PURPOSE: To detect the objective nucleic acid such as Vibrio cholerae from diarrheal feces in a short time for the purpose of early diagnosing, etc., whether a patient suffering from diarrhea is infected with toxicogenic Vibrio cholerae or not by using the feces in the intact untreated state for a DNA amplification method.

CONSTITUTION: Diarrheal feces are directly collected from the rectum of a patient suffering from diarrhea with a sterilized catheter, boiled at 94°C for 5min and subjected to lysis. The resultant feces in an untreated state are used as a sample for a DNA amplification method and two kinds of sequences 5' CTCAGACGGGATTTGTTAGGCACG3' and 5'TCTATCTCTGTAGCCCCTATTACG3' are used as a primer. Operations composed of denaturation of chromosomic DNA at 94°C for 5min, primer connection at 60°C for min 30sec and elongation with a Taq DNA polymerase at 72°C for 1min 30sec are performed 30-40 cycles to carry out DNA amplification. Development is performed by polyacrylamide gel electrophoresis and staining with ethidium bromide is carried out to detect the objective nucleic acid in the feces. Thereby, the presence of infection is discriminated.