FIELD OF THE INVENTION

The invention is in the field of microorganism/cell identification and isolation by means of microfluidic devices. It relates to a method for amplifying and detecting a nucleic acid sequence of interest from microorganisms or cells within microdroplets, wherein the microorganisms or cells survive the analysis method and can be isolated, re-grown and expanded thereafter.

BACKGROUND

Microbial resources, such as cell banks generated from patient samples, are essential to understand life sciences because microorganisms are crucial to maintain the inner ecosystem of humans, higher animals and plants.

Identifying and understanding the microorganisms at the strain level has a great impact in the field of health, biotechnology, agriculture, food technology and for research in the life sciences. With reference to the health, for example, this is an important issue as some strains, even within the same species, may be pathogenic for humans while others are not. Therefore, the differentiation between these two groups, pathogenic and non-pathogenic, is crucial in clinical microbiology and in medical and pharmaceutical treatment. Strain identification is important, for instance, in terms of selecting the appropriate drug (e.g. when a specific bacterial strain is resistant to a particular antibiotic).

In the last decade, microfluidic devices have been proposed as potential platforms for ultra-high throughput screening technologies, because of their properties of low sample consumption, low analysis costs, easy handling of picoliter volumes of liquids and their suitability for cell-based assays.

However, screening for, identifying and isolating particular microorganisms out of a huge diversity of an initial sample such as a cell bank is still a major challenge. So far, several approaches were used, all of which are time-consuming and costly.

Some have developed an approach to isolate and culture bacteria using the genomic information from a complex sample. They use a reverse genomic approach to predict cell surface proteins, designed antibodies which can bind to specific surface proteins, enabling isolation and regrowth of the strains bound to the designed antibodies (Cross et al., 2019, Nat Biotechnol, DOI: 10.1038/s41587-019-0260- 6). However, this approach requires specific knowledge and steps to design and produce such antibodies.

Others have described an integrated microfluidic workflow for genetically targeted cultivation and isolation of microorganisms (Ma et al., 2014, PNAS, 111 (27) 9768-9773). They designed a microfluidic device to generate micro-chambers of individually addressable replica microbial cultures. After growth of the bacteria, the micro-chambers were split into two identical copies. PCR was performed on the first copy to identify the location of the micro-chambers containing the targeted strain, and then the live cells were retrieved from the corresponding second copy of the micro-chambers for the scale-up cultivation.

The present invention, however, enables identification of strains' genomic elements within a microdroplet, whilst a large fraction of the contained microorganisms or cells stays alive. The present invention therefore enables magnitudes higher screening throughputs than Cross' and Ma's method. In most cases, screening requires the isolation and culture of microorganisms from which a sample is then retrieved to analyze the obtained strains by means of genotyping, i.e. using the polymerase chain reaction to identify certain microorganism-specific marker genes or by sequencing such genetic information. This is a time-consuming and costly undertaking as hundreds to thousands of isolates need to be screened by such methods. Therefore, it would be desirable to obtain a method with which live cultures could be directly screened for the presence of microorganism-specific marker genes or transcripts, followed by an optional isolation and expansion of microorganisms of interest from the vast diversity of the initial sample.

BRIEF DESCRIPTION OF THE INVENTION

The inventors have solved the above-mentioned problems by providing for the following solutions.

The invention relates to a microdroplet comprising:

(i) one or more cells and

(ii) reagents for performing an amplification reaction.

The invention relates to an amplification method comprising the steps of

(i) providing a microdroplet according to the invention and

(ii) performing an amplification reaction of the one or more nucleic acids in the microdroplet. The invention relates to a kit comprising:

(i) microfluidic chips or materials for preparing microfluidics chips,

(ii) reagents for creating microdroplets,

(iii) reagents for an amplification reaction,

(iv) optional primers for an amplification reaction, and optionally

(v) a manual.

The invention relates to a composition comprising multiple microdroplets in solution according to the invention as well as a microfluidic system comprising a composition according to the invention.

The invention relates to a method for performing a detection reaction in a microdroplet comprising one or more cells, one or more expressed gene products of one or more nucleic acid sequences and reagents for performing a detection reaction to detect the one or more expressed gene products.

The present invention provides a screening composition, method, kit and system that allows for the ultra-high throughput culture of diverse microbial samples and the isolation of specific microorganisms within this huge diversity based on their specific genotypic features without destroying the live microorganisms during and after screening.

The assay method relies on the finding that microbial cells or other cells release genetic information as deoxyribonucleic acid or ribonucleic acid into the culture medium in which they are growing or are maintained. The DNA released to the extracellular medium by cells is called extracellular DNA (eDNA). Different specific mechanisms are involved in eDNA release, such as autolysis, active secretion, and the association of eDNA with membrane vesicles. In microorganisms, in which DNA release has been studied in detail, the production of eDNA is coordinated by the population when it reaches a certain cell density, and is induced in a subpopulation in response to the accumulation of quorum sensing signals (Ibanez De Aldecoa et al., 2017, Front. Microbiol., DOI: 10.3389/fmicb.2017.01390). Bacillus subtilis, for example, shows a lytic-independent eDNA release mechanism, wherein the eDNA release is regulated by quorum sensing (Ibanez De Aldecoa et al., 2017, Front. Microbiol., DOI: 10.3389/fmicb.2017.01390). The biological functions of eDNA range from roles in biofilm formation or biofilm dispersal to defense mechanisms, DNA damage repair and horizontal gene transfer, for instance (Ibanez De Aldecoa etal., 2017, Front. Microbiol., DOI: 10.3389/fmicb.2017.01390). However, released genetic information has not been studied in the droplet-based microfluidic system. In this invention, the applicant inventively found that the deoxyribonucleic acid or ribonucleic acid in microfluidic droplets can present the genomic and transcriptomic information of the cells from the same droplets, and it can be applied to select out cells based on the strain/species-specific genomic and transcriptomic information. In order to identify the released genomic and transcriptomic information in the microfluidic droplets, the amounts released by the cells or present from e.g. a fraction of apoptotic cells in the culture can be detected by amplification methods such as PCR, RT- PCR, qPCR, qRT-PCR etc.. However, standard genetic amplification methods need high temperature which would kill the microbial cells. The present invention, however, employs amplification methods in the presence of complex culture media to sensitively and specifically identify the genotype of such microorganisms or cells under culture conditions without, unlike for standard PCR methods, the need to destroy the integrity of the microorganisms or cells in culture. The invention thus enables the isolation of live microorganisms or cells for further manipulation and/or storage for future re-growth from stored cultures. Such further usage of the isolated, living microorganisms or cells can comprise, but is not limited to, the characterization of the genetic material or transcriptome or peptidome of the isolated potential or predetermined pathogens, or the testing or screening for drug resistance and/or susceptibility.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the screening of live cells within microdroplets for the presence of one or more microorganism- or cell-specific nucleic acid sequences of interest, thus enabling for example the identification of a specific bacterial strain. A large fraction of said live cells survive the amplification and detection method and can be isolated for further usage or storage.

Studying microbiota and their symbiotic or pathogenic effects is of great importance for ecosystems, the health system and the pharmaceutical and cosmetic industry, for instance. Enabling the isolation of specific strains or species from a microbiota sample to study its symbiotic or pathogenic effects is still challenging. By using microdroplets and optimized culturing conditions, the applicant is able to generate a collection of diverse microorganisms from a microbiota sample, covering 80% of the initial sample diversity. To achieve this, the initial sample is diluted and single cells are encapsulated in microdroplets. Each of these microdroplets serves as a "microbioreactor", enabling expansion of the single cells therein. Using ultra-high throughput methods, the present invention enables screening of the microdroplets for the presence of strain-, species- or cell-specific genetic information encoded on nucleic acids or derivatives thereof by a method comprising amplification of low amounts of extracellular nucleic acids, detection of the amplicon and potential isolation of cells or microdroplets of interest.

The invention relates to a microdroplet comprising: (i) one or more cells and

(ii) reagents for performing an amplification reaction.

In a preferred embodiment said microdroplet is in a microfluidic system.

A "microdroplet" herein means a liquid droplet, wherein the basis for the liquid is preferably comprising a solution of hydrocarbons or water. The average volume of the microdroplet is less than 100 pl, preferably less than 1 pl, more preferably less than 50 nl, even more preferably 10 pl to 10 nl. The microdroplet according to the invention has a volume of 1 fl to 100 pl, 10 fl to 10 pl, 100 fl to 1 pl, 1 pl to 100 nl, 10 pl to 10 nl, 12 pl to 1 nl, 15 pl to 100 pl or 16 pl to 50 pl. The microdroplet artificially compartmentalizes cells and their released genetic elements, thereby keeping them physically linked, enabling amplification and detection of the genetic material within the microdroplet, ultimately enabling isolation of the live cells of interest. Therefore, in one embodiment of the invention, a singlecell microorganism or a single cell was clonally expanded in the microdroplet, thereby having released genetic material into the microdroplet compartment.

"One or more cells" in this context refers to a single microorganism, cell or viral particle that may or may not have been clonally expanded within said microdroplet. In more detail, the term "cells" corresponds to bacterial cells, viruses, archaeal cells, fungal cells, yeast cells, mammalian cells, plant cells, other eukaryotic cells, other prokaryotic cells or microorganisms. These cells release genetic material during cultivation. Therefore, in one embodiment of the invention, the one or more cells are selected from the group comprising bacterial cells, viruses, archaeal cells, fungal cells and other prokaryotic and eukaryotic cells. These cells release genetic material during cultivation within said microdroplet. Preferably, "more cells" refers to a plurality of cells that are a result of a clonal expansion of a single cell, wherein the clonal expansion preferably occurred within said microdroplet.

"Reagents" herein means a mixture of components needed to perform an amplification reaction, wherein the mixture comprises, but is not limited to, a buffered solution, such as, but not limited to, a rehydration buffer, a polymerase, primers, optionally a recombinase, optionally an exonuclease, optionally one or more single-strand binding proteins, optionally Mg(OAc)2 and optionally a probe.

Therefore, in one embodiment of the invention, the reagents for performing the amplification the amplification reaction, which are comprised within the microdroplet, comprise a rehydration buffer, primers, Mg(OAc)2, a recombinase, a polymerase, an exonuclease, a single-strand binding protein and optionally a probe. In another embodiment of the invention, the amplification reaction reagents, which are comprised within the microdroplet, are selected from reagents needed to perform a polymerase chain reaction (PCR) or variants thereof, a signal mediated amplification of RNA technology (SMART), a strand displacement amplification (SDA), a transcription mediated amplification (TMA), a single primer isothermal amplification (SPIA), a self-sustained sequence replication (3 SR), a nicking enzyme amplification reaction (NEAR), a multiple displacement amplification (MDA), a loop mediated isothermal amplification (LAMP), a helicase-dependent amplification (HDA), a rolling circle amplification (RCA), a nucleic acid sequence-based amplification (NASBA) or a recombinase polymerase amplification (RPA). Preferably, the amplification reaction reagents, which are comprised within the microdroplet, are reagents for performing a recombinase polymerase amplification (RPA).

In one embodiment of the invention, the reagents for performing an amplification reaction are added to a microdroplet comprising said one or more cells by at least one injection, the method preferably being performed by a person skilled in the art using a microfluidic device. By injection and subsequent gentle mixing, said microdroplet is generated.

In another embodiment of the invention, the reagents for performing an amplification reaction are added to a microdroplet comprising said one or more cells by fusion or merging of the aforementioned microdroplet comprising said one or more cells with at least one other microdroplet comprising the reagents needed to perform said amplification reaction, the method preferably being performed by a person skilled in the art using a microfluidic device. By fusion or merging and subsequent gentle mixing, said microdroplet is generated.

The invention relates to an amplification method comprising the steps of:

(i) providing a microdroplet according to the invention and

(ii) performing an amplification reaction of the one or more nucleic acids in the microdroplet.

The amplification reaction is performed on one or more nucleic acid sequences, wherein the term "nucleic acid sequence" refers to genetic information encoded by any natural or artificial analogue of a nucleic acid sequence of interest or a microorganism- or cell-specific sequence of ribonucleic acid and/or deoxyribonucleic acid present in the culture of said microorganism or cell, wherein another deoxyribonucleic acid was created from said ribonucleic acid through a prior or concurrent reversetranscription reaction. The nucleic acid component of the genetic information may moreover be linked, covalently or non-covalently, to one or more molecules or structures, including proteins, chemical entities and groups, solid-phase supports such as magnetic beads, and the like. In the present invention, these structures or molecules can be designed to assist in the amplification and/or detection and/or sorting and/or isolation of the genetic element. The genetic information can also refer to the products encoded by the one or more nucleic acid sequences.

Ideally the amplification reaction is a non-isothermal amplification reaction, such as polymerase chain reaction (PCR) and variants thereof, or an isothermal amplification reaction such as signal mediated amplification of RNA technology (SMART), strand displacement amplification (SDA), transcription mediated amplification (TMA), single primer isothermal amplification (SPIA), self-sustained sequence replication (3 SR), nicking enzyme amplification reaction (NEAR), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), nucleic acid sequence-based amplification (NASBA), or preferably a recombinase polymerase amplification (RPA). The amplification reaction is performed between 4°C and 95°C, preferably between 10°C and 65°C, more preferably between 20°C and 58°C, even more preferably between 32°C and 48°C, even more preferably between 37°C and 42°C and most preferably at 37°C. Further, the amplification reaction takes between 5 and 180 minutes, preferably between 10 and 120 minutes, more preferably between 15 and 60 minutes, even more preferably between 20 and 45 minutes and most preferably 30 minutes.

Ideally and most preferably, the reaction is a recombinase polymerase amplification (RPA) reaction.

The RPA reaction (Piepenburg, Olaf, Williams, Colin H.; Stemple, Derek L.; Armes, Niall A. (2006), "DNA Detection Using Recombination Proteins". PLOS Biology 4 (7)) employs three core enzymes - a recombinase, a single-strand DNA-binding protein (SSB) and a strand-displacing polymerase. Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA. SSBs bind to displaced strands of DNA and prevent the primers from being displaced. Finally, the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two opposing primers, much like PCR, if the target sequence is indeed present, an exponential DNA amplification reaction is initiated. No other sample manipulation such as thermal or chemical melting is required to initiate amplification. At optimal temperatures the reaction progresses rapidly and results in specific DNA amplification from just a few target copies to detectable levels, typically within 10 minutes, for rapid detection of e.g. viral genomic DNA or RNA, bacterial genomic DNA, as well as short length aptamer DNA. The three core RPA enzymes can be supplemented by further enzymes to provide extra functionality. Addition of exonuclease III allows the use of an exo probe for real-time, fluorescence detection akin to real-time PCR. Addition of endonuclease IV means that a nfo probe can be used for lateral flow strip detection of successful amplification. If a reverse transcriptase is added, then RNA can be reverse transcribed and the cDNA produced amplified all in one step. Currently only the TwistAmp exo version of RPA is available with the reverse transcriptase included, although users can simply supplement other TwistAmp reactions with a reverse transcriptase to produce the same effect. As with PCR, all forms of RPA reactions can be multiplexed by the addition of further primer/probe pairs, allowing the detection of multiple analytes or an internal control in the same tube, see Wikipedia. RecA recombinase protein, or its prokaryotic and eukaryotic relatives coat single-stranded DNA (ssDNA) to form filaments, which then scan double-stranded DNA (dsDNA) for regions of sequence homology. When homologous sequences are located, the nucleoprotein filament strand invades the dsDNA creating a short hybrid and a displaced strand bubble known as a D-loop. The free 3'-end of the filament strand in the D-loop can be extended by DNA polymerases to synthesize a new complementary strand. The complementary strand displaces the originally paired strand as it elongates. By utilizing pairs of oligonucleotides in a manner similar to that used in PCR it is possible to amplify low amount of target DNA sequences in an analogous fashion but without any requirement for thermal melting (thermocycling). This has the advantage both of allowing the use of heat labile polymerases previously unusable in PCR, and increasing the fidelity and sensitivity by template scanning and strand invasion instead of hybridization. Other amplification methods that can be performed on low amounts of extracellular target nucleic acids within microdroplets and which can be performed under conditions enabling survival of enough cells for further cultivation thereof, are also covered within the scope of the present invention.

Exemplarily, the RPA reaction may be performed as follows: Bacillus subtilis is cultured in LB medium at 37°C over night prior to the RPA reaction. The RPA mixture is composed of 29.5 pL of primer-free rehydration buffer, 2.4 pL of each primer (10 pM) and 0.6 pL of probe (10 pM). Then the mixture is added to a freeze-dried pellet tube with a mixture of recombinase, Bsu polymerase, Exonuclease III and single strand binding protein Gp32. 2.5 pL of Mg(OAc)2 (280 mM) is added to the pellet tube. The tube is centrifuged prior to the RPA reaction. Then RPA reaction is performed at 39°C for 30 mins on a real-time PCR instrument.

Forward primer (SEQ ID 1): CCTTAATTTCTCCGAGAACTTCATATTCAAGCGTC

Reverse primer (SEQ ID 2): ACGGCATTAACAAACGAACTGATTCATCTGCTTGG

Probe (SEQ ID 3, 4): TTCTTCAATCATTTCAAAGACACGG/iFluorT/C/idSD//iBHQ-ldT/ACTTCTGTA AGCTTA where /iFluorT/ presents the fluorophore, /idSp/ presents the tetrahydrofuran (THF) spacer, and /iBHQ-ldT/ presents the probe quencher. The underlined parts of the probe above indicate SEQ ID 4, which is part of SEQ ID 3 as disclosed in the priority application EP22154846.4, but SEQ ID 3 needed to be "split" in the present sequence protocol according to WIPO standard ST.26.

In a further aspect and preferably, said amplification reaction is performed in a microfluidics system. This allows for manipulation of the microdroplet and the amplification reaction. Preferably, said amplification reaction is performed in at least one, preferably at least 1,000, more preferably at least 100,000, even more preferably at least 10,000,000, most preferably at least 10,000,000,000 microdroplets in parallel or sequentially within or outside of a microfluidic device. The number of microdroplets according to the invention are within the range of, 1 to 100,000,000,000, 1 to 10,000,000,000, 1 to 1,000,000,000, 1 to 100,000,000, 1 to 10,000,000, 1 to 1,000,000, 1 to 100,000, 1 to 10,000 or 1 to 1,000.

Preferably, the amplification method is performed in a microfluidics system.

Preferably, the amplification reaction is performed in 1 to 100,000,000,000 , 1 to 10,000,000,000 , 1 to 1,000,000,000 , 1 to 100,000,000 , 1 to 10,000,000 , 1 to 1,000,000 , 1 to 100,000 , 1 to 10,000 or 1 to 1,000 microdroplets in parallel.

In one embodiment, said amplification reaction additionally comprises barcoding the one or more nucleic acid sequences during amplification.

The invention relates to a composition comprising multiple of said microdroplets in solution.

The invention further relates to a microfluidic system comprising the composition according to the invention.

In one embodiment, said microfluidic system is used for performing said amplification reaction, used to

(i) amplify one or more nucleic acid sequences or any natural or artificial analogue of one or more nucleic acid sequences of interest,

(ii) additionally detect one or more amplicons and

(iii) additionally potentially isolate single microdroplets from a composition comprising multiple of said microdroplets in solution.

In one embodiment, the microfluidic system according to the invention for performing the amplification method according to the invention, is used to

(i) amplify one or more nucleic acid sequences or any natural or artificial analogue of one or more nucleic acid sequences of interest,

(ii) additionally detect one or more amplicons and

(iii) additionally potentially isolate single microdroplets from a composition according to the invention. In one embodiment, detection of the nucleic acid sequence of interest within said microfluidic system comprises the use of a probe or a guiding molecule or a peptide or a protein or derivatives of the aforementioned components specific to the nucleic acid sequence of interest, all of which are directly or indirectly associated with a fluorophore.

In one embodiment, detection of the nucleic acid sequence of interest within said microfluidic system comprises the use of a probe and/or a guiding molecule and/or a peptide and/or a protein and/or derivatives of the aforementioned components specific to the nucleic acid sequence of interest, all of which are directly or indirectly associated with a fluorophore.

In one embodiment, at least 10 % of cells, preferably 40 % of cells, more preferably 60 % of cells survive the amplification, the detection and the potential isolation step within said microfluidic system, which is sufficient for further cultivation and expansion of surviving cells.

In a further aspect, the present invention relates to an amplification kit comprising:

(i) microfluidics chips or materials for preparing microfluidics chips,

(ii) reagents for creating microdroplets,

(iii) reagents for an amplification reaction,

(iv) optional primers for an amplification reaction, and

(v) a manual.

In a further aspect, the present invention relates to a kit comprising:

(i) microfluidics chips or materials for preparing microfluidics chips,

(ii) reagents for creating microdroplets,

(iii) reagents for an amplification reaction,

(iv) optional primers for an amplification reaction, and

(v) a manual.

The term "optional" means that the primers may be added separately and that they do not necessarily need to be included in the kit. The "reagents for an amplification reaction" comprise at least one, preferably at least two, even more preferably at least three, most preferably all of the reagents described for the present invention, although the concentration may differ. In one embodiment, the reagents for performing the amplification comprise a rehydration buffer, Mg(OAc)2, a recombinase, a polymerase, an exonuclease, a single-strand binding protein and optionally a probe and primers. Preferably, the kit accordingly is used for an amplification reaction in at least one, preferably at least 1,000, more preferably at least 100,000, even more preferably at least 10,000,000, most preferably at least 10,000,000,000 microdroplets in parallel or sequentially within or outside of a microfluidic device. The number of microdroplets according to the invention are within the range of, 1 to 100,000,000,000, 1 to 10,000,000,000, 1 to 1,000,000,000, 1 to 100,000,000, 1 to 10,000,000, 1 to 1,000,000, 1 to 100,000, 1 to 10,000 or 1 to 1,000.

In another aspect, the invention also relates to a method comprising the steps of:

(i) providing a composition comprising multiple microdroplets in solution, wherein single-cell microorganisms or single cells were compartmentalized into the microdroplets,

(ii) clonally expanding said single-cell microorganisms or single cells within the microdroplets, wherein a plurality of nucleic acids are released by the microorganisms or cells during expansion,

(iii) performing an amplification reaction on one or more of the plurality of nucleic acids within each of the microdroplets according to step (ii), wherein the one or more nucleic acids are markers for one or more microorganisms or cells of interest,

(iv) detecting the one or more amplicons generated in step (iii), and

(v) isolating one or more of the microdroplets for which one or more amplicons were detected in step (iv), wherein at least 10% of the microorganisms or cells survive all of the method steps, wherein optionally, the microorganisms or cells within the isolated one or more microdroplets of step (v) are subsequently isolated from the one or more isolated microdroplets and are optionally expanded for further usage or stored for further usage.

In one embodiment, the single-cell microorganisms or single cells were compartmentalized into at least 0.001%, at least 0.01%, at least 0.1%, or at least 0.5%, or at least 1%, or at least 5%, or at least 8%, or at least 10%, or at least 15%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90% of the microdroplets.

In one embodiment, the further usage of the microorganisms or cells within the isolated microdroplets can comprise, but is not limited to, the further isolation of the microorganisms or cells from the one or more microdroplets and the characterization of their genetic material or transcriptome or peptidome, wherein the isolated microorganisms or cells are potential pathogens or predetermined pathogens. Alternatively or additionally, the isolated microorganisms or cells can be used for the testing or screening for drug resistance and/or susceptibility.

Also, in one embodiment, the isolated microdroplets comprising the microorganisms or cells of interest, can be broken and the included microorganisms or cells may be further cultivated and/or expanded and/or stored independently of microdroplets, for example on agar plates or cell culture dishes.

In one embodiment, at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 65%, or at least 70%, or at least 80%, or at least 90% of the microorganisms or cells survive all of the method steps.

Preferably at least 10%, more preferably 40%, even more preferably 60% of the microorganisms or cells survive all of the method steps.

In one embodiment of the invention, the composition comprising multiple microdroplets may comprise a diverse pool of variants of the same microorganism or cell species or strain as compared to the one from the isolated microdroplet. Therefore, the one or more isolated microdroplets can comprise a specific target microorganism or cell species of interest, which was isolated from a diverse pool of variants of the same microorganism or cell species or strain.

In another embodiment, the composition comprising multiple microdroplets may comprise a diverse pool of different kinds of microorganisms or cell species as compared to the one from the isolated microdroplet. Therefore, in a preferred embodiment, the one or more isolated microdroplets can comprise a specific target microorganism or cell species of interest, which was isolated from a diverse pool of different kinds of microorganisms or cell species.

The amplification reaction is performed on one or more of the plurality of nucleic acids, wherein the term "one or more of the plurality of nucleic acids" as used herein can be used synonymously with the term "one or more nucleic acid sequences" and generally refers to one or more nucleic acid molecules or sequences of interest within a plurality of nucleic acid molecules or sequences, which were released by the cells or microorganisms within the microdroplets. The terms may also refer to genetic information encoded by any natural or artificial analogue of a nucleic acid sequence of interest or a microorganism- or cell-specific sequence of ribonucleic acid and/or deoxyribonucleic acid present in the culture of said microorganism or cell, wherein another deoxyribonucleic acid was created from said ribonucleic acid through a prior or concurrent reverse-transcription reaction. The nucleic acid component of the genetic information may moreover be linked, covalently or non-covalently, to one or more molecules or structures, including proteins, chemical entities and groups, solid-phase supports such as magnetic beads, and the like. In the present invention, these structures or molecules can be designed to assist in the amplification and/or detection and/or sorting and/or isolation of the genetic element. The genetic information can also refer to the products encoded by the one or more nucleic acid sequences.

Ideally the amplification reaction is a non-isothermal amplification reaction, such as polymerase chain reaction (PCR) and variants thereof, or an isothermal amplification reaction such as signal mediated amplification of RNA technology (SMART), strand displacement amplification (SDA), transcription mediated amplification (TMA), single primer isothermal amplification (SPIA), self-sustained sequence replication (3 SR), nicking enzyme amplification reaction (NEAR), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), nucleic acid sequence-based amplification (NASBA), or preferably a recombinase polymerase amplification (RPA). The amplification reaction is performed between 4°C and 95°C, preferably between 10°C and 65°C, more preferably between 20°C and 58°C, even more preferably between 32°C and 48°C, even more preferably between 37°C and 42°C and most preferably at 37°C. Further, the amplification reaction takes between 5 and 180 minutes, preferably between 10 and 120 minutes, more preferably between 15 and 60 minutes, even more preferably between 20 and 45 minutes and most preferably 30 minutes.

Ideally and most preferably, the reaction is a recombinase polymerase amplification (RPA) reaction.

In a further aspect and preferably, said amplification reaction is performed in a microfluidics system. This allows for manipulation of the microdroplet and the amplification reaction. Preferably, said amplification reaction is performed in at least one, preferably at least 1,000, more preferably at least 100,000, even more preferably at least 10,000,000, most preferably at least 10,000,000,000 microdroplets in parallel or sequentially within or outside of a microfluidic device. The number of microdroplets according to the invention are within the range of, 1 to 100,000,000,000, 1 to 10,000,000,000, 1 to 1,000,000,000, 1 to 100,000,000, 1 to 10,000,000, 1 to 1,000,000, 1 to 100,000, 1 to 10,000 or 1 to 1,000.

Preferably, the amplification method is performed in a microfluidics system. Preferably, the amplification reaction is performed in 1 to 100,000,000,000 , 1 to 10,000,000,000 , 1 to 1,000,000,000 , 1 to 100,000,000 , 1 to 10,000,000 , 1 to 1,000,000 , 1 to 100,000 , 1 to 10,000 or 1 to 1,000 microdroplets in parallel.

In one embodiment, said amplification reaction additionally comprises barcoding the one or more nucleic acid sequences during amplification.

In one embodiment, the invention relates to a method comprising the steps of:

(i) compartmentalizing microorganisms or cells into microdroplets, preferably single cells thereof,

(ii) optionally clonally expanding said single-cell microorganism or single cell within said microdroplets,

(iii) amplifying one or more nucleic acid sequences of interest or any natural or artificial analogue of one or more nucleic acid sequences of interest,

(iv) detecting one or more amplicons and

(v) optionally isolating microdroplets from a composition comprising multiple microdroplets in solution, wherein each of the microdroplets contains a clonally expanded single-cell microorganism or a clonally expanded single cell.

"Compartmentalizing" in the context of the present invention relates to a method performed by a person skilled in the art, comprising the generation of microdroplets, whereby at least some microdroplets comprise at least one single cell, preferably one single cell.

"Clonally expanding" means that said compartmentalized single cell in said microdroplet is cultured in a growth-promoting environment under growth-promoting conditions, thereby enabling replication of said single cell.

"Isolating microdroplets" in the context of the present invention means isolating microdroplets of interest from a composition comprising multiple microdroplets, wherein each of the microdroplets contains a clonally expanded single-cell microorganism or single cell. In one embodiment of the invention, isolation may be reached by FACS or microfluidic sorting, while the majority of the microorganism or cells are and remain alive.

In one embodiment, the single-cell microorganisms or single cells were compartmentalized into at least 0.001%, at least 0.01%, at least 0.1%, or at least 0.5%, or at least 1%, or at least 5%, or at least 8%, or at least 10%, or at least 15%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90% of the microdroplets. In one embodiment, the further usage of the microorganisms or cells within the isolated microdroplets can comprise, but is not limited to, the further isolation of the microorganisms or cells from the one or more microdroplets and the characterization of their genetic material or transcriptome or peptidome, wherein the isolated microorganisms or cells are potential pathogens or predetermined pathogens. Alternatively or additionally, the isolated microorganisms or cells can be used for the testing or screening for drug resistance and/or susceptibility.

In one embodiment, at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 65%, or at least 70%, or at least 80%, or at least 90% of the microorganisms or cells survive all of the method steps.

Preferably at least 10%, more preferably 40%, even more preferably 60% of the microorganisms or cells survive all of the method steps.

In one embodiment of the invention, the composition comprising multiple microdroplets may comprise a diverse pool of variants of the same microorganism or cell species or strain as compared to the one from the isolated microdroplet. Therefore, the one or more isolated microdroplets can comprise a specific target microorganism or cell species of interest, which was isolated from a diverse pool of variants of the same microorganism or cell species or strain.

In another embodiment, the composition comprising multiple microdroplets may comprise a diverse pool of different kinds of microorganisms or cell species as compared to the one from the isolated microdroplet. Therefore, in a preferred embodiment, the one or more isolated microdroplets can comprise a specific target microorganism or cell species of interest, which was isolated from a diverse pool of different kinds of microorganisms or cell species.

In one embodiment, the isolated microdroplets comprising the microorganisms or cells of interest, can be broken and the included microorganisms or cells may be further cultivated and/or expanded and/or stored independently of microdroplets, for example on agar plates or cell culture dishes.

Detection of the amplicon may comprise direct or indirect fluorescent and/or chemical labelling and/or peptide- or protein-based labelling of the amplicon by a composition comprising one or more of the following: probes and/or guiding molecules and/or proteins and/or peptides and/or nucleic acids and/or solid-phase supports, such as magnetic beads, and/or derivatives of the aforementioned listed components. The aforementioned composition enables detection of one or more amplicons that were generated by a prior amplification reaction performed according to the invention. The aforementioned composition may further assist in the sorting and/or isolation of a genetic element potentially encoding a gene product of interest, or of the microdroplet comprising the cells of interest.

In cases where the one or more of the plurality of nucleic acids, which are markers for one or more microorganisms or cells of interest, are present in amounts sufficiently high to be detectable, amplification might not be needed and can be skipped, so that detection can occur on the one or more non-amplified nucleic acids.

Within the scope of the present invention, said detection method can also be independent of an amplicon, but can instead also relate to the detection of non-amplified nucleic acids, or peptides encoded by said nucleic acids or proteins encoded by said nucleic acids, wherein the detection is enabled by other nucleic acids used as reporters or guide molecules, peptides or proteins or a combination of the aforementioned using an appropriate detection reaction. The person skilled in the art is aware of numerous methods for detection of the aforementioned molecules.

Thus, in another aspect, the invention also relates to a method comprising the steps of:

(i) providing a composition comprising multiple microdroplets in solution, wherein single-cell microorganisms or single cells were compartmentalized into the microdroplets, optionally wherein said single-cell microorganisms or single cells are subsequently clonally expanded within the microdroplets,

(ii) release of a plurality of nucleic acids by the microorganisms or cells into the microdroplets,

(iii) detecting one or more of the plurality of nucleic acids, wherein the one or more nucleic acids are markers for one or more microorganisms or cells of interest, and

(iv) isolating one or more of the microdroplets for which one or more of the plurality of nucleic acids were detected in step (iii), wherein at least 10% of the microorganisms or cells survive all of the method steps, wherein optionally, the microorganisms or cells within the isolated one or more microdroplets of step (iv) are subsequently isolated from the one or more isolated microdroplets and are optionally expanded for further usage or stored for further usage.

In one embodiment, the detection of amplified or non-amplified nucleic acid sequences comprises binding and hydrolysis or cleavage of a nucleic acid probe which comprises a fluorophore and a quencher, thereby effectively separating the quencher and the fluorophore leading to a fluorescent signal in the presence of the specific nucleic acid sequence. In one embodiment, the probe used for detection of amplified or non-amplified nucleic acid sequences is designed according to the clustered regularly interspaced short palindromic repeats (CRISPR) system, comprising at least one nucleic acid molecule and a CRISPR-associated (Cas) protein or derivatives thereof.

In one embodiment, the amplified or non-amplified nucleic acid sequences are detected by direct or indirect binding to chemicals, other nucleic acids and derivatives thereof, one or more peptides, one or more proteins or solid-phase supports or combinations thereof.

The present invention further relates to a method for performing a detection reaction in a microdroplet comprising one or more cells, one or more expressed gene products of one or more nucleic acid sequences and reagents for performing a detection reaction to detect the one or more expressed gene products.

The term "expressed gene products" refers to ribonucleic acids or peptides or proteins expressed from genetic material of the one or more cells within the microdroplet.

The term "detection reaction" in the present invention further means direct or indirect fluorescent and/or chemical labelling and/or radioactive labelling and/or peptide- or protein-based labelling of the expressed gene products by a composition comprising one or more of the following: probes; guiding molecules; proteins, such as antibodies; peptides; nucleic acids; solid-phase supports, such as magnetic beads; binding molecules which are labelled with fluorophores or chemicals or radioactive markers; peptides; proteins; enzymes; nanobodies; antibodies or derivatives thereof; colorimetric enzyme substrates; aptamers; or derivatives of the aforementioned listed components.

The term "detection reaction" in the present invention can also refer to other methods that enable detection of expressed gene products, whereby the detection reaction can comprise, but is not limited to, one or more of the following methods: mass-spectrometry, liquid chromatography-mass spectrometry (LC-MS), high performance liquid chromatography-mass spectrometry (HPLC-MS), image-based analyses, electro-chemical analyses and/or thermal analyses.

The terms "microdroplet", "one or more cells", "nucleic acid sequences" are identical to the explanations thereof in above paragraphs of the present patent application.

"Reagents for performing a detection reaction" comprise, but are not limited to, fluorophores, chemicals, radioactive markers, probes, guiding molecules, nucleic acids, solid-phase supports, binding molecules which are labelled with fluorophores or chemicals or radioactive markers, peptides, proteins, enzymes, nanobodies, antibodies or derivatives thereof, colorimetric enzyme substrates, or aptamers used to directly or indirectly label the expressed gene product, thus enabling the detection reaction. In one embodiment, the method for performing said detection reaction comprises performing the detection reaction in a microfluidic system.

In one embodiment, the method for performing said detection reaction refers to the detection of said expressed gene products by other nucleic acids, peptides or proteins, such as antibodies and derivatives thereof, or by other enzymatic or non-enzymatic assays that enable detection.

In one embodiment, the method for performing said detection reaction is performed in at least one, preferably at least 1,000, more preferably at least 100,000, even more preferably at least 10,000,000, most preferably at least 10,000,000,000 microdroplets in parallel or sequentially within or outside of a microfluidic device. The number of microdroplets according to the invention are within the range of, 1 to 100,000,000,000, 1 to 10,000,000,000, 1 to 1,000,000,000, 1 to 100,000,000, 1 to 10,000,000, 1 to 1,000,000, 1 to 100,000, 1 to 10,000 or 1 to 1,000.

EXAMPLES

The examples described within this invention are for the purpose of facilitating understanding of the present invention only and are not to be construed as limiting the scope of the invention in any way.

Example 1

In the prove of concept (POC) experiment, b. subtilis suspension precultured overnight was diluted with LB to around 0.1 cells per microdroplet. The diluted b. subtilis suspension was encapsulated into microdroplets. The microdroplet size was 22 pL. The microdroplets were collected and incubated at 37°C overnight. During the incubation, DNA fragments were released by the bacterial cells and remained in microdroplets.

The targeted DNA fragments were amplified by recombinase polymerase amplification (RPA) and detected by the fluorescence generated by RPA's probe. The RPA primers and probe were designed based on the SpoB gene which is specific to b. subtilis. The sequences of primers and probe for b. subtilis are listed below:

Forward primer (SEQ ID 1): CCTTAATTTCTCCGAGAACTTCATATTCAAGCGTC

Reverse primer (SEQ ID 2): ACGGCATTAACAAACGAACTGATTCATCTGCTTGG

Probe (SEQ ID 3, 4): TTCTTCAATCATTTCAAAGACACGG/iFluorT/C/idSD//iBHQ-ldT/ACTTCTGTA AGCTTA where /iFluorT/ presents the fluorophore, /idSp/ presents the tetrahydrofuran (THF) spacer, and /iBHQ-ldT/ presents the probe quencher. The underlined parts of the probe above indicate SEQ ID 4, which is part of SEQ ID 3 as disclosed in the priority application EP22154846.4, but SEQ ID 3 needed to be "split" in the present sequence protocol according to WIPO standard ST.26.

In order to trigger the RPA reaction in microdroplets, 4.4 pl of 280 mM Mg(OAc)2 and 60.9 pl of RPA master mixture were added to each microdroplet sequentially. The RPA master mixture was prepared by mixing 29.5 pL of primer free rehydration buffer, 2.4 pL of each primer (10 pM) and 0.6 pL probe (10 pM). Then, the total mixture was added to a tube with freeze-dried pellet to make the RPA master mixture ready.

After addition of Mg(OAc)2 and RPA master mixture, the microdroplets were incubated at 37°C for 30 mins. Then the microdroplets were imaged under a fluorescence microscope. As shown in Fig. 1, one microdroplet containing grown b. subtilis has green fluorescence signal significantly higher than other microdroplets without bacteria. Following imaging, the microdroplets are broken and b. subtilis are able to regrow on an LB agar plate.

The data from the prove of concept experiment indicate that this invention enables identification of a specific strain based on its released genetic information within microdroplets while the strain survives the POC experiment and can be re-grown thereafter.

Example 2

Reagents

Bacteria

Escherichia coli MG1655, DSMZ (cat. no. 18039)

Bacillus subtilis 168, DSMZ (cat. no. 402)

Molecular reagents

PrimeTime® Gene Expression Master Mix, IDT Ref# 1055770

TwistDx TwistAmp® exo kit

Primers and probes ordered from IDT

Mg(OAc)2, Sigma 63052, aliquoted 280 mM in DNA-free H2O, stored at -20°C.

The fluorophore used within the probes was fluorescein.

The fluorinated surfactant used was provided by RAN Biotechnologies (Ref#: 008-FluoroSurfactant). Primers

Primers were ordered from IDT.

Primers and probes used to amplify and detect nucleic acids released by B. subtilis

SpoOB gene (https://www.ncbi.nlm.nih.gov/gene/935956): CTAGTCCAACCCAATTTCAATCAGACATTCGTGACTCGTGATTTCAAAACGCATGATATC AACGTCCTCATATCC ATTCTGCCGAATATCATCAAAAGCAGATGGATCGGCAAAGGCGCCGTGAAAATCAAGGTA CAGAATCAGCTGT CTGTCAGGATGATCCGTTTGAAGCGAAACCGTTAAATGATTTTCACTCTCTCTGCTGACT GCTTGATCAAACAG

ATGAAACAGCTTTCTCATCAGTTTCGCCAGCTTTTGATCATAAGCCGACAAATCCTT AATTTCTCCGAGAACTTC ATATTCAAGCGTCATATAATGGGTTTTCCAATTAAACGTAAGAAAATCAAACGCCAAATG CGGTGTTTTCAGGT TTGAGAGCTTTGATTCGTGCTTTGCGTCTATAACCATTTCTTCAATCATTTCAAAGACAC GGTCATACTTCTGTAA GCTTAAGTTTCCTTTAATCAGCTGCAGCTTATTCATCCAATCATGCCGGGAATGGCCAAG CAGATGAATCAGTT CGTTTGTTAATGCCGTGTCGCTTATATTTTCTTCTTGATTTTTTGAAACATCCTTCAT (SEQ ID 5)

Forward primer: CCTTAATTTCTCCGAGAACTTCATATTCAAGCGTC (SEQ ID 1)

Reverse primer: ACGGCATTAACAAACGAACTGATTCATCTGCTTGG (SEQ ID 2) bp=262

Probe: TTCTTCAATCATTTCAAAGACACGG/iFluorT/C/idSp//iBHQ-ldT/ACTTCTGTA AGCTTA/3SpC3/

(SEQ ID 6, 7) where /iFluorT/ presents the fluorophore, /idSp/ presents the tetrahydrofuran (THF) spacer, /iBHQ- ldT/ presents the probe quencher, and /3SpC3/ presents the C3 spacer. The underlined parts of the probe above indicate SEQ ID 7, which forms a probe in conjunction with SEQ ID 6 (SEQ ID 6 represents the non-underlined part of the above probe).

Experimental procedure

Encapsulation of Bacillus subtilis (B. subtilis) and Escherichia coli (E. coli) bacteria into droplets

B. subtilis and E. coli were inoculated and cultured in tubes over night prior to the experiment. The next day, B. subtilis and E. coli were mixed to 1:10 and diluted to 0.2 cel l/20pL. As a control, 100 pL of the bacterial mixture were streaked on a plate before the microfluidic experiments to validate by colony PCR that both bacterial strains were present in the mixture.

The bacterial mixture was loaded onto a droplet generation chip and encapsulated into microfluidic droplets as a described microfluidic workflow (Mazutis, L., Gilbert, J., Ung, W. et al. Single-cell analysis and sorting using droplet-based microfluidics. Nat Protoc 8, 870-891 (2013). https://doi.org/10.1038/nprot.2013.046). In brief, HFE7500 containing 2.5% (w/w) fluorinated surfactant was used as the oil phase. The bacterial mixture added with 0.05% (v/v) of lOmM sulforhodamine was used as the aqueous phase. The flow rate of the oil phase was 650 pL/h and the flow rate of the aqueous phase was 600 pL/h. The generated droplet size was 25 pL. The droplets were collected in a 1.5 mL tube filled with HFE7500 containing 0.5% (w/w) fluorinated surfactant. Around 10 million droplets were collected. After the droplet generation, the droplets were incubated at 37°C for 3 hours to allow growth of bacteria in droplets.

After 3 hours incubation, the droplets were added with 280 mM Mg(OAc)2 as described microfluidic workflows (Proceedings of the National Academy of Sciences 106(34):14195-200, DOI: 10.1073/pnas.0903542106). Briefly, the incubated droplets were loaded into a droplet fusion chip, then spaced by HFE7500 containing 0.5% (w/w) fluorinated surfactant then fused with 280 mM Mg(OAc)2. The flow rate of the droplets was 250 pL/h. The flowrate of HFE7500 was 220 pL/h. The flow rate of Mg(OAc was 70 pL/h. After adding Mg(OAc)2, the droplets were collected.

As shown in figure 2, which was taken from a movie, the bacteria occupancy is around 10%.

Preparation of RPA master mix

PCR tubes = 4;

50 pl per PCR tube.

The master mix for RPA exo was prepared and 34.9 pl were aliquoted to each pellet tube. They were mixed well by ultrasonication for 10 mins with ice.

Adding of RPA master mix by picoinjection chip

After addition of Mg(OAc)2 into the droplets, the droplets were added with the prepared master mix of RPA exo as described microfluidic workflows (Proceedings of the National Academy of Sciences 106(34):14195-200, DOI: 10.1073/pnas.0903542106). Briefly, the incubated droplets were loaded into a droplet fusion chip, then spaced by HFE7500 containing 0.5% (w/w) fluorinated surfactant then fused with the master mix of RPA exo. The flow rate of the droplets was 70 pL/h. The flowrate of HFE7500 was 400 pL/h. The flow rate of the master mix of RPA exo was 100 pL/h. After adding the RPA mix, the droplets were incubated at 38°C for up to 3 hours.

Droplet sorting of the RPA droplets

Followed by the incubation, the droplets were sorted according to a standard microfluidic workflow (Mazutis, L., Gilbert, J., Ung, W. et al. Single-cell analysis and sorting using droplet-based microfluidics. Nat Protoc 8, 870-891 (2013). https://doi.org/10.1038/nprot.2013.046). In brief, the droplets were loaded into a microfluidic sorting chip and spaced by two spacing oil. HFE7500 was used as spacing oil in this experiment. The flow rate of droplets was 30 pL/h. The flow rate of the spacing oil 1 was 200 pL/h. The flow rate of the spacing oil 2 was 350 pL/h.

A blue laser (wavelength = 488 nm, 10 mW) and a yellow laser (wavelength = 561 nm, 10 mW) were aligned and focused into the microfluidic sorting chip. The droplets passed through the focused laser point in the microfluidic channel, and their excited fluorescence signal was recorded by photomultiplier tubes (PMTs). Green fluorescence indicates a successful RPA reaction in the particular droplet. Sulforhodamine is a red fluorescent dye and serves as a marker for the droplets (see figure 3A, figure 3B).

Figure 3A depicts voltage (V) over time (ms). Each of the four spikes shown in figure 3A indicates that a droplet emitting red (PMT 4) and/or green fluorescence (PMT2) is detected.

Figure 3B shows the gate setting used to select and sort out green and red fluorescent droplets.

The droplets were observed after sorting.

As shown in figure 4, droplets with fluorescence were successfully selected. Figure 4 also shows a fluorescent droplet comprising bacteria. This data confirms that the present invention successfully selects for droplets based on the fluorescence signal from RPA, and that living bacteria can be found in the RPA positive droplets.

FIGURE CAPTIONS

Fig. 1 shows microscope images of microdroplets after the RPA reaction under the bright field (left) and under the fluorescence field (right). Microdroplet with the growth of b. subtilis (indicated by the white arrows) shows significant higher green fluorescence intensity than other microdroplets without the growth of b. subtilis. Experimental details are described in Example 1.

Fig. 2 shows microdroplets, wherein about 10% of the droplets comprise B. subtilis or E. coli bacteria. Experimental details are described in Example 2.

Fig. 3A depicts voltage (V) over time (ms) used for droplet sorting. When a fluorescent droplet passes through the sorting channel, photons emitted by the excited fluorophores can be detected by photomultiplier tubes (PMTs). Each of the four spikes indicates that a droplet emitting red (PMT4) and/or green fluorescence (PMT2) is detected above the threshold. Green fluorescence above the threshold of about 0.14 indicates a successful RPA reaction in the particular droplet. Red fluorescence stems from sulforhodamine, which serves as a marker for the droplets. The background threshold for red fluorescence was set to about 0.08. Experimental details are described in Example 2. Figure 3B shows the gate setting (Gate3) used to select and sort out green and red fluorescent droplets.

Experimental details are described in Example 2.

Figure 4 shows that fluorescent droplets were successfully selected by sorting. It shows a fluorescent droplet comprising bacteria. Experimental details are described in Example 2.