRESneo was purchased from Clontech. pEGFP and pGFPuv, vectors containing the eGFP and uvGFP genes were also purchased from Clontech. Expression vector pEZZ, used as a source of the ZZ affinity tag was purchased from Pharmacia. All oligonucleotides were purchased from LifeTechnologies.

Methods Unless otherwise indicated, the methods used are standard biochemistry and molecular biology techniques. Examples of suitable general methodology textbooks include Sambrook et al., Molecular Cloning, A Laboratory Manual (1989) and Ausubel et al., Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc.

The vectors were all constructed using a combination of PCR and ligating pairs of oligonucleotides into plasmids that had been cut with restriction enzymes.

A detailed schema for construction of the vector family is set out below.

Protocol for generating LIC vector family 1. Parent 905.2 was cut with EcoRl and Srfl 2. Large fragment from 1 was excised and dephosphorylated 3. Annealed oligo pair 1 was klenow filled, cut with Srfl/EcoRl 4.3 was cloned into 2 to give construct 1 (N-HA: Fsel) 5. Parent 905.2 was cut with Bsp106 and Srfl 6. Large fragment from 6 was excised and dephosphorylated 7. Annealed oligo pair 2 was klenow filled, cut with Srfl/Bsp106 8.7 was cloned into 6 to give construct 2 (C-HA: Fsel) 9. construct 1 was cut with Bsp106 & EcoRl 10. annealed oligo pair 3 cloned into 9 to give construct 3 (N-His8: Fsel) 11. construct 2 was cut with Fsel & Srfl 12. annealed oligo pair 4 cloned into 11 to give construct 4 (C-His8: Fsel) 13. ZZ gene amplified using oligo pair 5 from plasmid pEZZ18 (Pharmacia) and cut with EcoRl & Bsp106 14. ZZ gene amplified using oligo pair 6 from plasmid pEZZI8 (Pharmacia) and cut with Fsel & Srfl 15. eGFP gene amplified using oligo pair 7 from plasmid pEGFP (Clontech) and cut with EcoRl & Bspl 06 16. eGFP gene amplified using oligo pair 8 from plasmid pEGFP (Clontech) and cut with Fsel & Srfl 17.13 was cloned into 9 to give construct 5 (N-ZZ: Fsel) 18.14 was cloned into 11 to give construct 6 (C-ZZ: Fsel) 19.15 was cloned into 9 to give construct 7 (N-eGFP: Fsel) 20.16 was cloned into 11 to give construct 8 (C-eGFP : Fsel) 21. construct 1 was cut with Fsel 22. annealed oligo pair 9 was cloned into 21 to give construct 9 (N-HA: Bsgl) 23. construct 3 was cut with Fsel 24. annealed oligo pair 9 was cloned into 23 to give construct 10 (N-His8: Bsgl) 25. construct 4 was cut with Fsel 26. annealed oligo pair 9 was cloned into 25 to give construct 11 (C-His8: Bsgl) 27. GFPuv gene was amplified using oligo pair 10 from plasmid pGFPuv (Clontech)

28. construct 9 was cut with Stul 29.27 was cloned into 28 to give construct 12 (N-HA: Bsgl lights-out) 30. construct 10 was cut with Stul 31.27 was cloned into 30 to give construct 13 (N-His8: Bsgl lights-out) 32. construct 11 was cut with Stul 33.27 was cloned into 32 to give construct 14 (C-His8: Bsgl lights-out) 34. construct 9 was cut with EcoRl 35. annealed oligo pair 11 was cloned into 34 to give construct 15 (N-HA-His8- TEV: Bsgl) 36. construct 7 was cut with Fsel 37. construct 8 was cut with Fsel 38. annealed oligo pair 9 was cloned into 36 to give construct 16 (N-egfp: Bsgl) 39. annealed oligo pair 9 was cloned into 37 to give construct 17 (C-egfp: Bsgl) 40. construct 16 was cut with Stu 1 41. construct 17 was cut with Stu 1 42.27 was cloned into 40 to give construct 18 (N-egfp: Bsgl lights-out) 43.27 was cloned into 41 to give construct 19 (C-egfp : Bsgl lights-out) Oligonucleotide pairs used for the preparation of the vector family No. Upper primer Lower primer 1 ATAAGAATGAATTCGGAAGTGGAAGTGGCCGGCC ATTCTTATGCCCGGGCTTACAAGTCTTCTTCAG AATCCAACCTCCGAACAAAAGCTTAT AAATAAGCTTTTGTTCGGAGGTTGGAT 2 ATAAGAATATCGATCAGGAAGTGGAAGTGGCCGG ATTCTTATGCCCGGGCTTATGCGTAGTCGGGCA CCAATTACCCCTACGACGTGCCCGAC CGTCGTAGGGGTAATTGGCCGGCCACT 3 CGATCGCCACCATGCACCACCATCACCACCATCAC AATTCGTGGTGATGGTGGTGATGGTGGTGCAT CACG GGTGGCGAT 4 CCAATTACCCCTACGACCACCACCACCACCACCAC GGGCTTAGTGGTGGTGGTGGTGGTGGTGGTGG CACCACTAAGCCC TCGTAGGGGTAATTGGCCGG 5 GAATAAGATCGATCGCCACCATGACGATGAAGCC GAGCTCGAATTCGACGTCTACTTTC GTAGACAAC 6 GAATAAGGGCCGGCCAATTACCCCTACGACCATG ATTCTTATGCCCGGGCTCAGGGTACCGAGCTCG ACGATGAAGCCGTAGACAAC 7 GAATAAGATCGATCGCCACCATGGTGAGCAAGGG GAATAAGGAATTCCTTGTACAGCTCGTCC 8 GAATAAGGGCCGGCCAATTACCCCTACGACGCCA ATAAGTGCCCGGGCTTACTTGTACAGCTCGTCC CCATGGTGAGCAAG 9 AAATTTAAATTTCTGCACAGGCC'I'GTGCAGTTTAA TTTAAATTTAAACTGCACAGGCCTGTGCAGAA ATTTAAACCGG ATTTAAATTTCCGG 10 GGAAGTGGAAGTGGCTCCCGACTGGAAAGCGGGC GGAAGGTTGGATTGGCTTAGCGACCGGCGCTC AGTTGG 11 AATTCCACCACCACCACCACCACCACCACGAGAA AATTGGGATCCCTGGAAGTACAGGTTCTCGTG CCTGTACTTCCAGGGATCCC GTGGTGGTGGTGGTGGTGGTGG Summary of the Vector Family Generated No.N-tag C-tag UvGFP Linearisation 1 HA Myc No Fse1-1 site 2 none HA No Fse1-1 site 3 His8 Myc No Fse1-1 site 4 none His8 no Fse1-1 site 5 ZZ Myc no Fse1-1 site 6none ZZ no Fse1-1 site 7 eGFP Myc no Fse1-1 site 8none EGFP no Fse1-1 site 9 HA Myc no Fse1-1 site 10His8 Myc no Bsg1-2 sites 11 none His8 no Bsg1-2 sites 12 HA Myc yes Bsg1-2 sites 13 His8 Myc yes Bsg1-2 sites 14none His8 yes Bsg1-2 sites 15HA-His8-TEV Myc yes Bsg1-2 sites 16 eGFP Myc no Bsg1-2 sites 17none EGFP no Bsg1-2 sites 18eGFP Myc yes Bsg1-2 sites 19 none EGFP yes Bsg1-2 sites

The vectors are used by first linearising with either Fsel (1 to 8) or Bsgl (9- 15). For the Bsgl vectors a stuffer fragment is released, which is either small or contains the uv-GFP gene. The vector is then treated with T4 polymerase together with dCTP, giving rise to single-stranded overlaps at the ends of the linear DNA fragment such as these shown below: ..... TTC CCAATCCAACCTCCGAA.......

..... AAGCCTTCACCTTCACC CTT.......

The gene of interest is amplified by PCR using the primers shown below, and then treated with T4 polymerase and dGTP in the same way as the vector. The two DNAs are then mixed, left to anneal before transforming into a suitable strain of E. coli. Recombinants are then selected and the DNA sequence is reconfirmed by sequencing. The DNA can then be transfected into a suitable mammalian cell, and colonies can be selected by culture in the presence of neomycin.

PCR Primers Used for Gene Recover T agging Upper Primer Lower Primer Vectors N-terminal GGAAGTGGAAGTGGCXXX... GGAGGTTGGATTGGCTTAXXX... 1,3,5, single tag 7, 9, 10, 12,13, 15,16, 18 doubletag GGAAGTGGAAGTGGCXXX... GGAGGTTGGATTGGCXXX... 1,3,5, 7,9,10, 12,13, 15, 16, 18 C-termina AGGAAGTGGAAGTGGCCACCATGXXX... GTAGGGGTAATTGGCXXXXXXX... 2,4,6, single tag 8, 11, 14, 17, 19

XXX indicates either the first three nucleotides of the recombinant cDNA in the upper primers, or the reverse compliment of the last three (not including the termination codon) in the lower primers.

The LIC overlap sequences are shown in bold. For the C-terminal tagged upper primer, a Kozak sequence (CCACC) is included.

Example 2 The gene for human glucocortocoid receptor was amplified by PCR using the following oligonucleotides: GGAAGTGGAAGTGGCATGGACTCCAAAGAATCATTAAC & GGAGGTTGGATTGGCTTACTTTTGATGAAACAGAAGTTTTTTG. The nucleotides shown in bold are complimentary to the DNA encoding the receptor, while those in normal text are complimentary to the LIC overhangs. PCR product was cleaned using the Wizard PCR purification system from Promega and treated with T4 polymerase and dGTP according to published procedures. Vector number 13 was digested with Bsgl and treated with T4 polymerase and dCTP. The two DNA species were then mixed, left for 30 minutes at room temperature then transformed into E. coli strain DHSa. The resulting colonies were counted under a fluorescent light (84% were non-fluorescent) and 10 non-fluorescent ones were selected. Plasmid DNA was prepared from these bacteria and they were analysed for the presence of receptor by restriction digestion. 9 out of 10 contained the glucocortocoid receptor. One clone was sequenced and used to transiently transfect HEK cells with selection using G418. The transfected pool of cells expressed His8 tagged glucocortocoid receptor, as judged by

Western Blot. Unexpectedly, it was found the the same construct would not support expression in HeLa cells.

Example 3 The gene for human presenilin 1, Genbank accession number L42110, was amplified by PCR from a cDNA using the following two pairs of oligonucloetides : Pair 1 (for N-terminus tagging) GGAAGTGGAAGTGGCACAGAGTTACCTGCACCGTTGTCC GGAGGTTGGATTGGCTTAGATATAAAATTGATGGAATGC Pair 2 (for C-terminus tagging) AGGAAGTGGAAGTGGCCACCATGACAGAGTTACCTGC GTAGGGGTAATTGGCGATATAAAATTGATGGAATGC The nucleotides shown in bold are complimentary to the DNA encoding the receptor, while those in normal text are complimentary to the LIC overhangs. PCR product was cleaned using the Wizard PCR purification system from Promega and treated with T4 polymerase and dGTP according to published procedures. Vectors numbers 2 & 8 were digested with Fsel while vector 14 was digested with Bsgl.

All were then treated with T4 polymerase and dCTP. The purified and treated insert and vector DNA species were then mixed, left for 30 minutes at room temperature then transformed into E. coli strain DH5a. DNA sequence was confirmed for all the clones that were progressed, and a representative of each type was then used to transfect HEK cells. Expression of recombinant presenilin 1 was confirmed by Western blotting.