2

3

4

5

6

7

8

9 0 1 2 CYTOSTATIN I 3 4 This invention relates, in part, to newly identified 5 polynucleotides and polypeptides; variants and derivatives 6 of the polynucleotides and polypeptides; processes for 7 making the polynucleotides and the polypeptides, and their 8 variants and derivatives; agonists and antagonists of the 9 polypeptides; and uses of the polynucleotides, 0 polypeptides, variants, derivatives, agonists and i antagonists. In particular, in these and in other regards, 2 the invention relates to polynucleotides and polypeptides 3 of human Cytostatin I. 4 5 BACKGROUND OF THE INVENTION 6 The cytostatin I of the present invention has been 7 putatively identified as a growth inhibitory protein. This 8 identification has been made as a result of amino acid 9 sequence homology to mammary-derived growth inhibitor 0 (MDGI) and direct measurements on cell growth. i Mammary-derived growth inhibitor (MDGI) is a cell 2 growth inhibitor and differentiation factor firstly 3 purified mammary carcinoma cells Ehrlich ascites, and then 4 from cows milk and bovine mammary gland (Grosse et al. 2 5 references) . MDGI inhibits proliferation of mammary 6 epithelial cell lines in a dose-dependent and reversible 7 manner. Maximal inhibition of cell proliferation by 8 purified MDGI is in the range of 35 to 50%. In these cells

half-maximal inhibition waε obtained with about 10" ¹⁰ M MDGI (1 ng/ml) . Inhibition was abolished by simultaneously adding epidermal growth factor (EGF) , insulin. MDGI also inhibits the proliferation of several other permanent mammary carcinoma cell lines. MDGI has been shown to be immunologically related to a fibroblast growth inhibitor. Peptides that locally signal growth cessation and stimulate differentiation of the developing epithelium are very important for mammary gland development. Recombinant and wild-type forms of mammary-derived growth inhibitor (MDGI) and heart-fatty acid binding protein (FABP) , which belong to the FABP family, specifically inhibit growth of 3 normal mouse mammary epithelial cells (MEC) and promote 4 morphological differentiation, stimulates its own s expression and promotes milk protein synthesis. Selective 6 inhibition of endogenous MDGI expression in MEC by 7 antisense phosphorothioate oligonucleotides suppresses s appearance of alveolar end buds and lowers the beta-casein 9 level in organ cultures. Furthermore, MDGI suppresses the 0 mitogenic effects of EGF, and EGF antagonizes the i activities of MDGI. Finally, the regulatory properties of 2 MDGI can be fully mimicked by an 11-amino acid sequence, 3 represented in the COOH terminus of MDGI and a subfamily of 4 structurally related FABPs. MDGI is the first known growth 5 inhibitor which promotes mammary gland differentiation. 6 The amount of MDGI increased dramatically with the onset of lactation after delivery. Recent studies shows that a new 8 posttranslational processing form of MDGI, MDGI 2, not 9 present in lactation, was found in the bovine gland during 0 pregnancy. (Brandt et al., Biochem. Biophy. Res. Comm., i Vol. 189, p. 406, November 30, 1992.) To date, bovine, rat 2 and mouse MDGI have been identified but no human MDGI or 3 MDGI-like protein. There is no sequence homology between MDGI and other 5 known growth inhibitors. Thuε, along with interferons, 6 transforming growth factors β , and tumor necrosis factors, 7 MDGI is one of the few naturally occurring growth 8 inhibitors for mammary epithelium identifier so far.

Sequence analysis revealed extensive sequence homology of MDGI to a family of low molecular mass hydrophobic ligand- binding proteinε, among them fatty acid-binding protein

₄ (F _A BP) from brain and heart, myelin P2, a differentiation

₅ associated protein in adipocytes (p422) , gastrotropin, and

₆ t _h e cellular retinoic acid-binding protein (CRABP) . These

₇ proteins basically share two properties in common: they a bind hydrophobic ligands such aε long-chain fatty acids, ₉ retinoids, and eicosanoids, and they are expressed in a

₀ differentiation-dependent manner in mammary gland, heart,

1 liver, brain, or intestine. All these proteins act

2 intracellularly except MDGI and gastrotropin, which act

3 extracellularly in vitro. The C-terminus of MDGI residues 126-130 are identical to residueε 108-112 of bovine growth

5 hormone. Thiε stretch of amino acids is part of a sequence 6 of growth hormone that is essential for its biological 7 activity. Synthetic peptides corresponding to the MDGI- 8 sequence, residue 121-131 mimic the effects of MDGI. The 9 functions of these MDGI proteins are not yet well-defined, o although a role in fatty acid transport, sequestration, or

1 metabolism has been widely discussed. Interaction with aε

2 yet unknown hydrophobic ligands might play a functional

3 role in the mechanism of growth inhibition exerted by MDGI.

4 It is proposed that MDGI may act in an autocrine manner as

5 a growth inhibitor, however, MDGI lacks a signal sequence

6 for membrane translocation, most of MDGI has an

7 intracellular localization. With regard to the secretion, a an analogy might exist to other growth factors that also

9 lack a signal sequence like FGF and PG-ECGF. In those o cases cell damage aε a possible way of secretion, or the

1 existence of related factors with a signal sequence as a

2 physiological ligands of the respective surface receptors,

3 have been discussed. Among other activities, MDGI reportedly may inhibit c-

5 fos, c-myc and c-ras expression. MDGI has differentiation- s promoting activity on mouse pluripotent embryonic stem ι cells and supports the commitment of undifferentiated ESC 3 for neural differentiation. It is also suggested that MDGI

1 may be involved in the regulation of endothelial cell

2 proliferation.

3 MDGI inhibits the induction of supersensitivity of

4 neonatal rat heart muscle cells for beta-adrenergic

5 receptors by lipoxygenase metabolites and various agents .

6 The inhibitory activity of MDGI related to the induction of

7 supersensitivity for hydrophilic beta-adrenergic agonists

8 might point to a physiological role for a close relative of

9 MDGI - the cardiac fatty acid-binding protein (H-FABP) . 0 One function of H-FABP could be to protect, the heart, i under pathophysiological conditions, from lipoxygenase 2 metabolites causing supersensitivity of beta-adrenergic 3 receptors. Thus, H-FABP may be a physiological modulator 4 of beta-adrenergic responses in the cardiac muscle. There s is a need for a human MDGI-like protein and the gene e encoding it. 7

18 SUMMARY OF THE INVENTION

19 Toward these ends, and others, it is an object of the 0 present invention to provide polypeptides, inter alia, that 2i have been identified as novel cytostatin I by homology

22 between the amino acid sequence set out in Figure 1 and

23 known amino acid sequences of other proteins such as mouse

24 mammary-derived growth inhibitor (MDGI) .

25 It is a further object of the invention, moreover, to

26 provide polynucleotides that encode cytostatin I,

27 particularly polynucleotides that encode the polypeptide

28 herein designated cytostatin I.

29 In a particularly preferred embodiment of this aspect

30 of the invention the polynucleotide compriseε the region 3i encoding human cytostatin I in the sequence set out in

32 Figure 1.

33 in accordance with this aspect of the present

34 invention there is provided an isolated nucleic acid

35 molecule encoding a mature polypeptide expressed by the

36 human cDNA contained in ATCC Deposit No. 97103.

37 In accordance with this aspect of the invention there

38 are provided isolated nucleic acid molecules encoding human

cytostatin I, including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention,

₃ biologically, diagnostically, clinically or therapeutically

₄ uεeful variantε, analogε or derivatives thereof, or

₅ fragmentε thereof, including fragments of the variantε,

6 analogs and derivatives.

7 Among the particularly preferred embodiments of this

₈ aspect of the invention are naturally occurring allelic

9 variants of human cytostatin I . o It also is an object of the invention to provide i cytostatin I polypeptideε, particularly human cytoεtatin I 2 polypeptideε, that may be employed therapeutically as a 3 cell growth inhibitor, to cause differentiation stimulatory 4 activity on various responsive types of tissues and cellε, s to treat neoplasia, to inhibit angiogenesiε, to inhibit 6 metaεtases of tumor cellε, to stimulate milk production and 7 promote involution of the breast. s In accordance with this aspect of the invention there 9 are provided novel polypeptides of human origin referred to 0 herein as cytostatin I aε well as biologically, i diagnostically or therapeutically useful fragments, 2 variants and derivatives thereof, variants and derivatives 3 of the fragmentε, and analogε of the foregoing. 4 Among the particularly preferred embodimentε of this 5 aspect of the invention are variants of human cytostatin I 6 encoded by naturally occurring alleles of the human 7 cytostatin I gene. 8 It is another object of the invention to provide a 9 process for producing the aforementioned polypeptides, 0 polypeptide fragments, variants and derivatives, fragments i of the variants and derivatives, and analogs of the 2 foregoing. In a preferred embodiment of this aspect of 3 the invention there are provided methods for producing the 4 aforementioned cytostatin I polypeptideε compriεing 5 culturing host cells having expressibly incorporated 6 therein an exogenously-derived human cytoεtatin I-encoding polynucleotide under conditions for expression of human

1 cytostatin I in the host and then recovering the expressed

2 polypeptide.

3 In accordance with another object the invention there

4 are provided products, compositions, processes and methods

5 that utilize the aforementioned polypeptides and

6 polynucleotideε for reεearch, biological, clinical and

7 therapeutic purpoεes, inter alia .

8 In accordance with certain preferred embodiments of

9 this aspect of the invention, there are provided products, 0 compositions and methods, inter alia, for, among other i things: assessing cytostatin I expression in cells by 2 determining cytostatin I polypeptides or cytostatin I- 3 encoding mRNA; assaying genetic variation and aberrations, 4 such as defects, in cytostatin I genes; and administering s a cytostatin I polypeptide or polynucleotide to an organism 6 to augment cytostatin I function or remediate cytostatin I 7 dysfunction. 8 In accordance with certain preferred embodiments of 9 this and other aspects of the invention there are provided 0 probes that hybridize to human cytostatin I sequenceε. i In certain additional preferred embodiments of this 2 aspect of the invention there are provided antibodies 3 against cytostatin I polypeptides. In certain particularly 4 preferred embodiments in this regard, the antibodies are 5 highly selective for human cytostatin I. 6 In accordance with another aεpect of the present 7 invention, there are provided cytostatin I agonists. Among 8 preferred agonistε are moleculeε that mimic cytostatin I, 9 that bind to cytostatin I-binding molecules or receptor 0 molecules, and that elicit or augment cytostatin I-induced i reεponses. Also among preferred agoniεtε are moleculeε 2 that interact with cytoεtatin I or cytostatin I 3 polypeptides, or with other modulators of cytostatin I 4 activities, and thereby potentiate or augment an effect of 5 cytostatin I or more than one effect of cytostatin I . 6 In accordance with yet another aspect of the present 7 invention, there are provided cytostatin I antagonistε. 8 Among preferred antagonists are those which mimic

cytostatin I so as to bind to cytostatin I receptor or binding molecules but not elicit a cytostatin I-induced response or more than one cytostatin I-induced response. Also among preferred antagonists are molecules that bind to or interact with cytostatin I so as to inhibit an effect of cytostatin I or more than one effect of cytostatin I or which prevent expression of cytostatin I . In a further aspect of the invention there are provided compositions comprising a cytostatin I polynucleotide or a cytostatin I polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise a cytostatin I polynucleotide for expression of a cytostatin I polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction asεociated with aberrant endogenous activity of cytostatin I . Other objects, features, advantages and aspectε of the preεent invention will become apparent to those of skill from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Nucleotide and deduced amino acid sequence of human Cytostatin I. The nucleotide sequence of the cDNA encoding human cytoεtatin and amino acid εequence is shown. The cDNA sequence encodes a primary translation product of 107 amino acids of which the first 21 to 38 amino acids likely

₁ represent a putative leader sequence or transmembrane

2 domain.

3 Figure 2. Sequence homology of Cytostatin I with

4 other family members (SEQ ID NO: 7-11) .

5 Comparison of the amino acid sequence of cytostatin I

6 (HTOBH93 , top) to other members in the family is shown (SEQ

7 ID NO: 7-11) .

8 Figure 3. Tissue distribution of cytostatin I .

9 (3A & 3B) Two μg of polyA RNA from the human tisεues o indicated were separated on a 1% agarose-formaldehyde gel i and transferred to a nylon membrane. The membrane was 2 probed with ³² P-labeled cytostatin I cDNA probe. Cytostatin 3 I is highly expressed in spleen and kidney, moderately 4 expressed in liver and thymus . The lanes on the 3A and 3B s gels are: 6 Figure 3A Figure 3B 7 Lane l, spleen heat s Lane 2, thymus brain 9 Lane 3 , prostate placenta 0 Lane 4, testis lung i Lane 5, ovary liver 2 Lane 6, small intestine skeletal muscle 3 Lane 7, colon kidney 4 Lane 8 , peripheral blood leukocyteε pancreas 5 , 6 # RNA Size market (kb) : 9.5; 7.5; 4.4; 2.4; 1.35. 7 8 3C) 10 μg of total RNA from the cell lines shown were 9 separated on a 1% agarose-formaldehyde gel and transferred 0 to a nylon membrane. The membrane was probed with ³² P- i labeled cytostatin I cDNA. Lane 1, CAMAl (breast cancer); 2 Lane 2 AN3CA (uterine cancer) ; Lane 3, SK.UT.l (uterine 3 cancer) ; Lane 4, MG63 (osteoblastoma) ; Lane 5, HOS 4 (osteoblaεtoma; Lane 6, MCF7 (breaεt cancer) ; Lane 7, 5 OVCAR-3 (ovarian cancer) ; Lane 8, CAOV-3 (ovarian cancer) ; 6 Lane 9, HUVEC; Lane 10, AOSMIC (smooth muscle) ; Lane 11, 7 Fore skin fibroblast. The expression of cystatin I is 8 undetectable in these cells.

₁ Figure 4. Purification of bacterial-expreεεed human

2 cytostatin I (HG07400-2E) .

₃ The entire coding sequence including the putative signal sequence or transmembrane domain was fused in frame

5 with a 6-His tag present in the expression vector pQE9

6 (Qiagen) . E. coli haboring the expression plasmid were

7 induced with 1 mM IPTG during the logarithmic growth phase.

8 Following a 3-hour induction, the cell pellet was lysed

9 with 6M Guanidine hydrochloride and cytostatin I was o purified using a Nickel-chelate affinity chromatography i column. The highly purified protein was denatured by 2 dialysis in PBS buffer. M, molecular weight markers,- Lane 3 l and 2, induced cell lysate; Lane 3 and 4, uninduced cell 4 lysate; Lane 5, pass through fraction from Nickel-chelate s column purification; Lane 6, 7 and 8, Fraction eluted with 6 7M Guanidine hydrochloride (pH 5) ; 9 Fraction eluted with 7 6M Guanidine hydrochloride (pH 2) . 8 Figure 5A Growth inhibitory activity of cytostatin I 9 (HG07400-1E, highest concentration 100 ng/ml) against Mdamb 0 231 human breast cancer cells. i Figure 5B Growth inhibitory activity of cytostatin I 2 (HG07400-2E, highest concentration 1000 ng/ml) against 3 Mdamb 231 human breast cancer cells. 4 Figure 5C Growth inhibitory activity of cytostatin I 5 (HG07400-1E) against Jurat human T cell leukemia cells. 6 Figure 5D Growth inhibitory activity of cytostatin I 7 (HG07400-2E) against CCD-29LU human lung fibroblast cells. 8 Figure 5E Growth inhibitory activity of cytostatin I 9 (HG07400-2E) against CPA 47 bovine pulmonary artery 0 endothelial cells. i Figure 6. Northern blot analyεiε of cytoεtatin I 2 expression in human breaεt tiεεues. Total RNAs were 3 prepared from five metastatic breast carcinomas (C 4 represents carcinomas) and five benign breastε (B 5 represents benign breast) . RNA samples from B1-B4 were 6 isolated from breast fibroadenomas, and RNA sample of B5 was isolated from breast hyperplasia. Each lane contained 8 30 ug of total RNA. (A) TMP-4 RNA hybridized with

1 ³² P-labeled full-length cytostatin I cDNA probe. (B) 18 S

2 rRNA indicating the integrity of the RNA samples and the

3 loading control.

4 Figure 7. Jn situ hybridization analysis of cytostatin

5 I (A-D) expression in human breast. Open arrows indicate

6 the stromal cells and closed arrows indicate both normal

7 and neoplastic breast epithelial cells. Areas with brown

8 color indicate the cytostatin I signals. (A) Low

9 magnification (100X) view of fibroadenomas showing a strong ιo labeling of epithelial cells for cytostatin I mRNA. (B) ii Low-power view (100X) of hyperplasia showε a negative

12 staining for cytostatin I. (C) Negatively stained low grade

13 in si tu carcinoma. (D) Infiltrating carcinoma- low

14 magnification view (160X) of the negatively stained

15 cytostatin I . All the Sections were counterstained

16 lightly with hematoxylin for a better view of the

17 negatively stained of malignant and highly proliferative ie breast epithelial cells.

19 20

21 GLOSSARY

22 The following illustrative explanations are provided

23 to facilitate understanding of certain terms used

24 frequently herein, particularly in the examples. The

25 explanations are provided aε a convenience and are not

26 limitative of the invention.

27 DIGESTION of DNA refers to catalytic cleavage of the 28 DNA with a restriction enzyme that acts only at certain

29 sequences in the DNA. The various reεtriction enzymes

30 referred to herein are commercially available and their 3i reaction conditions, cofactors and other requirements for

32 use are known and routine to the skilled artisan.

33 For analytical purposes, typically, 1 μg of plasmid or

34 DNA fragment is digested with about 2 units of enzyme in

35 about 20 μl of reaction buffer. For the purpose of

36 isolating DNA fragments for plasmid construction, typically

37 5 to 50 μg of DNA are digested with 20 to 250 units of

38 enzyme in proportionately larger volumes.

1 Appropriate buffers and substrate amounts for

2 particular restriction enzymes are described in standard

3 laboratory manuals, such as those referenced below, and

4 they are specified by commercial suppliers.

5 Incubation times of about l hour at 37 ^° C are

6 ordinarily used, but conditions may vary in accordance with

7 standard procedures, the εupplier'ε instructions and the

8 particulars of the reaction. After digestion, reactions

9 may be analyzed, and fragments may be purified by 0 electrophoresiε through an agaroεe or polyacrylamide gel, i using well known methods that are routine for those skilled 2 in the art . 3 GENETIC ELEMENT generally means a polynucleotide 4 comprising a region that encodes a polypeptide or a region 5 that regulates transcription or translation or other 6 processes important to expresεion of the polypeptide in a 7 hot cell, or a polynucleotide comprising both a region s that encodes a polypeptide and a region operably linked 9 thereto that regulates expresεion. 0 Genetic elementε may be compriεed within a vector that i replicates as an episomal element; that is, as a molecule 2 physically independent of the host cell genome. They may 3 be comprised within mini-chromosomes, such as those that 4 arise during amplification of tranεfected DNA by 5 methotrexate selection in eukaryotic cells. Genetic 6 elements also may be comprised within a host cell genome; 7 not in their natural state but, rather, following 8 manipulation such as isolation, cloning and introduction 9 into a host cell in the form of purified DNA or in a 0 vector, among others. i ISOLATED means altered "by the hand of man" from its 2 natural state; i.e., that, if it occurs in nature, it has 3 been changed or removed from its original environment, or 4 both. 5 For example, a naturally occurring polynucleotide or 6 a polypeptide naturally present in a living animal in itε 7 natural state is not "isolated, " but the same 8 polynucleotide or polypeptide separated from the coexisting

1 materials of its natural state is "isolated", as the term

2 is employed herein. For example, with respect to

3 polynucleotideε, the term isolated means that it is

4 separated from the chromosome and cell in which it

5 naturally occurs.

6 As part of or following isolation, such

7 polynucleotides can be joined to other polynucleotides, β such as DNAs, for mutagenesis, to form fusion proteins, and 9 for propagation or expresεion in a hoεt, for inεtance. The 0 iεolated polynucleotides, alone or joined to other i polynucleotides such aε vectorε, can be introduced into 2 hoεt cellε, in culture or in whole organisms. Introduced 3 into host cells in culture or in whole organisms, such DNAs 4 still would be isolated, as the term is used herein, s because they would not be in their naturally occurring form 6 or environment. Similarly, the polynucleotides and 7 polypeptideε may occur in a compoεition, εuch as a media s formulations, solutions for introduction of polynucleotides 9 or polypeptides, for example, into cells, compositions or 0 solutions for chemical or enzymatic reactions, for i instance, which are not naturally occurring compositionε, 2 and, therein remain isolated polynucleotides or 3 polypeptides within the meaning of that term as it is 4 employed herein. 5 LIGATION refers to the process of forming 6 phosphodiester bonds between two or more polynucleotides, 7 which most often are double εtranded DNAε. Techniqueε for 8 ligation are well known to the art and protocolε for 9 ligation are described in standard laboratory manuals and 0 references, such as, for instance, Sambrook et al., 1 MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed.; Cold 2 Spring Harbor Laboratory Preεε, Cold Spring Harbor, New 3 York (1989) and Maniatis et al . , pg. 146, as cited below. 4 OLIGONUCLEOTIDE (S) refers to relatively short 5 polynucleotides. Often the term refers to single-stranded 6 deoxyribonucleotides, but it can refer aε well to εingle-or 7 double-stranded ribonucleotides, RNA:DNA hybrids and 8 double-stranded DNAs, among others.

1 Oligonucleotides, such as single-stranded DNA probe

2 oligonucleotides, often are synthesized by chemical

3 methods, such as those implemented on automated

4 oligonucleotide synthesizers. However, oligonucleotides

5 can be made by a variety of other methods, including in

6 vitro recombinant DNA-mediated techniques and by expression

7 of DNAs in cells and organiεmε. e Initially, chemically εyntheεized DNAε typically are

9 obtained without a 5' phoεphate. The 5' ends of such 0 oligonucleotides are not substrates for phosphodiester bond i formation by ligation reactions that employ DNA ligaseε 2 typically used to form recombinant DNA molecules. Where 3 ligation of such oligonucleotides is desired, a phosphate 4 can be added by standard techniques, such as those that s employ a kinase and ATP. 6 The 3' end of a chemically synthesized oligonucleotide 7 generally has a free hydroxyl group and, in the presence of 8 a ligase, such as T4 DNA ligase, readily will form a 9 phosphodiester bond with a 5' phosphate of another 0 polynucleotide, such as another oligonucleotide. As is i well known, this reaction can be prevented selectively, 2 where desired, by removing the 5' phosphates of the other 3 polynucleotide(s) prior to ligation. 4 PLASMIDS generally are designated herein by a lower 5 case p preceded and/or followed by capital letters and/or 6 numberε, in accordance with standard naming conventions 7 that are familiar to those of skill in the art. 8 Starting plasmids disclosed herein are either commercially 9 available, publicly available on an unrestricted basis, or 0 can be constructed from available plasmids by routine i application of well known, published procedures. Many 2 plasmids and other cloning and expresεion vectorε that can 3 be used in accordance with the present invention are well 4 known and readily available to those of skill in the art. 5 Moreover, those of skill readily may construct any number 6 of other plasmidε suitable for use in the invention. The properties, construction and use of such plasmids, as well

1 as other vectorε, in the preεent invention will be readily

2 apparent to thoεe of εkill from the preεent disclosure.

3 POLYNUCLEOTIDE(S) generally refers to any

4 polyribonucleotide or polydeoxribonucleotide, which may be

5 unmodified RNA or DNA or modified RNA or DNA. Thus, for

6 instance, polynucleotides as used herein refers to, among

7 others, single-and double-εtranded DNA, DNA that is a

8 mixture of single-and double-stranded regions, single- and

9 double-εtranded RNA, and RNA that iε mixture of εingle- and 0 double-εtranded regions, hybrid molecules compriεing DNA i and RNA that may be single-stranded or, more typically, 2 double-stranded or a mixture of single- and double-stranded 3 regions. In addition, polynucleotide as used herein 4 refers to triple-stranded regions comprising RNA or DNA or 5 both RNA and DNA. The strands in such regions may be from 6 the same molecule or from different moleculeε. The regions 7 may include all of one or more of the molecules, but more 8 typically involve only a region of some of the molecules. 9 One of the molecules of a triple-helical region often is an 0 oligonucleotide. i As used herein, the term polynucleotide includes DNAs 2 or RNAs as described above that contain one or more 3 modified bases. Thus, DNAs or RNAs with backbones modified 4 for stability or for other reasons are "polynucleotides" as 5 that term is intended herein. Moreover, DNAε or RNAs 6 comprising unusual bases, such as inosine, or modified 7 bases, such as tritylated baseε, to name just two examples, 8 are polynucleotides aε the term is used herein. 9 It will be appreciated that a great variety of 0 modifications have been made to DNA and RNA that εerve many i useful purposes known to those of skill in the art. The 2 term polynucleotide as it is employed herein embraces such 3 chemically, enzymatically or metabolically modified forms 4 of polynucleotideε, as well as the chemical forms of DNA 5 and RNA characteristic of viruses and cells, including 6 simple and complex cells, inter alia. 7 POLYPEPTIDES, aε used herein, includes all 8 polypeptides as described below. The basic structure of

1 polypeptides is well known and has been described in

2 innumerable textbooks and other publications in the art.

3 In this context, the term is used herein to refer to any

4 peptide or protein comprising two or more amino acids

5 joined to each other in a linear chain by peptide bonds.

6 As used herein, the term refers to both short chains, which

7 also commonly are referred to in the art as peptides,

8 oligopeptides and oligomers, for example, and to longer

9 chains, which generally are referred to in the art as o proteins, of which there are many types. i It will be appreciated that polypeptides often contain 2 amino acidε other than the 20 amino acids commonly referred 3 to as the 20 naturally occurring amino acids, and that many 4 amino acids, including the terminal amino acidε, may be 5 modified in a given polypeptide, either by natural 6 processes, such as processing and other post-translational 7 modifications, but also by chemical modification techniques 8 which are well known to the art. Even the common 9 modifications that occur naturally in polypeptides are too 0 numerous to list exhaustively here, but they are well i described in basic texts and in more detailed monographs, 2 as well as in a voluminous research literature, and they 3 are well known to those of skill in the art. 4 Among the known modifications which may be present in 5 polypeptides of the present are, to name an illustrative 6 few, acetylation, acylation, ADP-riboεylation, amidation, 7 covalent attachment of flavin, covalent attachment of a 8 heme moiety, covalent attachment of a nucleotide or 9 nucleotide derivative, covalent attachment of a lipid or 0 lipid derivative, covalent attachment of i phoεphotidylinoεitol, croεε-linking, cyclization, diεulfide 2 bond formation, demethylation, formation of covalent cross- 3 links, formation of cystine, formation of pyroglutamate, 4 formylation, gamma-carboxylation, glycosylation, GPI anchor 5 formation, hydroxylation, iodination, methylation, 6 myristoylation, oxidation, proteolytic processing, 7 phosphorylation, prenylation, racemization, selenoylation,

sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. Such modificationε are well known to those of skill and have been deεcribed in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma- carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as, for instance PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993) . Many detailed reviews are available on this subject, such aε, for example, those provided by Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1- 12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York (1983); Seifter et al., Analyεiε for protein modifications and nonprotein cofactors, Meth. Enzymol. 182: 626-646 (1990) and Rattan et al., Protein Syntheεiε: Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci. 663: 48-62 (1992) . It will be appreciated, as is well known and as noted above, that polypeptideε are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a reεult of posttranslation events, including natural proceεεing event and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translation natural procesε and by entirely εynthetic methodε, aε well. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptideε and εuch modifications may be present in polypeptides of the present invention, aε well.

1 For instance, the amino terminal residue of polypeptides

2 made in E. coli, prior to proteolytic processing, almost

3 invariably will be N-formylmethionine.

4 The modifications that occur in a polypeptide often

5 will be a function of how it is made. For polypeptides

6 made by expressing a cloned gene in a host, for instance,

7 the nature and extent of the modifications in large part

8 will be determined by the host cell posttranslational

9 modification capacity and the modification signalε preεent ιo in the polypeptide amino acid εequence. For instance, as ii is well known, glycosylation often does not occur in

12 bacterial hosts such as E. coli. Accordingly, when

13 glycosylation is desired, a polypeptide should be expressed

14 in a glycosylating host, generally a eukaryotic cell. is Insect cell often carry out the same posttranεlational

16 glycoεylations as mammalian cells and, for this reason,

17 insect cell expression systems have been developed to ie expresε efficiently mammalian proteinε having native

19 patterns of glycosylation, inter alia. Similar

20 considerations apply to other modifications.

21 It will be appreciated that the same type of

22 modification may be present in the same or varying degree

23 at several sites in a given polypeptide. Also, a given

24 polypeptide may contain many types of modifications.

25 In general, aε uεed herein, the term polypeptide

26 encompaεεes all such modifications, particularly those that

27 are present in polypeptides synthesized by expressing a

28 polynucleotide in a host cell.

29 VARIANT(S) of polynucleotideε or polypeptideε, aε the

30 term iε used herein, are polynucleotides or polypeptides 3i that differ from a reference polynucleotide or polypeptide, 2 respectively. Variants in this sense are described below 3 and elsewhere in the present discloεure in greater detail. 4 5 (1) A polynucleotide that differε in nucleotide 6 εequence from another, reference polynucleotide. Generally, differences are limited so that the nucleotide

1 sequences of the reference and the variant are closely

2 similar overall and, in many regionε, identical.

3 Aε noted below, changes in the nucleotide sequence of

4 the variant may be silent. That is, they may not alter the

5 amino acids encoded by the polynucleotide. Where

6 alterations are limited to silent changes of this type a

7 variant will encode a polypeptide with the same amino acid

8 sequence as the reference. Also as noted below, changes in

9 the nucleotide sequence of the variant may alter the amino 0 acid sequence of a polypeptide encoded by the reference i polynucleotide. Such nucleotide changes may result in 2 amino acid substitutionε, additions, deletions, fusionε and 3 truncations in the polypeptide encoded by the reference 4 sequence, as discussed below. s (2) A polypeptide that differs in amino acid sequence 6 from another, reference polypeptide. Generally, 7 differences are limited so that the sequenceε of the s reference and the variant are cloεely εimilar overall and, 9 in many region, identical. 0 A variant and reference polypeptide may differ in i amino acid sequence by one or more substitutions, 2 additions, deletions, fusions and truncations, which may be 3 present in any combination. 4 RECEPTOR MOLECULE, as used herein, refers to molecules 5 which bind or interact specifically with cytostatin I 6 polypeptides of the present invention, including not only 7 clasεic receptorε, which are preferred, but alεo other 8 moleculeε that specifically bind to or interact with 9 polypeptides of the invention (which also may be referred 0 to as "binding molecules" and "interaction moleculeε," i reεpectively and aε "cytoεtatin I binding moleculeε" and 2 "cytoεtatin I interaction molecules." Binding between 3 polypeptides of the invention and such moleculeε, including 4 receptor or binding or interaction molecules may be 5 exclusive to polypeptides of the invention, which is very 6 highly preferred, or it may be highly specific for 7 polypeptides of the invention, which is highly preferred, 8 or it may be highly specific to a group of proteins that

1 includes polypeptides of the invention, which is preferred,

2 or it may be specific to several groups of proteins at

3 least one of which includes polypeptideε of the invention.

4 Receptors also may be non-naturally occurring, such as

5 antibodies and antibody-derived reagents that bind

6 specifically to polypeptides of the invention.

7

8 DESCRIPTION OF THE INVENTION

9 The present invention relates to novel cytostatin I 0 polypeptides and polynucleotides, among other things, as i described in greater detail below. In particular, the 2 invention relates to polypeptides and polynucleotides of a 3 novel human cytostatin I, which is related by amino acid sequence homology to mouse mammary-derived growth 5 inhibitor. The invention relates especially to cytostatin 6 I having the nucleotide and amino acid sequenceε εet out in 7 Figure 1, and to the cytoεtatin I nucleotide and amino acid s εequences of the human cDNA in ATCC Deposit No. 97103, 9 which is herein referred to as "the depoεited clone" or as 0 the "cDNA of the deposited clone." It will be appreciated i that the nucleotide and amino acid sequences set out in 2 Figure 1 were obtained by sequencing the cDNA of the 3 deposited clone. Hence, the sequence of the deposited 4 clone is controlling as to any discrepancies between the 5 two and any reference to the sequences of Figure 1 include 6 reference to the sequence of the human cDNA of the 7 deposited clone. 8 9 Polynucleotides 0 In accordance with one aspect of the present i invention, there are provided isolated polynucleotides 2 which encode the cytostatin I polypeptide having the 3 deduced amino acid sequence of Figure 1. 4 Using the information provided herein, such as the 5 polynucleotide sequence set out in Figure 1, a 6 polynucleotide of the present invention encoding human 7 cytostatin I polypeptide may be obtained using standard 8 cloning and screening procedures, such as those for cloning

1 cDNAs uεing mRNA from cellε of human tissue as starting

2 material. Human cytostatin I of the invention is

3 structurally related to other proteins of the cytostatin

4 family, as shown by the results of sequencing the cDNA

5 encoding human cytostatin I in the deposited clone. The

6 cDNA sequence thus obtained is set out in Figure 1.

7 MDGI was originally identified aε the cellular

8 retinoic acid-binding protein (CRABP) . Both CRABP and MDGI

9 belong to a family of proteinε known to bind hydrophobic o ligandε, referred to aε Fatty acid binding proteins i (FABPs) . Cytoεtatin I is 33% identical and 63% similar to 2 mouse MDGI. Cytostatin I iε highly expreεεed in εpleen and 3 kidney, moderately expreεεed in liver and thymuε. The 4 selective expression of cytostatin I was demonstrated s during analysis expresεion in εelected human tissueε. The 6 cytostatin I gene was found three times in nine week old 7 early state library, it was found once each in breast 8 lympho node library, pancreas library and tonsils library. 9 Cytostatin I protein was expressed and purified from E. 0 coli . Our findings demonstrate that cytostatin I has i growth inhibitory activity against breast cancer cells, 2 leukemia cellε, fibroblaεt cellε, and endothelial cellε. 3 The coding sequence which encodes the polypeptide may 4 be identical to the coding sequence of the polynucleotide 5 shown in Figure 1. It also may be a polynucleotide with a 6 different sequence, which, as a result of the redundancy 7 (degeneracy) of the genetic code, encodeε the polypeptide 8 of the DNA of Figure 1. 9 Polynucleotides of the present invention which encode 0 the polypeptide of Figure 1 may include, but are not i limited to the coding εequence for the mature polypeptide, 2 by itself; the coding sequence for the mature polypeptide 3 and additional coding sequences, such as those encoding a 4 leader or secretory sequence, such as a pre-, or pro- or 5 prepro- protein sequence; the coding sequence of the mature 6 polypeptide, with or without the aforementioned additional 7 coding sequences, together with additional, non-coding 8 sequences, including for example, but not limited to

1 introns and non-coding 5' and 3' sequenceε, εuch as the

2 transcribed, non-translated sequences that play a role in

3 transcription, mRNA processing - including splicing and

4 polyadenylation signals, for example - ribosome binding and

5 stability of mRNA; additional coding sequence which codes

6 for additional amino acids, such as those which provide

7 additional functionalities. Thus, for instance, the

8 polypeptide may be fused to a marker εequence, such as a

9 peptide, which facilitates purification of the fused 0 polypeptide. In certain preferred embodiments of this i aspect of the invention, the marker sequence is a hexa- 2 histidine peptide, such as the tag provided in the vector 3 pQE-9, among others, many of which are commercially 4 available. As described in Gentz et al., Proc. Natl. Acad. 5 Sci., USA 86: 821-824 (1989), for instance, hexa-histidine 6 provides for convenient purification of the fusion protein. 7 The HA tag corresponds to an epitope derived of 8 influenza hemagglutinin protein, which has been described 9 by Wilson et al., Cell 37: 767 (1984), for instance. 0 In accordance with the foregoing, the term i "polynucleotide encoding a polypeptide" as used herein 2 encompasseε polynucleotides which include a sequence 3 encoding a polypeptide of the present invention, 4 particularly the human cytostatin I having the amino acid 5 sequence set out in Figure 1. The term encompasses 6 polynucleotides that include a εingle continuouε region or 7 diεcontinuous regions encoding the polypeptide (for 8 example, interrupted by introns) together with additional 9 regions, that also may contain coding and/or non-coding 0 sequences. i The present invention further relates to variants of 2 the herein above described polynucleotides which encode for 3 fragments, analogs and derivatives of the polypeptide 4 having the deduced amino acid sequence of Figure l. A 5 variant of the polynucleotide may be a naturally occurring 6 variant such as a naturally occurring allelic variant, or 7 it may be a variant that is not known to occur naturally. 8 Such non-naturally occurring variants of the polynucleotide

1 may be made by mutagenesiε techniqueε, including those

2 applied to polynucleotideε, cells or organisms.

3 Among variants in this regard are variants that differ from the aforementioned polynucleotides by nucleotide

5 substitutions, deletions or additionε. The substitutions,

6 deletions or additions may involve one or more nucleotides.

7 The variants may be altered in coding or non-coding regions

8 or both. Alterations in the coding regions may produce

9 conservative or non-conservative amino acid εubεtitutionε, 0 deletionε or additions. i Among the particularly preferred embodiments of the 2 invention in this regard are polynucleotides encoding 3 polypeptides having the amino acid sequence of cytostatin 4 I set out in Figure 1 or the amino acid sequence of 5 cytostatin I of the cDNA of the deposited clone; variants, 6 analogs, derivatives and fragments thereof, and fragments 7 of the variants, analogε and derivativeε. 8 Further particularly preferred in this regard are 9 polynucleotides encoding cytostatin I variants, analogs, 0 derivatives and fragments, and variants, analogε and i derivatives of the fragments, which have the amino acid 2 sequence of the cytostatin I polypeptide of Figure 1 in 3 which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no 4 amino acid residueε are εubεtituted, deleted or added, in 5 any combination. Especially preferred among these are 6 silent substitutions, additions and deletionε, which do not 7 alter the properties and activities of the cytostatin I. 8 Also especially preferred in thiε regard are conservative 9 substitutions. Most highly preferred are polynucleotides 0 encoding polypeptideε having the amino acid sequence of i Figure 1 without substitutions. 2 Further preferred embodiments of the invention are 3 polynucleotides that are at least 70% identical to a 4 polynucleotide encoding the cytostatin I polypeptide having 5 the amino acid sequence set out in Figure 1, and 6 polynucleotides which are complementary to such 7 polynucleotides. Alternatively, most highly preferred are 8 polynucleotides that compriεe a region that is at least 80%

1 identical to a polynucleotide encoding the cytostatin I

2 polypeptide of the cDNA of the deposited clone and

3 polynucleotideε complementary thereto. In this regard,

4 polynucleotides at least 90% identical to the same are

5 particularly preferred, and among these particularly

6 preferred polynucleotides, those with at least 95% are

7 eεpecially preferred. Furthermore, those with at least 97%

8 are highly preferred among those with at least 95%, and

9 among these those with at least 98% and at least 99% are o particularly highly preferred, with at least 99% being the i more preferred. 2 Particularly preferred embodiments in this respect, 3 moreover, are polynucleotides which encode polypeptides 4 which retain subεtantially the same biological function or s activity as the mature polypeptide encoded by the cDNA of 6 Figure 1. 7 The present invention further relates to 8 polynucleotides that hybridize to the herein above- 9 described sequences. In this regard, the present invention 0 especially relates to polynucleotides which hybridize under i stringent conditions to the herein above-described 2 polynucleotides. As herein used, the term "stringent 3 conditionε" meanε hybridization will occur only if there is 4 at least 95% and preferably at least 97% identity between 5 the sequences. 6 As discussed additionally herein regarding 7 polynucleotide assayε of the invention, for inεtance, 8 polynucleotides of the invention as discussed above, may be 9 used as a hybridization probe for cDNA and genomic DNA to 0 isolate full-length cDNAs and genomic clones encoding i cytostatin I and to isolate cDNA and genomic clones of 2 other genes that have a high sequence similarity to the 3 human cytostatin I gene. Such probes generally will 4 comprise at least 15 bases. Preferably, εuch probeε will 5 have at least 30 baseε and may have at least 50 bases. 6 Particularly preferred probes will have at least 30 bases 7 and will have 50 bases or less.

1 For example, the coding region of the cytoεtatin I

2 gene may be isolated by screening uεing the known DNA

3 sequence to synthesize an oligonucleotide probe. A labeled

4 oligonucleotide having a sequence complementary to that of

5 a gene of the present invention is then used to screen a

6 library of human cDNA, genomic DNA or mRNA to determine

7 which members of the library the probe hybridizes to.

8 The polynucleotides and polypeptides of the present

9 invention may be employed aε reεearch reagents and 0 materials for discovery of treatments and diagnostics to i human disease, as further discuεεed herein relating to 2 polynucleotide assayε, inter alia. 3 The polynucleotideε may encode a polypeptide which is 4 the mature protein plus additional amino or carboxyl- s terminal amino acids, or amino acids interior to the mature 6 polypeptide (when the mature form haε more than one 7 polypeptide chain, for inεtance) . Such εequenceε may play 8 a role in proceεεing of a protein from precurεor to a 9 mature form, may facilitate protein trafficking, may 0 prolong or εhorten protein half-life or may facilitate i manipulation of a protein for assay or production, among 2 other things. As generally iε the case in situ, the 3 additional amino acids may be processed away from the 4 mature protein by cellular enzymes. 5 A precursor protein, having the mature form of the 6 polypeptide fused to one or more prosequences may be an 7 inactive form of the polypeptide. When prosequences are 8 removed such inactive precurεorε generally are activated. 9 Some or all of the prosequences may be removed before 0 activation. Generally, such precursorε are called i proproteins. 2 3 Deposited materials 4 A deposit containing a human cytostatin I cDNA has 5 been deposited with the American Type Culture Collection, 6 as noted above. Also aε noted above, the cDNA deposit is 7 referred to herein as "the deposited clone" or as "the cDNA 8 of the deposited clone."

1 The depoεited clone was deposited with the American

2 Type Culture Collection, 12301 Park Lawn Drive, Rockville,

3 Maryland 20852, USA, on March 21, 1995, and asεigned ATCC

4 Depoεit No. 97103.

5 The deposited material is a pBluescript SK (-) plasmid

6 (Stratagene, La Jolla, CA) that contains the full length

7 cytostatin I cDNA.

8 The deposit has been made under the terms of the

9 Budapest Treaty on the international recognition of the o deposit of micro-organisms for purposes of patent i procedure. The strain will be irrevocably and without 2 restriction or condition released to the public upon the 3 issuance of a patent. The deposit iε provided merely aε 4 convenience to those of skill in the art and is not an 5 admisεion that a deposit is required for enablement, such 6 as that required under 35 U.S.C. §112. 7 The sequence of the polynucleotides contained in the s deposited material, as well as the amino acid sequence of 9 the polypeptide encoded thereby, are controlling in the 0 event of any conflict with any description of sequences i herein. 2 A license may be required to make, use or sell the 3 deposited materials, and no such license is hereby granted. 4 5 Polypeptides 6 The present invention further relates to a human 7 cytoεtatin I polypeptide which haε the deduced amino acid 8 sequence of Figure 1. 9 The invention also relateε to fragments, analogs and 0 derivatives of these polypeptides. The terms "fragment," i "derivative" and "analog" when referring to the polypeptide 2 of Figure 1 means a polypeptide which retains esεentially 3 the εame biological function or activity as such 4 polypeptide. Thus, an analog includeε a proprotein which 5 can be activated by cleavage of the proprotein portion to 6 produce an active mature polypeptide. 7 The polypeptide of the present invention may be a 8 recombinant polypeptide, a natural polypeptide or a

1 synthetic polypeptide. In certain preferred embodiments it

2 is a recombinant polypeptide.

3 The fragment, derivative or analog of the polypeptide

4 of Figure 1 may be (i) one in which one or more of the

5 amino acid residues are substituted with a conserved or

6 non-conserved amino acid residue (preferably a conserved

7 amino acid residue) and such substituted amino acid residue

8 may or may not be one encoded by the genetic code, or (ii)

9 one in which one or more of the amino acid residues 0 includes a substituent group, or (iii) one in which the i mature polypeptide is fused with another compound, such aε 2 a compound to increaεe the half-life of the polypeptide 3 (for example, polyethylene glycol) , or (iv) one in which 4 the additional amino acidε are fuεed to the mature s polypeptide, εuch aε a leader or secretory sequence or a 6 sequence which is employed for purification of the mature 7 polypeptide or a proprotein εequence. Such fragmentε, 8 derivatives and analogε are deemed to be within the εcope 9 of thoεe εkilled in the art from the teachings herein. 0 Among the particularly preferred embodiments of the i invention in this regard are polypeptides having the amino 2 acid sequence of cytostatin I set out in Figure l, 3 variants, analogs, derivatives and fragmentε thereof, and 4 variants, analogs and derivatives of the fragments. 5 Alternatively, particularly preferred embodiments of the 6 invention in this regard are polypeptides having the amino 7 acid sequence of the cytostatin I of the cDNA in the 8 deposited clone, variants, analogε, derivatives and 9 fragments thereof, and variants, analogε and derivativeε of 0 the fragmentε. i Among preferred variants are those that vary from a 2 reference by conservative amino acid substitutions. Such 3 substitutions are those that substitute a given amino acid 4 in a polypeptide by another amino acid of like 5 characteristics. Typically seen as conservative 6 substitutions are the replacements, one for another, among 7 the aliphatic amino acids Ala, Val, Leu and lie; 8 interchange of the hydroxyl reεidues Ser and Thr, exchange

of the acidic residues Asp and Glu, substitution between the amide residueε Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr. Further particularly preferred in this regard are variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments, having the amino acid εequence of the cytostatin I polypeptide of Figure 1 in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residueε are substituted, deleted or added, in any combination. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the cytostatin I. Also especially preferred in this regard are conservative substitutions. Most highly preferred are polypeptides having the amino acid sequence of Figure 1 without substitutions. The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity. The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids. As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Fragments or portions of the polypeptideε of the preεent invention may be employed for producing the

1 corresponding full-length polypeptide by peptide synthesis,-

2 therefore, the fragments may be employed aε intermediateε

3 for producing the full-length polypeptideε. Fragments or portions of the polynucleotides of the present invention

5 may be used to synthesize full-length polynucleotides of

6 the present invention.

7

8 Fragments

9 Also among preferred embodiments of this aspect of the 0 present invention are polypeptideε comprising fragments of i cytostatin I, most particularly fragments of the cytostatin 2 I having the amino acid set out in Figure 1, or having the 3 amino acid sequence of the cytostatin I of the depoεited 4 clone, and fragmentε of variants and derivatives of the s cytostatin I of Figure 1. 6 In this regard a fragment iε a polypeptide having an 7 amino acid sequence that entirely is the same as part but 8 not all of the amino acid sequence of the aforementioned 9 cytostatin I polypeptideε and variantε or derivativeε 0 thereof. i Such fragmentε may be "free-standing," i.e., not part 2 of or fused to other amino acids or polypeptides, or they 3 may be comprised within a larger polypeptide of which they 4 form a part or region. When comprised within a larger 5 polypeptide, the presently discussed fragments most 6 preferably form a single continuous region. However, 7 several fragments may be comprised within a single larger 8 polypeptide. For instance, certain preferred embodiments 9 relate to a fragment of a cytoεtatin I polypeptide of the 0 preεent comprised within a precursor polypeptide designed i for expression in a host and having heterologous pre and 2 pro-polypeptide regions fused to the amino terminus of the 3 cytostatin I fragment and an additional region fused to the 4 carboxyl terminus of the fragment. Therefore, fragments in 5 one aspect of the meaning intended herein, refers to the 6 portion or portionε of a fusion polypeptide or fusion 7 protein derived from cytostatin I.

1 As representative examples of polypeptide fragments of

2 the invention, there may be mentioned those which have from

3 about 25 to about 107 amino acids.

4 In this context about includes the particularly

5 recited range and ranges larger or smaller by several, a

6 few, 5, 4, 3, 2 or 1 amino acid at either extreme or at

7 both extremes. For instance, about 25-107 amino acids in

8 this context means a polypeptide fragment of 25 plus or

9 minus εeveral, a few, 5, 4, 3, 2 or 1 amino acidε to 107 o plus or minus several a few, 5, 4, 3, 2 or 1 amino acid i residues, i.e., ranges as broad as 25 minus several amino 2 acids to 107 plus several amino acids to as narrow as 25 3 plus several amino acids to 107 minus several amino acids. 4 Highly preferred in this regard are the recited ranges s plus or minus as many as 5 amino acids at either or at both 6 extremes. Particularly highly preferred are the recited 7 ranges plus or minus as many as 3 amino acids at either or 8 at both the recited extremes. Especially particularly 9 highly preferred are ranges plus or minus 1 amino acid at 0 either or at both extremes or the recited ranges with no i additions or deletions. Most highly preferred of all in 2 this regard are fragments from about 25 to about 107. 3 Among especially preferred fragments of the invention 4 are truncation mutants of cytostatin I. Truncation mutants 5 include cytostatin I polypeptides having the amino acid 6 sequence of Figure 1, or of variants or derivatives 7 thereof, except for deletion of a continuous series of 8 residues (that iε, a continuouε region, part or portion) 9 that includes the amino terminus, or a continuous series of 0 residues that includes the carboxyl terminus or, aε in i double truncation mutantε, deletion of two continuouε 2 series of residues, one including the amino terminus and 3 one including the carboxyl terminus. Fragments having the size ranges εet out about alεo are preferred embodimentε of 5 truncation fragments, which are eεpecially preferred among 6 fragments generally. Also preferred in this aspect of the invention are 8 fragments characterized by structural or functional

1 attributes of cytostatin I. Preferred embodiments of the

2 invention in this regard include fragments that comprise

3 alpha-helix and alpha-helix forming regions ("alpha- regions") , beta-sheet and beta-sheet-forming regions

5 ("beta-regions") , turn and turn-forming regionε ("turn-

6 regions") , coil and coil-forming regions ("coil-regions") ,

7 hydrophilic regions, hydrophobic regions, alpha amphipathic

8 regions, beta amphipathic regions, flexible regions,

9 surface-forming regions and high antigenic index regions of o cytostatin I . i Certain preferred regions in these regards are set out 2 in Figure 3, and include, but are not limited to, regions 3 of the aforementioned types identified by analysis of the 4 amino acid sequene set out in Figure 1. As εet out in 5 Figure 3, such preferred regions include Gamier-Robson 6 alpha-regions, beta-regions, turn-regions and coil-regions, 7 Chou-Fasman alpha-regions, beta-regions and turn-regions, 8 Kyte-Doolittle hydrophilic regions and hydrophilic regions, 9 Eisenberg alpha and beta amphipathic regions, Karplus- 0 Schulz flexible regions, Emini surface-forming regions and i Jameson-Wolf high antigenic index regions. 2 Among highly preferred fragments in this regard are 3 those that comprise regions of cytostatin I that combine 4 several structural features, εuch aε several of the 5 features set out above. In this regard, the regions 6 defined by the residues about 25 to about 107 of Figure 1, 7 which all are characterized by amino acid compositions 8 highly characteristic of turn-regions, hydrophilic regions, 9 flexible-regions, surface-forming regions, and high 0 antigenic index-regions, are especially highly preferred i regions. Such regionε may be comprised within a larger 2 polypeptide or may be by themselveε a preferred fragment of 3 the present invention, as discussed above. It will be 4 appreciated that the term "about" as used in this paragraph 5 has the meaning set out above regarding fragments in 6 general. Further preferred regions are those that mediate 8 activities of cytostatin I. Most highly preferred in this

1 regard are fragments that have a chemical, biological or

2 other activity of cytostatin I, including those with a

3 similar activity or an improved activity, or with a

4 decreased undesirable activity. Highly preferred in this

5 regard are fragments that contain regions that are homologs

6 in sequence, or in position, or in both sequence and to

7 active regions of related polypeptides, such as the related

8 polypeptides set out in Figure 2, which includes

9 cytostatins. Among particularly preferred fragments in lo these regards are truncation mutants, as discusεed above. ii It will be appreciated that the invention also relates

12 to, among others, polynucleotides encoding the

13 aforementioned fragments, polynucleotides that hybridize to

14 polynucleotideε encoding the fragments, particularly those is that hybridize under stringent conditions, and

16 polynucleotides, such as PCR primerε, for amplifying

1 polynucleotides that encode the fragments. In these ie regards, preferred polynucleotides are those that 19 correspondent to the preferred fragments, as discussed 2o above.

21

22 Vectors, host cells, expression

23 The present invention also relates to vectors which

24 include polynucleotides of the preεent invention, hoεt

25 cells which are genetically engineered with vectors of the

26 invention and the production of polypeptides of the

27 invention by recombinant techniques.

28 Host cells can be genetically engineered to 9 incorporate polynucleotides and express polypeptides of the

30 present invention. For instance, polynucleotides may be 3i introduced into host cells using well known techniques of 2 infection, transduction, transfection, transvection and 3 transformation. The polynucleotides may be introduced 4 alone or with other polynucleotides. Such other 5 polynucleotides may be introduced independently, co- 6 introduced or introduced joined to the polynucleotides of the invention.

1 Thus, for instance, polynucleotides of the invention

2 may be transfected into host cells with another, separate,

3 polynucleotide encoding a selectable marker, using standard

4 techniques for co-transfection and selection in, for

5 instance, mammalian cells. In this case the

6 polynucleotides generally will be stably incorporated into

7 the host cell genome.

8 Alternatively, the polynucleotides may be joined to a

9 vector containing a selectable marker for propagation in a 0 host. The vector construct may be introduced into host i cells by the aforementioned techniques. Generally, a 2 plasmid vector iε introduced as DNA in a precipitate, such 3 as a calcium phosphate precipitate, or in a complex with a 4 charged lipid. Electroporation also may be uεed to 5 introduce polynucleotideε into a hoεt. If the vector is a 6 virus, it may be packaged in vitro or introduced into a 7 packaging cell and the packaged viruε may be transduced 8 into cells. A wide variety of techniques suitable for 9 making polynucleotides and for introducing polynucleotides 0 into cellε in accordance with thiε aεpect of the invention i are well known and routine to thoεe of εkill in the art. 2 Such techniques are reviewed at length in Sambrook et al. 3 cited above, which is illustrative of the many laboratory 4 manuals that detail these techniques. In accordance with 5 this aspect of the invention the vector may be, for 6 example, a plasmid vector, a single or double-stranded 7 phage vector, a single or double-stranded RNA or DNA viral 8 vector. Such vectors may be introduced into cells as 9 polynucleotides, preferably DNA, by well known techniques 0 for introducing DNA and RNA into cellε. The vectors, in i the case of phage and viral vectors also may be and 2 preferably are introduced into cells aε packaged or 3 encapsidated virus by well known techniques for infection 4 and tranεduction. Viral vectorε may be replication 5 competent or replication defective. In the latter caεe 6 viral propagation generally will occur only in 7 complementing host cells.

1 Preferred among vectors, in certain reεpectε, are

2 those for expression of polynucleotides and polypeptideε of

3 the present invention. Generally, such vectors comprise

4 cis-acting control regions effective for expression in a

5 host operatively linked to the polynucleotide to be

6 expressed. Appropriate trans-acting factors either are

7 supplied by the host, supplied by a complementing vector or

8 supplied by the vector itself upon introduction into the

9 host. o In certain preferred embodiments in thiε regard, the i vectors provide for specific expression. Such specific 2 expression may be inducible expresεion or expression only 3 in certain types of cells or both inducible and cell- 4 specific. Particularly preferred among inducible vectors 5 are vectors that can be induced for expresεion by 6 environmental factorε that are easy to manipulate, such aε 7 temperature and nutrient additives. A variety of vectors 8 suitable to this aspect of the invention, including 9 constitutive and inducible expression vectors for use in 0 prokaryotic and eukaryotic hostε, are well known and i employed routinely by those of skill in the art. 2 The engineered host cellε can be cultured in 3 conventional nutrient media, which may be modified aε appropriate for, inter alia, activating promoterε, 5 selecting transformants or amplifying genes. Culture 6 conditions, such as temperature, pH and the like, 7 previously used with the host cell selected for expression 8 generally will be suitable for expresεion of polypeptideε 9 of the preεent invention as will be apparent to those of 0 skill in the art. i A great variety of expression vectors can be used to 2 express a polypeptide of the invention. Such vectorε 3 include chromosomal, episomal and virus-derived vectors 4 e.g., vectors derived from bacterial plasmids, from 5 bacteriophage, from yeast episomes, from yeast chromosomal 6 elements, from viruseε such as baculoviruεeε, papova 7 viruses, such as SV40, vaccinia viruses, adenoviruses, fowl 8 pox viruses, pseudorabies viruses and retroviruses, and

1 vectorε derived from combinations thereof, such as those

2 derived from plasmid and bacteriophage genetic elements,

3 such as cosmids and phagemids, all may be used for

4 expresεion in accordance with thiε aεpect of the present

5 invention. Generally, any vector suitable to maintain,

6 propagate or expresε polynucleotideε to expreεε a

7 polypeptide in a hoεt may be used for expresεion in this

8 regard.

9 The appropriate DNA sequence may be inserted into the 0 vector by any of a variety of well-known and routine i techniques. In general, a DNA sequence for expression is 2 joined to an expression vector by cleaving the DNA sequence 3 and the expression vector with one or more restriction 4 endonucleases and then joining the restriction fragments s together using T4 DNA ligase. Procedures for restriction 6 and ligation that can be used to this end are well known 7 and routine to those of skill. Suitable procedures in this s regard, and for constructing expresεion vectors using 9 alternative techniques, which also are well known and 0 routine to those skill, are set forth in great detail in i Sambrook et al. cited elεewhere herein. 2 The DNA εequence in the expression vector is 3 operatively linked to appropriate expression control 4 sequence(ε), including, for inεtance, a promoter to direct 5 mRNA tranεcription. Representatives of such promoters 6 include the phage lambda PL promoter, the E. coli lac, trp 7 and tac promoters, the SV40 early and late promoters and 8 promoters of retroviral LTRs, to name just a few of the 9 well-known promoters. It will be understood that numerous 0 promoters not mentioned are suitable for use in this aspect i of the invention are well known and readily may be employed 2 by those of skill in the manner illustrated by the 3 discussion and the examples herein. 4 In general, expresεion conεtructs will contain sites 5 for transcription initiation and termination, and, in the 6 transcribed region, a ribosome binding site for 7 translation. The coding portion of the mature transcriptε 8 expreεεed by the conεtructε will include a translation

initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated. In addition, the constructs may contain control regions that regulate as well as engender expresεion. Generally, in accordance with many commonly practiced procedures, such regions will operate by controlling transcription, such as repressor binding siteε and enhancers, among otherε. The vector containing the appropriate DNA εequence aε described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate hoεt uεing a variety of well known techniques suitable to expression therein of a desired polypeptide. Representative examples of appropriate hosts include bacterial cells, such aε E. coli, Streptomyceε and Salmonella typhimurium cellε; fungal cells, such as yeast cells,- insect cells such as Drosophila S2 and Spodoptera Sf9 cells,- animal cells such as CHO, COS and Bowes melanoma cells,- and plant cells. Hosts for of a great variety of expression constructε are well known, and thoεe of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention. The following vectorε, which are commercially available, are provided by way of example. Among vectorε preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen,- pBS vectors, Phageεcript vectorε, Blueεcript vectorε, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors are listed solely by way of illustration of the many commercially available and well known vectors that are available to those of skill in the art for use in accordance with this aspect of the present invention. It will be appreciated

1 that any other plaεmid or vector suitable for, for example,

2 introduction, maintenance, propagation or expression of a

3 polynucleotide or polypeptide of the invention in a host

4 may be used in this aspect of the invention.

5 Promoter regionε can be selected from any desired gene

6 using vectors that contain a reporter transcription unit

7 lacking a promoter region, such as a chloramphenicol acetyl

8 transferase ("cat") transcription unit, downstream of

9 restriction site or sites for introducing a candidate 0 promoter fragment; i.e., a fragment that may contain a i promoter. As is well known, introduction into the vector 2 of a promoter-containing fragment at the restriction site 3 upstream of the cat gene engenders production of CAT 4 activity, which can be detected by standard CAT assayε. 5 Vectors suitable to this end are well known and readily 6 available. Two such vectors are pKK232-8 and pC 7. Thus, 7 promoters for expression of polynucleotides of the present 8 invention include not only well known and readily available 9 promoters, but also promoters that readily may be obtained 0 by the foregoing technique, uεing a reporter gene. i Among known bacterial promoterε εuitable for 2 expression of polynucleotides and polypeptideε in 3 accordance with the present invention are the E. coli lad 4 and lacZ and promoters, the T3 and T7 promoters, the T5 5 tac promoter, the lambda PR, PL promoters and the trp 6 promoter. Among known eukaryotic promoterε suitable in 7 this regard are the CMV immediate early promoter, the HSV 8 thymidine kinase promoter, the early and late SV40 9 promoters, the promoters of retroviral LTRε, εuch as those 0 of the Rous sarcoma virus ("RSV") , and metallothionein i promoters, such as the mouse metallothionein-I promoter. 2 Selection of appropriate vectors and promoters for 3 expresεion in a hoεt cell iε a well known procedure and the 4 requisite techniques for expression vector construction, 5 introduction of the vector into the host and expresεion in 6 the host are routine skillε in the art. 7 The preεent invention alεo relateε to hoεt cellε 8 containing the above-deεcribed conεtructε diεcuεεed above.

1 The host cell can be a higher eukaryotic cell, such as a

2 mammalian cell, or a lower eukaryotic cell, such as a yeast

3 cell, or the host cell can be a prokaryotic cell, such as

4 a bacterial cell.

5 Introduction of the construct into the host cell can

6 be effected by calciumphosphate transfection, DEAE-dextran

7 mediated transfection, cationic lipid-mediated

8 transfection, electroporation, transduction, infection or

9 other methods. Such methods are described in many standard 0 laboratory manuals, such as Davis et al. BASIC METHODS IN 1 MOLECULAR BIOLOGY, (1986) . 2 Constructs in host cellε can be uεed in a conventional 3 manner to produce the gene product encoded by the 4 recombinant sequence. Alternatively, the polypeptides of 5 the invention can be synthetically produced by conventional 6 peptide syntheεizerε. 7 Mature proteins can be expressed in mammalian cells, 8 yeast, bacteria, or other cellε under the control of 9 appropriate promoters. Cell-free translation syεtems can 0 also be employed to produce such proteins using RNAs i derived from the DNA constructε of the present invention. 2 Appropriate cloning and expression vectors for use with 3 prokaryotic and eukaryotic hosts are described by Sambrook 4 et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., 5 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 6 N.Y. (1989) . 7 Transcription of the DNA encoding the polypeptides of 8 the present invention by higher eukaryotes may be increased 9 by inserting an enhancer sequence into the vector. 0 Enhancers are cis-acting elements of DNA, usually about i from 10 to 300 bp that act to increase transcriptional 2 activity of a promoter in a given host cell-type. Examples 3 of enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, 5 the cytomegalovirus early promoter enhancer, the polyoma 6 enhancer on the late side of the replication origin, and 7 adenovirus enhancers.

1 Polynucleotides of the invention, encoding the

2 heterologous structural sequence of a polypeptide of the

3 invention generally will be inserted into the vector using

4 standard techniques so that it is operably linked to the

5 promoter for expresεion. The polynucleotide will be

6 positioned so that the transcription start site is located

7 appropriately 5' to a ribosome binding site. The ribosome

8 binding site will be 5' to the AUG that initiates

9 translation of the polypeptide to be expressed. Generally, 10 there will be no other open reading frames that begin with ii an initiation codon, usually AUG, and lie between the

12 ribosome binding site and the initiating AUG. Also,

13 generally, there will be a translation stop codon at the

14 end of the polypeptide and there will be a polyadenylation is εignal and a transcription termination signal appropriately

16 disposed at the 3' end of the transcribed region.

17 For secretion of the translated protein into the lumen

18 of the endoplasmic reticulum, into the periplasmic space

19 or into the extracellular environment, appropriate 20 secretion signals may be incorporated into the expresεed 2i polypeptide. The signals may be endogenous to the

22 polypeptide or they may be heterologous signals.

23 The polypeptide may be expresεed in a modified form,

24 εuch as a fusion protein, and may include not only J. secretion signals but also additional heterologous

26 functional regions. Thus, for instance, a region of

27 additional amino acids, particularly charged amino acids,

28 may be added to the N-terminus of the polypeptide to

29 improve stability and persiεtence in the host cell, during

30 purification or during εubsequent handling and storage. 3i Alεo, region alεo may be added to the polypeptide to

32 facilitate purification. Such regionε may be removed prior

33 to final preparation of the polypeptide. The addition of

34 peptide moietieε to polypeptides to engender secretion or

35 excretion, to improve stability and to facilitate

36 purification, among others, are familiar and routine

37 techniques in the art.

1 Following transformation of a suitable hoεt strain and

2 growth of the host strain to an appropriate cell density,

3 where the selected promoter is inducible it is induced by

4 appropriate means (e.g., temperature shift or exposure to

5 chemical inducer) and cells are cultured for an additional

6 period.

7 Cells typically then are harvested by centrifugation,

8 disrupted by physical or chemical means, and the resulting

9 crude extract retained for further purification.

10 Microbial cells employed in expression of proteins can ii be disrupted by any convenient method, including freeze-

12 thaw cycling, sonication, mechanical diεruption, or uεe of

13 cell lysing agents, such methods are well know to those

14 skilled in the art. is Various mammalian cell culture systemε can be employed ie for expression, as well. Examples of mammalian expresεion

17 systems include the COS-7 lines of monkey kidney is fibroblast, described in Gluzman et al., Cell 23: 175

19 (1981) . Other cell lines capable of expreεsing a

20 compatible vector include for example, the C127, 3T3, CHO,

21 HeLa, human kidney 293 and BHK cell lines.

22 The cytostatin I polypeptide can be recovered and

23 purified from recombinant cell cultureε by well-known

24 methods including ammonium sulfate or ethanol

25 precipitation, acid extraction, anion or cation exchange

26 chromatography, phosphocellulose chromatography,

27 hydrophobic interaction chromatography, affinity

28 chromatography, hydroxylapatite chromatography and lectin

29 chromatography. Most preferably, high performance liquid

30 chromatography ("HPLC") is employed for purification. Well 3i known techniques for refolding protein may be employed to 2 regenerate active conformation when the polypeptide is 3 denatured during isolation and or purification. Polypeptides of the present invention include 5 naturally purified products, products of chemical synthetic 6 procedures, and products produced by recombinant techniques 7 from a prokaryotic or eukaryotic host, including, for 8 example, bacterial, yeast, higher plant, insect and

1 mammalian cellε. Depending upon the hoεt employed in a

2 recombinant production procedure, the polypeptides of the

3 present invention may be glycosylated or may be non- glycosylated. In addition, polypeptides of the invention

5 may alεo include an initial modified methionine reεidue, in

6 some cases as a result of host-mediated processes.

7 Cytostatin I polynucleotideε and polypeptideε may be

8 used in accordance with the present invention for a variety

9 of applications, particularly those that make use of the 10 chemical and biological properties cytoεtatin I. Among ii these are applications in tumor treatment, inhibition of

12 angiogenesiε, inhibition of metaεtases, stimulation of milk

13 production and promotion of involution of the breast.

14 Additional applications relate to diagnosis and to is treatment of disorders of cells, tisεueε and organiεms. ie These aspectε of the invention are illustrated further by 17 the following discusεion.

18

19 Polynucleotide assayε

20 This invention is also related to the use of the 2i cytostatin I polynucleotides to detect complementary

22 polynucleotides such aε, for example, aε a diagnoεtic

23 reagent. Detection of a mutated form of cytostatin I

24 associated with a dysfunction will provide a diagnostic

25 tool that can add or define a diagnosis of a disease or

26 susceptibility to a disease which results from under-

27 expression over-expression or altered expression of

28 cytostatin I, such as, for example, aberrant cellular

29 proliferation.

30 Individuals carrying mutations in the human cytoεtatin 3i I gene may be detected at the DNA level by a variety of

32 techniques. Nucleic acids for diagnosiε may be obtained

33 from a patient's cells, such as from blood, urine, saliva,

34 tissue biopsy and autopsy material. The genomic DNA may be

35 used directly for detection or may be amplified

36 enzymatically by using PCR prior to analysis. PCR (Saiki

37 et al., Nature, 324: 163-166 (1986)) . RNA or cDNA may also 38 be used in the εame wayε. Aε an example, PCR primers

complementary to the nucleic acid encoding cytostatin I can be used to identify and analyze cytostatin I expression and mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled cytostatin I RNA or alternatively, radiolabeled cytostatin I antisense DNA sequenceε . Perfectly matched εequences can be distinguished from mismatched duplexes by RNaεe A digestion or by differences in melting temperatures. Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing. In addition, cloned DNA segments may be employed as probes to detect εpecific DNA segments. The sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method. For example, a sequencing primer is used with double- stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags. Genetic testing baεed on DNA εequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gelε, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gelε in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230: 1242 (1985)) . Sequence changes at specific locations also may be revealed by nuclease protection assayε, εuch aε RNaεe and Si protection or the chemical cleavage method (e.g. , Cotton et al., Proc. Natl. Acad. Sci., USA, 85: 4397-4401 (1985)) .

i Thus, the detection of a specific DNA sequence may be

2 achieved by methods such aε hybridization, RNaεe

3 protection, chemical cleavage, direct DNA εequencing or the

4 use of restriction enzymes, (e.g., restriction fragment

5 length polymorphisms ("RFLP") and Southern blotting of

6 genomic DNA.

7 In addition to more conventional gel-electrophoresiε

8 and DNA sequencing, mutations also can be detected by in

9 situ analysis. 0 I Chromoεome assays 2 The sequences of the present invention are also 3 valuable for chromosome identification. The sequence is 4 εpecifically targeted to and can hybridize with a 5 particular location on an individual human chromosome. 6 Moreover, there is a current need for identifying 7 particular εites on the chromosome. Few chromosome marking 8 reagents based on actual sequence data (repeat 9 polymorphisms) are presently available for marking 0 chromosomal location. The mapping of DNAs to chromosomes i according to the present invention is an important first 2 step in correlating those sequences with genes aεεociated 3 with diεeaεe. 4 In certain preferred embodimentε in this regard, the 5 cDNA herein disclosed is used to clone genomic DNA of a 6 cytostatin I gene. This can be accomplished using a 7 variety of well known techniques and libraries, which 8 generally are available commercially. The genomic DNA the 9 is used for in situ chromosome mapping using well known 0 techniques for this purpose. Typically, in accordance with i routine procedures for chromosome mapping, some trial and 2 error may be necesεary to identify a genomic probe that 3 gives a good in situ hybridization εignal. 4 In some cases, in addition, sequences can be mapped to 5 chromosomes by preparing PCR primers (preferably 15-25 bp) 6 from the cDNA. Computer analysiε of the 3' untranslated 7 region of the gene is used to rapidly select primers that 8 do not span more than one exon in the genomic DNA, thus

1 complicating the amplification process. These primers are

₂ then used for PCR screening of somatic cell hybrids

3 containing individual human chromosomes. Only those

4 hybrids containing the human gene corresponding to the

5 primer will yield an amplified fragment.

6 PCR mapping of somatic cell hybrids is a rapid

7 procedure for asεigning a particular DNA to a particular

8 chromoεome. Uεing the present invention with the same

9 oligonucleotide primers, sublocalization can be achieved 10 with panelε of fragments from specific chromosomes or pools ii of large genomic clones in an analogous manner. Other

12 mapping strategies that can similarly be used to map to its

13 chromosome include in situ hybridization, prescreening with

14 labeled flow-sorted chromosomeε and preselection by

15 hybridization to construct chromosome specific-cDNA

16 librarieε.

17 Fluoreεcence in situ hybridization ("FISH") of a cDNA ie clone to a metaphaεe chromosomal spread can be used to

19 provide a preciεe chromosomal location in one step. This

20 technique can be used with cDNA as short as 50 or 60. For 2i a review of this technique, see Verma et al. , HUMAN

22 CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES, Pergamon Press,

23 New York (1988) . 4 Once a sequence has been mapped to a precise 5 chromosomal location, the physical position of the sequence 6 on the chromosome can be correlated with genetic map data. 7 Such data are found, for example, in V. McKusick, MENDELIAN 8 INHERITANCE IN MAN, available on line through Johns Hopkins 9 Univerεity, Welch Medical Library. The relationεhip 0 between geneε and diεeaεes that have been mapped to the i same chromosomal region are then identified through linkage 2 analysis (coinheritance of physically adjacent genes) . 3 Next, it is necessary to determine the differences in 4 the cDNA or genomic sequence between affected and 5 unaffected individuals. If a mutation is observed in some 6 or all of the affected individuals but not in any normal 7 individuals, then the mutation is likely to be the 8 causative agent of the disease.

1 With current resolution of physical mapping and

2 genetic mapping techniqueε, a cDNA precisely localized to

3 a chromosomal region associated with the disease could be

4 one of between 50 and 500 potential causative genes. (This

5 assumes 1 megabase mapping resolution and one gene per 20

6 kb) .

7

8 Polypeptide assays

9 The present invention also relates to a diagnostic 0 assayε such as quantitative and diagnostic asεayε for i detecting levelε of cytoεtatin I protein in cells and 2 tissues, including determination of normal and abnormal 3 levels. Thus, for instance, a diagnostic asεay in 4 accordance with the invention for detecting under- 5 expression of cytostatin I protein compared to normal 6 control tissue sampleε may be uεed to detect the presence 7 of aberrant cellular proliferation, for example. Asεay s techniqueε that can be uεed to determine levelε of a 9 protein, such as an cytostatin I protein of the present 0 invention, in a sample derived from a host are well-known i to those of skill in the art. Such asεay methodε include 2 radioimmunoaεεayε, competitive-binding aεsayε, WesternBlot 3 analyεiε and ELISA aεεayε. Among these ELISAs frequently 4 are preferred. An ELISA aεsay initially comprises 5 preparing an antibody specific to cytostatin I, preferably 6 a monoclonal antibody. In addition a reporter antibody 7 generally iε prepared which bindε to the monoclonal 8 antibody. The reporter antibody iε attached a detectable 9 reagent such as radioactive, fluorescent or enzymatic 0 reagent, in this example horseradish peroxidase enzyme. i To carry out an ELISA a sample is removed from a host 2 and incubated on a εolid support, e.g. a polystyrene dish, 3 that binds the proteins in the sample. Any free protein 4 binding sites on the dish are then covered by incubating 5 with a non-specific protein such aε bovine serum albumin. 6 Next, the monoclonal antibody is incubated in the dish 7 during which time the monoclonal antibodies attach to any 8 cytostatin I proteins attached to the polystyrene dish.

1 Unbound monoclonal antibody is washed out with buffer. The

₂ reporter antibody linked to horseradish peroxidase is

3 placed in the dish resulting in binding of the reporter

4 antibody to any monoclonal antibody bound to cytostatin I.

5 Unattached reporter antibody is then washed out. Reagents

6 for peroxidase activity, including a colorimetric subεtrate

7 are then added to the diεh. Immobilized peroxidaεe,

8 linked to cytostatin I through the primary and secondary

9 antibodies, produces a colored reaction product. The o amount of color developed in a given time period indicates i the amount of cytostatin I protein present in the sample. 2 Quantitative resultε typically are obtained by reference to 3 a εtandard curve. 4 A competition assay may be employed wherein antibodies s specific to cytostatin I attached to a solid εupport and 6 labeled cytoεtatin I and a εample derived from the host are 7 passed over the solid support and the amount of label 8 detected attached to the εolid support can be correlated to 9 a quantity of cytostatin I in the sample. 0 i Antibodies 2 The polypeptides, their fragments or other 3 derivatives, or analogs thereof, or cells expressing them 4 can be used aε an immunogen to produce antibodieε thereto. 5 Theεe antibodieε can be, for example, polyclonal or 6 monoclonal antibodieε. The preεent invention also includes 7 chimeric, single chain, and humanized antibodies, as well 8 as Fab fragments, or the product of an Fab expression 9 library. Various procedures known in the art may be used 0 for the production of εuch antibodies and fragments. i Antibodies generated against the polypeptides 2 corresponding to a sequence of the present invention can be 3 obtained by direct injection of the polypeptides into an 4 animal or by administering the polypeptides to an animal, 5 preferably a nonhuman. The antibody so obtained will then 6 bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can 8 be used to generate antibodies binding the whole native

1 polypeptides. Such antibodieε can then be used to isolate

2 the polypeptide from tissue expresεing that polypeptide.

3 For preparation of monoclonal antibodieε, any

4 technique which provides antibodies produced by continuouε

5 cell line cultures can be used. Examples include the

6 hybridoma technique (Kohler, G. and Milstein, C. , Nature

7 256: 495-497 (1975), the trioma technique, the human B-cell

8 hybridoma technique (Kozbor et al., Immunology Today 4: 72

9 (1983) and the EBV-hybridoma technique to produce human 0 monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL i ANTIBODIES AND CANCER THERAPY, Alan R. Lisε, Inc. (1985) . 2 Techniques described for the production of single 3 chain antibodies (U.S. Patent No. 4,946,778) can be adapted 4 to produce single chain antibodies to immunogenic s polypeptide products of this invention. Also, transgenic 6 mice, or other organisms such as other mammals, may be used 7 to express humanized antibodies to immunogenic polypeptide s productε of this invention. 9 The above-deεcribed antibodies may be employed to 0 isolate or to identify clones expresεing the polypeptide or i purify the polypeptide of the present invention by 2 attachment of the antibody to a solid support for isolation 3 and/or purification by affinity chromatography. 4 Thus, among otherε, the medical relevance and 5 practical use of the cytostatin I of the present invention 6 are based upon comparisonε with other known proteinε and by 7 experimental analysis. The experimental results suggest 8 that cytostatin I, as a therapeutic protein, may have the 9 following medical applications: 0 1. Anti-tumor: the growth inhibitory activity of i cytostatin I may be used as a therapeutic agent to treat 2 various cancers. The expression of cytostatin I in human 3 breast cancers was firεt investigated in seven breast 4 cancer cell lines: MCF-7, T47D, MDA-MD-231, MDA-MD-435, 5 MDA-MD-436, BT549 and Hs578t. Northern blot analysis 6 failed to detect the cytostatin I transcript in all breast 7 cancer cell lines. The inability to pick up the cytoεtatin 8 I mRNA in breaεt cancer cell lineε by Northern blot

indicates that the expresεion of the cytostatin I gene may be down-regulated in breast cancers during the breast malignant progression. To evaluate the potential biological significance of cytostatin I to human breast cancer progression, we studied cytostatin I gene expression in human breast tumor biopsy samples. The expression of cytostatin I in metaεtatic breast carcinomas and benign breast tisεueε were analyzed by Northern blot. Fig. 1 shows a downward progression in the levels of cytostatin I from benign breast to the highly metastatic breast carcinomas. Four of the four RNA samples from benign breast fibroadenomas showed a 1.1 kb transcript. RNAs from εample B5, a breaεt hyperplasia, showed a very weak 1.l cytostatin I transcript. In contrast, no signal of the cytostatin I transcript can be detected in all metastatic breast carcinomas except sample C3. The RNA from sample C3 represents an inflammatory breast carcinoma that carried many infiltrating lymphocytes. The strong signal of the cytostatin I transcript may be derived from the infiltrating lymphocytes. The existence of cytostatin I transcripts in benign human breast tissues and its loss of expression in breast carcinomas indicate a role of down-regulation of cytostatin I in breast cancer progression. In order to localize the cellular source of the cytostatin I expression and to further assess the biological relevance of the down-regulation of cytostatin I expresεion in breaεt cancerε, in si tu hybridization waε done on fixed εectionε from 10 in εitu ductal carcinomaε, 10 infiltrating carcinomas, and 13 benign breast lesions including 7 benign breast fibroadenomas and 6 benign breast hyperplasia (Fig. 2) . In theεe experiments, two aspects of MDGI-1 expression were examined: a) the tissue localization (stromal versus epithelial) of the cytostatin I and b) the correlation of cytostatin I expression and breast malignant phenotype. In all cases a strong cytostatin I transcript was found in the epithelial cells of benign breast fibroadenomas (Fig.2A) . The labeling of cytostatin I mRNA

1 was detectable in the epithelial cells in all seven benign breast fibroadenomas. In contrast, in all cases the highly infiltrating malignant breast εampleε are not labeled either in the neoplaεtic cellε themselves or their

5 surrounding stromal cells (Fig. 2D) . Nine of ten low grade

6 in si tu carcinomas were also stained negatively (Fig. 2C) .

7 In benign breast hyperplasia, five of the six samples

8 showed a negative staining (Fig. 2B) and one sample showed

9 a sparse and a light staining of cytostatin I tranεcript. 0 The loss of expreεsion in both breast carcinomas and the i highly proliferative benign breast hyperplasia (some may 2 eventually become carcinomas) suggeεt the role of 3 cytoεtatin I aε an anti-proliferative or tumor εuppreεεor 4 gene in breaεt cancer onεet and progression. s 2. Anti-angiogenesiε: cytoεtatin I inhibitε 6 fibroblast and endothelial cell growth. 7 3. Anti-metastaεiε: tumor cellε muεt attract new 8 veεεels in order to grow and metastasize efficiently. The 9 inhibition of endothelial cell growth by cytoεtatin I, 0 therefore, prevents metastases. i 4. Stimulation of milk production after childbirth: 2 cytostatin I inhibits mammary epithelial cell growth and 3 modulation mammary gland differentiation, promotes 4 formation of alveolar buds, εupportε development of 5 differentiated lobuloalveoli, and stimulates milk protein 6 synthesis and fat droplet accumulation. 7 5. Stimulation of dairy cows milk production or 8 recombinant proteins produced by cows. 9 6. Modulation of beta-adrenergic senεitivity of 0 cardiac myocyteε. i The variouε potential theapeutic categorieε and uεeε 2 of the cytoεtatin I include but are not limited to all 3 aspects of the following areaε of medical practice: 1. 4 Oncology, 2. Cardiovaεcular, 3. Immunology, 4. Hematology, 5 5. Metabolism, 6. Gynecology and Obstetricε, and 7. 6 Endocrinology. 7 8 Cytostatin I binding molecules and asεays

1 This invention also provides a method for

2 identification of molecules, such as receptor moleculeε,

3 that bind cytostatin I. Genes encoding proteins that bind

4 cytostatin I, such as receptor proteins, can be identified

5 by numerous methods known to those of skill in the art, for

6 example, ligand panning and FACS sorting. Such methods are

7 described in many laboratory manualε εuch aε, for inεtance,

8 Coligan et al., Current Protocolε in Immunology 1(2):

9 Chapter 5 (1991) . o For instance, expression cloning may be employed for i this purpose. To this end polyadenylated RNA is prepared 2 from a cell responsive to cytostatin I, a cDNA library is 3 created from this RNA, the library is divided into pools 4 and the pools are transfected individually into cellε that s are not responsive to cytostatin I. The transfected cells 6 then are exposed to labeled cytoεtatin I. (Cytostatin I 7 can be labeled by a variety of well-known techniques 8 including standard methods of radio-iodination or incluεion 9 of a recognition εite for a site-specific protein kinase.) 0 Following exposure, the cells are fixed and binding of i cytoεtatin I is determined. These procedures conveniently 2 are carried out on glass slides. 3 Pools are identified of cDNA that produced cytostatin 4 I-binding cellε. Sub-pools are prepared from these 5 positives, transfected into host cells and screened as 6 described above. Uεing an iterative sub-pooling and re- 7 screening process, one or more single clones that encode 8 the putative binding molecule, such as a receptor molecule, 9 can be isolated. 0 Alternatively a labeled ligand can be photoaffinity i linked to a cell extract, such as a membrane or a membrane 2 extract, prepared from cells that expreεε a molecule that 3 it bindε, εuch aε a receptor molecule. Croεε-linked 4 material iε reεolved by polyacrylamide gel electrophoreεis 5 ("PAGE") and exposed to X-ray film. The labeled complex 6 containing the ligand-receptor can be excised, resolved 7 into peptide fragments, and subjected to protein 8 microsequencing. The amino acid sequence obtained from

1 microsequencing can be used to design unique or degenerate

2 oligonucleotide probes to screen cDNA libraries to identify

3 geneε encoding the putative receptor molecule. Polypeptideε of the invention alεo can be used to

5 assess cytostatin I binding capacity of cytostatin I

6 binding molecules, εuch as receptor molecules, in cells or

7 in cell-free preparations.

8

9 Agonistε and antagonists - asεayε and molecules ιo The invention also provides a method of screening ii compounds to identify those which enhance or block the

12 action of cytostatin I on cellε, εuch as its interaction

13 with cytostatin I-binding moleculeε such as receptor

1 molecules. An agonist is a compound which increases the is natural biological functions of cytostatin I, while ie antagonists decrease or eliminate such functions.

17 For example, a cellular compartment, such as a is membrane or a preparation thereof, such as a membrane-

19 preparation, may be prepared from a cell that expresses a

20 molecule that binds cytoεtatin I, εuch aε a molecule of a 2i εignaling or regulatory pathway modulated by cytoεtatin I.

22 The preparation iε incubated with labeled cytostatin I in

23 the absence or the presence of a candidate molecule which

24 may be a cytostatin I agonist or antagonist. The ability

25 of the candidate molecule to bind the binding molecule is

26 reflected in decreased binding of the labeled ligand.

27 Moleculeε which bind gratuitouεly, i.e., without inducing

28 the effectε of cytostatin I on binding the cytostatin I

29 binding molecule, are most likely to be good antagonists.

30 Molecules that bind well and elicit effectε that are the 3i εame aε or cloεely related to cytoεtatin I, are good

32 agoniεtε.

33 Cytoεtatin I-like effectε of potential agonists and

34 antagonistε may by measured, for instance, by determining

35 activity of a εecond meεεenger εyεtem following interaction

36 of the candidate molecule with a cell or appropriate cell

37 preparation, and comparing the effect with that of 38 cytostatin I or molecules that elicit the same effects as

1 cytostatin I. Second messenger syεtemε that may be uεeful

2 in this regard include but are not limited to AMP guanylate

3 cyclase, ion channel or phosphoinoεitide hydrolysis second

4 messenger syεtems.

5 Another example of an assay for cytostatin I

6 antagonists is a competitive assay that combines cytostatin

7 I and a potential antagonist with membrane-bound cytostatin

8 I receptor moleculeε or recombinant cytoεtatin I receptor

9 molecules under appropriate conditions for a competitive lo inhibition assay. Cytostatin I can be labeled, such as by ii radioactivity, such that the number of cytostatin I

12 molecules bound to a receptor molecule can be determined

13 accurately to assess the effectiveness of the potential

14 antagonis . is Potential antagonistε include small organic molecules, ie peptides, polypeptides and antibodieε that bind to a

17 polypeptide of the invention and thereby inhibit or

18 extinguiεh itε activity. Potential antagonists also may be

19 small organic molecules, a peptide, a polypeptide such as

20 a closely related protein or antibody that binds the same 2i sites on a binding molecule, εuch aε a receptor molecule,

22 without inducing cytoεtatin I-induced activitieε, thereby

23 preventing the action of cytostatin I by excluding

24 cytostatin I from binding.

25 Other potential antagonistε include antiεenεe

26 molecules. Antisenεe technology can be used to control

27 gene expression through antisense DNA or RNA or through

28 triple-helix formation. Antiεenεe techniqueε are discussed,

29 for example, in - Okano, J. Neurochem. 56: 560 (1991);

30 OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE 3i EXPRESSION, CRC Presε, Boca Raton, FL (1988) . Triple helix

32 formation iε discusεed in, for inεtance Lee et al. , Nucleic

33 Acids Research 6: 3073 (1979); Cooney et al. , Science 241:

34 456 (1988); and Dervan et al., Science 251: 1360 (1991).

35 The methods are based on binding of a polynucleotide to a

36 complementary DNA or RNA. For example, the 5' coding 7 portion of a polynucleotide that encodes the mature 8 polypeptide of the preεent invention may be uεed to design

1 an antisense RNA oligonucleotide of from about 10 to 40

2 base pairs in length. A DNA oligonucleotide is designed to

3 be complementary to a region of the gene involved in

4 transcription thereby preventing tranεcription and the

5 production of cytoεtatin I. The antisense RNA

6 oligonucleotide hybridizes to the mRNA in vivo and blocks

7 translation of the mRNA molecule into cytostatin I

8 polypeptide. The oligonucleotides described above can also

9 be delivered to cells such that the antisense RNA or DNA 10 may be expresεed in vivo to inhibit production of ii cytostatin I.

12 The antagonists may be employed in a composition with

13 a pharmaceutically acceptable carrier, e.g., as hereinafter

14 described. is The antagonistε may be employed for inεtance to treat

16 and/or prevent exceεεive inhibition of cell or tiεεue

17 growth or inappropriate differentiation εtimulatory ie activity. For example, the antagoniεtε promote involution

19 of breaεt (return of an enlarged breaεt to normal εize

20 after parturition, childbirth) : Antisense phosphorothioate 2 oligonucleotides or antibodieε to cytoεtatin I could

22 εelectively inhibit endogenouε cytoεtatin I expreεεion in

23 mammary epithelial cells and suppresses appearance of

24 alveolar end buds and lowerε the beta-caεein level.

25

26 Compoεitionε

27 The invention alεo relates to compositions comprising

28 the polynucleotide or the polypeptides discussed above or

29 the agonists or antagonistε. Thus, the polypeptides of the

30 present invention may be employed in combination with a 3i non-sterile or sterile carrier or carriers for use with

32 cells, tisεues or organisms, such as a pharmaceutical

33 carrier suitable for administration to a εubject. Such

34 compositions comprise, for instance, a media additive or a

35 therapeutically effective amount of a polypeptide of the

36 invention and a pharmaceutically acceptable carrier or

37 excipient. Such carriers may include, but are not limited

38 to, saline, buffered saline, dextrose, water, glycerol,

1 ethanol and combinationε thereof. The formulation should

2 suit the mode of administration.

3

4 Kits

5 The invention further relates to pharmaceutical packs

6 and kits comprising one or more containers filled with one

7 or more of the ingredients of the aforementioned

8 compositionε of the invention. Aεεociated with such

9 container(s) can be a notice in the form prescribed by a ιo governmental agency regulating the manufacture, use or sale ii of pharmaceuticals or biological products, reflecting

12 approval by the agency of the manufacture, use or sale of

13 the product for human administration.

14

15 Administration

16 Polypeptideε and other compoundε of the preεent

17 invention may be employed alone or in conjunction with ie other compoundε, such as therapeutic compounds.

19 The pharmaceutical compositionε may be adminiεtered in

20 any effective, convenient manner including, for inεtance, 2i administration by topical, oral, anal, vaginal,

22 intravenous, intraperitoneal, intramuscular, subcutaneous,

23 intranasal or intradermal routes among others.

24 The pharmaceutical compositions generally are

25 administered in an amount effective for treatment or

26 prophylaxis of a specific indication or indications. In

27 general, the compositions are administered in an amount of

28 at least about 10 μg/kg body weight. In most caseε they

29 will be administered in an amount not in excess of about 8

30 mg/kg body weight per day. Preferably, in most cases, dose 3i is from about 10 μg/kg to about 1 mg/kg body weight, daily. 2 It will be appreciated that optimum dosage will be

33 determined by standard methods for each treatment modality

34 and indication, taking into account the indication, its

35 severity, route of administration, complicating conditions

36 and the like. 7

38 Gene therapy

1 The cytostatin I polynucleotides, polypeptides,

2 agonists and antagonistε that are polypeptideε may be

3 employed in accordance with the present invention by

4 expresεion of εuch polypeptideε in vivo, in treatment

5 modalitieε often referred to as "gene therapy."

6 Thus, for example, cellε from a patient may be

7 engineered with a polynucleotide, εuch aε a DNA or RNA,

8 encoding a polypeptide ex vivo, and the engineered cells

9 then can be provided to a patient to be treated with the 0 polypeptide. For example, cells may be engineered ex vivo i by the use of a retroviral plasmid vector containing RNA 2 encoding a polypeptide of the present invention. Such 3 methods are well-known in the art and their use in the 4 present invention will be apparent from the teachings 5 herein. 6 Similarly, cells may be engineered in vivo for 7 expresεion of a polypeptide in vivo by procedures known in 8 the art. For example, a polynucleotide of the invention 9 may be engineered for expresεion in a replication defective 0 retroviral vector, as discussed above. The retroviral i expression construct then may be isolated and introduced 2 into a packaging cell iε tranεduced with a retroviral 3 plaεmid vector containing RNA encoding a polypeptide of the 4 present invention such that the packaging cell now produces 5 infectious viral particles containing the gene of interest. 6 These producer cells may be administered to a patient for 7 engineering cells in vivo and expresεion of the polypeptide 8 in vivo. Theεe and other methodε for adminiεtering a 9 polypeptide of the preεent invention by such method should 0 be apparent to those skilled in the art from the teachingε i of the preεent invention. 2 Retroviruεeε from which the retroviral plasmid vectors 3 herein above mentioned may be derived include, but are not 4 limited to, Moloney Murine Leukemia Virus, spleen necrosis 5 virus, retroviruses such as Rous Sarcoma Virus, Harvey 6 Sarcoma Virus, avian leukoεiε virus, gibbon ape leukemia 7 viruε, human immunodeficiency virus, adenovirus, 8 Myeloproliferative Sarcoma Virus, and mammary tumor virus.

1 In one embodiment, the retroviral plasmid vector is derived

2 from Moloney Murine Leukemia Virus.

3 Such vectorε well include one or more promoterε for

4 expreεεing the polypeptide. Suitable promoters which may

5 be employed include, but are not limited to, the retroviral

6 LTR; the SV40 promoter; and the human cytomegalovirus (CMV)

7 promoter described in Miller et al., Biotechniques 7: 980-

8 990 (1989) , or any other promoter (e.g. , cellular promoterε

9 εuch as eukaryotic cellular promoters including, but not o limited to, the histone, RNA polymeraεe III, and β-actin i promoters) . Other viral promoters which may be employed 2 include, but are not limited to, adenovirus promoters, 3 thymidine kinase (TK) promoters, and B19 parvovirus 4 promoters. The selection of a suitable promoter will be s apparent to those skilled in the art from the teachings 6 contained herein. 7 The nucleic acid sequence encoding the polypeptide of s the present invention will be placed under the control of 9 a suitable promoter. Suitable promoters which may be 0 employed include, but are not limited to, adenoviral i promoters, such as the adenoviral major late promoter; or 2 heterologous promoters, such aε the cytomegaloviruε (CMV) 3 promoter,- the reεpiratory εyncytial viruε (RSV) promoter; 4 inducible promoters, such aε the MMT promoter, the 5 metallothionein promoter; heat εhock promoterε,- the albumin 6 promoter; the ApoAI promoter; human globin promoters; viral 7 thymidine kinase promoters, such as the Herpes Simplex 8 thymidine kinase promoter,- retroviral LTRs (including the 9 modified retroviral LTRs herein above described) ,- the β- 0 actin promoter; and human growth hormone promoterε. The i promoter alεo may be the native promoter which controlε the 2 gene encoding the polypeptide. 3 The retroviral plaεmid vector is employed to transduce 4 packaging cell lines to form producer cell lines. Examples 5 of packaging cells which may be transfected include, but 6 are not limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19- 7 14X, VT-19-17-H2, YCRE, YCRIP, GP+E-86, GP+envAml2, and DAN 8 cell lines as described in Miller, A. , Human Gene Therapy

l: 5-14 (1990). The vector may be transduced into the packaging cells through any meanε known in the art. Such meanε include, but are not limited to, electroporation, the use of liposomeε, and CaP04 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host. The producer cell line will generate infectious retroviral vector particleε, which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particleε then may be employed to tranεduce eukaryotic cellε, either in vitro or in vivo. The transduced eukaryotic cells will expreεε the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cellε, embryonic carcinoma cellε, aε well aε hematopoietic stem cellε, hepatocytes, fibroblaεts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

EXAMPLES

The present invention is further described by the following examples. The examples are provided solely to illustrate the invention by reference to specific embodiments. These exemplification's, while illustrating certain specific aspects of the invention, do not portray the limitations or circumscribe the εcope of the disclosed invention. Certain terms used herein are explained in the foregoing glossary. All examples were carried out using εtandard techniqueε, which are well known and routine to those of skill in the art, except where otherwise described in detail. Routine molecular biology techniqueε of the following exampleε can be carried out aε described in standard laboratory manuals, such as Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold

1 Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

2 (1989), herein referred to as "Sambrook."

3 All parts or amounts set out in the following examples

4 are by weight, unless otherwise specified.

5 Unleεε otherwise stated εize separation of fragments

6 in the examples below was carried out using standard

7 techniqueε of agarose and polyacrylamide gel

8 electrophoresis ("PAGE") in Sambrook and numerous other

9 references such aε, for inεtance, by Goeddel et al. , 0 Nucleic Acids Res. 8: 4057 (1980) . i Unless described otherwise, ligations were 2 accompliεhed using standard bufferε, incubation 3 temperatureε and timeε, approximately equimolar amountε of 4 the DNA fragments to be ligated and approximately 10 units s of T4 DNA ligase ("ligaεe") per 0.5 μg of DNA. 6 7 Example 1 8 Expreεεion and purification of human cytoεtatin I uεing 9 bacteria 0 i The DNA εequence encoding human cytoεtatin I in the 2 deposited polynucleotide was amplified using PCR 3 oligonucleotide primers specific to the amino and carboxyl 4 terminal sequence of the human cytostatin I protein and to 5 vector sequences 3' to the gene. Additional nucleotides 6 containing restriction sites to facilitate cloning were 7 added to the 5' and 3' sequences respectively. 8 The 5' oligonucleotide primer had the sequence 5' 9 CGCGGATCCATGCCTCCCAACCTCACTG 3' containing the underlined 0 BamHI restriction site, which encodes a start AUG, followed i by 19 nucleotides of the human cytostatin I coding sequence 2 beginning with the starting codon of the gene. 3 The 3' primer had the sequence 5' GCGTCTAGACT 4 ATCTGACCTTCCTGAAGAC3' containing the underlined Xbal site 5 restriction site followed by 20 nucleotides of cytostatin 6 I including the stop codon. The restrictions siteε were convenient to reεtriction 8 enzyme sites in the bacterial expression vectors pQE-9

1 which were used for bacterial expreεεion in theεe examples.

2 (Qiagen, Inc. Chatsworth, CA) . pQE-9 encodes ampicillin

3 antibiotic resiεtance ("Ampr") and contains a bacterial

4 origin of replication ("ori") , an IPTG inducible promoter,

5 a ribosome binding site ("RBS") , a 6-His tag and

6 restriction enzyme siteε.

7 The amplified human cytoεtatin I DNA and the vector

8 pQE-9 both were digeεted with BamHI and Xbal and the

9 digeεted DNAε then were ligated together. Inεertion of the 0 cytostatin I DNA into the pQE-9 restricted vector placed i the cytostatin I coding region downεtream of and operably 2 linked to the vector' ε IPTG-inducible promoter and in-frame 3 with an initiating AUG appropriately positioned for 4 translation of cytostatin I. s The ligation mixture was transformed into competent E. 6 coli M15/rep4 cells using standard procedures. Such 7 procedures are deεcribed in Sambrook et al . , MOLECULAR 8 CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor 9 Laboratory Preεs, Cold Spring Harbor, N.Y. (1989) . E. coli 0 strain M15/rep4, containing multiple copies of the plasmid i pREP4, which expresses lac represεor and confers kanamycin 2 resiεtance ("Kanr") , waε used in carrying out the 3 illustrative example described here. This εtrain, which is 4 only one of many that are suitable for expressing 5 cytostatin I, is available commercially from Qiagen. 6 Transformantε were identified by their ability to grow 7 on LB plates in the presence of ampicillin. Plasmid DNA 8 was isolated from resistant colonies and the identity of 9 the cloned DNA was confirmed by restriction analysis. 0 Clones containing the desired constructs were grown i overnight ("O/N") in liquid culture in LB media 2 supplemented with both ampicillin (100 ug/ml) and kanamycin 3 (25 ug/ml) . 4 The O/N culture was used to inoculate a large culture, 5 at a dilution of approximately 1:100 to 1:250. The cells 6 were grown to an optical density at 600nm ("OD600") of 7 between 0.4 and 0.6. isopropyl-B-D-thiogalactopyranoside 8 ("IPTG") was then added to a final concentration of 1 mM to

₁ induce transcription from lac repressor sensitive

₂ promoters, by inactivating the lad repressor. Cells

₃ subsequently were incubated further for 3 to 4 hours. Cells

₄ then were harvested by centrifugation and disrupted, by

₅ standard methods. The cell pellet was solubilized in the

₆ chaotropic agent 6 Molar Guanidine HCl. After

₇ clarification, solubilized cytostatin I was purified from

₈ this solution by chromatography on a Nickel-Chelate column

₉ under conditions that allow for tight binding by proteins ιo containing the 6-His tag (Hochuli, E. et al., J. ii Chromatography 411:177-184 (1984)) . Cytostatin I (90 %

12 pure was eluted from the column in 6 molar guanidine HCl pH

13 5.0 and for the purpose of renaturation adjusted to 3 molar

1 guanidine HCl, lOOmM sodium phosphate, 10 mmolar is glutathione (reduced) and 2 mmolar glutathione (oxidized) .

16 After incubation in this εolution for 12 hourε the protein

17 was dialyzed to 10 mmolar sodium phosphate. ie The entire coding sequence including the putative

19 signal sequence or transmembrane domain was fused in frame

20 with a 6-His tag present in the expression vector pQE9. E. 2i coli harboring the expresεion plasmid were induced with 1

22 mM IPTG during the logarithmic growth phase. Following a

23 3-hour induction, the cell pellet was lysed with 6M

24 Guanidine hydrochloride and cytostatin I was purified using

25 a Nickel-chelate affinity chromatography column. The

26 highly purified protein was denatured by dialysis in PBS

27 buffer. The gel is shown in Figure 4: M, molecular weight

28 markers; Lane 1 and 2, induced cell lysate; Lane 3 and 4,

29 uninduced cell lysate; Lane 5, pass through fraction from

30 Nickel-chelate column purification,- Lane 6, 7 and 8, 3i Fraction eluted with 6M Guanidine hydrochloride (pH 5) ,- 9 32 Fraction eluted with 6M Guanidine hydrochloride (pH 2) .

33

34 Example 2

35 Cloning and expresεion of human cytoεtatin I in a

36 baculoviruε expression system

37 The cDNA εequence encoding the full length human

38 cytoεtatin I protein, in the depoεited clone is amplified

1 using PCR oligonucleotide primers corresponding to the 5'

2 and 3' εequenceε of the gene:

3 The 5' primer haε the εequence 5'CGC GGA TCC CCC TCC

4 CAA CCT CAC TGG CTA C 3' containing the underlined BamHI

5 restriction enzyme site followed by 22 nucleotides of the

6 sequence of cytostatin I of Figure 1. Inserted into an

7 expresεion vector, as described below, the 5' end of the

8 amplified fragment encoding human cytostatin I provides an

9 efficient signal peptide. An efficient signal for 0 initiation of translation in eukaryotic cells, as described i by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is 2 appropriately located in the vector portion of the 3 construct. 4 The 3' primer has the sequence 5' CGC GGA TCC CTA TCT s GAC CTT CCT GAA GA 3' containing the underlined BamHI 6 restriction followed by 20 nucleotides of the C-terminal 7 cytostatin I coding sequence set out in Figure 1, including s the stop codon. 9 The amplified fragment is isolated from a 1% agarose 0 gel using a commercially available kit ("Geneclean," BIO i 101 Inc., La Jolla, Ca.). The fragment then is digested 2 with BamHI and Asp7l8 and again is purified on a 1% agarose 3 gel. This fragment is designated herein F2. 4 The vector pA2-Gp is used to expreεε the cytoεtatin I 5 protein in the baculoviruε expression syεtem, uεing 6 standard methods, such as thoεe described in Summers et al, 7 A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL 8 CULTURE PROCEDURES, Texas Agricultural Experimental Station 9 Bulletin No. 1555 (1987) . This expression vector contains 0 the strong polyhedrin promoter of the Autographa i californica nuclear polyhedrosis viruε (AcMNPV) followed by 2 convenient reεtriction εiteε. The εignal peptide of AcMNPV 3 gp67, including the N-terminal methionine, is located just 4 upstream of a BamHI site. The polyadenylation site of the 5 simian virus 40 ("SV40") is used for efficient 6 polyadenylation. For an easy selection of recombinant 7 virus the beta-galactosidase gene from E.coli is inserted 8 in the same orientation as the polyhedrin promoter and is

followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that expresε the cloned polynucleotide. Many other baculoviruε vectors could be used in place of pA2-GP, such as pAc373, pVL94l and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required. Such vectors are described in Luckow et al. , Virology 170: 31-39, among others. The plasmid is digested with the restriction enzyme BamHI and then is dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated herein "V2". Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase. E.coli HB101 cells are transformed with ligation mix and spread on culture plates. Bacteria are identified that contain the plasmid with the human cytostatin I gene by digesting DNA from individual colonies using BamHI and then analyzing the digestion product by gel electrophoresiε. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pBaccytostatin I. 5 μg of the plasmid pBaccytostatin I is co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA. ) , using the lipofection method described by Feigner et al. , Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987) . lμg of BaculoGold™ virus DNA and 5 μg of the plasmid pBaccytostatin I are mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwards 10 μl Lipofectin plus 90 μl Grace'ε medium are

1 added, mixed and incubated for 15 minutes at room

2 temperature. Then the transfection mixture is added drop-

3 wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm

4 tissue culture plate with 1 ml Grace's medium without

5 serum. The plate is rocked back and forth to mix the newly

6 added solution. The plate iε then incubated for 5 hours at

7 27 'C. After 5 hourε the tranεfection εolution is removed

8 from the plate and 1 ml of Grace's insect medium

9 supplemented with 10% fetal calf serum is added. The plate o is put back into an incubator and cultivation is continued i at 27°C for four days. 2 After four days the supernatant is collected and a 3 plaque assay is performed, as described by Summers and 4 Smith, cited above. An agaroεe gel with "Blue Gal" (Life s Technologieε Inc. , Gaitherεburg) iε uεed to allow eaεy 6 identification and isolation of gal-expressing clones, 7 which produce blue-εtained plaqueε. (A detailed s description of a "plaque assay" of this type can also be 9 found in the user's guide for insect cell culture and 0 baculovirology distributed by Life Technologieε Inc., i Gaithersburg, page 9-10) . 2 Four days after serial dilution, the virus is added to 3 the cells. After appropriate incubation, blue εtained 4 plaqueε are picked with the tip of an Eppendorf pipette. 5 The agar containing the recombinant viruses is then 6 resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by a brief 8 centrifugation and the supernatant containing the 9 recombinant baculovirus is used to infect Sf9 cells seeded 0 in 35 mm disheε. Four days later the supernatants of these i culture disheε are harvested and then they are stored at 2 4'C. A clone containing properly inserted cytostatin I is 3 identified by DNA analysiε including reεtriction mapping 4 and sequencing. This is designated herein as V-cytostatin 5 I. 6 Sf9 cells are grown in Grace's medium supplemented 7 with 10% heat-inactivated FBS. The cells are infected with 8 the recombinant baculovirus V-cytoεtatin I at a

ι multiplicity of infection ("MOI") of about 2 (about 1 to

2 about 3) . Six hourε later the medium iε removed and iε

3 replaced with SF900 II medium minuε methionine and cysteine (available from Life Technologies Inc. , Gaithersburg) . 42

5 hours later, 5 μCi of 35S-methionine and 5 μCi 35S cysteine

6 (available from Amersham) are added. The cells are further

7 incubated for 16 hours and then they are harvested by

8 centrifugation, lysed and the labeled proteins are

9 visualized by SDS-PAGE and autoradiography. 0 i Example 3 2 Expression of Recombinant Cytostatin I in COS cells 3 The expression of plasmid containing the cytostatin I 4 gene is derived from a vector pcDNAI/Amp (Invitrogen) 5 containing: 1) SV40 origin of replication, 2) ampicillin 6 resistance gene, 3) E.coli replication origin, 4) CMV 7 promoter followed by a polylinker region, an SV40 intron s and polyadenylation site. A DNA fragment encoding the 9 entire cytostatin I precursor and a HA tag fused in frame 0 to its 3' end is cloned into the polylinker region of the i vector, therefore, the recombinant protein expresεion iε 2 directed under the CMV promoter. The HA tag corresponds to 3 an epitope derived from the influenza hemagglutinin protein 4 as previously described (I. Wilson, H. Niman, R. Heighten, 5 A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37:767, 6 (1984)). The infusion of HA tag to the target protein 7 allows easy detection of the recombinant protein with an 8 antibody that recognizes the HA epitope. 9 The plasmid construction strategy iε described as 0 follows: i The DNA sequence encoding cytostatin I, ATCC is 2 constructed by PCR on the original cytostatin I cloned 3 using two primers: the 5' primer from the 5' end of the 4 cytostatin I gene and a 3' sequence from the 3' end of the 5 cytostatin I gene. Therefore, the PCR product contains the 6 a cytoεtatin I coding sequence followed by HA tag fused in 7 frame, a translation termination stop codon next to the HA 8 tag, and a final restriction endonuclease site. The PCR

1 amplified DNA fragment and the vector, pcDNAI/Amp, are

2 digeεted with the appropriate reεtriction enzymeε and

3 ligated. The ligation mixture iε tranεformed into E. coli

4 strain SURE (available from Stratagene Cloning Systemε,

5 11099 North Torrey Pines Road, La Jolla, CA 92037) the

6 transformed culture iε plated on ampicillin media plateε

7 and resistant colonies are selected. Plasmid DNA is

8 isolated from transformants and examined by restriction

9 analysis for the presence of the correct fragment. For 10 expresεion of the recombinant cytostatin I, COS cells are ii transfected with the expression vector by DEAE-DEXTRAN

12 method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular

13 Cloning: A Laboratory Manual, Cold Spring Laboratory Presε,

14 (1989)) . The expression of the cytostatin I HA protein is is detected by radiolabelling and immunoprecipitation method ie (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold 17 Spring Harbor Laboratory Presε, (1988)). Cellε are is labelled for 9 hourε with 35S-cyεteine two dayε poεt

19 transfection. Culture media is then collected and cells

20 are lysed with detergent (RIPA buffer (150 MM NaCl, 1%

21 NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5)

22 (Wilson, I. et al. , Id. 37:767 (1984)). Both cell lyεate

23 and culture media are precipitated with an HA εpecific

24 monoclonal antibody. Proteins precipitated are analyzed on

25 15% SDS-PAGE gels.

26 Example 4

27 Expression pattern of cytostatin I in human tissue

28 Northern blot analysiε iε carried out to examine the

29 levels of expression of cytostatin I in human tissues.

30 Total cellular RNA sampleε are iεolated with RNAzol® B 3i εystem (Biotecx Laboratories, Inc. 6023 South Loop East,

32 Houston, TX 77 03 3 ) . About 10 [ig of total RNA isolated

33 from each human tissue specified iε εeparated on 1% agaroεe

34 gel and blotted onto a nylon filter (Sambrook, Fritsch, and

35 Maniatis, Molecular Cloning, Cold Spring Harbor Press,

36 (1989)). The labeling reaction is done according to the

37 Stratagene Primelt kit with 50ng DNA fragment. The labeled

38 DNA is purified with a Select-G-50 column (5 Prime - 3

Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303) . The filter is then hybridized with radioactive labeled full length cytostatin I gene at 1,000,000 cpm/ml in 0. 5 M NaP04, pH 7. 4 and 7% SDS overnight at 65°C. Af ter washing twice at room temperature and twice at 60°C with 0.5 x SSC, 0.1% SDS, the filter is then exposed at -70°C overnight with an intensifying screen. Figure 3A issustrates the tissue distribution of cytostatin I in various human tissueε. The reεultε are issustrated in figures 3A, 3B and 3C.

Example 5 Gene therapeutic expression of human cytoεtatin I Fibroblaεts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tisεue culture flaεk, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature overnight. After 24 hours at room temperature, the flaεk iε inverted - the chunks of tiεεue remain fixed to the bottom of the flaεk - and freεh media is added (e.g., Ham's F12 media, with 10% FBS, penicillin and εtreptomycin) . The tissue is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several dayε. After an additional two weeks in culture, a monolayer of fibroblasts emerges. The monolayer is trypsinized and scaled into larger flasks. A vector for gene therapy is digested with reεtriction enzymeε for cloning a fragment to be expressed. The digested vector is treated with calf intestinal phosphatase to prevent self-ligation. The dephosphorylated, linear vector is fractionated on an agarose gel and purified. Cytostatin I cDNA capable of expressing active cytostatin I, is isolated. The ends of the fragment are modified, if necessary, for cloning into the vector. For instance, 5" overhanging may be treated with DNA

1 polymeraεe to create blunt endε. 3 ' overhanging ends may

2 be removed using SI nuclease. Linkers may be ligated to

3 blunt ends with T4 DNA ligase.

4 Equal quantities of the Moloney murine leukemia virus

5 linear backbone and the cytostatin I fragment are mixed

6 together and joined using T4 DNA ligase. The ligation

7 mixture is used to transform E. Coli and the bacteria are

8 then plated onto agar-containing kanamycin. Kanamycin

9 phenotype and restriction analysiε confirm that the vector 10 has the properly inserted gene. ii Packaging cells are grown in tisεue culture to

12 confluent denεity in Dulbecco'ε Modified Eagleε Medium 3 (DMEM) with 10% calf serum (CS) , penicillin and

14 streptomycin. The vector containing the cytostatin I gene

15 is introduced into the packaging cells by standard

16 techniques. Infectious viral particles containing the

17 cytostatin I gene are collected from the packaging cells,

18 which now are called producer cells.

19 Fresh media iε added to the producer cellε, and after

20 an appropriate incubation period media iε harveεted from i the plates of confluent producer cells. The media,

22 containing the infectious viral particleε, is filtered

23 through a Millipore filter to remove detached producer

24 cells. The filtered media then is used to infect fibroblaεt

25 cellε. Media iε removed from a εub-confluent plate of 26 fibroblaεts and quickly replaced with the filtered media.

27 Polybrene (Aldrich) may be included in the media to

28 facilitate transduction. After appropriate incubation, the

29 media is removed and replaced with fresh media. If the

30 titer of virus is high, then virtually all fibroblastε will 3i be infected and no selection is required. If the titer is

32 low, then it is necessary to use a retroviral vector that

33 has a selectable marker, such as neo or his, to εelect out

34 tranεduced cellε for expanεion.

35 Engineered fibroblaεtε then may be injected into ratε,

36 either alone or after having been grown to confluence on :-7 microcarrier beads, such as cytodex 3 beads. The injected

₁ fibroblasts produce cytostatin I product, and the

2 biological actions of the protein are conveyed to the host.

₃ It will be clear that the invention may be practiced

4 otherwise than as particularly described in the foregoing

5 description and examples.

6

7 Example 6

8 Biological Activity of Cytostatin I

9 The activity of cytoεtatin I iε illustrated in Figure o 5. Two-fold serial dilution of purified cytostatin I (MDGI i homolog, HGO7400-1E or HGO7400-2E) starting from 100 ng/ml 2 were made in RPMI 1640 medium with 0.5% FBS. The adherent 3 target cells were prepared from confluent cultures by 4 trypsinization in PBS, and non-adherent target cells were s harvested from stationary cultures and washed once with 6 medium. Target cells were suspended at 1 x 10 ⁵ cells/ml in 7 medium containing 0.5% FBS, then 0.1 ml aliquots were 8 dispenεed into 96-well flat-bottomed microtiter plates 9 containing 0.1 ml serially diluted test sampleε. 0 Incubation waε continued for 70 hr. The activity waε i quantified uεing MTS [3 (4,5-dimethyl-thiazoyl-2-yl) 5 (3- 2 carboxymethoxyphenyl) -2- (4-εulfophenyl) -2H-tetrazolium) ] 3 Assay. MTS assay is performed by the addition of 20 til of 4 MTS and phenazine methosulfate (PMS) solution to 96 well 5 plates (Stock solution was prepared aε deεcribed by Promega 6 Technical Bulletin No. 169) . During a 3 hr incubation, 7 living cells convert the MTS into a the aqueous soluble 8 formazan product. Wells with medium only (no cells) were 9 processed in exactly the same manner aε the reεt of the 0 wellε and were used for blank controls. Wells with medium i and cells were uεed as baseline controls. The absorbence 2 at 490 nm was recorded using an ELISA reader and is 3 proportional to the number of viable cells in the wells. Cell growth promotion (positive percentage) or inhibition 5 (negative percentage) , as a percentage compared to baseline 6 control wells (variation between three baseline control well is less than 5%) , calculated for each sample 8 concentration , by the formula : 0O _{expaτimeιΛa}} / OO^^ _conlroI X 100

1 -100. All determinations were made in triplicate. Mean

2 and SD were calculated by Microsoft Excel.

3

4 Example 7

5 In si tu Hybridization Conditions

6 Deparaffinized and acid-treated sections (5-urn thick)

7 were treated with proteinase K (0.2 mg/ml) for 30 min, a prehybridized at 50°C for 4 hourε, and hybridized overnight 9 with digoxigenin labeled anti-sense transcripts from a 0 TIMP-4 or TIMP-2 cDNA insert. The TIMP-4 antisense i transcript is a 390 bp riboprobe as described for Northern 2 blot. The TIMP-2 probe is a l.l kb antisense probe that 3 was generated from Notl-digested TIMP-2 template. 4 Hybridization (50°C for 18 hourε) followed by RNaεe s treatment (40 ug/ml, 3 0 min at 37°C) and three εtringent 6 washings (60°C for 40 min) . Sections were incubated with 7 mouse anti-digoxigenin antibodies (Boehringer) followed by 8 the incubation with biotin-conjugated secondary rabbit 9 anti-mouse antibodies (DAKO) . The colorimetric detection 0 were perforMed using a standard indirect i streptavidin-biotin immunoreaction method by DAKO's 2 Universal LSAB Kit according to manufacturer's 3 instructions. 4 Numerous modifications and variations of the present 5 invention are possible in light of the above teachings and, 6 therefore, are within the εcope of the appended claimε. 7

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Ni, Jian

Gentz, Reiner Yu, Guo- iang Rosen, Craig A Su, Jef rey

(ii) TITLE OF INVENTION: Human G-Protein Coupled Receptor

(iii) NUMBER OF SEQUENCES: 11

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI,

STEWART & 0LSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: R0SELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068-1739

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

<C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.30

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: Herewith

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Ferraro, Gregory D

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-550

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(?) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 861 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

{ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 94..414

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

CACGAGCTGG AATCTCTCAG CCTCACCTGC CAGACAACAC CCCCTCCTTC CTCACCCTGT 60

TTCCTGCATT CTCCTGAAAC CTTCATCCAC ACA ATG CCT CCC AAC CTC ACT GGC 114

Met Pro Pro Asn Leu Thr Gly

TAC TAC CGC TTT GTT TCG CAG AAG AAC ATG GAG GAC TAC CTG CAA GCC 162 Tyr Tyr Arg Phe Val Ser Gin Lys Aβn Met Glu Asp Tyr Leu ^β ln Ala 10 15 20

CTA AAC ATC AGC TTG GCT GTG CGG AAG ATC GCG CTG CTG CTG AAG CCG 210 Leu Asn Ile Ser Leu Ala Val Arg Lys Ile Ala Leu Leu Leu Lys Pro 25 30 35

GAC AAG GAG ATC GAA CAC CAG GGC AAC CAC ATG ACG GTG AGG ACG CTC 258 Asp Lys Glu Ile Glu His Gin Gly Asn His Met Thr Val Arg Thr Leu 40 45 50 55

AGC ACC TTC CGA AAC TAC ACT TTG CAG TTT GAT GTG GGA GTG CAG AAA 306 Ser Thr Phe Arg Asn Tyr Thr Leu Gin Phe Asp Val Gly Val Gin Lys 60 65 70

GGG GAG GTC CCC AAC CGG GGC TGG AGA CAC TGG CTG GAG GGA GAG TTG 354 Gly Glu Val Pro Asn Arg Gly Trp Arg His Trp Leu Glu Gly Glu Leu 75 80 85

CTG TAT CTG GAA CTG ACT GCA AGG GAT GCA GTG TGC GAG CAG GTC TTC 402 Leu Tyr Leu Glu Leu Thr Ala Arg Asp Ala Val Cys Glu Gin Val Phe 90 95 100

AGG AAG GTC AGA TAGCCGGAGA GGAGCCAAGA TCCCTCCAGA CAGCACCAGC 454

Arg Lys Val Arg 105

TCACAGACGC TCTTGTTGTG CCCCCTTCAA GCCCAGATTG TGCCAGGTCA GCTGTCCCTT 514

CCTCTGGCCA CCTTTCCTCC CTCTGGGTCC CTCCTCACCC CTCCCCGTGT TAATCTGTAA 574

CTTGGAGCCC CCAGGACAAA GTCCTTTCTC ACACTCCACT GCCCAATAGT GACCTCACTT 634

CCAGGTCAAG GTCTGGCGTC CCAAATGAAA GAAGCAGGCA AAGGGAAGGA GCCCCTGAGG 694

ACAACCAATC TCCGCTCTCT CCTGTCCATT TGACCTCTTC TTTTCCTTCT AAGAAAOAAC 754

TAAGCTTTGG GCATTTOGCG ATTAGTGAAA ATTCTATCCT GATGGACTTC TGGAAAACTG 814

TGACTGGGGT TCAACAOTTT AAACAGGGGC TACTGGGGGA AAAAAAA 861

(2) INFORMATION POR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 107 ami o acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Pro Pro Asn Leu Thr Gly Tyr Tyr Arg Phe Val Ser Gin Lys Asn 1 5 10 15

Met Glu Asp Tyr Leu Gin Ala Leu Asn Ile Ser Leu Ala Val Arg Lys 20 25 30

Ile Ala Leu Leu Leu Lys Pro Asp Lys Glu Ile Glu His Gin Gly Asn 35 40 45

_H is Met Thr Val Arg Thr Leu Ser Thr Phe Arg Asn Tyr Thr Leu Gin 50 55 60

Phe Asp Val Gly Val Gin Lys Gly Glu Val Pro Asn Arg Gly Trp Arg 65 70 75 80

_H is Trp Leu Glu Gly Glu Leu Leu Tyr Leu Glu Leu Thr Ala Arg Asp 85 90 95

Ala Val Cys Glu Gin Val Phe Arg Lys Val Arg 100 105

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CGCGGATCCA TGCCTCCCAA CCTCACTG 28

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH.- 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GCGTCTAGAC TATCTGACCT TCCTGAAGAC 30

(2) INFORMATION FOR SEQ ID NO:5:

⁽ ) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CGCGGATCCC CCTCCCAACC TCACTGGCTA C 31

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LBNGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CGCGGATCCC TATCTGACCT TCCTGAAGA 29

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 133 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Met Ala Asp Ala Phe Val Gly Thr Trp Lys Leu Val Asp Ser Lys Asn 1 5 10 15

Phe Asp Asp Tyr Met Lys Ser Leu Gly Val Gly Phe Ala Thr Arg Gin 20 25 30

Val Ala Ser Met Thr Lys Pro Thr Thr Ile Ile Glu Lys Asn Gly Asp 35 40 45

Thr Ile Thr Ile Lys Thr Gin Ser Thr Phe Lys Asn Thr Glu Ile Asn 50 55 60

Phe Gin Leu Gly Ile Glu Phe Asp Glu Val Thr Ala Asp Asp Arg Lys 65 70 75 80

Val Lys Ser Leu Val Thr Leu Asp Gly Gly Lys Leu Ile His Val Gin 85 90 95

Lys Trp Asn Gly Gin Glu Thr Thr Leu Thr Arg Glu Leu Val Asp Gly 100 105 110

Lys Leu Ile Leu Thr Leu Thr His Gly Ser Val Val Ser Thr Arg Thr 115 120 125

Tyr Glu Lys Glu Ala 130

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 135 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Met Pro Val Asp Phe Thr Gly Tyr Trp Lys Met Leu Val Asn Glu Asn 1 5 10 15

Phe Glu Glu Tyr Leu Arg Ala Leu Asp Val Aβn Val Ala Leu Arg Lys 20 25 30

Ile Ala Asn Leu Leu Lys Pro Asp Lys Glu Ile Val Gin Asp Gly Aβp 35 40 45

His Met Ile Ile Arg Thr Leu Ser Thr Phe Arg Asn Tyr Ile Met Asp 50 55 60

Phe Gin Val Gly Lys Glu Phe Glu Glu Asp Leu Thr Gly Ile Asp Aβp 65 70 75 80

Arg Lys Cys Met Thr Thr Val Ser Trp Asp Gly Asp Lys Leu Gin Cys 85 90 95

Val Gin Lys Gly Glu Lys Glu Gly Arg Gly Trp Thr Gin Trp lie Glu 100 105 110

Gly Asp Glu Leu Hie Leu Glu Met Arg Val Glu Gly Val Val Cys Lys 115 120 125

Gin Val Phe Lys Lys Val Gin 130 135

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 134 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEOUENCE DESCRIPTION: SEQ ID NO:9:

Met Thr Arg Aβp Gin Asn Gly Thr Trp Glu Met Glu Ser Aβn Glu Asn 1 5 10 15

Phe Glu Gly Tyr Met Lys Ala Leu Asp Ile Asp Phe Ala Thr Pro Lys 20 25 30

Ile Ala Val Arg Leu Thr G n Thr Lys Val Ile Asp Gin Asp Gly Aβp 35 40 45

Asn Phe Lys Thr Lys Thr Thr Ser Thr Phe Arg Asn Tyr Aβp Val Asp 50 55 60

Phe Thr Val Gly Val Glu Phe Asp Glu Tyr Thr Lys Ser Leu Asp Asn 65 70 75 80

Arg His Val Lys Ala Leu Val Thr Trp Glu Gly Asp Val Leu Val Cys

85 90 95

Val Gin Lys Gly Glu Lys Glu Asn Arg Gly Trp Lys Gin Trp Ile Glu 100 105 110

Gly Asp Lys Leu Tyr Leu Glu Leu Thr Cys Gly Asp Gin Val Cys Arg 115 120 125

Gin Val Phe Lys Lys Lys 130

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 133 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Met Val Asp Ala Phe Leu Gly Thr Trp Lys Leu Val Asp Ser Lys Aβn 1 5 10 15

Phe Asp Asp Tyr Met Lys Ser Leu Gly Val Gly Phe Ala Thr Arg Gin 20 25 30

Val Ala Ser Met Thr Lys Pro Thr Thr Ile Ile Glu Lys Asn Gly Asp 35 40 45

Ile Leu Thr Leu Lys Thr His Ser Thr Phe Lye Asn Thr Glu Ile Ser 50 55 60

Phe Lys Leu Gly Val Glu Phe Asp Glu Thr Thr Ala Asp Aβp Arg Lye 65 70 75 80

Val Lys Ser Ile Val Thr Leu Aβp Gly Gly Lys Leu Val His Leu Gin 85 90 95

Lys Trp Asp Gly Gin Glu Thr Thr Leu Val Arg Glu Leu Ile Asp Gly 100 105 110

Lys Leu Ile Leu Thr Leu Thr His Gly Thr Ala Val Cys Thr Arg Thr 115 120 125

Tyr Glu Lys Glu Ala 130

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 132 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

Met Ser Asn Lys Phe Leu Gly Thr Trp Lys Leu Val Ser Ser Glu Asn 1 5 10 15

Phe Asp Asp Tyr Met Lys Ala Leu Gly Val Gly Leu Ala Thr Arg Lys 20 25 30

Leu Gly Asn Leu Ala Lys Pro Thr Val Ile Ile Ser Lye Lys Gly Asp 35 40 45

Ile lie Thr Ile Arg Thr Glu Ser Thr Phe Lys Asn Thr Glu Ile Ser 50 55 60

Phe Lys Leu Gly Gin Glu Phe Glu Glu Thr Thr Ala Asp Aβn Arg Lys 65 70 75 80

Thr Lys Ser Ile Val Thr Leu Gin Arg Gly Ser Leu Asn Gin Val Gin 85 90 95

Arg Trp Asp Gly Lye Glu Thr Thr Ile Lys Arg Lys Leu Val Asn Gly IOC 105 110

Lys Met Val Ala Glu Cys Lys Met Lys Gly Val Val Cys Thr Arg Ile 115 120 125

Tyr Glu Lys Val 130