CROSS REFERENCE TO RELATED APPLICATIONS

[001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63/404,633, filed September 8, 2022, the contents of which are all incorporated herein by reference in their entirety.

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[002] The contents of the electronic sequence listing (NIBN-P-041-PCT.xml; Size: 5,276 bytes; and Date of Creation: September 7, 2023) is herein incorporated by reference in its entirety.

FIELD OF INVENTION

[003] The present invention is in the field of personalized cancer treatment.

BACKGROUND OF THE INVENTION

[004] Tumor cells suffer from metabolic stress: Metabolic stress is a common feature of the tumor microenvironment, being a result of defective neovasculature and tissue architecture. In addition, the activation of oncogenes, such as K-Ras and MYC, increases anabolic processes linked to proliferation which consume NADPH (a major antioxidant) and ATP, and inhibit catabolic processes, which support cellular NADPH and ATP levels. Therefore, in order survive and grow into a macroscopic tumor, tumor cells must adapt to nutrient deprivation.

[005] Cellular adaptation to stress entails modulation of the proteome by increasing the synthesis of specific proteins while decreasing the synthesis of most others. Cellular regulation of mRNA translation is thus key for proper cellular responses to various stresses, including nutrient deprivation. It has been shown that in order to survive and adapt to nutrient deprivation conditions, both tumor and non-tumor cells rely on a negative regulator of mRNA translation elongation, eukaryotic elongation factor 2 kinase (eEF2K). [006] 4EBPs - Negative regulators of mRNA translation activated by nutrient stress: Mechanistic target of rapamycin (a.k.a. Mammalian target of rapamycin; mTOR) is a nutrient sensor kinase which has evolved to integrate information regarding the metabolic state of the cell and accordingly regulate various anabolic and catabolic processes, including mRNA translation. As illustrated in Figure 1, under nutrient-rich conditions, active mTOR phosphorylates its targets, including eukaryotic initiation factor 4E binding protein 1-3 (eIF4EBPl-3; 4EBPs), thereby maintaining their inactive status under these conditions. In parallel, eIF4G and eIF4A bind to the cap-binding protein eIF4E, together forming the eIF4F cap-binding complex, to promote a high level of cap-dependent translation initiation. Under low nutrient conditions, mTOR is inactive, 4EBPs lose their phosphorylation to become active and compete with eIF4G for binding to eIF4E, thereby disrupting formation of the eIF4F complex so as to inhibit cap-dependent mRNA translation initiation. As most cellular translation is cap-dependent, 4EBPs are negative regulators of mRNA translation.

[007] In addition to regulating global mRNA translation, 4EBPs were shown to regulate, positively and negatively, the translation of specific transcripts in a process known as selective translation. For example, in hypoxia, 4EBPs stimulate the cap-independent translation of HIFla and VEGF, whereas under normal conditions or upon mTOR inhibition by small molecules, 4EBPs inhibit the translation of mRNAs encoding mitochondrial proteins and proliferation-promoting proteins.

[008] The physiological functions of 4EBPs under starvation were investigated in Drosophila where it was found that survival of 4EBP knockout (ko) flies experiencing starvation was compromised and upon dietary restriction, 4EBPs promoted selective translation of mRNA encoding mitochondrial proteins so as to facilitate fly longevity. In Drosophila larvae, starvation conditions resulted in reduced global protein synthesis, however, this reduction was not mediated by the mTOR pathway or 4EBP, reflective of how the physiological context of mRNA translation regulation remains poorly understood.

[009] The information regarding translation regulation of a particular transcript by 4EBPs is encoded in the 5’UTR. Polysome profiling revealed that by binding to eIF4E, 4EBPs inhibit the translation of mRNA with a 5’ terminal oligopyrimidine (TOP) motif, including a subset of mRNA encoding mitochondrial proteins. Upon hypoxia, a physiological condition leading to mTOR inhibition and therefore 4EBPs activation, the selective translation of transcripts harboring 5’-UTR TOP motifs is independent of 4EBPs. Under these conditions, 4EBPs promote the cap-independent translation of internal ribosome entry sites (IRES) containing transcripts in breast tumor cells. Nevertheless, it is not well understood how 4EBPs function under starvation conditions.

[010] 4EBP is mostly considered to be a tumor suppressor: The role of 4EBPs in cancer is still debated. On the one hand, 4EBPs are considered anti-tumorigenic as they restrict protein synthesis and proliferation and inhibit the oncogenic eIF4E. On the other hand, 4EBP1 was shown to support breast cancer resistance to hypoxia, the resistance of glioblastoma to radiation therapy and promote proliferation of breast cancer cells in culture. In addition, 4EBP1 was found to be highly expressed in luminal-epithelial prostate tumor cells and was shown to protect these tumor cells from PI3K pathway inhibitors by reducing global protein synthesis. It is therefore proposed that negative regulators of mRNA translation are exploited by tumor cells in order to adapt to metabolic stress found in the tumor microenvironment and that a new method of treating cancer by exploiting 4EBP1 is therefore greatly needed.

SUMMARY OF THE INVENTION

[Oi l] The present invention provides methods of treating cancer comprising reducing expression or function of eukaryotic initiation factor 4E-binding protein 1 (EIF4EBP1) or EIF4EBP2 in a cell of the cancer, wherein the function is binding Eukaryotic translation initiation factor 4E (EIF4E) or increasing expression or function of EIF4E, wherein the function is increasing translation or decreasing binding of EIF4E to EIF4EBP1/2 in a cell of said cancer, wherein said function is binding to EIF4EBP1/2, and the cancer comprises a region of glucose starvation. Methods of determining suitability to be treated by a method of the invention are also provided. Kits comprising at least one agent configured for detection of EIF4EBP1/2 or EIF4E protein level, mRNA level or genomic duplication and at least one agent configured for determining glucose levels are also provided.

[012] According to a first aspect, there is provided a method of treating cancer in a subject in need thereof, the method comprising: a. reducing expression or function of eukaryotic translation initiation factor 4E-binding protein 1 (EIF4EBP1) or EIF4EBP2 in a cell of the cancer, wherein the function is binding to Eukaryotic translation initiation factor 4E (EIF4E); or b. increasing expression or function of EIF4E in a cell of said cancer, wherein the function is increasing translation or decreasing binding of EIF4E to EIF4EBP1/2; and wherein the cancer comprises a region of glucose limitation, thereby treating the cancer in the subject.

[013] According to some embodiments, the cancer comprises a duplication of EIF4EBP1/2.

[014] According to some embodiments, the cancer overexpresses EIF4EBP1/2 or under expresses EIF4E.

[015] According to some embodiments, the reducing function comprises increasing phosphorylated EIF4EBP1/2, increasing EIF4E mediated translation or both.

[016] According to some embodiments, the reducing function does not comprise administering a mammalian target of rapamycin (mTOR) inhibitor.

[017] According to some embodiments, the glucose limitation comprises glucose levels in the cancer below a predetermined threshold.

[018] According to some embodiments, the method further comprises the step of confirming glucose limitation in the cancer before the reducing.

[019] According to some embodiments, the confirming comprises at least one of: in vivo metabolic labeling in the cancer, directly measuring glucose in the cancer, measuring glucose in the cancer by PET-scan, measuring glucose in the cancer by magnetic resonance imaging (MRI) or magnetic resonance spectroscopy (MRS), and measuring histone H2B mono-ubiquitination in the cancer.

[020] According to some embodiments, the cancer is selected from lung cancer, breast cancer, bladder cancer, uterine cancer, esophageal cancer, head and neck cancer, colorectal cancer, brain cancer and brain metastasis.

[021] According to some embodiments, the cancer is selected from lung squamous cell carcinoma, breast invasive carcinoma, bladder urothelial carcinoma, uterine carcinosarcoma, esophageal carcinoma, head and neck squamous cell carcinoma, colorectal adenocarcinoma and glioma.

[022] According to some embodiments, the cancer is glioblastoma. [023] According to some embodiments, the reducing comprises administering an agent that reduces EIF4EBP1/2 expression or function.

[024] According to some embodiments, the agent is a regulatory RNA that binds to an mRNA of EIF4EBP1/2 and degrades the mRNA or inhibits translation of the mRNA.

[025] According to some embodiments, the agent is a genome editing protein or complex and a targeting oligonucleotide that targets the genome editing protein or complex to the EIF4EBP1/2 genomic locus.

[026] According to some embodiments, the agent is a small molecule that binds to EIF4EBP1/2 and inhibits EIF4EBP1/2 binding to EIF4E.

[027] According to some embodiments, the agent induces or protects phosphorylation of EIF4EBP1/2.

[028] According to some embodiments, the increasing comprises administering an agent that increases EIF4E expression.

[029] According to some embodiments, the agent is a regulatory RNA that binds to an mRNA of EIF4E and increases translation or inhibits degradation of the mRNA.

[030] According to some embodiments, the decreasing comprises administering an agent that binds to EIF4E and inhibits EIF4E binding to EIF4EBP1.

[031] According to some embodiments, the decreasing comprises administering an agent that binds to EIF4E, inhibits EIF4E binding to EIF4EBP2.

[032] According to some embodiments, and the agent does not inhibit binding of EIF4E to EIF4G.

[033] According to some embodiments, the agent is a small molecule. According to some embodiments, the agent is a peptide.

[034] According to some embodiments, the peptide competes with EIF4EBP1/2 for binding to EIF4E.

[035] According to some embodiments, the peptide comprises or consists of the amino acid sequence KFLMECRNSPVTKT (SEQ ID NO: 5).

[036] According to some embodiments, the agent binds to the 4EBP1/2 binding pocket of EIF4E. According to some embodiments, the agent binds to the lateral hydrophobic pocket of EIF4E. [037] According to some embodiments, the method further comprises increases reactive oxygen species (ROS) in the cell of the cancer.

[038] According to some embodiments, the increasing ROS comprises increasing glucose deprivation in the cancer.

[039] According to another aspect, there is provided a method of determining suitability of a subject suffering from cancer to be treated by a method of the invention, the method comprising receiving a sample from the subject comprising cancer cells and measuring at least one of: a. expression of EIF4EBP1 in the sample; b. expression of EIF4EBP2 in the sample; c. expression of EIF4E in the sample; and d. glucose levels in the sample; wherein an expression of EIF4EBP1/2 above a predetermined threshold, expression of EIF4E below a predetermined threshold or glucose levels below a predetermined threshold indicates the subject is suitable to be treated by a method of the invention.

[040] According to some embodiments, the expression of EIF4EBP1/2, the expression of EIF4E, and the glucose levels are in the cancer cells in the sample.

[041] According to some embodiments, the predetermined threshold of EIF4EBP1/2 expression is expression of EIF4EBP1/2 in healthy cells of the same cell type as the cancer cells.

[042] According to some embodiments, the predetermined threshold of EIF4E expression is expression of EIF4E in healthy cells of the same cell type as the cancer cells.

[043] According to some embodiments, glucose levels below the predetermined threshold are indicative of glucose limitation.

[044] According to some embodiments, the sample is selected from a peripheral blood sample, a tumor fluid sample and a tumor biopsy sample.

[045] According to some embodiments, the method comprises measuring glucose levels in the sample and at least one of (a) and (b).

[046] According to another aspect, there is provided a kit comprising: a. at least one agent configured for detection of EIF4EBP1 protein or mRNA levels or genomic duplication, configured for detection of EIF4EBP2 protein or mRNA levels or genomic duplication or configured for detection of EIF4E protein or mRNA levels or genomic duplication; and b. at least one agent configured for determining glucose levels in a sample.

[047] According to some embodiments, the agent is a nucleic acid molecule.

[048] According to another aspect, there is provided a pharmaceutical composition comprising a peptide comprising or consisting of SEQ ID NO: 5 for use in treating cancer in a subject in need thereof, wherein the cancer comprises a region of glucose limitation.

[049] According to another aspect, there is provided a method of selecting a therapeutic agent, the method comprising: a. providing an agent that binds to EIF4E; b. determining if the provided agent inhibits binding of EIF4EBP1 or EIF4EBP2 to EIF4E and selecting an agent that inhibits the binding by at least a predetermined threshold; and c. determining if the selected agent inhibits binding of EIF4G to EIF4E and selecting an agent that inhibits the binding by less than a predetermined threshold; thereby selecting a therapeutic agent.

[050] According to some embodiments, step (c) comprises selecting an agent that does not inhibit binding of EIF4G to EIF4E.

[051] According to another aspect, there is provided a method of selecting a therapeutic agent for treating a cancer comprising a region of glucose limitation, the method comprising: a. providing an agent; b. determining if the agent i. reduces expression of EIF4EBP1, EIF4EBP2 or both; ii. reduces binding of EIF4EBP1, EIF4EBP2 or both to EIF4E; or iii. increases expression of EIF4E; and c. selecting an agent that reduces expression of EIF4EBP1, EIF4EBP2 or both, reduces binding or increases expression of EIF4E by more than a predetermined threshold; thereby selecting a therapeutic agent for treating a cancer comprising a region of glucose limitation. [052] According to some embodiments, the method comprises contacting cancer cells under glucose limitation or a cancer comprising a region of glucose limitation with the selected agent, measuring survival of the cancer cells or cancer and selecting an agent that reduces survival of the cancer cells or cancer.

[053] According to some embodiments, the method comprises determining if the selected agent inhibits binding of EIF4G to EIF4E and selecting an agent that inhibits the binding by less than a predetermined threshold.

[054] According to some embodiments, the therapeutic agent is for use in a method of the invention.

[055] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[056] Figure 1: A schematic illustration of 4EBP pathway and activity.

[057] Figure 2: 4EBPs protect against glucose starvation. Bar graphs of cell death after nutrient starvation. The indicated cells were treated with glucose (Glc) or amino acid (AA) starvation (strv) for 48 hours after which cell death was measured using propidium iodide (PI) staining and FACS. Western blots with anti-4EBPl antibodies of 4EBP knockdown and knockout are shown.

[058] Figure 3: Over expression of constitutively active 4EBP1 protects HeLa cells from glucose starvation. Bar graph of cell death after nutrient starvation. The indicated cells lines were treated with glucose (Glc) or amino acid (AA) starvation (strv) for 48 hours after which cell death was measured using PI staining and FACS. 4EBP1 levels in cells expressing the constitutively active 4EBP1 were determined using western blot with anti- 4EBP1 antibodies.

[059] Figure 4: 4EBPs protect cells form glucose starvation through inhibiting eIF4E. Bar graphs of cell death after glucose starvation. The indicated cells were transfected with siRNA targeting eIF4E for 24 hours after which cells were treated with glucose starvation. Cell death was measured using PI staining and FACS. Western blots show eIF4E levels as measured using anti-eIF4E antibodies. Actin was used as a loading control.

[060] Figure 5: 4EBPs protect cells against glucose starvation by inhibiting mRNA translation. Bar graphs of cell death after glucose starvation with and without cycloheximide. The indicated kd and ko cells were treated with glucose starvation for 48 hours in the presence of cycloheximide (CHX) or vehicle (DMSO). Cell death was measured using PI staining and FACS.

[061] Figure 6: 4EBPs function by regulating selective but not total mRNA translation. Line graphs showing measured protein synthesis in WT or kd/ko cells. Protein synthesis was measured in HEK293 (left) MEF cells (right) under control or glucose starvation conditions using a 10 min. AHA pulse and western blot. 4EBP1 kd/ko cell extracts and HSC70 loading controls are shown. n=3.

[062] Figure 7: Antioxidants rescue 4EBPs depleted cells from glucose starvation. Bar graphs of cell death after glucose starvation. The indicated cells were glucose starved for 48 hours in the presence of N-acetyl-cysteine (NAC) or catalase or vehicle (DMSO) after which cell death was measured using PI staining and FACS.

[063] Figure 8: High ROS levels in 4EBPs depleted cells upon glucose starvation. Bar graphs of relative ROS production in artificial units (a.u.). The indicated cell lines were treated with glucose (Glc) starvation (starv) for 24 hours after which ROS levels were measured using CM-DCFDA staining and FACS.

[064] Figures 9A-9C: 4EBP1 promotes the TCA cycle and NADPH levels in glucose- starved cells. sh4EBPs-HEK293 cells were subjected to glucose starvation for 48 hours. Cellular metabolites were measured by LC-MS. (9A) Bar graph of TCA cycle metabolites measured in three biological replicates. Average ± SD. (9B) Schematic representation of the TCA cycle. Boxed=metabolites whose levels drop upon glucose starvation. (9C) Bar graph of the NADPH/NADP+ ratio obtained from the indicated HEK293 cell lines following 24 hours of glucose starvation. Average ± SD; n=3.

[065] Figure 10: 4EBPs depletion leads to increased fatty acid synthesis upon glucose starvation. Line graph of percent labeled carbon incorporation. 4EBPs wt and ko MEFs were glucose starved for 24 hours after which the cells were pulsed with labeled glucose, harvested at the indicated time points and the incorporation of labeled carbons into lipids was measured using mass spectrometry. [066] Figure 11: ACC1 and FASN are linked to 4EBPs protective functions. Bar graphs of cell death in ACC1 and FASN knockdown cells. Cells were transfected with siRNA targeting the indicated transcripts. The cells were starved from glucose for 48 hours after which cell death was measured using PI staining and FACS.

[067] Figure 12: ACC inhibition rescues 4EBPs depleted cells from glucose starvation. Bar graphs NADPH/NADP ratio (left), ROS production (middle) and cell death (right) in glucose starved cells. 4EBPs kd HEK293 cells were treated with glucose starvation in the presents of TOFA (ACC inhibitor) or vehicle for the indicated time. NADPH/NADP levels were measured using mass spectrometry. ROS was measured using CM-DCFDA. Cell death was measured using PI staining and FACS.

[068] Figure 13: 4EBP1 protects U87 brain tumor cells from glucose starvation by curbing ROS. Bar graph of cell death in U87 brain cancer cells after glucose starvation. U87 cells expressing shRNA targeting 4EBP1 or scrambled control, were treated with glucose starvation in the presents of cycloheximide (CHX), NAC or catalase for 48 hours after which cell death was measured using PI staining and FACS. Inset western blot shows 4EBP1 knockdown. HSC70 is used as a loading control.

[069] Figure 14: 4EBP1 protects MCF7 breast tumor cells from glucose starvation by inhibiting mRNA translation. Bar graph of cell death of MCF7 breast cancer cells after glucose starvation. MCF7 cells expressing shRNA targeting 4EBP1 (sh203 or 343) or scrambled control, were treated with glucose starvation in the presents of cycloheximide (CHX) for 72 hours after which cell death was measured using PI staining and FACS. Inset western blot shows 4EBP1 knockdown. HSC70 was used as a loading control.

[070] Figures 15A-15E: 4EBP1 is clinically relevant in multiple cancers. (15A) Bar graph showing 4EBP1 gene region is amplified in multiple tumor types. Data from cBioportal. (15B) Box plots showing 4EBP1 transcript is over expressed in non-small cell lung carcinoma and colon tumors. Data from R2 (hgserverl.amc.nl/cgi-bin/r2/main.cgi). (15C) Western blots showing 4EBP1 protein is highly expressed in tumor tissue. (15D) Dot plot of 4EBP1 mRNA expression is correlated with that of PPM1G, the 4EBP phosphatase. Data obtained from R2. (15E) Survival curves showing 4EBP1 mRNA expression in tumors is correlated with poor patient outcome in multiple cancers. Data obtained from R2.

[071] Figure 16: 4EBP1 is relevant in glioblastoma. Box plot of normalized 4EBP1 mRNA expression. 4EBP1 mRNA levels in normal brain tissue vs low grade glioma (LGG) and glioblastoma (GBM) were determined using GEPIA. (Top-left). Survival curves showing 4EBP1 mRNA levels correlation with patient survival was determined using Rembrandt or TCGA datasets (Top-right). Micrographs of GBM tumors and matched normal brain were stained using anti-4EBPl antibodies. (Bottom)

[072] Figure 17: 4EBP1 is essential for tumor generation in U87. 10 ^A 6 U87 cells were injected to flanks of mice and 8 weeks later, tumors were excised (Image Top-left) and their mass was measured. A bar graph provides average tumor mass (Bottom-left) Tumors were also stained with anti-Ki-67 antibodies (Right).

[073] Figure 18. NOD-SCID mice were injected with U87 cells stably expressing doxycycline inducible shRNA targeting 4EBP1 (203) or scrambled control (scr). When tumors reached 10 ^A 3, mice were treated with DOX or vehicle or left untreated. Line graph provides tumor volume (Left). Tumor mass was measured using calliper. A bar graph depicts tumor mas at the end of the experiment (Bottom-right). Lysates obtained from harvested tumors were analyzed by western blot and anti-4EBPl antibodies. Actin was used as a loading control (Top-right).

[074] Figure 19. Cells (5xlO ^A 4) were injected into mice brains and three weeks postinjection; the resulting tumors were imaged by MRI (Top). Arrows indicate the tumor mass. Survival curve of mice is provided (Bottom).

[075] Figure 20. Micrographs of brain tissue obtained from mice growing 4EBP1 expressing and deficient U87 tumors were stained using anti-8-hydroxy-2'-deoxyguanosine antibodies (Left). Bar graph of estimated staining intensity (Right).

[076] Figure 21. GL261 cells expressing shCONTROL or sh4EBPl (610) were injected into the brains of B6 mice. Two weeks post injection mice brains were imaged using MRI (shCONTROL left; sh4EBPl (610), right). Mice survival is plotted (Middle). 4EBP1 levels in the cells were measured using western blot (Right).

[077] Figure 22. A scatter plot of relative fluorescence indicating EIF4E interaction with 4EBP. The anti-4EBPl antibody is able to significantly reduce EIF4E interaction with 4EBP1.

DETAILED DESCRIPTION OF THE INVENTION

[078] The present invention, in some embodiments, provides methods of treating cancer comprising reducing expression or function of eukaryotic initiation factor 4E-binding protein 1 (EIF4EBP1) or EIF4EBP2 or increasing expression/modulating function of Eukaryotic translation initiation factor 4E (EIF4E) in a cell of the cancer. Methods of determining suitability to be treated by a method of the invention and kits comprising at least one agent configured for detection of EIF4EBP1/2 or EIF4E and at least one agent configured for determining glucose levels are also provided.

[079] The invention is based on the surprising finding that 4EBP1/2 acts as an oncogene only in the context of glucose starvation/deprivation. 4EBP1/2 is generally considered to be a tumor suppressor as it restricts protein synthesis and proliferation. However, paradoxically, in certain tumors and cancer subjects 4EBP1/2 has been found to have a pro-tumor effect. These confusing results have made the targeting of 4EBP1/2 therapeutically in humans nearly impossible as it could not be known if 4EBP1/2 should be increased or removed; blocked or activated. The risk always being that rather than kill the cancer the therapeutic intervention would actually make matters worse. As described hereinbelow, it has been discovered that 4EBP1/2 acts as an oncogene only in tumors under glucose starvation/deprivation pressures. In such circumstances, uncontrolled protein synthesis is detrimental to the cancer cells and 4EBP1/2 activation, and sequestering of EIF4E, is essential to survival. Surprisingly during amino acid starvation no such protective effect by 4EBP1/2 was observed. This discovery opens up therapeutic avenues to target 4EBP1/2 and EIF4E and inhibit sequestering of EIF4E only in cancers under glucose starvation. Though such a therapy will increase protein synthesis in the cancer, which is generally considered tumorigenic, in these specific cancers the overall effect will be tumor cell death. A new method of patient- specific cancer therapy is therefore possible.

[080] By a first aspect, there is provided a method of treating cancer in a subject, the method comprising reducing expression or function of EIF4EBP1, thereby treating cancer.

[081] By a first aspect, there is provided a method of treating cancer in a subject, the method comprising reducing expression or function of EIF4EBP2, thereby treating cancer.

[082] By another aspect, there is provided a method of treating cancer in a subject, the method comprising increasing expression or modulating function of EIF4E, thereby treating cancer.

[083] By another aspect, there is provide a peptide comprising the amino acid sequence KFLMECRNSPVTKT (SEQ ID NO: 5) for use in treating cancer in a subject in need thereof.

[084] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human. In some embodiments, the subject is in need of a method of the invention. In some embodiments, the subject suffers from cancer. In some embodiments, the cancer overexpresses EIF4EBP1/2. In some embodiments, the cancer under expresses EIF4E. In some embodiments, the cancer expresses higher levels of EIF4EBP1/2 as compared to healthy cells. In some embodiments, the cancer expresses statistically significantly higher levels of EIF4EBP1/2 as compared to healthy cells. In some embodiments, the cancer expresses at least about 1.5, or 2 times higher levels of EIF4EBP1/2 as compared to healthy cells. In some embodiments, the cancer expresses lower levels of EIF4E as compared to healthy cells. In some embodiments, the cancer expresses statistically significantly lower levels of EIF4E as compared to healthy cells. In some embodiments, the cancer expresses at least about 1.5, or 2 times lower levels of EIF4E as compared to healthy cells. In some embodiments, expression is mRNA expression. In some embodiments, expression is protein expression. In some embodiments, the cancer comprises a duplication of EIF4EBP1/2. In some embodiments, the duplication is a genomic duplication. In some embodiments, the method further comprises confirming EIF4EBP1/2 overexpression in the cancer. In some embodiments, the cancer comprises a mutation or deletion of EIF4E. In some embodiments, the mutation is a mutation that decreases expression. In some embodiments, the mutation is a mutation in a regulatory element controlling EIF4E expression. In some embodiments, the method further comprises confirming EIF4E under expression in the cancer.

[085] In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a tumor. In some embodiments, the cancer is a hematological cancer. In some embodiments, the cancer is a carcinoma. In some embodiments, carcinoma comprises carcinosarcoma and adenocarcinoma. Examples of cancer include, but are not limited to brain, skin, breast, lung, renal, liver, pancreatic, head and neck, hematopoietic, endometrial, bladder, sarcoma, glioma, colorectal, gastric, prostate, ovarian, testicular, and cervical cancer. In some embodiments, the cancer is selected from lung cancer, breast cancer, bladder cancer, uterine cancer, esophageal cancer, head and neck cancer, colorectal cancer and brain cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the lung cancer is lung squamous cell carcinoma. In some embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is breast invasive carcinoma. In some embodiments, the bladder cancer. In some embodiments, the cancer is urothelial cancer. In some embodiments, the cancer is bladder urothelial carcinoma. In some embodiments, the cancer is uterine cancer. In some embodiments, the uterine cancer is uterine carcinosarcoma. In some embodiments, the cancer is esophageal cancer. In some embodiments, the esophageal cancer is esophageal carcinoma. In some embodiments, the cancer is head and neck cancer. In some embodiments, the head and neck cancer is head and neck squamous cell carcinoma. In some embodiments, the cancer is colorectal cancer. In some embodiments, the colorectal cancer is colorectal adenocarcinoma. In some embodiments, the cancer is brain cancer. In some embodiments, the brain cancer is glioma. In some embodiments, the glioma is glioblastoma. In some embodiments, the glioma is selected from astrocytoma, oligodendroglioma and ependymoma. In some embodiments, the cancer is a metastasis. In some embodiments, the metastasis is brain metastasis.

[086] In some embodiments, the cancer comprises a region of glucose starvation. In some embodiments, the cancer comprises a region of glucose deprivation. As used herein, the terms “glucose starvation”, “glucose limitation” and “glucose deprivation” are used interchangeably and refer to a microenvironment in which glucose is present in rate limiting amounts. In some embodiments, a region is a microenvironment. In some embodiments, a microenvironment is a tumor microenvironment. In some embodiments, the cancer is in glucose starvation. In some embodiments, the cancer is in a state of glucose starvation. In some embodiments, the cancer is under glucose pressure due to a lack of available glucose. In some embodiments, glucose starvation comprises glucose levels below a predetermined threshold. In some embodiments, the predetermined threshold is the level of glucose in non- cancerous tissue. In some embodiments, the non-cancerous tissue is the same tissue type from which the cancer is derived. In some embodiments, the predetermined threshold is the level of glucose in a cell in circulation. In some embodiments, the predetermined threshold is the level of glucose in a cancerous cell not under hypoxia.

[087] In some embodiments, the method further comprises a step of confirming glucose starvation in the cancer. In some embodiments, the confirming is before the reducing. In some embodiments, the confirming is before the administering. In some embodiments, the confirming is during the reducing. In some embodiments, the confirming is during the administering. In some embodiments, confirming comprises measuring glucose in the cancer. In some embodiments, a measurement below a predetermined threshold indicates the presence of glucose starvation. Methods of measuring glucose levels are well known in the art and any such method can be employed. Examples of such methods include, but are not limited to metabolic labeling, direct glucose measurement, PET-scan, dynamic glucose enhanced magnetic resonance imaging (GE-MRI), MRI, magnetic resonance spectroscopy (MRS) and measuring histone H2B mono-ubiquitination. In some embodiments, the measuring is a non-invasive measuring. In some embodiments, the measuring is measuring in a sample. In some embodiments, the method further comprises obtaining a sample from the subject. In some embodiments, a sample from the subject is provided. In some embodiments, the sample is a sample from the cancer. In some embodiments, the sample is a fluid sample. In some embodiments, the sample is a tumor sample. In some embodiments, a tumor sample is a biopsy. In some embodiments, the fluid is tumor fluid. In some embodiments, glucose levels are directly measured in the sample. In some embodiments, the measuring is by MRI. In some embodiments, the measuring is by PET-scan. In some embodiments, the measuring is by MRS. In some embodiments, the MRI is GE-MRI. In some embodiments, the MRS is GE-MRS. In some embodiments, the PET-scan is GE-PET. Methods of performing glucose measurement by MRS are provided, for example in Tanaka et al., 2021, “Glioma cells require one-carbon metabolism to survive glutamine starvation”, herein incorporated by reference in its entirety. In some embodiments, histone H2B mono- ubiquitination is measured in the sample. In some embodiments, mono-ubiquitination is at lysine 123 (K123) of H2B. Methods of performing glucose measurements using H2B mono- ubiquitination are provided, for example, in Urasaki et al., “Coupling of glucose deprivation with impaired histone H2B monoubiquitination in tumors”, PLoS One, 7(5):e36775, herein incorporated by reference in its entirety. In some embodiments, the measuring is in the cancer. In some embodiments, the measuring is in vivo measuring. In some embodiments, the measuring comprises in vivo metabolic labeling. Methods of performing glucose measurements using metabolic labeling are provided, for example, in Antoniewicz, 2018, “A guide to 13C metabolic flux analysis for the cancer biologist”, Exp Mol Med, Apr 16;50(4): 1-13, herein incorporated by reference in its entirety. In some embodiments, the measuring comprises PET-scan of the cancer. Methods of performing glucose measurements using PET-scan are provided, for example, in Cochran et al., 2017, “Determining glucose metabolism kinetics using 18F-FDG micro-PET/CT”, J Vis Exp, May 2;(123):55184 and Sprinz et al., 2018, “Effects of blood glucose level on 18F fluorodeoxyglucose (18F-FDG) uptake for PET/CT in normal organs: an analysis of 5623 patients”, PLoS One, Feb 27;13(2):e0193140, which are herein incorporated by reference in their entireties. In some embodiments, a subject confirmed to comprise a cancer comprising glucose starvation is suitable to receive a method of the invention.

[088] In some embodiments, expression is expression in a cell of the cancer. In some embodiments, expression is in the cancer. In some embodiments, expression is in a region of the cancer. In some embodiments, expression is average expression. In some embodiments, the region is a region of glucose starvation. Methods of reducing gene and/or protein expression are well known in the art and any such method may be employed to reduce EIF4EBP1/2. In some embodiments, the expression is mRNA expression. In some embodiments, the expression is protein expression. In some embodiments, the expression is mRNA or protein expression. In some embodiments, expression is cytoplasmic expression. In some embodiments, expression is nuclear expression.

[089] The term "expression" as used herein refers to the biosynthesis of a gene product, including the transcription and/or translation of the gene product. Thus, expression of a nucleic acid molecule may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or other functional RNA) and/or translation of RNA into a precursor or mature protein (polypeptide). Thus, either mRNA or protein can be measured to determine expression and either mRNA or protein can be reduced to reduce expression. In some embodiments, expression is expression level. Methods of determining gene expression are well known in the art and any such method may be employed.

[090] A variety of known techniques may be suitable for determining expression. Such techniques include methods based on hybridization analysis of polynucleotides and on sequencing of polynucleotides, and proteomics-based methods. In some embodiments, the measuring step is performed by nucleic acid hybridization, nucleic acid amplification, or an immunological method. In some embodiments, the measuring step is performed in-situ. In some embodiments, fluorescence labeling or staining are applied. In some embodiment, an imaging step is further applied.

[091] In some embodiments, the expression is obtained by measuring protein levels of EIF4EBP1/2. In some embodiments, the expression is obtained by measuring protein levels of EIF4E. In some embodiments, the expression, and the level of expression, of proteins or polypeptides can be detected through immunohistochemical staining of tissue slices or sections. In some embodiments, the tissue is tumor tissue. Additionally, EIF4EBP1/2 or EIF4E proteins/polypeptides can be detected by Western blotting, ELISA or Radioimmunoassay (RIA) assays employing protein-specific antibodies. In some embodiments, the measuring comprises extracting proteins from a sample. In some embodiments, the sample is a tumor sample. In some embodiments, the measuring comprises lysing the sample. In some embodiments, protein is extracted from the lysate. Lysing buffers and protein sample buffers, i.e., Laemmli buffer, STM buffer, TP buffer, SDS sample buffer and the like, are well known in the art and any suitable buffer may be used. In some embodiments, measuring is by western blot. In some embodiments, the measuring is by antibody-based detection. Anti- EIF4EBP1/2 antibodies are well known in the art. [092] Alternatively, EIF4EBP1/2 or EIF4E protein levels can be determined by constructing or using an antibody microarray in which binding sites comprise immobilized, preferably monoclonal, antibodies specific to a plurality of proteins of interest. Methods for making monoclonal antibodies are well known (see, e.g., Harlow and Lane, 1988, ANTIBODIES: A LABORATORY MANUAL, Cold Spring Harbor, N.Y., which is incorporated in its entirety for all purposes). In one embodiment, monoclonal antibodies are raised against synthetic peptide fragments designed based on genomic sequence of the cell. With such an antibody array, proteins from the cell are contacted to the array, and their binding is assayed with assays known in the art.

[093] In some embodiments, the determining expression comprises the step of obtaining nucleic acid molecules from the sample. In some embodiments, nucleic acids are obtained from the lysate. In some embodiments, obtaining is isolating. In some embodiments, the nucleic acids molecules are selected from mRNA molecules, DNA molecules and cDNA molecules. In some embodiments, the cDNA molecules are obtained by reverse transcribing the mRNA molecules. Methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andres et al., BioTechniques 18:42044 (1995).

[094] Numerous methods are known in the art for measuring expression levels of one or more genes such as by amplification of nucleic acids (e.g., PCR, isothermal methods, rolling circle methods, etc.) or by quantitative in situ hybridization. Design of primers for amplification of specific genes is well known in the art, and such primers can be found or designed on various websites such as bioinfo.ut.ee/primer3-0.4.0/ or pga.mgh.harvard.edu/primerbank/ for example.

[095] The skilled artisan will understand that these methods may be used alone or combined. Non-limiting exemplary method are described herein.

[096] RT-qPCR: A common technology used for measuring RNA abundance is RT-qPCR where reverse transcription (RT) is followed by real-time quantitative PCR (qPCR). Reverse transcription first generates a DNA template from the RNA. This single-stranded template is called cDNA. The cDNA template is then amplified in the quantitative step, during which the fluorescence emitted by labeled hybridization probes or intercalating dyes changes as the DNA amplification process progresses. Quantitative PCR (qPCR) produces a measurement of an increase or decrease in copies of the original RNA and has been used to attempt to define changes of gene expression in cancer tissue as compared to comparable healthy tissues. In some embodiments, the PCR is qPCR.

[097] RNA-Seq: RNA-Seq uses recently developed deep-sequencing technologies. In general, a population of RNA (total or fractionated, such as poly(A)+) is converted to a library of cDNA fragments with adaptors attached to one or both ends. Each molecule, with or without amplification, is then sequenced in a high-throughput manner to obtain short sequences from one end (single-end sequencing) or both ends (pair-end sequencing). The reads are typically 30-400 bp, depending on the DNA-sequencing technology used. In principle, any high-throughput sequencing technology can be used for RNA-Seq. Following sequencing, the resulting reads are either aligned to a reference genome or reference transcripts or assembled de novo without the genomic sequence to produce a genome-scale transcription map that consists of both the transcriptional structure and/or level of expression for each gene. To avoid artifacts and biases generated by reverse transcription direct RNA sequencing can also be applied. In some embodiments, the sequencing is next-generation sequencing. In some embodiments, the sequencing is deep sequencing. In some embodiments, the sequencing is shotgun sequencing.

[098] Microarray: Expression levels of a gene may be assessed using the microarray technique. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are arrayed on a substrate. The arrayed sequences are then contacted under conditions suitable for specific hybridization with detectably labeled cDNA generated from RNA of a test sample. As in the RT-PCR method, the source of RNA typically is total RNA isolated from a tumor sample, and optionally from normal tissue of the same patient as an internal control or cell lines. RNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g., formalin-fixed) tissue samples. For archived, formalin- fixed tissue cDNA-mediated annealing, selection, extension, and ligation, DASL-Illumina method may be used. For a non-limiting example, PCR amplified cDNAs to be assayed are applied to a substrate in a dense array. Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's microarray technology.

[099] As used herein, “EIF4EBP1” refers to Eukaryotic translation initiation factor 4E- binding protein 1. It is also known as 4EBP1, and the two names are used herein interchangeably. Additional names include 4E-BP1, BP-1, and PHAS-I. In some embodiments, human 4EBP1 comprises of consists of the nucleotide sequence provided in Entrez gene accession number 1978. In some embodiments, human 4EBP1 comprises or consists of the amino acid sequence provided in UniProt number Q13541. In some embodiments, human 4EBP1 mRNA comprises or consists of the nucleotide sequence provided in RefSeq number NM_004095. In some embodiments, human 4EBP1 protein comprises or consists of the amino acid sequence provided in RefSeq number NP_004086.

[0100] As used herein, “EIF4EBP2” refers to Eukaryotic translation initiation factor 4E- binding protein 2. It is also known as 4EBP2, and the two names are used herein interchangeably. Additional names include 4E-BP2, BP-2, and PHAS-II. In some embodiments, human 4EBP2 comprises of consists of the nucleotide sequence provided in Entrez gene accession number 1979. In some embodiments, human 4EBP1 comprises or consists of the amino acid sequence provided in UniProt number Q13542. In some embodiments, human 4EBP1 mRNA comprises or consists of the nucleotide sequence provided in RefSeq number NM_004096. In some embodiments, human 4EBP1 protein comprises or consists of the amino acid sequence provided in RefSeq number NP_004087.

[0101] As used herein, “EIF4E” refers to Eukaryotic translation initiation factor 4E. It is also known as EIF4E1 or eIF-4E, and the names are used herein interchangeably. Additional names include CBP, and AUTS19. In some embodiments, human EIF4E comprises of consists of the nucleotide sequence provided in Entrez gene accession number 1977. In some embodiments, human EIF4E comprises or consists of the amino acid sequence provided in UniProt number P06730. In some embodiments, human EIF4E mRNA comprises or consists of the nucleotide sequence provided in a RefSeq number selected from NM_001968, NM_001130678, NM_001130679 and NM_001331017. In some embodiments, human EIF4E protein comprises or consists of the amino acid sequence provided in a RefSeq number selected from NP_001959, NP_001124150, NP_001124151 and NP_001317946.

[0102] By another aspect, there is provided an agent that reduces expression of EIF4EBP1.

[0103] By another aspect, there is provided an agent that reduces EIF4EBP1 function.

[0104] By another aspect, there is provided an agent that reduces EIF4EBP2 function.

[0105] By another aspect, there is provided an agent that increases expression of EIF4E.

[0106] By another aspect, there is provided an agent that modulates EIF4E function.

[0107] By another aspect, there is provided an agent that binds EIF4E and inhibits binding to EIF4EBP1/2. [0108] By another aspect, there is provided an agent that binds EIF4E, inhibits its binding to EIF4EBP1/2, and does not hinder or increases its binding affinity to EIF4G.

[0109] In some embodiments, the agent is for use in treating cancer in a subject. In some embodiments, the reducing comprises administering an agent that reduces 4EBP1/2 expression. In some embodiments, the reducing comprises administering an agent that reduces 4EBP1/2 function. In some embodiments, the reducing comprises administering an agent that reduces 4EBP1/2 expression and/or function. In some embodiments, the increasing comprises administering an agent that increases EIF4E expression. In some embodiments, the modulating comprises administering an agent that increases EIF4E function, wherein said function is increasing translation. In some embodiments, the modulating comprises administering an agent that increases EIF4E function, wherein said function is binding to EIF4EBP1/2.

[0110] In some embodiments, the agent is a peptide. In some embodiments, the peptide is a fragment from EIF4EBP1. In some embodiments, the peptide is a fragment from EIF4EBP2. In some embodiments, the peptide comprises the amino acid sequence KFLMECRNSPVTKT (SEQ ID NO: 5). In some embodiments, the peptide consists of SEQ ID NO: 5. In some embodiments, the peptide consists of not more than 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 amino acids. Each possibility represents a separate embodiment of the invention. In some embodiments, the peptide consists of not more than 50 amino acids. In some embodiments, the peptide is not the complete EIF4EBP1/2. In some embodiments, the peptide comprises not more than 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 consecutive amino acids from EIF4EBP1/2. Each possibility represents a separate embodiment of the invention.

[0111] In some embodiments, the agent is in a composition. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a pharmaceutically acceptable excipient, carrier or adjuvant. In some embodiments, the composition comprises a therapeutically effective amount or dose of the agent. In some embodiments, the composition is for use in treating cancer.

[0112] By another aspect, there is provided a composition comprising a peptide comprising or consisting of SEQ ID NO: 5. [0113] As used herein, the term “carrier,” “excipient,” or “adjuvant” refers to any component of a pharmaceutical composition that is not the active agent. As used herein, the term “pharmaceutically acceptable carrier” refers to non-toxic, inert solid, semi-solid liquid filler, diluent, encapsulating material, formulation auxiliary of any type, or simply a sterile aqueous medium, such as saline. Some examples of the materials that can serve as pharmaceutically acceptable carriers are sugars, such as lactose, glucose and sucrose, starches such as corn starch and potato starch, cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt, gelatin, talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol, polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate, agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline, Ringer's solution; ethyl alcohol and phosphate buffer solutions, as well as other non-toxic compatible substances used in pharmaceutical formulations. Some non-limiting examples of substances which can serve as a carrier herein include sugar, starch, cellulose and its derivatives, powered tragacanth, malt, gelatin, talc, stearic acid, magnesium stearate, calcium sulfate, vegetable oils, polyols, alginic acid, pyrogen-free water, isotonic saline, phosphate buffer solutions, cocoa butter (suppository base), emulsifier as well as other non-toxic pharmaceutically compatible substances used in other pharmaceutical formulations. Wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, excipients, stabilizers, antioxidants, and preservatives may also be present. Any non-toxic, inert, and effective carrier may be used to formulate the compositions contemplated herein. Suitable pharmaceutically acceptable carriers, excipients, and diluents in this regard are well known to those of skill in the art, such as those described in The Merck Index, Thirteenth Edition, Budavari et al., Eds., Merck & Co., Inc., Rahway, N.J. (2001); the CTFA (Cosmetic, Toiletry, and Fragrance Association) International Cosmetic Ingredient Dictionary and Handbook, Tenth Edition (2004); and the “Inactive Ingredient Guide,” U.S. Food and Drug Administration (FDA) Center for Drug Evaluation and Research (CDER) Office of Management, the contents of all of which are hereby incorporated by reference in their entirety. Examples of pharmaceutically acceptable excipients, carriers and diluents useful in the present compositions include distilled water, physiological saline, Ringer's solution, dextrose solution, Hank's solution, and DMSO. These additional inactive components, as well as effective formulations and administration procedures, are well known in the art and are described in standard textbooks, such as Goodman and Gillman’s: The Pharmacological Bases of Therapeutics, 8th Ed., Gilman et al. Eds. Pergamon Press (1990); Remington’s Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa. (1990); and Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott Williams & Wilkins, Philadelphia, Pa., (2005), each of which is incorporated by reference herein in its entirety. The presently described composition may also be contained in artificially created structures such as liposomes, ISCOMS, slow-releasing particles, and other vehicles which increase the half-life of the peptides or polypeptides in serum. Liposomes include emulsions, foams, micelies, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. Liposomes for use with the presently described peptides are formed from standard vesicle-forming lipids which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally determined by considerations such as liposome size and stability in the blood. A variety of methods are available for preparing liposomes as reviewed, for example, by Coligan, J. E. et al, Current Protocols in Protein Science, 1999, John Wiley & Sons, Inc., New York, and see also U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.

[0114] The carrier may comprise, in total, from about 0.1% to about 99.99999% by weight of the pharmaceutical compositions presented herein.

[0115] As used herein, the terms “administering,” “administration,” and like terms refer to any method which, in sound medical practice, delivers a composition containing an active agent to a subject in such a manner as to provide a therapeutic effect. One aspect of the present subject matter provides for oral administration of a therapeutically effective amount of a composition of the present subject matter to a patient in need thereof. Other suitable routes of administration can include parenteral, subcutaneous, intravenous, intramuscular, or intraperitoneal.

[0116] The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.

[0117] The term "therapeutically effective amount" refers to an amount of a drug effective to treat a disease or disorder in a mammal. The term “a therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. The exact dosage form and regimen would be determined by the physician according to the patient's condition. [0118] In some embodiments, reducing expression comprises administering an agent that reduces expression. In some embodiments, the agent that reduces expression is selected from a genome editing protein or complex, a regulatory nucleic acid molecule and a small molecule. In some embodiments, the genome editing protein or complex is specific to the 4EBP1/2 genomic locus. In some embodiments, the regulatory nucleic acid molecule binds to the 4EBP1/2 genomic locus. In some embodiments, the regulatory nucleic acid molecule binds to the 4EBP1/2 gene product. In some embodiments, the regulatory nucleic acid molecule binds to a 4EBP1/2 mRNA. In some embodiments, the small molecule binds to 4EBP1/2.

[0119] In some embodiments, increasing expression comprises administering an agent that increases expression. In some embodiments, the agent that increases expression is selected from a genome editing protein or complex, a regulatory nucleic acid molecule and a small molecule. In some embodiments, the genome editing protein or complex is specific to the EIF4EBP1 genomic locus. In some embodiments, the regulatory nucleic acid molecule binds to the EIF4EBP1 genomic locus. In some embodiments, the regulatory nucleic acid molecule binds to the EIF4EBP1 gene product. In some embodiments, the regulatory nucleic acid molecule binds to a EIF4EBP1 mRNA. In some embodiments, the small molecule binds to EIF4EBP1. In some embodiments, the genome editing protein or complex is specific to the EIF4EBP2 genomic locus. In some embodiments, the regulatory nucleic acid molecule binds to the EIF4EBP2 genomic locus. In some embodiments, the regulatory nucleic acid molecule binds to the EIF4EBP2 gene product. In some embodiments, the regulatory nucleic acid molecule binds to a EIF4EBP2 mRNA. In some embodiments, the small molecule binds to EIF4EBP2.

[0120] In some embodiments, the agent is a genome editing protein or complex. In some embodiments, reducing expression comprises excision of a genomic locus comprising part of the 4EBP1 gene for a genome of the cancer or a cell of the cancer. In some embodiments, increasing expression comprises duplication of a genomic locus comprising part of the EIF4EBP1 gene for a genome of the cancer or a cell of the cancer. In some embodiments, increasing expression comprises mutation of a genomic locus comprising part of the EIF4EBP1 gene for a genome of the cancer or a cell of the cancer. In some embodiments, reducing expression comprises excision of a genomic locus comprising part of the 4EBP2 gene for a genome of the cancer or a cell of the cancer. In some embodiments, increasing expression comprises duplication of a genomic locus comprising part of the EIF4EBP2 gene for a genome of the cancer or a cell of the cancer. In some embodiments, increasing expression comprises mutation of a genomic locus comprising part of the EIF4EBP2 gene for a genome of the cancer or a cell of the cancer. In some embodiments, excision of the genomic locus results in non-expression of 4EBP1/2 mRNA or protein. In some embodiments, mutation of the genomic locus results in increased expression of EIF4EBP1/2. In some embodiments, the mutation is in a regulatory element of EIF4EBP1/2. In some embodiments, 4EBP1/2 mRNA or protein is functional 4EBP1/2 mRNA or protein. In some embodiments, EIF4EBP1/2 mRNA or protein is functional EIF4EBP1/2 mRNA or protein. Examples of a genome-editing protein/complex include, but are not limited to, a clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated nuclease, a Zinc- finger nuclease (ZFNs), a meganuclease and a transcription activator- like effector nuclease (TALEN). In some embodiments, the genome editing protein or complex is targeted to the genomic locus. In some embodiments, the agent comprises a nucleic acid molecule that targets the genome editing protein or complex to the genomic locus. In some embodiments, the nucleic acid molecule is an RNA. In some embodiments, the RNA is a regulatory RNA. In some embodiments, the nucleic acid molecule is a guide RNA (gRNA). In some embodiments, the gRNA is a single guide RNA (sgRNA). In some embodiments, the sgRNA is chemically modified. In some embodiments, the nucleic acid molecule is complementary to a sequence in the genomic locus. In some embodiments, the sequence is at a boundary of the genomic locus.

[0121] In some embodiments, EIF4EBP1/2 function is reduced. In some embodiments, 4EBP1/2 function comprises sequestering EIF4E. In some embodiments, 4EBP1/2 function comprises blocking interaction of EIF4E with EIF4G. In some embodiments, 4EBP1/2 function comprises inhibiting EIF4E mediated translation. In some embodiments, EIF4E mediated translation is cap-dependent translation. In some embodiments, reducing function comprises increasing phosphorylation of 4EBP1/2. In some embodiments, reducing function comprises increasing EIF4E mediated translation. In some embodiments, reducing function comprises increasing EIF4E binding to EIF4G. In some embodiments, reducing function comprises reducing EIF4E sequestering. In some embodiments, reducing function comprises directly inhibiting 4EBP1/2. In some embodiments, reducing function comprises directly binding 4EBP1/2. In some embodiments, reducing function does not comprise inhibiting mammalian target of rapamycin (mTOR). In some embodiments, reducing function does not comprise administering an mTOR inhibitor. In some embodiments, reducing function comprises activating mTOR. In some embodiments, activating mTOR comprises administering an mTOR activator. In some embodiments, activating mTOR is activating the mTOR pathway. In some embodiments, reducing function does not comprise increasing glucose in the cancer.

[0122] In some embodiments, EIF4E function is modulated. In some embodiments, modulated is reduced. In some embodiments, modulated is increased. In some embodiments, modulated comprises increasing a first function and decreasing a second function. In some embodiments, EIF4E function comprises inducing translation. In some embodiments, inducing translation is increasing translation. In some embodiments, translation is translation rate. In some embodiments, EIF4E function is interaction with EIF4G. In some embodiments, interaction is binding. In some embodiments, EIF4E function comprises EIF4E mediated translation. In some embodiments, EIF4E mediated translation is capdependent translation. In some embodiments, EIF4E function comprises binding to EIF4EBP1/2. In some embodiments, increasing function comprises reducing the sequestering of EIF4E. In some embodiments, increasing function comprises directly binding EIF4E. In some embodiments, modulating function comprises inhibiting binding to EIF4EBP1/2 and not inhibiting binding to EIF4G.

[0123] In some embodiments, reducing function comprises administering an agent that reduces function. In some embodiments, increasing function comprises administering an agent that increases function. In some embodiments, the agent is a regulatory nucleic acid molecule. The term "regulatory nucleic acid molecule" as used herein refers to non-coding molecules that modulate gene expression. In some embodiments, the regulatory RNA inhibits transcription. In some embodiments, the regulatory RNA increases transcription. In some embodiments, the regulatory RNA inhibits translation. In some embodiments, the regulatory RNA increases translation. In some embodiments, the regulatory RNA increases mRNA degradation. In some embodiments, the regulatory RNA inhibits mRNA degradation. In some embodiments, the nucleic acid molecule is RNA. In some embodiments, the nucleic acid molecule is DNA. Regulatory nucleic acid molecules that reduce 4EBP1/2 expression and function are well-known in the art and commercially available from companies such as Santa Cruz Biotechnology and Cell Signaling Technology to name but a few.

[0124] In some embodiments, the nucleic acid molecule comprises a chemically altered backbone. In some embodiments, the molecule is chemically modified. In some embodiments, the chemical modification is a modification of a backbone of the molecule. In some embodiments, the chemical modification is a modification of a sugar of the molecule. In some embodiments, the chemical modification is a modification of a nucleobase of the molecule. In some embodiments, the chemical modification increases stability of the molecule in a cell. In some embodiments, the chemical modification increases stability of the molecule in vivo. In some embodiments, the chemical modification is selected from: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate - deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2 -methoxy ethyl phosphorothioate backbone, a constrained ethyl backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-p-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, ligand-conjugated antisense, and a combination thereof. In some embodiments, the regulatory nucleic acid molecule is an antisense oligonucleotide.

[0125] In some embodiments, the regulatory nucleic acid molecule is a regulatory RNA. These molecules include but are not limited to microRNAs (miRNAs), small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), small nuclear RNAs (snRNAs), long noncoding RNAs (IncRNAs) and antisense oligonucleotides (ASOs). In some embodiments, the regulatory RNA is an shRNA. In some embodiments, the regulatory RNA comprises or consists of the sequence GCCAGGCCTTATGAAAGTGAT (SEQ ID NO: 1). In some embodiments, the regulatory RNA comprises or consists of the sequence GCCAGGCCTTATGAAAGTGATC (SEQ ID NO: 2). In some embodiments, the regulatory RNA comprises or consists of the sequence CGGTGAAGAGTCACAGTTTGA (SEQ ID NO: 3). In some embodiments, the regulatory RNA comprises or consists of the sequence CGGTGAAGAGTCACAGTTTGAC (SEQ ID NO: 4).

[0126] In some embodiments, the regulatory nucleic acid is specific to 4EBP1/2. In some embodiments, the regulatory nucleic acid binds to 4EBP1/2. In some embodiments, the regulatory nucleic acid is specific to EIF4E. In some embodiments, the regulatory nucleic acid binds to EIF4E. In some embodiments, binding is specific binding. In some embodiments, specific binding comprises not significantly binding to any other target. In some embodiments, the regulatory nucleic acid binds to the 4EBP1/2 genomic locus. In some embodiments, the regulatory nucleic acid binds to a 4EBP1/2 mRNA. In some embodiments, binding inhibits transcription of 4EBP1/2. In some embodiments, binding inhibits 4EBP1/2 translation. In some embodiments, binding degrades the 4EBP1/2 mRNA. In some embodiments, degrades comprises increasing degradation. In some embodiments, the regulatory nucleic acid binds to the EIF4E genomic locus. In some embodiments, the regulatory nucleic acid binds to a EIF4E mRNA. In some embodiments, binding increases transcription of EIF4E. In some embodiments, binding increases EIF4E translation. In some embodiments, binding inhibits degradation the EIF4E mRNA.

[0127] In some embodiments, the regulatory nucleic acid is a short regulatory molecule. In some embodiments, short is less than 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length. Each possibility represents a separate embodiment of the invention. In some embodiments, short is less than 50 nucleotides in length. In some embodiments, short is less than 20 nucleotides in length. In some embodiments, the regulatory nucleic acid is at least 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length. Each possibility represents a separate embodiment of the invention.

[0128] In some embodiments, the agent is a small molecule. In some embodiments, the agent is a peptide. In some embodiments, the small molecule binds to 4EBP1/2. In some embodiments, the small molecule binds to EIF4E. In some embodiments, the peptide binds to 4EBP1/2. In some embodiments, the peptide binds to EIF4E. In some embodiments, the agent is a 4EBP1/2 inhibitor. In some embodiments, the agent is an EIF4E activator. In some embodiments, the agent is a mTOR activator. In some embodiments, the agent inhibits 4EBP1/2 binding to EIF4E. In some embodiments, the agent inhibits EIF4E binding to EIF4EBP1/2. In some embodiments, the agent does not inhibit EIF4E binding to EIF4G. In some embodiments, the agent inhibits EIF4E binding to EIF4EBP1/2 and does not inhibit EIF4E binding to EIF4G. In some embodiments, the agent induces phosphorylation of 4EBP1/2. In some embodiments, the agent phosphorylates 4EBP1/2. In some embodiments, the agent protects a phosphorylation of 4EBP1/2. In some embodiments, protects is protects from dephosphorylation. In some embodiments, the agent binds to the phosphorylation on 4EBP1/2. In some embodiments, the phosphorylation is phosphorylation of threonine (Thr) 37 of 4EBP1/2. In some embodiments, the phosphorylation is phosphorylation of Thr 46 of 4EBP1/2. In some embodiments, the phosphorylation is phosphorylation of Thr 70 of 4EBP1/2. In some embodiments, the phosphorylation is phosphorylation of serine (Ser) 65 of 4EBP1/2. In some embodiments, the phosphorylation is phosphorylation of at least one of Thr 37, Thr 46, Thr 70 and Ser 65. In some embodiments, the phosphorylation is phosphorylation of at least one of Thr 37, Thr 46 and Ser 65. In some embodiments, the phosphorylation is phosphorylation of at least one of Thr 70 and Ser 65. In some embodiments, at least one of is at least 2 of. In some embodiments, at least one of is at least 3 of. In some embodiments, at least one of is all of.

[0129] In some embodiments, the agent binds, blocks or occludes the EIF4EBPl/2-binding pocket of EIF4E. In some embodiments, the agent binds, blocks or occludes the lateral hydrophobic pocket of EIF4E. In some embodiments, the agent binds, blocks or occludes the EIF4E-binding pocket of EIF4EBP1/2. In some embodiments, the agent does not bind, block or occlude the EIF4G-binding pocket of EIF4E. The structure of the EIF4E-EIF4G complex is known in the art (see for example Gruner et al., 2016, “The structures of eIF4E- eIF4G complexes reveal an extended interface to regulate translation initiation”, Mol. Cell, Nov 3;64(3):467-479 and Miras et al., 2017, “Structure of eiF4E in complex with eIF4G peptide supports a universal bipartite binding mode for protein translation”, Plant Physiol., Jul; 174(3): 1476-149, herein incorporated by reference in their entirety) and agents that do not block the interaction site can be clearly conceived.

[0130] In some embodiments, the agent is a peptide. In some embodiments, the peptide is a fragment of EIF4EBP1/2. In some embodiments, a fragment is less than 100% of EIF4EBP1/2. In some embodiments, the peptide competes with EIF4EBP1/2 for binding to EIF4E. In some embodiments, the peptide comprises KFLMECRNSPVTKT (SEQ ID NO: 5). In some embodiments, the peptide consists of SEQ ID NO: 5. In some embodiments, the amino acid sequence of the peptide comprises SEQ ID NO: 5. In some embodiments, the amino acid sequence of the peptide consists of SEQ ID NO: 5. In some embodiments, the small molecule is an antibody. Antibodies to 4EBP1/2, to EIF4E and specifically to phosphorylated 4EBP1/2, are well-known in the art and commercially available from companies such as Therma Fisher, Abeam, Cell Signaling Technologies, Bio-rad and Santa Cruz Biotechnology to name but a few.

[0131] In some embodiments, inhibiting is at least a 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 97, 99 or 100% inhibition. Each possibility represents a separate embodiment of the invention. In some embodiments, inhibiting is at least a 50% inhibition. In some embodiments, inhibiting is at least an 80% inhibition. In some embodiments, inhibiting is at least a 90% inhibition. In some embodiments, inhibiting is at least a 95% inhibition.

[0132] In some embodiments, the method further comprises increasing reactive oxygen species (ROS) in the cancer. In some embodiments, the increasing is in the cell of the cancer. In some embodiments, increasing ROS comprises administering an agent that increases ROS. In some embodiments, increasing ROS comprises increasing glucose starvation in the cancer. In some embodiments, increasing glucose starvation comprises fasting the subject. In some embodiments, fasting is intermittent fasting. In some embodiments, the increasing ROS is performed before the reducing 4EBP1/2 expression or function or increasing EIF4E expression or modulating EIF4E function. In some embodiments, the increasing ROS is performed concomitantly to the reducing 4EBP1/2 expression or function or increasing EIF4E expression or modulating EIF4E function. In some embodiments, before is at most 48, 36, 24, 18, 16, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 hour before the reducing. Each possibility represents a separate embodiment of the invention.

[0133] In some embodiments, the method further comprises administering another anticancer therapy. In some embodiments, the anticancer therapy is administered concomitantly to the inducing or increasing. In some embodiments, the anticancer therapy is administered before the inducing or increasing. In some embodiments, the anticancer therapy is administered after the inducing or increasing. In some embodiments, the anticancer therapy is a chemotherapeutic agent. Chemotherapies are well known in the art and any such therapy may be combined as part of the method of the invention. In some embodiments, the chemotherapy is doxycycline.

[0134] By another aspect, there is provided a method of determining suitability of a subject to be treated by a method of the invention, comprising receiving a sample from the subject and measuring at least one of expression of EIF4EBP1/2 in the sample, expression of EIF4E in the sample and glucose levels in the sample, thereby determining suitability.

[0135] In some embodiments, the subject suffers from cancer. In some embodiments, the subject is in need to determining suitability. In some embodiments, the sample contains cancer cells. In some embodiments, the sample is a cancer sample. In some embodiments, the sample is a biopsy. In some embodiments, the sample is a tumor fluid sample. In some embodiments, the sample is from the tumor microenvironment (TME). In some embodiments, the sample comprises the tumor extracellular matrix (ECM). In some embodiments, the TME comprises ECM. In some embodiments, the TME is the ECM. In some embodiments, the sample is a fluid sample. In some embodiments, the fluid is a bodily fluid. In some embodiments, the bodily fluid is selected from: blood, serum, plasma, gastric fluid, intestinal fluid, saliva, bile, tumor fluid, breast milk, urine, interstitial fluid, cerebral spinal fluid and stool. In some embodiments, the fluid comprises cancer cells. In some embodiments, the fluid comprises fluid cell-free DNA (cfDNA). In some embodiments, the biopsy is a liquid biopsy. In some embodiments, the sample is selected from a blood, tumor fluid and biopsy sample. In some embodiments, blood is peripheral blood.

[0136] In some embodiments, expression is expression in the cancer cells. In some embodiments, expression is expression in cfDNA. In some embodiments, expression is a gene duplication. In some embodiments, glucose levels are levels in the cancer cells. In some embodiments, glucose levels are levels in the TME. In some embodiments, both EIF4EBP1/2 expression and glucose levels are measured. In some embodiments, both EIF4E expression and glucose levels are measured. In some embodiments, all of EIF4EBP1/2 expression, EIF4E expression and glucose levels are measured. In some embodiments, expression is expression levels.

[0137] In some embodiments, expression of EIF4EBP1/2 above a predetermined threshold indicates the subject is suitable to be treated by a method of the invention. In some embodiments, an EIF4EBP1/2 gene duplication indicates the subject is suitable to be treated by a method of the invention. In some embodiments, glucose levels below a predetermined threshold indicates the subject is suitable to be treated by a method of the invention. In some embodiments, the presence of both expression of EIF4EBP1/2 above a predetermined threshold and glucose levels below a predetermined threshold indicates the subject is suitable to be treated by a method of the invention.

[0138] In some embodiments, expression of EIF4E below a predetermined threshold indicates the subject is suitable to be treated by a method of the invention. In some embodiments, an EIF4E gene deletion or mutation indicates the subject is suitable to be treated by a method of the invention. In some embodiments, the presence of both expression of EIF4E below a predetermined threshold and glucose levels below a predetermined threshold indicates the subject is suitable to be treated by a method of the invention.

[0139] In some embodiments, the predetermined threshold is EIF4EBP1/2 expression in healthy cells. In some embodiments, the predetermined threshold is EIF4E expression in healthy cells. In some embodiments, the healthy cells are of the same cell type as the cancer cells. In some embodiments, the healthy cells are from the same tissue as the cancer cells. In some embodiments, glucose levels below the predetermined threshold are indicative of glucose starvation. In some embodiments, glucose starvation is measured in the sample. It will be understood by a skilled artisan that as described hereinabove glucose starvation can be measured in ways other than directly measuring glucose itself. Such indirect measures may be used for determining suitability to be treated.

[0140] By another aspect, there is provided a kit comprising at least one agent configured for detection of EIF4EBP1, configured for detection of EIF4EBP2 or configured for detection of EIF4E and at least one agent configured for determining glucose levels.

[0141] In some embodiments, the agent is configured for detection of EIF4EBP1. In some embodiments, the agent is configured for detection of EIF4EBP2. In some embodiments, the agent is configured for detection of EIF4E. In some embodiments, detection is detection of protein. In some embodiments, protein is protein levels. In some embodiments, the detection is detection of mRNA. In some embodiments, mRNA is mRNA levels. In some embodiments, the agent is configured for detection of EIF4EBP1 genomic duplication. In some embodiments, the agent is configured for detection of EIF4EBP2 genomic duplication. In some embodiments, the agent is configured for detection of EIF4E genomic deletion or mutation. In some embodiments, the agent is a nucleic acid molecule. In some embodiments, the agent is a probe. In some embodiments, the agent is a primer. In some embodiments, the agent is an antibody. Methods of detecting and quantifying protein and mRNA expression are provided hereinabove and are generally known in the art. In some embodiments, the agent is specific to EIF4EBP1 protein. In some embodiments, the agent is specific to EIF4EBP1 mRNA. In some embodiments, the agent is specific to the EIF4EBP1 genomic locus. In some embodiments, the agent is specific to EIF4EBP2 protein. In some embodiments, the agent is specific to EIF4EBP2 mRNA. In some embodiments, the agent is specific to the EIF4EBP1 genomic locus. In some embodiments, the agent does not substantially detect any other pro tein/mRNA/genomic locus. In some embodiments, specific for EIF4EBP1 is specific for EIF4EBP1 and EIF4EBP2. In some embodiments, specific for EIF4EBP1 is specific only for EIF4EBP1. In some embodiments, specific for EIF4EBP2 is specific for EIF4EBP1 and EIF4EBP2. In some embodiments, specific for EIF4EBP2 is specific only for EIF4EBP2. In some embodiments, the agent is specific to EIF4E protein. In some embodiments, the agent is specific to EIF4E mRNA. In some embodiments, the agent is specific to the EIF4E genomic locus.

[0142] In some embodiments, an agent configured for detecting glucose is configured for detecting glucose starvation. In some embodiments, the agent is a metabolic labeling agent. In some embodiments, the metabolic labeling agent is radioactive carbon. In some embodiments, the radioactive carbon is carbon 13 (13C). In some embodiments, 13C is U- 13C. In some embodiments, the agent is a PET-scan agent. In some embodiments, the PET -scan agent is fluorodeoxy glucose (FDG). In some embodiments, FDG is 18F-FDG. In some embodiments, the agent is configured to detect histone H2B mono-ubiquitination. In some embodiments, the agent is an anti-histone H2B antibody. In some embodiments, the antibody is an anti-mono-ubiquitinated H2B antibody. In some embodiments, the antibody is anti- K123 of H2B. In some embodiments, the antibody is anti-mono-ubiquitinated K123 of H2B.

[0143] In another aspect, there is provided a method of selecting a therapeutic agent, the method comprising: a. providing an agent that binds to EIF4E; b. determining if the provided agent inhibits binding of EIF4EBP1 or EIF4EBP2 to EIF4E; and c. selecting an agent that inhibits the binding; thereby selecting a therapeutic agent.

[0144] In another aspect, there is provided a method of selecting a therapeutic agent for treating cancer, the method comprising: a. providing an agent; b. determining if the agent i. reduces expression of EIF4EBP1, EIF4EBP2 or both; ii. reduces binding of EIF4EBP1, EIF4EBP2 or both to EIF4E; or iii. increases expression of EIF4E; and c. selecting an agent that reduces expression of EIF4EBP1, EIF4EBP2 or both by more than a predetermined threshold, reduces binding of EIF4EBP1, EIF4EBP2 or both to EIF4E by more than a predetermined threshold or increases expression of EIF4E by more than a predetermined threshold; thereby selecting a therapeutic agent for treating cancer.

[0145] In some embodiments, inhibiting the binding is significantly inhibiting the binding. In some embodiments, inhibiting the binding is by at least a predetermined threshold. In some embodiments, inhibiting the binding is inhibiting the binding sufficiently to increase translation in a cell contacted with the agent. In some embodiments, the method further comprises contacting a cell with the selected agent. In some embodiments, the method comprises measuring translation in the contacted cell. In some embodiments, the method comprises selecting an agent that increases translation. In some embodiments, increasing translation is increasing by at least a predetermined threshold. In some embodiments, increasing is significantly increasing. In some embodiments, reducing is significantly reducing.

[0146] In some embodiments, the method comprises determining if the selected agent inhibits binding of EIF4G to EIF4E. In some embodiments, the method comprises selecting an agent that does not or lowly inhibits the binding. In some embodiments, lowly inhibiting the binding is inhibiting by less than a predetermined threshold. In some embodiments, the method comprises selecting an agent that does not inhibit the binding. [0147] In some embodiments, the method comprises contacting cancer cells with the selected agent. In some embodiments, the contacting is in vivo. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in culture. In some embodiments, the cancer cells are a cancer. In some embodiments, the cancer cells are a tumor. In some embodiments, the cancer cells are in a model organism. In some embodiments, the organism is a rodent. In some embodiments, the rodent is a mouse. In some embodiments, cancer cells are under glucose limitation. In some embodiments, the cancer cells are deprived of glucose. In some embodiments, the cancer comprises a region of glucose limitation. In some embodiments, the cancer is brain cancer. In some embodiments, the method further comprises monitoring the cancer cells after the contacting. In some embodiments, the monitoring comprises measuring survival of the cancer cells. In some embodiments, measuring survival comprises measuring cell death. In some embodiments, the monitoring comprises measuring aggressiveness of the cancer cells. In some embodiments, the monitoring comprises measuring metastasis of the cancer. In some embodiments, the monitoring comprises measuring volume of the cancer. In some embodiments, the method further comprises selecting an agent that inhibits the cancer cells. In some embodiments, inhibiting the cancer cells comprises reducing survival. In some embodiments, inhibiting the cancer cells comprises increasing cell death. In some embodiments, inhibiting the cancer cells comprises reducing aggressiveness. In some embodiments, inhibiting the cancer cells comprises reducing metastasis. In some embodiments, inhibiting the cancer cells comprises reducing the volume of the cancer.

[0148] In some embodiments, the agent is for use in a method of treating cancer. In some embodiments, the agent is for use in a method of treating a cancer comprising a region of glucose limitation. In some embodiments, the agent is for use in a method of the invention.

[0149] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm+- 100 nm.

[0150] It is noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0151] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."

[0152] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0153] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0154] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES

[0155] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I- III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.

Example 1: 4EBP protects cells from glucose starvation

[0156] It was hypothesized that 4EBPs promote cellular survival upon glucose starvation by inhibiting mRNA translation. Accordingly, HEK293 cells expressing shRNA (SEQ ID NO: 1) targeting 4EBP1/2 (4EBPs) (see Dowling et al., 2010, “mTORCl -mediated cell proliferation, but not cell growth, controlled by the 4E-BPs.,” Science (80), vol. 328, no. May, pp. 1172-1177, herein incorporated by reference in its entirety), 4EBPs knockout (ko) cells and wild type (wt) MEFs were subjected to glucose starvation or amino acid starvation. Cell death was measured after 48 hours using PI staining and FACS (Fig. 2). It was found that 4EBPs depletion rendered cells more sensitive to glucose starvation but not amino acid starvation. This was observed both in the shRNA knockdown cells and the full knockout cells. In accordance, overexpression of a constitutively active 4EBP mutant (4EBP-AA) (Gingras et al., 1999, “Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism.,” Genes Dev., vol. 13, no. 11, pp. 1422-37, herein incorporated by reference in its entirety) protected HeLa cells form glucose starvation (Fig. 3). [0157] To test if 4EBPs protect cells by inhibiting eIF4E, siRNA was used to knockdown (kd) eIF4E in 4EBPs depleted HEK293 and MEF cells and it was found that eIF4E depletion rescued 4EBP kd and ko cells form glucose starvation (Fig. 4). These data indicate that 4EBPs protect cells form glucose starvation by inhibiting its canonical target, eIF4E.

[0158] To test if 4EBPs protect cells by inhibiting mRNA translation 4EBPs kd and ko cells were treated with glucose starvation in the presence of the mRNA translation inhibitor cycloheximide (CHX). It was found that CHX rescued the cells from glucose starvation induced cell death (Fig. 5). These data show that 4EBP protects cells by inhibiting mRNA translation.

[0159] Next, total protein synthesis was measured using L-azidohomoalanine (AHA), a synthetic methionine homolog, rather than puromycin, which allows measurement of protein synthesis upon glucose starvation. Whether 4EBPs are essential for mRNA translation inhibition upon glucose starvation was tested using 4EBPs kd HEK293, 4EBPs ko MEF, and control cells together with AHA labelling and it was found that this is not the case (Fig. 6). While there are higher levels of global protein synthesis in 4EBPs kd HEK293 cells, as compared with controls under normal conditions, there was a significant drop in protein synthesis in both cell lines, which presented as similar protein synthesis levels three hours after the onset of glucose starvation (Fig. 6). In MEF cells, no significant differences in mRNA translation were found between 4EBPs wt and ko cells at the 0- and 24-hour time points (Fig. 6). Because cell death is observed 48 hours post-glucose starvation whereas differences in protein synthesis are eliminated 24 hours post-treatment, it is therefore likely that the protective functions of 4EBPs are linked to their regulation of selective mRNA translation, rather than global mRNA translation.

Example 2: 4EBPs protect glucose starved cells by promoting NADPH and curbing ROS

[0160] Maintaining NADPH levels and REDOX balance is critical for cell survival upon glucose starvation. It was tested if 4EBPs’ protective functions upon glucose starvation are linked to REDOX balance. Indeed, antioxidants, NAC and catalase, rescued 4EBPs depleted cells from glucose starvation (Fig. 7). Furthermore, increased levels of reactive oxygen species (ROS) were observed in 4EBPs depleted cells upon glucose starvation and over expression of 4EBP-AA (constitutively active mutant) curbed ROS upon glucose station (Fig. 8). [0161] To identify the metabolic consequences of 4EBPs depletion upon glucose starvation 4EBPs kd and control HEK293 were treated with glucose starvation for 24 hours after which metabolic profiling was performed using MS/MS. Reduction in specific TCA cycle metabolites and, importantly in NADPH/NAD ratio was observed in 4EBPs depleted cells vs. controls upon glucose starvation (Fig. 9), indicating that 4EBPs protect cells from glucose starvation by promoting NADPH levels and curbing ROS.

Example 3: 4EBP1 inhibits fatty acid synthesis upon glucose starvation

[0162] Fatty acid synthesis is the most NADPH consuming cellular process. Because reduced NADPH levels were observed in 4EBPs depleted cells upon glucose starvation, it was asked if there are differences in fatty acid synthesis in these conditions. To this end, 4EBPs wt and ko MEFs were starved for glucose for 24 hours after which the cells were pulsed with labeled glucose and the incorporation of glucose carbons to cellular lipids was measured using mass spectrometry (Fig. 10). Increased labeled fatty acids were measured in the 4EBP KO cells indicating that 4EBPs inhibit fatty acid synthesis upon glucose starvation.

[0163] Fatty acid synthesis is dependent on the rate limiting acetyl-coA carboxylase (ACC1) and fatty acid synthetase (FASN). To test if regulating the fatty acid synthesis pathway is linked to 4EBPs protective functions upon glucose starvation, ACC1 or FASN were knocked down using siRNA, kd cells were glucose starved and measured for cell death (Fig. 11). Knockdown of FASN or ACC1 rescued 4EBPs kd cells from glucose starvation induced cell death. Furthermore, ACC, and therefore fatty acid synthesis, was inhibited using the synthetic inhibitor 5-(tetradecyloxy)-2-furoic acid (TOFA) and this inhibition was found to rescue NADPH, ROS and cell death in 4EBPs kd HEK293 cells (Fig. 12).

[0164] To test if 4EBP1 is also functional in tumor cells U87 cells expressing sh4EBPl or control were used. Cells were starved for glucose for 48 in the presents of NAC, catalase or CHX after which cell death was measured (Fig. 13). As was the case in non-tumor cell lines, here too 4EBP1 protected the cells against glucose starvation by curbing ROS. Similar results were obtained using breast cancer (MCF7) cells (Fig. 14).

Example 4: 4EBP1 is clinically relevant in multiple cancers

[0165] To test if 4EBP1 is clinically relevant, its amplification in tumors obtained from cancer patients was interrogated using cBioportal and it was found that it is amplified in multiple tumors (Fig. 15A). In addition, it was found that, at the mRNA level, 4EBP1 is over expressed in several tumors including non-small cell lung cancer and colon cancer (Fig. 15B). Using lysates obtained from tumors, and western blots, over expression of 4EBP1 protein was observed in lung cancer tumors (Fig. 15C).

[0166] 4EBP1 is negatively regulated by phosphorylation and its phosphatase, PPM1G, dephosphorylates it to induce its activation. It was found that the expression of 4EBP1 and PPM1G mRNA are correlated in lung tumors suggesting that there is sufficient PPM1G to dephosphorylate and activate 4EBP1 in tumors (Fig. 15D).

[0167] To test if 4EBP1 is associated with aggressiveness of disease, a Kaplan-Meir analysis was performed using lung, breast and colon cancer patient derived data. It was found that high expression of 4EBP1 is associated with poor patient outcome (Fig. 15E).

[0168] The focus was turned to glioblastoma, and it was found that 4EBP1 mRNA is highly expressed in glioblastoma multiform (GBM) tumors as compared with normal brain or low- grade glioma. It was also found that patients with high 4EBP1 expression in their tumors exhibited reduced survival. Finally, it was found that 4EBP1 protein is highly expressed in GBM tumors as compared with matched normal brain (Fig. 16). Together, these data indicate that 4EBP1 is highly clinically relevant in GBM.

Example 5: 4EBP1 promotes tumorigenicity and aggressiveness in brain cancer

[0169] To test if 4EBP1 promotes tumorigenicity, U87 cells expressing shRNA targeting 4EBP1 and controls were employed. Cells were injected to the flanks of NOD-SCID mice and tumors were allowed to grow for three weeks after which tumors were harvested and their mass measured (Fig. 17). 4EBP1 kd cells generated smaller tumors as compared with control cells. Ki-67 staining of the tissue by immunohistochemistry found increased Ki-67 staining in the control tumors as compared to 4EBP1 kd tumors (Fig. 17). This demonstrates that targeting of 4EBP1 is a viable treatment modality for solid tumors.

[0170] To determine if 4EBP1 is important for established tumors, rather than tumorigenicity, U87 cells stably expressing doxycycline inducible shRNA vectors either targeting 4EBP1 or scrambled control were used. Cell were injected into NOD-SCID mice, allowed to generate tumors in the size of 10 ^A 3 cubic millimeters after which mice were exposed to doxycycline or vehicle (in their drinking water). Tumor volume was measured using caliper and mass was measured at the end of the experiment (Fig. 18). 4EBP1 depletion led to tumor shrinkage indicating a role in tumorigenicity and maintenance and not merely tumor establishment. [0171] Next it was tested if 4EBP1 is functional in tumors growing in the target tissue of GBM, the brain. The brain absolutely requires glucose to function and thus might theoretically be a tissue in which tumors are not particularly exposed to glucose starvation. U87 cells expressing shRNA targeting 4EBP1 or controls were injected to the brains of NOD-SCID mice and tumor growth was followed using MRI (Fig. 19). Reduced tumor growth of cells expressing shRNA targeting 4EBP1 was observed. In addition, depleting 4EBP1 reduced tumor aggressiveness and increased mice survival (Fig. 19) indicating 4EBP1 targeting is an effective treatment modality for brain tumors.

[0172] As it was found that 4EBP1 protects cells from glucose starvation by curbing ROS, oxidative damage was measured using antibodies recognizing oxidized nucleic acids, in 4EBP1 expressing and depleted tumors. Increased oxidative stress was indeed observed in the 4EBP1 depleted tumors (Fig. 20).

[0173] To test if 4EBP1 affects tumor growth in immune-proficient mice, the GL261 mouse GBM model was employed. Cells expressing shRNA targeting 4EBP1 were injected into brains of B6 mice. MRI analysis, two weeks post injection, showed that sh4EBPl tumors were smaller as compared to control scramble shRNA tumors. In accordance, mice expressing sh4EBPl in their tumors survived longer (Fig. 21). Together, these data show that 4EBP1 is pro-tumorigenic in human and mouse cell lines and can be targeted as a therapeutic modality in cancers under glucose starvation.

Example 6: Blocking 4EBP1 binding to EIF4E

[0174] Next the ability of agents to block the interaction of 4EBP1 with EIF4E was tested. Biotinylated 4EBP1 was attached to streptavidin-coated ELISA plates. Following washing, EIF4E was added which was followed by detection with fluorescent anti-EIF4E antibody. Fluorescence was then recorded with a plate reader. EIF4E added alone was used as a positive control and 4EBP1 without any additions was used as a negative control.

[0175] First, an anti-4EBPl antibody (Cell Signaling; 53H11) was tested. The antibody reduced the ability of EIF4E to bind to the plate bound 4EBP1, indicating that this antibody does occlude the eIF4E binding pocket (Fig. 22). Next, a peptide fragment from 4EBP1 was tested. The fragment, KFLMECRNSPVTKT (SEQ ID NO: 5) is predicted to bind to the EIF4E binding pocket for 4EBP and thus compete with the full 4EBP1 protein. The peptide and EIF4E are mixed (with or without preincubation) and both added to the plate bound 4EBP1. The peptide reduces EIF4E binding to 4EBP and thus is an effective agent at blocking the interaction of the two proteins. [0176] A blocking assay is also performed to test that the agents do not inhibit binding of EIF4E to EIF4G. In this assay EIF4E is immobilized to the plate and a fluorescent antibody to EIF4G is used for detection. EIF4G is added alone as a positive control and the plate with bound EIF4E and not addition is used as the negative control. The peptide is added to the plate and allowed to bind to EIF4E. EIF4G is then added and detected. The peptide binds only in the 4EBP pocket and does not inhibit/block interaction of EIF4E with EIF4G. Various other variations of the peptide (e.g., longer peptides, or chemically modified peptides) are also tested both for their ability to block EIF4E-4EBP interaction and not to block EIF4E-EIF4G interaction. Peptides that are able to bind to the 4EBP binding pocket without occluding/perturbing the EIF4G binding pocket are selected as blocking agents.

Example 7: Use of the blocking agents to treat cancer

[0177] Various tumor cell lines are tested. Cells from lung cancer, breast cancer, bladder cancer, uterine cancer, esophageal cancer, head and neck cancer, colorectal cancer and brain cancer are tested. In particular, U87 cells are tested. The cells are grown with and without glucose deprivation and an anti-4EBPl blocking antibody (e.g., 53H11) or a 4EBP1 fragment (e.g., SEQ ID NO: 5) are added. Cell survival and proliferation is measured. Both the blocking antibody and the peptide reduce cancer cell survival under conditions of glucose deprivation.

[0178] Various tumor cell lines are also injected into mice to produce a mouse model for testing the antibodies and peptides. Tumor cells are injected into the flank or to specific sites to be tested (e.g., into the brain). The blocking agents (antibodies or peptides) are administered either concomitantly with the cancer cells or after a tumor is allowed to form. In both cases, the blocking agents reduce tumor volume, aggressiveness, metastasis and increase the overall survival of the mice. This indicates that the blocking agents are capable of treating tumors and specifically those with limited glucose.

[0179] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.