60/233,004, filed September 15, 2000, which is incorporated by reference herein in its entirety.

1. INTRODUCTION The field of the invention relates to methods and compositions for the discovery of compounds which inhibit the growth of a range of bacteria, especially mycobacteria. Compounds identified by the methods of the invention are useful as antibacterial agents.

2. BACKGROUND OF THE INVENTION In both eukaryotic and prokaryotic cells a large repertoire of regulatory systems is modulated by a variety of extracellular signals. In eukaryotic cells, the control of proliferation and differentiation is achieved by multiple signal transduction pathways, which are regulated by the co-ordinated action of protein kinases and phosphatases. The protein kinases fall primarily into two classes, those which phosphorylate tyrosine residues and those which target serine and threonine residues. Specificity of response is insured through a variety of strategies. Unique receptors and docking proteins, compartmentalization of pathways, and specific calcium ion channels all play a role in the transmission of extracellular signals via kinases and phosphatases to transcription factors (Pawson, 1995, Nature 373: 573-580).

Similarly, prokaryotic cells largely rely on protein phosphorylation cascades for regulation of cellular activities, but these are primarily histidine kinases, which are part of the sensing domain of two-component regulatory systems. These kinases and their associated response regulators are involved in adaptive responses such as nitrogen fixation, chemotaxis and the regulation of sporulation in Bacillus species (Stock et al., 1989, Microbiological Rev. 53: 450-490).

Recently, a number of reports indicate that eukaryotic-like kinase and phosphatase activities may complement these two-component systems in several different

types of bacteria. Phosphorylation of tyrosine has now been reported in a number of species, but it appears to be limited to phosphorylation on a small number of proteins, such as two flagellar proteins in Pseudomonas aeruginosa or one protein in Mycobacterium tuberculosis (South et al. , 1994, Molec. Micro. 12: 903-910; Chow et al. , 1994, FEMS Micro. Lett.

124: 203-208). However, nucleotide sequencing of the genomes of several bacteria suggested an abundance of such post-translational modifying enzymes.

The genus Mycobacterium contains many species of bacteria that harm both animals and humans. One example is Mycobacterium tuberculosis (Mtb) infections which continue to result in very significant morbidity and mortality world-wide. It is estimated that one third of the world's population is infected and that around three million people die from tuberculosis infections every year. Although there are reliable effective drugs for the treatment of tuberculosis, the increase in multiple antibotic resistant strains, especially in industrialized nations, is of considerable concern. There has been no new treatment for tuberculosis for three decades.

Since the discovery and development of new antibiotic drugs, especially those that are active against multidrug-resistant organisms, have slowed, it will take new methods and increased effort to speed up the process of discovering new antibiotic drugs that are effective (1996, Gold and Moellering, Jr. , New Eng. J. Med. , 335: 1445-1453). The present invention as described herein provides a novel method for identifying antibacterial compounds that are particularly effective against Mycobacterium species.

3. SUMMARY OF THE INVENTION The present invention relates to methods for screening for antibacterial compounds, and methods for treating bacterial diseases or preventing infections by bacteria.

The antibacterial screening method of the invention comprises two step: (a) contacting a growing culture of Streptomyces griseus or Streptomyces 85E with a test compound for a time sufficient to allow the test compound to alter aerial mycelial development or spore formation, and (b) contacting mycobacterium cells with the test compound of step (a) for a time sufficient to allow the test compound to inhibit growth of the mycobacterium. Test compounds that tested positive in both step (a) and step (b) are antibacterial compounds of the invention.

The antibacterial compounds of the invention can be used for inhibiting the growth of a bacteria or for treating or preventing a disease caused by a bacteria in a subject in need of the treatment or prevention comprising administering to the subject a therapeutically or prophylactically effective amount of the antibacterial compound. The antibacterial compounds of the invention can also be used in combination with existing antibacterial compounds for treatment or prevention of a disease. The antibacterial compounds can also be used to sterilize contaminated items or to inhibit growth of bacteria on an item by contacting the item with the compounds.

The target bacteria that are sensitive to the compounds of the invention contain phosphoproteins, such as those that binds an anti-phosphotyrosine antibody. Target bacteria include mycobacteria, myxobacteria and cyanobacteria, such as but not limited to M. tuberculosis, M. bovis and M. leprae.

The exemplary antibacterial compounds of the invention include but are not limited to cyclomarin A, pyridomycin, surfactin, viscosin, XR336, XR339 and XR774, and their derivatives.

Pharmaceutical composition comprising the antibacterial compounds of the invention are also contemplated.

4. BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the results of a typical Streptomyces 85E sporulation inhibition assay.

Figure 2 gives the chemical structure of compounds newly identified to be active in the sporulation assay and subsequently found to effectively inhibit the growth of mycobacterial strains.

5. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to methods for screening compounds with antibacterial activity. Specifically, the invention relates to assays for identifying compounds that interfere with phosphorylation and dephosphorylation pathways of bacteria. The invention also encompasses the uses of these compounds to inhibit growth of bacteria and to treat infectious diseases.

One of the most common form of post-translational modification of protein is phosphorylation on histidine, tyrosine, serine, and threonine. Gene regulation through histidine modification is common in bacteria and was thought to be characteristic of prokaryotes. Similarly, it was considered that modification on tyrosine, serine, and threonine residues were eukaryotic functions. However, it appears that some prokaryotes rely on phosphorylation cascades for adaptive responses, such as nitrogen fixation, and chemotaxis.

The present invention is based in part on the discovery by the inventors that some compounds that altered the development of aerial mycelia and sporulation in certain Streptomycete species are also potent inhibitors of growth of mycobacterial cells. The inventor recognized that phosphoproteins and related kinases and phosphatases present in bacteria can serve effectively as a target for antibacterial drug screening.

Without being bound by any theory or mechanism, the compounds of the invention interfere with phosphrylation and dephosphorylation pathways of bacteria either by inhibiting the functions of bacterial kinases and/or phosphatases. Because phosphoprotein-related targets in bacteria are distinct from known antibacterial targets, the antibacterials that are identified through the methods of the present invention are likely to be structurally novel, and without pre-existing resistance.

In one embodiment, the invention provides a method for identifying antibacterial compounds that comprises two steps. The first step comprises contacting a test compound with a prokaryotic organism that possesses enzyme activity in its developmental processes that is effective to phosphorylate tyrosine, serine and/or threonine. The test compound is allowed to contact the organism for a time sufficient for the compound to alter development of the organism. Preferably, the alteration of development is physically detectable, and most preferably visually observable. Compounds that scored positive in the first assay are tested in a second assay by contacting a test Mycobacterium species, and scoring for the ability of the compounds to inhibit mycobacterial cell growth. The various methods for screening of the invention are described in Section 5.1 hereinbelow.

In another embodiment, the present invention provides the use of compounds that interfere with phosphorylation and dephosphorylation pathways of bacteria as antibacterial compounds. Such compounds are expected to inhibit the growth of bacteria

that possesses enzyme activity that phosphorylates tyrosine, serine, and/or threonine residues. In a preferred embodiment, compounds that are shown to alter aerial mycelial development and/or inhibition of spore formation in a Streptomycete-based screening assay as described in U. S. Patent No. 5,770, 392, are useful, not only as eukaryotic kinase inhibitors, but also as antibacterial compounds for inhibiting the growth of bacteria that possesses enzyme activity that phosphorylates tyrosine, serine, and/or threonine residues.

The methods are particularly useful against Mycobacterium species, especially pathogenic strains of Mycobacterium species. According to the invention, such compounds, their analogs and derivatives are antimycobacterial agents.

In various embodiments, the test compound are present in a mixture with other molecules. As described in Section 5.2, the present invention also encompasses the use of such mixtures in the first Streptomycete-based assay and the second Mycobacterium assay. Such mixtures include but are not limited to microbial culture supernatants, microbial cell extracts, and fractions enriched for antibacterial activity. A test compound which affected aerial hyphae development and/or sporulation in the first Streptomycete- based assay may optionally be enriched or purified from the mixture prior to the second Mycobacterium assay.

In various embodiments, the invention provides uses of the antibacterial compounds of the invention, including but not limited to, uses as a sterilizing agent, and as a pharmaceutical for treatment or prevention of human and animal diseases. The bacterial species that are sensitive to such extracts and compounds, referred to herein as target organisms, such as Mycobacterium species, are described in Section 5.3. The various uses and methods of the antibacterial compounds are described in details in Section 5.4.

The ability of several purified natural products in inhibiting mycobacterial cell growth is described in detail in the example in Section 6.

5.1 METHOD OF IDENTIFICATION OF ANTIBACTERIAL COMPOUNDS The present invention provides a method to identify antibacterial compounds, comprising testing a compound in a Streptomyces-based assay first followed by an assay that is based on the viability of one or more bacterial species in the presence of the compound. The bacteria used in the second test is one that comprises one or more protein (s) that comprises phosphorylated amino acid residues, such as phosphorylated serine, phosphorylated threonine, and phosphorylated tyrosine. Positive results in both assays indicate that the compound is an antibacterial compound. One advantage of this approach is the reduction of number of assays that is to be performed with a target bacteria, which are pathogenic and possibly highly infectious. For Mycobacterium species, the growth inhibition assay takes many days to complete. For example, a preliminary screen using the relatively safe Streptomyces-based assay can eliminate a large number of non- active compounds, hence reducing the number of candidate compounds that are to be tested with a target bacteria, such as M. tuberculosis, which can take up to 3 weeks to complete.

The first step used in the method of the invention is based on the methods provided in U. S. Patent No. 5,770, 392, the disclosure of which is incorporated herein by reference in its entirety. Preferred prokaryotic organisms are Streptomyces griseus and Streptomyces 85E. As used herein, the term"Streptomyces-based assay"encompasses any assay based on the methodology disclosed in the U. S. Patent No. 5,770, 392, and may involve the use of other non-Streptomyces species of prokaryotic organism which possesses enzymes effective at phosphorylating tyrosine, serine, or threonine residues in a protein.

Suitable prokaryotic test organisms for use in the assay of the invention are streptomycetes, particularly strains of Streptomyces griseus, and a number of wild stains (e. g. , strains designated as WEC93-17A, WEC188-31C, WEC362-68A and WEC403-73F) demonstrated to be distinct by sequencing of the 16S rDNA. A particularly preferred prokaryotic organism is a wild strain of Streptomyces isolated from soil and designated Streptomyces WEC478-85E (hereinafter strain 85E). This strain has been deposited with the American Type Culture Collection in accordance with the provisions of the Budapest treaty and has been assigned Accession Number ATCC 55824.

In one embodiment, the material comprising a test compound to be tested can be applied to a filter paper disk and then placed on a plate which has been freshly

seeded with the prokaryotic test organism. The prokaryotic test organism is then allowed to contact and grow in the presence of the filter paper disk for a period of time, usually 24 to 36 hours, after which the organism is evaluated for altered development in the zone around the disk. The effects observed may include overall growth inhibition, but at least in the case of streptomycetes, an observation of an inhibition of the formation of aerial mycelia and/or spores, without inhibition of the growth of vegetative mycelia is particularly indicative of the presence of an inhibitor of post-translational phosphorylation. Depending on the specific test organism used, the growth medium employed may need to be a minimal media or a rich medium. This is the case because it appears that the metabolic pathways facilitating growth on minimal media are different from those operational during growth on rich media, and it may be the case that different kinases and phosphatases may be regulating development and metabolism under different growth conditions. Accordingly, it may also be advantageous to test materials using both a rich and a minimal medium.

In a preferred embodiment where Streptomyces 85E is used, the method of the invention is performed using a minimal medium such as ISP4, an inorganic salts/starch agar available from Difco, because this strain sporulates readily when grown on this medium. The relative ease to induce sporulation in this strain facilitates visual evaluation for differences in sporulation. In other embodiments, strains (such as 17A and 31C) which sporulate on rich medium, for example tryptic soy medium, can be used in the this step of the invention.

The second step of the method of the invention is a standard viability test using a bacterial strain that comprises one or more proteins that comprise amino acid residues that are phosphorylated, such as phosphorylated serines, threonines, and tyrosines.

Such bacterial strains can readily be identified, for example, by detecting the presence of phosphorylated serines, threonines, and/or tyrosines using immunological methods well known in the art. A preferred group of bacteria for this step of the method is Mycobacteriuam. Mycobacterium cells, such as but not limited to M. tuberculosis, M. phlei, and M. aurum can be used. The viability of the mycobacterial cells in the presence of one or more concentrations of the test compound is scored and compared to that without the test compound. Other bacteria that can be used include myxobacteria and cyanobacteria.

Test mycobacteria may be obtained from private laboratory deposits, public culture collections such as the American Type Culture Collection, or from commercial suppliers. It is preferable that the test mycobacteria is reasonably well characterized biochemically, physiologically, and/or genetically. It is desirable to use mycobacterial strains which have been developed for drug screening processes, and that conditions for their growth, maintenance, and manipulations are known. The test mycobacterial cells may be cultured under standard conditions of temperature, incubation time, optical density, and media composition corresponding to the nutritional and physiological requirements of the particular strain. However, conditions for maintenance and growth of the test cell may be different from those for assaying candidate test compounds in the screening methods of the invention. Any techniques known in the art may be applied to establish the optimal conditions. See section 6.1. 6 for an exemplany method.

Once an inhibitory compound that scored positive in both assays of the invention has been identified, the properties of the antibacterial compound can be determined by the following assays: The minimum inhibitory concentration (MIC) against bacterial organisms is determined for each test compound that is positive in the assays of the invention. Methods known in the art may be used such as broth microdilution testing, using a range of concentrations of each test compound (1993, National Committee for Clinical Laboratory Standards). Methods for Dilution Antimicrobial Susceptibility Tests For Bacteria That Grow Aerobically-Third Edition: Approved Standard, M7-A3). The MIC against a variety of pathogens are determined using the same method. Pathogenic species to be tested generally include: E. coli, Enterococcus faecium, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus epidermis, Shigellaflexneri, and Salmonella typhimurium.

Cytotoxicity can be measured by methods known in the art. One such method is assessing growth of mammalian cells in the presence of the test compound, using a protein binding dye, sulforhodamine B (SRB). SRB binds electrostatically to basic amino acids. Binding and solubilization of the dye can be controlled by changes in pH. SRB binds stoichiometrically to proteins in one pH range but can be solubilized and extracted for measurement in another. An increase in total protein is correlated to cell growth. Cell

growth in the presence of compound is compared to growth without added compound to establish a growth inhibitory concentration (GI50) (Skehan et al. , 1990, J. Natl. Cancer. Inst., 82: 1107-1112). Another method of measuring cytoxicity which may be used in an assay containing 3 [4,5-dimethylthiazol-2-yl]-2, 5,-diphenyltetrazolium bromide/2, 3-bis [2- methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilid e inner salt ("MTT/XTT") as described in Mosmann T. , 1983, J. Immunol. Methods, 65: 55-63, which is incorporated by reference in its entirety for all purposes.

The methods of the invention are also suited to high throughput screening and miniaturization. In various embodiments, the screening assays can be automated by the extensive use of computer-controlled electromechanical robotic devices to, rapidly and simultaneously for a number of samples, perform many repetitive tasks, such as reagent dispensing, material transfer, and washing, and microbiological manipulations such as picking of colonies, and inoculation, etc.

5.2 ANTIBACTERIAL COMPOUNDS The test compounds of the invention encompass numerous classes of chemical molecules, though typically they are organic molecules, and preferentially of low molecular weight. Typically, these compounds have a molecular weight of more than about 50, but less than about 3,000, and preferably less than 1,000. Test compounds comprise functional chemical groups necessary for interactions with the target transcription factor (s) and/or target nucleic acid molecules. Test compounds often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more functional groups, including but not limited to alkyl, carbonyl, amine, hydroxyl or carboxyl groups.

The compounds tested in the methods of the invention can be obtained from a wide variety of sources including collections of natural products in the form of bacterial, fungal, lichen, plant and animal extracts; and synthetic chemical libraries. Numerous means known in the art are available for the random, directed and combinatorial synthesis of a wide variety of chemical structures. In addition, natural products or known antibiotic compounds may be subjected to random or directed chemical modifications to produce derivatives and structural analogs for use as test compounds in the invention. Usually,

various predetermined concentrations are used for screening such as 0.001 um, 0.01 um, 0.1 um, 1.0 um, 10 um, and 100 u. m. Typically, these compounds have a molecular weight of more than about 50, but less than about 3,000, and preferably less than 1,000.

Test compounds that score positive in the screening assays of the invention, i. e. , antibacterial compounds, are putative agents that interfere with the phosphorylation and dephosphorylation pathways of bacteria, and are useful as antibacterial agents or as leads for the development of therapeutic agents for the treatment of infectious diseases caused by such bacteria. Many are inhibitors of eukaryotic signal transduction processes.

The test compounds of the invention can be present in a composition or mixture with other molecules, such as natural products, chemically-related derivatives, syntheic intermediates or precurors of the test compound. There is no requirement that the test compound be isolated or purifed. However, the test compound in a mixture can be enriched, fractionated, or isolated by methods known in the art after the Streptomyces-based assay for use in the second step of the method. In preferred embodiments, the composition comprising one or more test compound is a microbial cell culture, microbial cell culture supernatant, microbial cell extract, and fractions thereof enriched for a particular biological or biochemcial property.

By using a method of the invention, such as that described in the example in Section 6, the inventors identified a number of extracts and compounds that scored positive in the Strpetomyces 85E assay and in the Mycobacterium assay using M. phlei and/or M. aurum as the test species. According to the invention, the following compounds are effective as antimycobacterial agents: cyclomarin A, pyridomycin, surfactin, viscosin, XR379, XR336, XR339, and XR774. The chemical structures of some of these compounds are shown in Figure 2.

Cyclomarin A has been known to be useful as an anti-inflammatory agent (see U. S. Patent No. 5,444, 043) and as an antiviral agent (U. S. Patent No. 5,759, 995). The disclosures of these two U. S. patents are incorporated herein in their entireties. Cyclomarin A was not previously known to be produced by a terrestrial streptomycete and possess antimycobacterial activity. Accordingly, the invention provides the production of cyclomarin A by culturing Streptomyces D22-7B and isolating cyclomarin A from the culture or the culture supernantant. The invention also provides the use of cyclomarin A as

an antimycobacterial agent or as a lead compound for further modification and derivatization to improve its property as an antibacterial agent or antimycobacterial agent.

Pyridomycin is described in Ogawara et al. , 1968, Biochemistry, 7: 3296-302.

Surfactins and viscosin have been described in PCT publication no. WO 99/20792 which is incorporated herein by reference in its entirety. Viscosin has independently been demonstrated to possess antimycobacterial activity (1997, Gerard et al., J Nat Prod 60: 223-229). Thus, it is useful as a positive control in the assays of the invention.

Any antibacterial compound that scored positive in the Streptomyces assay and in the Mycobacterium assay of the invention, with the exception of viscosin, are encompassed as antimycobacterial agents of the invention. Many of the compounds are peptides that are not made via the ribosome but by peptide synthases, and they may contain unusual amino acids and lipids.

Other antibacterial compounds that scored positive in the Streptomyces assay and are candidate antimycobacterial agents include vulpinic acid and usnic acid, and their respective analogs or derivatives as described in PCT publication no. WO 99/20793 which is incorporated herein by reference in its entirety.

A number of natural product extracts prepared from isolates of soil bacteria scored positive in the Streptomyces assay and thus are candidate antibacterial and/or antimycobacterial agents. Such extracts, encompassed by the invention, are prepared from isolates of soil bacteria of the genus Pseudomonas, Bacillus, Streptomyces, Acinetobacter, Acidosphaera, Tsukamurella, Streptoverticillium, Kitasatosporia, Nocardia, Gordona, and Micromonospora, by standard techniques. The species that appear most closely related to the bacteria present in the various isolates are listed in Table 1 below: Table 1. Probable identities of soil bacteria isolates which have tested positive for production of compounds which inhibit sporulation of the tester strain Streptomyces 85E. GENUS CLOSEST RELATED SPECIES Pseudomonas fluorescens, putida Bacillus licheniformis, subtilis

Bacillus amyloliquefaciens Bacillus pumilis Bacillus simplex, megaterium Bacillus illinoisensis Bacillus pabuli Bacillus viscosus Acientobacter calcoaceticus Acidosphaera rubrifaciens Tsukamurella paurometabolum Streptomyces acidiscabies Streptomyces purpureus Streptomyces caelestris Streptomyces thermocarboxydus Streptomyces subrutilis Streptomyces lavendulae, virginiae Streptomyces setonii Streptomyces sampsonii Streptomyces galbus Streptomyces hygroscopicus Streptomyces eurythermus Streptomyces lincolnensis Streptomyces tendae Streptoverticillium mashuense Kitasatosporia azaticus Nocardia salmonicida Nocardia salmonicida Gordona hydrophobica Micromonospora megalomicea

In yet another embodiment of the invention, the use of microbial cell culture or compositions comprising materials derived from cell culture of the microbial species listed in Table I in the methods of the invention is specifically provided. Accordingly, the methods of the invention include the testing of cultures of Pseudomonas fluorescens, Pseudomonas putida, Bacillus licheniformis, Bacillus subtilis, Bacillus myloliquefaciens, Bacillus pumilis, Bacillus simplex, Bacillus megaterium, Bacillus illinoisensis, Bacillus pabuli, Bacillus viscosus, Acientobacter calcoaceticus, Acidosphaera rubrifaciens, Tsukamurella paurometabolum, Streptomyces acidiscabies, Streptomyces purpureus, Streptomyces caelestris, Streptomyces thermocarboxydus, Streptomyces subrutilis, Streptomyces lavendulae, Streptomyces virginiae, Streptomyces setonii, Streptomyces sampsonii, Streptomyces galbus, Streptomyces hygroscopicus, Streptomyces eurythermus, Streptomyces lincolnensis, Streptomyces tendae, Streptoverticillium mashuense, Kitasatosporia azaticus, Nocardia salmonicida, Gordona hydrophobica, and Micromonospora megalomicea. Other compounds that can be tested and used in the methods of the invention are described in United States Patent Nos. 5,306, 732; 6,057, 315; 5,565, 486; and 6,197, 811, and PCT publications W092/16517 and WO 98/17661, which are incorporated herein in their entireties.

5.3 MYCOBACTERIUM AND OTHER TARGET BACTERIA The antibacterial compounds identified by the methods of the infection can be used to treat or prevent a variety of infectious diseases in animals, including humans, companion animals (e. g. , dogs and cats), livestock animals (e. g. , sheep, cattle, goats, pigs, and horses), laboratory animals (e. g. , mice, rats, and rabbits), and captive or wild animals.

These infectious diseases are caused by a variety of target bacteria, including Mycobacterium species.

Although most cases of tuberculosis are caused by Mycobacterium tuberculosis, two additional species, Mycobacterium bovis and Mycobacterium africanum, also cause tuberculosis in humans. Anther species of Mycobacteria that is significantly harmful to humans is M. ulcerans produces a destructive, preliminarily tropical skin disease that, if not treated early, produces chronic ulcer with necrotic centers. Leprosy is another

disease caused by Mycobacteria, M. leprae. Leprosy is an ancient disease that still continues to threaten the quality of life of over 12 million people in all parts of the world.

Mycobacteria not only effects humans, but also animals. An example is M. paratuberculosis, causing chronic enteritis in ruminants, such as cattle and sheep. The disease is of major economic concern, which can infect a whole heard. Accordngly, veterinary applications of the antibacterial compounds and methods of the invention are included Other Mycobacteria species that are contemplated include but are not limited to M. africanum, M. asiaticum, M avium, M. bovis, M chelonei, M diphtheriae, M flavescens, M. fortuitum, M. gastri, M. gordonae, M. haemophilum, M. hominis, M. intercellulare, M. kansaii, M leprae, M lepraemurium, M malmoense, M marinum, M mictroti, M. paratuberculosis, M. phlei, M. scrofulaceum, M. simiae, M. smegmatis, M. szulgai, M terrae, M trivale, M tuberculosis, M uclerans, and M. xenopi.

Other target bacteria which are sensitive to the inhibitory compounds of the invention are characterized by the presence of phosphoproteins, in particular, those comprising phosphorylated serine, threonine, and tyrosine residues such as those that can bind to anti-phosphotyrosine antibodies. Target bacteria can thus be identified by immunological methods commonly known in the art, such as Western blotting using antiphosphoprotein antibodies. Many species of myxobacteria and cyanobacteria are contemplated to be target bacteria. Other examples of target bacteria may include gram negative bacteria such as Yersinia, Pseudomonas, and Salmonella species.

5.4 METHODS OF USE OF ANTIBACTERIAL COMPOUNDS In one embodiment, the invention features novel antibacterial compounds discovered by the methods described above. These antibacterial compounds are putative inhibitors of kinase and/or phosphatase enzymes in a target organism, including infectious pathogenic microorganism. The invention also encompasses novel pharmaceutical compositions comprising antibacterial compounds discovered as described above in various pharmaceutically acceptable formulations.

In another embodiment, the invention features a method for treating a subject infected with an infectious bacterium comprising administering to that subject a

therapeutically effective amount of an antibacterial agent which scored positive in both assays of the invention. Such administration can be by any method known to those skilled in the art, for example, by topical application or by systemic administration. The antibacterial compounds of the invention can also be used in combination with other antibiotics.

In yet another embodiment, antibacterial compounds of the present invention can be used to sterilize or to treat contaminated items, such as crops, wood, metal or plastic and the like, by methods such as, but not limited to, spraying or dusting of that agent onto the contaminated item. The antibacterial compounds can also be used to inhibit growth of bacteria on an item by contacting the item with the compounds or impregnating the compound into the item.

By"therapeutically effective amount"is meant an amount that relieves to some extent one or more symptoms of the disease or condition in the patient. Additionally, by"therapeutically effective amount"is meant an amount that returns to normal, either partially or completely, physiological or biochemical parameters associated with or causative of a bacterial disease or condition.

5.4. 1 FORMULATION The antibacterial compounds identified by methods of the invention may be formulated into pharmaceutical preparations for administration to animals for treatment of a variety of infectious diseases. Compositions comprising a compound of the invention formulated in a compatible pharmaceutical carrier may be prepared, packaged, labeled for treatment of and used for the treatment of the indicated infectious diseases caused by microorganisms.

If the antibacterial compound is water-soluble, then it may be formulated in an appropriate buffer, for example, phosphate buffered saline or other physiologically compatible solutions. Alternatively, if the resulting complex has poor solubility in aqueous solvents, then it may be formulated with a non-ionic surfactant such as Tween, polyethylene glycol or glycerine. Thus, the compounds and their physiologically acceptable solvates may be formulated for administration by inhalation or insufflation (either through the mouth or

the nose) or oral, buccal, parenteral, topical, dermal, vaginal, rectal administration and drug delivery device, e. g. , porous or viscous material, such as lipofoam.

For oral administration, the pharmaceutical preparation may be in liquid form, for example, solutions, syrups or suspensions, or may be presented as a drug product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e. g. , sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e. g. , lecithin or acacia); non-aqueous vehicles (e. g., almond oil, oily esters, or fractionated vegetable oils); and preservatives (e. g. , methyl or propyl-p-hydroxybenzoates or sorbic acid). The pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e. g. , pregelatinized maize starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose); fillers (e. g. , lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e. g. , magnesium stearate, talc or silica); disintegrants (e. g. , potato starch or sodium starch glycolat) ; or wetting agents (e. g. , sodium lauryl sulphate). The tablets may be coated by methods well-known in the art.

Preparations for oral administration may be suitably formulated to give controlled release of the active compound.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e. g. , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e. g. , gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds may be formulated for parenteral administration by injection, e. g. , by bolus injection or continuous infusion. Formulations for injection may be

presented in unit dosage form, e. g. , in ampules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e. g. , sterile pyrogen-free water, before use.

The antibacterial compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e. g. , containing conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulations described previously, the antibacterial compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the antibacterial compounds may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophilic drugs.

The antibacterial compounds and compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

The pharmaceutical compositions of the present invention comprise an antibacterial compound as the active ingredient, or a pharmaceutically acceptable salt thereof, and may also contain a pharmaceutically acceptable carrier, and optionally, other therapeutic ingredients, for example antivirals. The term"pharmaceutically acceptable salts"refers to salts prepared from pharmaceutically acceptable non-toxic acids and bases, including inorganic and organic acids and bases.

The pharmaceutical compositions include compositions suitable for oral, rectal, mucosal routes, transdermal, parenteral (including subcutaneous, intramuscular, intrathecal and intravenous), although the most suitable route in any given case will depend on the nature and severity of the condition being treated.

In practical use, an antibacterial compound can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e. g. , oral or parenteral (including tablets, capsules, powders, intravenous injections or infusions). In preparing the compositions for oral dosage form any of the usual pharmaceutical media may be employed, e. g. , water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, and the like; in the case of oral liquid preparations, e. g. , suspensions, solutions, elixirs, liposomes and aerosols; starches, sugars, micro-crystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like in the case of oral solid preparations e. g. , powders, capsules, and tablets. In preparing the compositions for parenteral dosage form, such as intravenous injection or infusion, similar pharmaceutical media may be employed, e. g. , water, glycols, oils, buffers, sugar, preservatives and the like know to those skilled in the art. Examples of such parenteral compositions include, but are not limited to Dextrose 5% w/v, normal saline or other solutions.

5.4. 2 ADMINISTRATION For administration to subjects, antibacterial compounds discovered by using the assays of the invention are formulated in pharmaceutically acceptable compositions.

The compositions can be used alone or in combination with one another, or in combination with other therapeutic or diagnostic agents. These compositions can be utilized in vivo, ordinarily in a mammal, preferably in a human, or in vitro. The newly discovered antibiotic compounds could be used in vitro as a means of sterilization in hospitals or tissue culture labs, by example, by applying the new compounds using standard environmental sterilization techniques.

In employing them in vivo, the compositions can be administered to the mammal in a variety of ways, including parenterally, intravenously, subcutaneously, intramuscularly, colonically, rectally, vaginally, nasally, orally, transdermally, topically, ocularly, or intraperitoneally.

As will be readily apparent to one skilled in the art, the magnitude of a therapeutic dose of an antibacterial compound in the acute or chronic management of an

infectious disease will vary with the severity of the condition to be treated, the particular composition employed, and the route of administration. The dose, and perhaps dose frequency, will also vary according to the species of the animal, the age, body weight, condition and response of the individual subject. For example, in an in vitro assay, 20 Mg of cyclomarin A and 10 gg of INH both inhibited growth of M. tuberculosis completely. The determination of effective dosage levels, that is the dosage levels necessary to achieve the desired result, will be within the ambit of one skilled in the art.

Desirable blood levels may be maintained by a continuous infusion of an antibiotic compound as ascertained by plasma levels. It should be noted that the attending physician would know how to and when to terminate, interrupt or adjust therapy to lower dosage due to toxicity. Conversely, the attending physician would also know how to and when to adjust treatment to higher levels if the clinical response is not adequate (precluding toxic side effects).

In selected cases, drug delivery vehicles may be employed for systemic or topical administration. They can be designated to serve as a slow release reservoir, or to deliver their contents directly to the target cell. Such vehicles have been shown to also increase the circulation half-life of drugs which would otherwise be rapidly cleared from the blood stream. Some examples of such specialized drug delivery vehicles which fall into this category are liposomes, hydrogels, cyclodextrins, and bioadhesive microspheres. These vehicles have been developed for chemotherapeutic agents.

Topical administration of compounds is advantageous when localized concentration at the site of administration with minimal systemic adsorption is desired.

This simplifies the delivery strategy of the agent to the disease site and reduces the extent of toxicological characterization. Furthermore, the amount of material to be administered is far less than that required for other administration routes.

Antibacterial compounds may also be systemically administered. Systemic absorption refers to the accumulation of compounds in the blood stream followed by distribution throughout the entire body. Administration routes which lead to systemic absorption include: oral, intravenous, subcutaneous, intraperitoneal, intranasal, intrathecal and ocular.

6. EXAMPLES The invention may be better understood by the following description of illustrative examples which are not intended to be limiting.

6.1 MATERIALS AND METHODS 6.1. 1 STRAINS The following bacterial strains were used for inhibition testing: Streptomyces 85E ATCC 55824, Streptomyces griseus ATCC 23345, Bacillus subtilis JH642, Staphylococcus aureus RN450, E. coli H101, Mycobacterium aurum 4721E, Mycobacterium phlei ATCC 11758, and Mycobacterium tuberculosis strain Erdman.

6.1. 2 KINASE INHIBITORS Tyrphostins AG 490, AG 1295, and AG 1478 and genistein were obtained from Calbiochem-Novabiochem Corp. , San Diego, CA. Each was dissolved in DMSO to 5 mg/ml (tyrphostins) or 20 mg/ml (genistein).

6.1. 3 PREPARATION OF CULTURE SUPERNATANT Isolates were grown in 20 ml of tryptic soy broth (Difco) for a period of 3 to 4 days at 30°C with shaking. A cell-free supernatant was prepared by centrifugation at 17,000 x g for 10 minutes and further clarified by passage through a 0.2 micron filter.

Supernatants were stored frozen at-20°C prior to screening. Soil isolates were preserved as frozen glycerol stocks at-20°C.

6.1. 4 CHARACTERIZATION OF ISOLATES Strains of interest were characterized by fatty acid methyl ester (FAME, Sasser, 2001, Technical note &num 101 available at www. midi-inc. com, MIDI, Inc., Newark, Delaware) and 16S rDNA sequence analyses. Samples were prepared for gas chromatography according to the protocol recommended for the MIDI automated microbial identification system and were chromatographed on a Hewlett-Packard 25m x 0.2mm phenyl methyl silicone fused capillary column on an HP 6890 system. Fatty acid profiles

were compared to those in the MIDI aerobic bacteria database (MIDI, Inc. , Newark, Delaware).

Primers for PCR amplification of 16S rDNA genes were GAGAGTTTGATCCTGGCTCAG (primer 16S. 0007. F21) and CGGACTCCTTGTTACGACTTC (primer 16S. 1491. R21) derived from primers described by Lane, 16S/23S rRNA sequencing, p. 115-175. In : Stackebrandt, E. & M. Goodfellow (Eds. ). Nucleic acid techniques in bacterial systematics. John Wiley & Sons, Chichester: 1991. PCR was carried out in a 50 ul reaction mix containing each primer at a concentration of 1 uM, 200 uM of each dNTP, 20 mM (NH4) 2S04, 75 mM Tris-HCl (pH 8.8), 0. 01 % Tween 20,1. 5 mM MgCl2, 0.4 units of Ultra Therm DNA Polymerase (Bio/Can Scientific, Mississauga, Ontario), and 20 RI of template DNA prepared from isolated bacterial colonies either by heating with InstaGene matrix (Bio-Rad) or in a Fast Prep instrument (Savant) according to the supplier's protocol for gram-positive bacteria (Bio/Can Scientific). PCR conditions included 30 cycles of denaturation (1 min. at 95°C), annealing (2 min. at 55°C), and extension (2 min. at 72°C) in an MJ Research model PTC 100 thermocycler. Products were purified on QIAquick spin columns (Qiagen), and partial sequence was obtained on an automated sequencer using a primer with the sequence TAG (TC) GGCG (AG) ACGGGTGAGTAA (primer 16S. 0099F) and ABI Prism dye terminator cycle sequencing reaction mix (Perkin Elmer). Sequences were compared by BLAST analysis to available ribosomal DNA sequences.

6.1. 5 STREPTOMYCES-BASED ASSAY Sterile 6 mm filter paper discs (Schleicher and Schuell) were dipped into aqueous solutions of crude samples; approximately 25 pl saturates the disc. In the case of pure compounds, known amounts were dispensed to the discs in aliquots up to 15 pl ; volatile solvents were evaporated prior to application of the disc to the test culture. ISP 4 (Difco) plates were evenly spread with mycelial fragments of Streptomyces 85E from an overnight culture grown in tryptic soy broth and discs containing test samples were placed immediately onto these freshly seeded plates and incubated at 30°C. Sporulation usually begins within 24 hours on this medium and plates are optimally scored for effects on development at about 36 to 48 hours after inoculation.

6.1. 6 MYCOBACTERIAL CELL GROWTH ASSAY Inhibition of mycobacterial strains (except M. tuberculosis and M. avium) was identified by placing compound on sterile sensitivity discs on to lawns of M. aurum or M. phlei on TSA plates. Zones were measured after 2-4 days incubation at 37°C. For M. tuberculosis and M. avium, a similar procedure was followed, using 7H10 medium (2,10, or 20 pg of compound was applied in water, MeOH or DMSO). Plates were incubated at 37°C and scored for inhibition zones after 3 weeks.

6.1. 7 KINASE INHIBITION ASSAYS Kinase inhibition assays were carried out with kits provided by Pierce (Rockford, IL) and kinases from Upstate Biotechnology (Lake Placid, NY) were used according to the manufacturer's instructions.

6.2 ISOLATION AND IDENTIFICATION OF ACTIVE COMPOUNDS 6.2. 1 GENERAL METHODS Preparative chromatography procedures were done with a Beckman HPLC instrument and system Gold software. A Hewlett-Packard HP-MSD-1100 system was used for analytical HPLC procedures. Beckman ultrapore ODS 5 C-18, Hypersil BDS 5p C-18 and Zorbax 5 p C-18 columns were used. An atmospheric pressure ionization-Electrospray (+ve) mass detector was used for routine analysis. NMR spectra were recorded in CDCL3, Cd30D and DMSO-d6.'H NMR (400 and 500 MHZ),"C NMR (125 MHZ) and HMBC, NMQC spectra were obtained on a Bruker NMR spectrometer while 13 C NMR (75 MHZ) was obtained on a Varian NMR spectrometer. Both high and low resolution FAM-MS were measured on a Kratos concept II HQ mass spectometer. Amino acid analyses were obtained on Applied Biosystems Aminoacid Analysis model 420A/H Selected soil isolates identified by the assay as producers of inhibitors were grown to stationary phase in cultures up to 10 litres in tryptic soy broth (Difco).

Supernatants and cell pellets were extracted separately with ethyl acetate and 10-20% methanol in ethyl acetate respectively. After concentrating both extracts and determining

their activity, they were pooled and fractionated on a low mesh silica gel column, eluting with chloroform in an increasing methanol gradient.

6.2. 2 SURFACTIN AND VISCOSIN Inhibitory activity in fractions from Bacillus 60A and Pseudomonas 11C was monitored by a thin layer chromatography bioassay method in which silica plates developed in chloroform : methanol (95: 5 v/v) were transferred to square culture dishes and overlaid with ISP-4 soft agar (0.6%) containing an inoculum of 10'-108 cfu from a fresh culture of Streptomyces 85E. After incubation at 30°C for 24 to 30 hours, fractions with activity could be identified by inhibition of sporulation in a zone over one or more spots. Active fractions were further purified by column chromatography on Sephadex LH-20, eluting with chloroform : methanol (1: 1 v/v) or methanol. The active compound from Bacillus 60A was determined by FAB-mass spectroscopy to exhibit M+at m/z 1036 and high resolution FAB- MS suggested the formula C53H93N70, 3. This formula and the source suggested surfactin.

Amino acid analysis confirmed the presence of leucine x 4, aspartic acid x 1, glutamic acid x 1 and valine xl, a composition consistent with surfactin. The pure compound matched an authentic sample (Sigma) by co-TLC and NMR spectroscopy.

In the case of Pseudomonas 11 C, similar procedures yielded a pure compound with a molecular weight of m/z 1126 and a molecular formula of C54Hg6N9O, 6, data which suggested the peptide viscosin. An amino acid composition of leucine (3), valine (1), serine (2), isoleucine (1), glutamic acid (1) and D-allo-threonine (1) (this ninth amino acid demonstrated by mass fragmentation data calculated from LRFAB-MS) and comparison as above with an authentic sample (a gift from Raymond Andersen) further confirmed this identification.

6.2. 3 STREPTOMYCES METABOLITES Additional isolates selected for chemical characterization of the compounds active in the assay were identified by 16S rDNA sequence comparisons to be distinct strains of Streptomyces, isolated from three different soil samples.

Streptomyces 171C had bactericidal activity as well as significant inhibition of Streptomyces development, as evidenced by an inner zone of complete growth inhibition

of Streptomyces 85E surrounded by an outer zone of vegetative mycelial growth lacking further development of aerial mycelium formation and sporulation. The crude culture broth also inhibited growth of B. subtilis. The concentrated crude extract from this isolate was chromatographed on reverse phase C-18 HPLC, eluting with a step gradient of methanol in water. Two UV peaks eluted closely in the 80% methanol fraction; LC/MS (API-ES+ve) analysis assigned m/z 1146 (M+ + M+) and m/z 541 (M+ + M+) to these peaks. Further separation of these peaks was achieved with a second round of reverse phase C-18 HPLC using a gradient of water/methanol/TFA from 40% methanol in 0.1% TFA/H2O to 100% methanol. Disc bioassays with Streptomyces 85E and B. subtilus assigned the bactericidal activity seen in the crude extract to m/z 1146 while the sporulation inhibitory activity was associated with m/z 541. Subsequent high resolution FAB-MS,'H and 13C NMR spectronic analysis identified m/z 1146 as berninamycin A with a formula CHNCS while m/z 541 was determined to be the macrolide pyridomycin (erizomycin), with the molecular formula C27H32N408 (Herr et al., United States Patent 3,367, 833,1968).

Streptomyces 154M produced the depsipeptide depsidomycin, with the molecular formula C38H65N9O9. The physico-chemical properties and structure determinants matched those described previously (Isshiki et al. , 1990, J. Antibiotics 33: 1195-1198).

Cyclomarin A Streptomyces D22-7B was determined to be a producer of cyclomarin A, molecular weight 1042; C56H82N8O11 previously identified from a marine source. This heptapeptide was the compound responsible for sporulation inhibition by the crude culture broth.

Depsidomycin A 1.25 litre culture of Streptomyces 154M was grown in tryptic soy broth for 72 hrs at 30°C from a 1% v/v inoculum from a freshly grown seed culture. Mycelia were harvested by centrifugation at 7880 x g. The supernatant was extracted with ethyl acetate and the mycelia pellet was extracted with 10% methanol in ethyl acetate. Both organic layers were concentrated separately in vacuo, which afforded crude active extracts. Further fractionation of the crude extract was carried out by column chromatography using normal

phase silica and chloroform and chloroform : methanol (increasing gradient) as eluting solvents. The active fraction was re-chromatographed first on a normal phase silica gel column (chloroform : methanol 99: 1 or 98: 2 % v/v) and then on a Sephadex LH-20 column in methanol. These purification steps yielded 7-8 mg of pure active compound (TDI-12).

Low resolution FAB-MS analysis suggested a molecular weight of m/z 791. The molecular formula of TDI-12 was determined to be C38H65N9O9 by high resolution FAB-MS analysis and by detailed analysis of'H and'3C NMR data. Comparison of these spectral data with the values published for depsidomycin and amino acid analysis confirmed TDI-12 to be this depsipeptide.

Pyridomycin Streptomyces 171 C had bactericidal activity as well as significant inhibition of Streptomyces development, as evidenced by an inner zone of complete growth inhibition of Streptomyces 85E surrounded by an outer zone of vegetative mycelial growth lacking further development of aerial mycelial formation and sporulation. The crude culture broth also inhibited growth of B. subtilis. A 1.8 litre fermentation of the isolate in tryptic soy broth was generated from a freshly grown seed culture and following centrifugation to remove the mycelial pellet the supernatant was extracted with ethyl acetate. The mycelial pellet was extracted with 10% methanol in ethyl acetate. After concentrating both extracts and determining their activity, they were pooled and chromatographed on C18 HPLC, eluting stepwise with a gradient of methanol in water. Two UV peaks eluted closely in the 80% methanol fraction; LC/MS (API-ES+ve) analysis assigned m/z 1145 [M+ + H] + and m/z 540 [M+ + H] + to these peaks. Further separation of these peaks was achieved with a second round of reverse phase HPLC on C18 using a gradient of water/methanol/TFA from 40% methanol in 0. 1 % TFA/Hz0 to 100% methanol. Disc bioassays with Streptomyces 85E and B. subtilis assigned the bactericidal activity seen in the crude extract to the fraction containing m/z 1146 while the sporulation inhibitory activity was associated with m/z 541.

Subsequent high resolution FAB-MS,'H and'3C NMR spectroscopic analysis identified the compound with molecular weight 1145 as berninamycin A with a formula C5, H5, N, 50, 5S while the compound with molecular weight 541 was determined to be the macrolide pyridomycin (erizomycin), with the molecular formula C27H32N408.

6.3 RESULTS 6.3. 1 DETECTION OF INHIBITORY ACTIVITY IN BACTERIAL CULTURE SUPERNATANTS A collection of Streptomycetes was screened for sensitivity to known protein kinase inhibitors. A strain isolated from a wash of a lichen sample collected in British Columbia designated WEC478-85E (hereinafter strain 85E), identified as a novel Streptomyces by 16S ribosomal DNA sequencing, was found to be exceptionally sensitive to the effects of compounds which inhibit aerial hyphae formation (Figure 1). This strain has been deposited with the American Type Culture Collection (ATCC 55824).

Streptomyces 85E sporulates very readily when grown on a minimal medium such as ISP4 but does not sporulate on tryptic soy agar.

The aerial hyphae assay has been employed to screen over two thousand bacterial culture supernatants for inhibitory activity. One hundred strains were found to produce compounds which prevented sporulation of Streptomyces 85E. Similarly, a number of known or suspected kinase inhibitors have been tested for inhibition of 85E sporulation.

6.3. 1 IDENTIFICATION OF ACTIVE COMPOUNDS From a group of 100 active strains, five highly active culture supernatants (large zones of sporulation inhibition) were selected for purification of the inhibitory compounds. Two of the producing strains were non-actinomycetes while the remaining three were Streptomyces.

Isolate 60A is a gram-positive, spore forming rod shaped bacterium. FAME analysis identified the strain as a Bacillus species with a similarity index value of 0.154 to Bacillus subtilis. The analysis of partial 16S rDNA sequence from this strain showed greatest homology to Bacillus licheniformis 1 6S rDNA (94% identity over 400 bases). The inhibitory compound was determined to be surfactin by comparison with an authentic sample (Sigma).

Isolate 11C is a gram-negative thin rod shaped bacterium. FAME analysis identified the strain as a Pseudomonas species with a similarity index value of 0.872 to P.

chloraphis or 0.719 to P. putida. The analysis of partial 16S rDNA sequence data from this strain showed greatest homology to P. putida (98% identity over 432 bases). This strain and two other Pseudomonads produced the inhibitory compound viscosin. The majority of soil isolates in this study which scored positive as producers of sporulation inhibitors were subsequently identified as strains of Streptomyces. Active compounds isolated from three strains were depsidomycin, pyridomycin and cyclomarin A. The structures of these compounds are shown in Fig. 2.

6.3. 2 ACTIVITY OF PURE COMPOUNDS ON BACTERIAL GROWTH AND DEVELOPMENT Surfactin purified from a Bacillus isolate was shown to be a very effective sporulation inhibitor, with a zone of sporulation inhibition extending to 20 mm when 10 pg of the pure compound was applied to a test disc placed on a lawn of Streptomyces 85E. A commercial sample of surfactin (Sigma) showed very similar inhibitory activity. The inhibitory effect on sporulation was persistent, lasting for at least 3 to 4 days after the unaffected areas of the culture had sporulated (Fig. 1). Surfactin at the concentrations tested was inactive against B. subtilis, S. aureus or E. coli tester strains.

Viscosin, depsidomycin, pyridomycin and cyclomarin A were also identified as specific and highly effective inhibitors of Streptomyces 85E development in the absence of generalised bactericidal activity (Table 2).

Table 2. Effects of the bioactive compounds isolated in this study on bacterial test strains.

The effects on development, measured as a zone of sporulation inhibition, recorded for Streptomyces strain 85E were produced with the application of 10 to 20 tg of each pure compound to the test disc. The effects on growth of the other strains were recorded as growth inhibition zones following application of 20 zg of each pure compound to the test disc.

Soil isolate Bioactive Effect on Effect on Effect on compound sporulation of growth of growth of isolated in this Streptomyces M. phlei B. subtilis study strain 85E and/or M aurum Bacillus strain 60A surfactin ++ (+) Pseudomonas strain I I C viscosin ++ ++- Streptomyces strain 154M depsidomycin ++ (+) Streptomyces strain 171C pyridomycin ++-- Streptomyces strain D22-7B cyclomarin A ++ ++ Streptomyces rishiriensis coumermycin ++ ++ ++: inhibition zone > 20mm +: inhibition zone > 10mm (+): very slight zone no effect seen 6.3. 3 ACTIVITY OF KNOWN SIGNAL TRANSDUCTION INHIBITORS ON SPORULATION OF STREPTOMYCES STRAIN 85E As controls, a number of known protein kinase inhibitors were tested for their effects on Streptomyces sporulation. Compounds such as genistein and staurosporine were found to delay the onset of sporulation for a limited time but the most striking results (Table 3) were seen with members of the tyrphostin family such as AG-1478, AG-490 and AG-1295.

Table 3. Effects of different tyrphostins, known protein tyrosine kinase inhibitors on sporulation of Streptomyces strains Compound Amount on Zone of inhibition of Zone of inhibition of disc, tig sporulation of Streptomyces sporulation of S. griseus, 85E, mm mm DMSO control 0 0 AG-1478 50 30 15 20 25 15 10 20 11 AG-490 50 15 15 20 0 9 10 0 0 AG-1295 50 11 0 20 12 0 10 12 0 Genistein 400 14 0 The tyrphostins AG-1478 and AG-1295 were most effective; as little as 10 llg applied to a culture of Streptomyces 85E delayed the onset of sporulation. The tyrphostins were also active in inhibiting development of S. griseus ; comparison of the sizes of the inhibition zones provides an example of the generally greater degree of inhibition seen when Streptomyces 85E is employed as the indicator strain.

A large culture collection of fungi and actinomycetes has been screened for inhibitory activity against isolated enzymes such as a bacterial histidine kinase (Trew et al., Novel streptopyrroles from Streptomyces rimosus with bacterial protein histidine kinase inhibitory and antimicrobial activities. J. Antibiotics 53: 1-11,2000, which is incorporated herein in its entirety), as well as for inhibitors of cytokine production and signalling in cell- based assays of macrophage activation (Rawlins et al. , Inhibition of endotoxin-induced TNFa production in macrophages by 5Z-7-oxo-zeaenol and other fungal resorccyclic acid lactones. Int. J. Immunopharmacol. 21: 799-814,1999 ; and Wrigley et al. , A novel (6S)- 4, 6-dimethyldodeca-2E, 4E-dienoyl ester of phomalactone and related a-pyrone esters from a Phomopsis sp. with cytokine production inhibitory activity. J. Antibiotics. 52: 862-872, 1999, which are incorporated herein in their entirety) and CD28 signal transduction.

Several of the identified compounds were active in inhibiting sporulation of Streptomyces 85E (Table 3) with the two most active being inhibitors of macrophage activation and CD28 signal transduction. A potent inhibitor of a bacterial histidine kinase (XR587) inhibited growth of Streptomyces 85E with no discernible effect on sporulation. The two compounds most active against 85E were also capable of inhibiting growth of mycobacterial test strains.

XR774, the principal inhibitor found in the CD28 signalling assay, was specific in its antimycobacterial activity having no effect on B. subtilis growth, whereas XR379 also inhibited B. subtilis (Table 4).

6.3. 4 EFFECTS OF SPORULATION INHIBITORS ON MYCOBACTERIA The compounds described above were tested for inhibition of several mycobacterial strains. Mycobacteria have been shown to contain eukaryotic-like protein kinase genes29) and it was of interest to see if inhibitors of development isolated from streptomycetes would interfere with the growth of mycobacteria. The results are shown in Tables 2 and 4. It should be noted that surfactin and viscosin had only weak activity against some strains but pyridomycin and cyclomarin A were good inhibitors of M. tuberculosis.

TABLE 4. Effects of novel signal transduction inhibitors on bacterial test strains.

The effects on development, measured as a zone of sporulation inhibition, recorded for Streptomyces strain 85E were produced with the application of 20 to 100 ug of each pure compound to the test disc. The effects on the mycobacterial strains were recorded as growth inhibition zones following application of similar quantities of each pure compound to the test disc.

XR compounds Screen where Chemical Sporulation Growth detected description inhibition inhibition of activity on 85E M. aurum and/or M. phlei XR-543 Macrophage Phomalactone-- activation derivative inhibition XR-379 Macrophage Analogue of ++ ++ activation XR-543 inhibition

XR-336 Macrophage Resorcylic acid + + activation lactone inhibition XR-318 Macrophage Resorcylic acid + activation lactone inhibition XR-665 Macrophage Phomalactone + activation inhibition XR-315 Macrophage Brefeldin A activation inhibition XR-475 Macrophage Geldanamycin activation inhibition XR-774 CD28 signal Benzofluoranthe ++ + transduction ne metabolite inhibitor XR-819 CD28 signal Oxidised transduction analogue of XR- inhibitor 774 XR339 from ++ ++ Cladosporium XR-587 Histidine kinase Streptopyrrole Bactericidal ++ inhibitor ++: inhibition seen with 20 pg/disc +: inhibition seen with 100 pg/disc no effect seen 6.4 DISCUSSION The variety of natural products found to inhibit sporulation of Streptomyces sp. further illustrates the potential of the screen for detection of a wide range of chemical moieties (Fig. 1). Development of aerial mycelia was profoundly affected by surfactin and viscosin, both lipopeptides with biosurfactant properties. Biosurfactants have the ability to

partition within membranes and it is possible that a perturbation at the cell membrane acts in a non-specific manner to disrupt a signalling pathway involved in Streptomyces development. However, recent studies of the surfactin biosynthesis genes and mutations in these genes provide some evidence that surfactin may be a regulatory molecule in Bacillus strains. Hence, surfactin and viscosin may be acting in a specific manner to disrupt developmental signals in Streptomyces.

The novel reduced benzofluoranthrene metabolite XR774 was a very potent inhibitor of Streptomyces 85E development and an antimycobacterial agent; this compound was detected in a screen for inhibitors of CD28 induced cytokine production and was subsequently shown to inhibit selected protein tyrosine kinases including Fyn, Lck, Abl and EGF-R in in vitro assays with IC50 values in the range 20-400 nM. Its oxidized derivative XR819, which is not a CD28 signal transduction inhibitor, was inactive in inhibiting sporulation or mycobacterial cell growth, confirming the specificity of the bacterial assay.

Another strong inhibitor of sporulation and mycobacterial cell growth, XR379 was identified as an inhibitor in a macrophage activation assay and was also inhibited the in vitro Src assay.

It has been found recently that a number of bacterial strains possess multiple function protein kinases. Mycobacteria are among the bacterial genera that have such kinases and the completion of the genome sequence of M. tuberculosis led to the identification of some eleven different kinase genes. Inhibitors of 85E sporulation were tested for their effect on mycobacterial growth. Surfactin and viscosin inhibit M. tuberculosis and M. avium-intracellulare at MICs of 10-20 ug/ml with no activity against other human pathogens tested. Depsidomycin was shown to have antibacterial and immunosuppressive activity. Pyridomycin and cyclomarin A are shown to be potent and specific in vitro inhibitors of mycobacterial species including M. tuberculosis. Compound XR774 was also active against certain mycobacterial species and some 25% of the crude extracts of streptomycete strains active in sporulation inhibition also inhibited M. aurum.

These results suggest that there are signal transduction targets that can be used for the identification of novel classes of drugs for the treatment of tuberculosis and other mycobacterial diseases.

It is important to note that several of the active compounds were non- ribosomal peptides. Protein kinase inhibitors identified by the methods of the invention offer a good possibility for the development of a new class of antimycobacterial drugs.

The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

Various references are cited herein, including patents, patent applications, and scientific literature, the disclosures of which are incorporated by reference in their entireties for all purposes.