Provisional Application Serial No. 60/281,119 filed April 3, 2001.

Background of the Invention Field of the Invention The invention relates generally to novel methods for detecting an activity of an enzyme catalyzing a reaction wherein a saccharide moiety is transferred to a protein (referred to as"protein glycosyltransferase") and novel methods for identifying a compound which modulates an activity of a protein glycosyltransferase. More particularly, the invention relates to novel methods for detecting an activity of a protein glycosyltransferase using a tag-fused protein and novel methods for identifying a compound which modulates an activity of a protein glycosyltransferase using a tag-fused protein.

Background of the Invention During the last ten years, numerous reports have indicated that many cytoplasmic and/or nuclear proteins are glycosylated in 0-glycosidic linkage by a single beta-N-acetylglucosamine moiety (0-GlcNAc) at hydroxyl residues of serine or threonine. O-GlcNAc modification (0-GlcNAcylation) is a well-characterized post-translational modification of proteins similar to protein phosphorylation (Kelly, W. G.. and Hart, G. W., Cell, 57, 243-251 (1989) : Snow, D. M., and Hart, G. W., Int.

Rev. C. vtol., 181, 43-74 (1998); and Comer, F. I., and Hart, G. W., J. Biol.

Chem., 275,29179-29182 (2000)).

Many proteins have been identified to be O-GlcNAcylated, including RNA polymerase II (Kelly, W. G., et al., J. Biol. Chem., 268, 10416-10424 (1993)), nuclear and cytoskeletal proteins (Hart, G. W., Annu. Rev.

Biochem., 66,315-335 (1997)) such as RNA polymerase II transcription factors (Comer, F. I., and Hart, G. W., Biochem. Biophys. Acta, 1473, 161-171 (1999); Jackson, S. P., and Tjian, R., Cell, 55, 125-133 (1988); and Medina, L, et al., G1vcob1o1oqy. 8, 383-391 (1998)), nuclear pore proteins (Starr, C. M., and Hanover, J. A., J. Biol. Chem., 265, 6868-6873 (1990) ; Holt, G. D., et al., J. Cell. Biol., 104, 1157-1164 (1987)) including p62 (Lubas, W. A. et al., Biochemistry, 34,1686-1694 (1995)), tumor suppressors (Shaw, P., et al., Oncogene, 12,921-930 (1996)), oncogenes (Chou, T. Y., et al., J. Biol. Chem., 270, 18961-18965 (1995); and Privalsky, M. L., J. Virol., 64, 463-466 (1990)), steroid receptors (Jiang, M. S., and Hart, G. W., J. Biol. Chem., 272,2421-2428 (1997)), cytoskeletal proteins such as Tau (Arnold, C. S., et al., J. Biol. Chem., 271, 28741-28744 (1996)), Talin (Hagmann, J., et al., J. Biol. Chem., 267, 14424-14428 (1992)), neurofilaments (Dong, D. L. Y., et al., J. Biol. Chem., 268, 16679-16687 (1993)), cytokeratins (Guan, K. L., Cell. Signal., 6, 581-589 (1994)) and clathrin assembly protein AP-3 (Murphy, J. E., et al., J. Biol. Chem., 269, 21346-21352 (1994)).

0-GIcNAcylation occurs in the cytosol and nucleus through the addition of a single monosaccharide, while the formation of complex glycoproteins occur in the Golgi apparatus or endoplasmic reticulum.

Turnover of O-GlcNAcylation is as rapid as changes in the phosphorylation state of proteins, as shown in the case of cytokeratins (Chou, C. F., et al., J. Biol. Chem.. 267, 3901-3906 (1992)) or alpha-B-crystallin (Roquemore, E. P., et al., Biochemistry. 35, 3578-3586 (1996)).

0-GlcNAcylation and phosphorylation interact and/or depend on each (Kelly, W. G., et al., J. Biol. Chem., 268, 16679-16687 (1993); Griffith, L. S., et al., Eur. J. Biochem, 262, 824-831 (1999)). Most proteins that can be O-GlcNAcylated also can be phosphoprylated.

O-GlcNAcylation is thought to be involved in the regulation of many cellular functions such as protein synthesis (Datta, B., et al., J. Biol.

Chem., 264, 20620-20624 (1989)), neurofilament assembly (Dong, D. L. Y., et al., J. Biol. Chem.. 268, 16679-16687 (1993)) and transcription (Comer, F. I., and Hart, G. W., Biochim. Bhiph. vs. Acta., 1473, 161-171 (1999)).

Moreover, it has been implicated in the involvement of diabetes (Marshal l, S., et al., J. Biol. Chem., 266, 4706-4712 (1991) ; Yki-Jarvinen, H., et al., Metabolism, 47,449-455 (1998) ; and Hebert, L. F. Jr., et al., J. Clin.

Invest., U98U, 930-936 (1996)) and neurologic disease (Arnold, C. S., et al., J. Biol. Chem., 271, 28741-28744 (1996); Griffith, L. S., et al., J.

Neurosci. Res., 41,270-278 (1995) ; Griffith, L. S., et al., Biochem. Biophvs. Res. Commun., 213, 424-431 (1995); Alonso, A. D., et al., Nat. Med., 2,783-787 (1996)).

0-GlcNAcylation is thought to be catalyzed by uridine diphospho-N-acetylglucosamine : polypeptide N-acetylglucosaminyl transferase (0-GlcNAc transferase is referred to as"OGT"). This enzyme has been purified from rat liver (Haltiwanger, R. S., et al., J. Biol. Chem.

267, 9005-9013 (1992)), and cDNAs thereof have been cloned molecularly with respect to rat, human and nematoda (Kreppel, L. K., et al., J. Biol.

Chem., 272, 9308-9315 (1997); Lubas, W. A., et al., J. Biol. Chem., 272, 9316-9324 (1997) ; Kreppel, L. K., and Hart, G. W., J. Biol. Chem., 274, 32015-32022 (1999); and Lubas, W. A., and Hanover, J. A., J. Biol. Chem., 275, 10983-10988 (2000)). The sequence homology of nucleotide sequence between OGT and any of the known glycosyltransferases (Kreppel, L. K., et al. (1997) id.) is low. OGT is found in the cytoplasm and nucleus of cells (Kreppel, L. K., et al. (1997) id.), and it has a high affinity for UDP-GlcNAc (Haltiwanger, R. S., et al. (1992) id. ; and Kreppel, L. K., and Hart, G. W. (1999) id.).

Current methods to detect OGT activity or to identify a modulator of OGT are inconvenient, tedious and time-consuming because such methods use column chromatography (Haltuwanger, R. S., et al., id.) or membrane (Lubas, W. A., et al., BiochemistrY, 34,1686-1694 (1995)).

Summary of the Invention In accordance with the present invention, we have discovered novel methods to detect activity of uridine diphospho-N-acetylglucosamine: polypeptide beta-N-acetylglucosaminyltransferase (EC 2.4.1. 94; referred to as"OGT") using a protein fused with a tag such as polyhistidine, myc, flag or glutathione S-transferase (referred to herein as"GST").

The present invention also concerns novel methods to identify a modulator of OGT using a protein fused with a tag such as oligohistidine or polyhistidine, myc, flag or GST. The methods are suitable to high throughput screening system. An identified modulator is useful for treating or preventing diseases characterized by an increased or a decreased glycosylation of proteins such as diabetes.

Moreover, the present invention provides novel methods to detect OGT activity and to identify a compound which modulates OGT activity by using immunopurified OGT.

Brief Description of the Drawings Figure 1 is a graph which shows the dose-dependent ability of UDP (uridine diphosphate) to inhibit OGT activity measured by using the OGT-TCA assay as described in Example 5.

Figure 2 is a graph which shows enzyme dependent O-GlcNAcylation of p62 fused with polyhisitidine as a tag (referred to as"Histag-p62") detected by the OGT-TALON assay described in Example 6.

Figure 3A is a graph which shows anti-OGT antibody dependent detection of O-GlcNAcylated Histag-p62 by the OGT-TALON assay described in Example 7.

Figure 3B is a graph which shows Protein A-agarose dependent O-GlcNAcylation of Histag-p62 detected by the OGT-TALON assay described in Example 7.

Figure 3C is a graph which shows enzyme dependent O-GlcNAcylation of Histag-p62 detected by the OGT-TALON assay described in Example 7.

Figure 3D is a graph which shows UDP-GlcNAc dependent O-GlcNAcylation of Histag-p62 detected by the OGT-TALON assay described in Example 7.

Figure 4 is a graph which shows an inhibitory activity of UDP on OGT measured by the OGT-FLASH PLATE-assay described in Example 8.

Detailed Description of the Invention The present invention discloses novel methods and novel kits such as (1) to (17) below.

(1) The present invention discloses a method to detect an activity of O-GlcNAc transferase (OGT) which comprises the following steps: (a) contacting a sample which is suspected to contain OGT with both at least one donor and at least one acceptor fused with a tag; and (b) measuring the amount of O-GlcNAc moUety on the acceptor fused with a tag.

(2) A method according to (1), wherein at least one acceptor fused with a tag is p62 or active fragment thereof fused with a tag.

(3) A method according to (2), wherein a tag comprises oligohistidine or polyhistidine.

(4) A kit for detecting an activity of O-GlcNAc transferase (OGT), which comprises at least one acceptor fused with a tag and at least one donor.

(5) A kit according to (4), wherein at least one acceptor fused with a tag is p62 or active fragment thereof fused with a tag.

(6) A kit according to (4) or (5), wherein a tag comprises oligohistidine or polyhistidine.

(7) A kit according to any of claims (4) to (6) which comprises at least one coated support which can trap at least one acceptor fused with a tag.

(8) A method to identify a compound which modulates an activity of 0-G1cNAc transferase (OGT) which method comprises the following steps: (a) contacting OGT with both at least one donor and at least one acceptor fused with a tag in the presence and absence of a test compound; (b) measuring an amount of O-GlcNAc moiety on the acceptor fused with a tag; (c) comparing an amount of 0-GIcNAc moiety on the acceptor fused with a tag measured in step (b) in the presence of the test compound with that in the absence of the test compound; and (d) determining whether the test compound is a modulator of OGT, the test compound being a modulator of OGT when an amount of 0-GIcNAc on the acceptor fused with a tag in the presence of the test compound is greater or less than that in the absence of the test compound.

The present invention is also directed to compounds identified by the above method (8). The present invention is further directed to the use of such compounds to produce a pharmaceutical composition for treating or preventing a disease characterized by an increased or a decreased glycosylation of proteins such as diabetes, obesity and neurological diseases. Still further, the present invention relates to a method for treating or preventing such diseases in a human by administering to a human a pharmaceutically effective amount of at least one of such compounds either alone or in combination with a pharmaceutically acceptable carrier.

(9) A method according to (8), wherein at least one acceptor fused with a tag is p62 or active fragment thereof fused with a tag.

(10) A method according to (8) or (9), wherein the tag comprises oligohistidine or polyhistidine.

(11) A method according to any of (8) to (10), wherein a modulator is an inhibitor.

(12) A method according to any of (8) to (11), wherein the O-GlcNAc transferase has been immunopurified by using an anti-O-GlcNAc transferase antibody.

(13) A kit for identifying a compound which modulates an activity of O-GlcNAc transferase (OGT), wherein such kit comprises at least one acceptor fused with a tag, at least one donor and 0-GIcNAc transferase.

(14) A kit according to (13), wherein at least one acceptor fused with a tag is p62 or an active fragment thereof fused with a tag.

(15) A kit according to (13) or (14), wherein the tag comprises oligohistidine or polyhistidine.

(16) A kit according to any of (13) to (15), wherein OGT has been immunopurified by using an anti-0-GIcNAc transferase antibody.

(17) A kit according to any of (13) to (16), wherein such kit comprises at least one coated support which can trap at least one acceptor fused with a tag.

The present invention provides novel methods to detect an activity of OGT. The reaction catalyzed by OGT is summarized as follows: donor having N-acetylglucosamine (GlcNAc) moiety + acceptor - O-GIcNAcylated acceptor + deGlcNAcylated donor The present invention provides a novel method for detecting a catalytic activity of OGT as mentioned above. The method comprises the following steps: (a) contacting a sample which is suspected to contain OGT with both at least one donor and at least one acceptor; and (b) measuring an amount of O-GlcNAc moiety on the acceptor; The term"donor"means a molecule which has at least one N-acetylglucosamine moiety intramolecularly such as uridine diphospho-N-acetylglucosamine (referred to as"UDP-GlcNAc"). Preferably, the"donor"is UDP-GlcNAc.

In addition, the donor can be labeled. Preferably, the donor can be labeled with at least one radioactive atom per molecule such as 3H and 14C. More preferably, the"donor"can be labeled with tritium (3H). The most preferable labeled donor is [6-3H] UDP-GlcNAc.

The term"acceptor"means a protein which can be glycosylated in 0-glycosidic linkage by a beta-N-acetylglucosamine (referred to 0-GIcNAc herein) including nuclear and cytoskeletal proteins such as RNA polymerase II, RNA polymerase transcription factors, nuclear pore proteins, tumor suppressors, oncogenes, steroid receptors, cytosleletal proteins, neurofilaments, cytokeratins, clathrin assembly protein AP-3 and p62 herein. Preferably, the"acceptor"is a protein described above fused with a tag selected from a group comprising oligohistidine, polyhistidine, myc, flag, GST or the like. More preferably, the"acceptor"is p62 or an active fragment thereof which is fused by a tag selected from the group comprising oligohistidine, polyhistidine, myc, flag and GST. The most preferable acceptor is p62 or an active fragment thereof fused with a tag consisting of oligohistidine or polyhistidine (referred to as"Histag-p62").

The phrase"active fragment"means a peptide which consists of a part of a full-length peptide and which can be O-GlcNAcylated by OGT. The phrase"active fragment of p62"means a peptide which consists of a part of a full-length p62 protein and which can be 0-GIcNAcylated by OGT.

For instance, a Histag-p62 can be obtained as follows: A polynucleotide encoding p62 or an active fragment thereof can be amplified by a reverse transcript polymerase chain reaction (RT-PCR).

A sense/forward primer and an antisense/reverse primer are chemically synthesized oligonucleotides designed on the basis of known nucleotide sequences encoding them such as Genbank Accession No. X52583, which can anneal with an antisense strand and a sense strand of a polynucleotide encoding p62 or an active fragment thereof, respectively. RT-PCR can be carried out by using a pair of primers and appropriate RNA such as total RNA and messenger RNA (referred to as"mRNA") as a template.

For the purpose of obtaining a cDNA encoding rat p62a polynucleotide encoding p62 (Genbank Accession No. X52583), rat adipocyte mRNA can be preferably used as a template.

A cloned p62 or active fragment thereof can be fused to a tag. In the present invention, the term"tag"has a meaning as understood by a person of ordinary skill in the art.

For example, a cloned nucleotide encoding p62 or an active fragment thereof can be fused to a nucleotide encoding an oligohistidine such as hexa-histidine by the insertion of a cloned nucleotide encoding p62 or an active fragment thereof into a commercially available expression vector such as pQE30 (QIGEN Inc.).

The resultant recombinant vector can be introduced into a prokaryote host cell such as an Escherichia coXi host cell or an eukaryote host cell to express p62 or an active fragment thereof in said host cell.

The expressed Histag-p62 can be extracted and purified by a metal chelation affinity chromatography or the like from the host cell lysate.

Besides Histag-p62, other acceptors fused with tags can be also obtained by similar methods to those mentioned above.

A sample, which is suspected to contain OGT (referred to as a"test sample"), can be selected from a group comprising a crude fraction, a partially purified fraction and a purified fraction. A crude fraction of a test sample can be obtained from appropriate biological sources, for example, an organ such as the brain, liver and heart; or a cell such as adipocytes, cell lines HepG2, 3T3-L1, Hela, Jurkat and U937 ; or blood or a body fluid. A test sample is not restricted to those mentioned. Said biological sources can be derived from an organism such as a human or a non-human animal.

When a test sample is contacted with both at least one donor and at least one acceptor, a condition employed for said contact can be selected from conditions suitable for usual enzymatic reactions.

The pH is usually settled between 6 to 8 by an appropriate buffer such as Tris/HC1 buffer and Hepes buffer. Inorganic salts can be added to a reaction mixture used for said contact, such as MgCl2 at an appropriate concentration between 1mM and 20mM, NaCl at an appropriate concentration lower than 20mM and NaH2PO4 at an appropriate concentration lower than lOmM.

An incubation temperature is usually a temperature between 4 to 37°C, preferably between 15 to 33°C, more preferably between 20 to 30°C. An incubation time of such contacting depends on other factors of the contacting conditions, but it is usually selected from 5 minutes to 24 hours, preferably, 10 minutes to 1 hour. Such contact can be performed in a test tube made of glass, a test tube made of polypropylene, or in a well on a multi-clustered plate (also called a microtiter plate).

After contacting a test sample with both at least one donor and at least one acceptor, the amount of O-GlcNAc moiety on the acceptor can be measured. When the contact is carried out in a aqueous solution, such amount can be measured as a concentration of O-GlcNAc moiety on the acceptor in a solution.

If necessary, further steps can be added before measuring an amount of O-GlcNAc moiety on at least one acceptor. Such further steps are selected from a group comprising techniques preferably employed for the separation of the acceptor from the donor (referred to as a"B/F separation"). Such separation can be carried out using usual techniques suitable for a separation of a soluble fraction from an insoluble fraction, which are well known to a person of ordinary skill in the art. Precipitation of protein using reagents such as trichloroacetic acid (referred to as "TCA"), ammonium sulfate, polyethylene glycol can be available for B/F separation. An immunoprecipitation using an antibody or an antiserum (also referred to as an"antibody"), which specifically recognizes and binds the acceptor, can be also used for said separation. An antibody can be obtained by any suitable technique to prepare an antibody that specifically binds a certain antigen, which are well known to a person of ordinary skill in the art.

The acceptor can be precipitated by the addition of at least one insoluble resin which recognizes and binds to said acceptor. For example, a resin can be a metal-chelating resin such as a nickel-chelating resin which is preferably used when the acceptor is fused with oligohistidine or polyhistidine. For example, TALON (BD Biosciences Clontech) is known to be a nickel-chelating resin.

After precipitation, filtration or centrifugation of the reaction mixture can be preferably employed to obtain an acceptor free from a donor before measuring an amount of O-GlcNAc moiety on the acceptor Then, the amount of O-GlcNAc moiety on an acceptor can be measured by using usual techniques which are well known to a person of ordinary skill in the art. Such measuring techniques have no limitation and can be selected depending on both the acceptor and the donor. The measurements can be spectrophotometrical, spectrofluorimetric, immunological, radiochemical or the like.

When a radiolabeled molecule having GlcNAc moiety is used as a donor, the amount of G1 cNAc moi ety on an acceptor can be measured radiochemically with or without a liquid scintillator or scintillant. When [6-3H] UDP-GlcNAc is used as a donor, the amount of [6-UDP-GlcNAc moiety on an acceptor can be measured with a 1 i qui d sci nti 11 ator or sci nti 11 ant.

When the acceptor is fused with a tag, the 0-GIcNAcylated acceptor fused with a tag can be substantially separated, not only by a usual B/F separation step as mentioned above, but also by using a coated support which can trap said acceptor fused with a tag from the donor. When oligohistidine or polyhistidine is used as a tag, the acceptor fused with a tag can chelate nickel atom bound to a support. A support can be selected from a group comprising a well on a microtiter plate, beads or the like.

A coated support can be obtained by the coating of a support with a metal such as nickel and a scintillant or scintillator. Nickel-chelate Scintillation Proximity Assay (SPA) beads (Amersham Pharmacia Biotech) and Ni-chelate Flash Plate PLUS (New England Nuclear) are commercially available and used to trap an acceptor fused with an oligohistidine or a polyhistidine such as Histag-p62.

The present invention also provides methods to identify compounds which modulate an activity of OGT which comprises the following steps: (a) contacting OGT with both at least one donor and at least one acceptor fused with a tag in the presence or absence of a test compound; (b) measuring an amount of O-GlcNAc moiety on the acceptor fused with a tag ; (c) comparing an amount of O-GlcNAc moiety on the acceptor fused with a tag measured in step (b) in the presence of the test compound with that in the absence of the test compound; and (d) determining whether the test compound is a modulator of OGT, the test compound being a modulator of OGT when an amount of O-GlcNAc on the acceptor fused with a tag in the presence of the test compound is greater or less than that in the absence of the test compound.

OGT used in the methods can be selected from a group comprising a crude, a partially purified and a purified fraction containing OGT, and an isolated OGT. Such OGT can be prepared as follows: A crude fraction of OGT can be obtained from appropriate biological sources, for example, an organ such as the brain, liver and heart: or a cell such as adipocytes, cell lines HepG2,3T3-L1, Hela, Jurkat and U937, or blood or a body fluid. The brain and liver are preferable sources. Sources of OGT are not restricted to those mentioned. Such biological sources can be derived from an organism such as a human or a non-human animal. A preferable organism is a human or rat.

OGT can be extracted by using usual techniques that are well known to a person of ordinary skill in the art. An example of said extraction methods is described as follows: Polyethylene glycol (referred to as"PEG"herein) such as PEG 8000 is added to the cytosol fraction of lysed biological sources. After precipitation of proteins by PEG, the pellets are obtained by centrifugation in order to remove salts and substances which are suspected to affect an activity of OGT. The pellets including OGT activity are re-suspended in an appropriate amount of a buffer and the resultant suspension is used as a crude fraction of OGT.

A purified or partially purified fraction containing OGT can be obtained from a crude fraction containing OGT by usual techniques employed to purify a protein which are known to a person of ordinary skill in the art. Such techniques include processes of chromatography such as ammonium sulfate precipitation ; hydrophobic interaction chromatography using a resin such as Phenyl-Sepharose 4B (Pharmacia Biotech) : and anion exchange chromatography using a resin such as Q-Sepharose Fast Flow (Parmacia Biotech).

A recombinant OGTis alsowithin the scope of the present invention.

A recombinant enzyme can be obtained by any usual gene manipulation techniques which are well known to a person of ordinary skill in the art such as the following: a polynucleotide encoding a full length OGT or a partial polypeptide thereof having OGT activity (also referred to as "OGT") amplified by PCR or RT-PCR on the basis of known nucleotide sequences such as Genbank Accession No. U76557 can be inserted into an expression vector, then the inserted expression vector can be introduced into a prokaryote or an eukaryote host cell. The resultant host cell having said vector can be fermented in a culture medium, and then, the desired recombinant protein can be obtained from the fermentation product through extraction steps, purification steps and/or isolation steps or the like.

An OGT can be immunopurified by using an anti-OGT antibody and/or an anti-OGT antiserum (referred to"anti-OGT antibody"). Anti-OGT antibody can be obtained by any usual chromatography which is well known to a person of ordinary skill in the art. Animals such as mice, rabbits or rats can be immunized with purified, partially purified or isolated OGT or a fragment thereof. Also, chemically synthesized or recombinant OGT or a fragment thereof can be used as an immunogen. The immunized animals are grown and then blood is recovered therefrom. Anti-OGT antibody is purified by any usual chromatography technique which is well known to a person of ordinary skill in the art (Kreppel L. K. et al., J. Biol. Chem., 272, 9308-9315 (1997)). An organism which is immunized by OGT is preferably different from the organism which said OGT is derived from. The anti-OGT antibody is useful for the immunological purification of OGT and/or the immunological detection of OGT.

In the present invention, the term"OGT"includes any mutants and any derivatives of OGT wherein at least one amino acid is deleted, added, inserted or changed which have activities of OGT. Such mutants or derivatives can be obtained from a culture of a host cell transformed by a vector which comprises a nucleotide encoding any of said mutants and derivatives of OGT. A nucleotide encoding any of said mutants and derivatives can be cloned by one or more than one selected from a group consisting of a deletion, an addition, an insertion and a change of at least one nucleotide on a polynucleotide encoding a full length OGT using nuclease digestion, polymerase chain reaction or the like. Chemically, genetically or biologically modified OGTs are also included in"OGT"in the present invention. Naturally occurring OGT analogues having activities of OGT are also included in the meaning of the term"OGT".

The methods for obtaining OGT are not restricted to those described herein.

A test compound can be a chemically synthesized compound, an isolated chemical compound, a chemical compound purified or partially purified from a biological sample or a crude extract of a biological sample containing a test compound. Biological samples can be derived from a fermentation product of a microorganism, from a plant, or from a human or a non-human animal. A preferable test sample is free from other substances which can disturb an enzymatic reaction catalyzed by OGT or which can disturb a measurement of an amount of GlcNAc moiety on an acceptor.

A test compound can be incubated with OGT before, during or after said test compound is contacted with the donor and/or the acceptor.

Conditions employed for said incubation are the same as those employed for methods to detect an activity of OGT described elsewhere.

The methods for identifying a modulator of OGT are suitable for a high throughput drug screening system.

In the present invention, a modulator of OGT is an activator thereof or an inhibitor thereof. When an amount of O-GlcNAc on the acceptor in the presence of the test compound is greater than that in the absence of the test compound, the test compound is determined to be an activator of OGT.

When an amount of O-GlcNAc on the acceptor in the presence of the test compound is less than that in the absence of the test compound, the test compound is determined to be an inhibitor of OGT.

An activator of OGT can be used to treat or to prevent diseases characterized by decreased glycosylation of proteins. An inhibitor of OGT can be used to treat or to prevent diseases characterized by increased glycosylation of proteins (referred to as a"saccharometabolic disease" in the present application). Such disease may include diabetes ; diabetic complications such as diabetic retinopathy, diabetic nephropathy, diabetic neuropathy, diabetic angiopathy; dyslipidaemia such as hyperlipemia; obesity ; neurological diseases such as Alzheimer's disease, amyotrophic lateral sclerosis, neuropathy, and neuralgia; and cancers such as colon cancer, lung cancer, prostate cancer, skin cancer, and leukemia.

The present invention also provides a kit which is used to identify a modulator of OGT. The kit comprises at least one acceptor which is preferably fused with a tag, at least one donor and OGT. Preferably, the kit comprises at least one coated support which can trap an acceptor fused with a tag. Such kits are useful for identifying a modulator of OGT which can be employed to treat or to prevent saccharometabolic diseases.

Moreover, the methods for detecting an activity of OGT can be also employed to detect an activity of OGT in a test sample for diagnosing saccharometabolic diseases.

When the methods are employed for diagnosis, a test sample can be derived from an organism such as a human or a non-human animal. The more preferable methods employed for diagnosis comprise the following steps : (a) contacting a test sample derived from an organism which is (i) suspected to have at least one saccharometabolic disease characterized by an increased or a decreased glycosylation of proteins or at a risk thereof or, (ii) a control sample derived from a healthy organism with both at least one donor and at least one acceptor fused with a tag ; (b) measuring an amount of O-GlcNAc moiety on the acceptor fused with a tag; (c) comparing an amount of O-GlcNAc moiety on the acceptor fused with a tag measured after the test sample derived from an organism which is suspected to have at least one saccharometabolic disease or a risk thereof was contacted with that measured after the control sample derived from a healthy organism was contacted; (d) determining that the organism which is suspected to have at least one saccharometabolic disease or a risk thereof has at least one saccharometabolic disease or a risk thereof when an amount of O-GlcNAc on the acceptor fused with a tag measured after the test sample derived from said organism was contacted is greater or less than that measured after the control sample derived from a healthy organism was contacted.

The present invention also provides a kit which is used to detect an activity of OGT. The kit comprises an acceptor fused with a tag and a donor. Preferably, the kit comprises at least one coated support which can trap an acceptor fused with a tag. Such kits are useful for diagnosing saccharometabolic diseases.

The present invention provides methods of treating or preventing saccharometabolic diseases.

For a saccharometabolic disease characterized by an increased glyclosylation of proteins, several approaches are available. One approach comprises administering to a subject or patient, such as a mammal, such as a human, an inhibitor compound (an antagonist including an inverse agonist) as hereinabove described along with a pharmaceutically acceptable carrier in an amount therapeutically effective to inhibit O-GlcNAcylation of an acceptor by OGT.

For a saccharometabolic disease characterized by a decreased glycosylation of proteins, several approaches are available. One approach comprises administering to a subject or patient, such as a mammal, such as a human, an activator compound (an agonist) as hereinabove described, along with a pharmaceutically acceptable carrier in an amount therapeutically effective to inhibit 0-GlcNAcylation of an acceptor by OGT.

The compounds of the present invention which modulate OGT activities may be formulated in combination with a suitable pharmaceutical carrier. Such formulations comprise a therapeutically effective amount of the compound, and a pharmaceutically acceptable carrier or excipient.

Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration, and would be well within the knowledge of a person of ordinary skill in the art. The present invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the present invention.

The compounds of the present invention which modulate OGT activities may be employed alone or in conjunction with other compounds, such as therapeutic compounds.

Forms of systemic administration of the pharmaceutical compositions include injection such as intravenous, subcutaneous, intramuscular, or intraperitoneal injection ; transmucosal or transdermal administration using penetrants such as bile salts or fusidic acids or other detergents; enteric or encapsulated ormulations ; oral administration may also be possible. Administration of these compounds may also be topical and/or localized, in the form of salves, pastes, gels or the like.

The dosage range required depends on the choice of compounds of the present invention or the route of administration, the nature of the formulation, the nature of the condition of the subject or patient, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.01 to 100 mg/kg of weight of the subject per day.

Wide variations in the required dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intraveneous injection. Variations of these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art.

EXAMPLES The present invention is further illustrated by the following examples. These examples are provided to aid in the understanding of the invention and are not construed as a limitation thereof.

Example 1. Cloning and Expression of His-tag p62 Acceptor 1) Cloning and Construction of His-taq p62 Expression Plasmid.

Full-length cDNA encoding rat p62 (SEQ ID NO. 3oGenbank Accession No. X52583) was obtained according to Starr, et al. (Starr, C. M., et al., J. Cell. Biol. 110, 1861-1871 (1990)). A part of p62 cDNA (nucleotide number of X52583; 1433 to 2218 of the nucleotide sequence of SEQ ID NO : 3) was amplified by a polymerase chain reaction, using a full length cDNA of rat p62 as a template and a pair of oligonucleotides as primers as follows : 5'GTGGGATCCCTCTCAGCTCCAGCGACAACT 3' (SEQ ID NO : 1) 5'CCTCCTCTGCAGCAGGGCAGAGCTCTGGTC 3' (SEQ ID NO : 2).

The amplified DNA was inserted into a vector pQE30 (QIAGEN Inc.) after the vector was digested by restriction enzymes BamHI and SacI.

The resultant recombinant vector carried a nucleotide encoding a part of p62 (from a serine at 240th to a serine at 495th of the amino acid sequence of SEQ ID NO : 3 ; SEQ ID NO : 4) with a hexa-histidine tag sequence at N-terminal region therof, and additional amino acids encoded in the original pQE30 vector. The nucleotide sequence of Histag-p62 was determined and the corresponding amino acid sequences were predicted (SEQ ID NO : 5). It was also predicted to have 279 amino acids and have a molecular weight of approximately 30k.

2) Expression and Purification of His-tag p62.

Escherichia coZi M15-pREP4 (QIAGEN Inc.) was transformed by the recombinant vector obtained in 1). The transformant in 1L of Luria-Bertani medium (Difco Laboratories) was grown at 37. °C to a mid logarithmic phase.

Then, 2mM isopropyl beta-thiogalactoside (referred to as"IPTG" : Beohringer Mannheim Biochemicals) was added thereto and incubated for 4 hours. The cells were harvested by centrifugation at 6,000 x g for 10 minutes.

The pellets were solubilized for 1 hour at 24°C in 28 ml of [6M guanidine-HCI, 10 mM Tris (pH 8), 100 mM NACII. After centrifugation at 10,000 x g for 10 minutes at 4°C, the supernatant was recovered, and 4 ml of slurry of TALON resin (BD Biosciences Clontech) previously equilibrated with 25 mM Hepes (pH 7.0), 10 mM MgCl2, 1 mM EDTA. After 30 minutes of intermittent shaking was imparted thereto, the resin was washed 4 times with 20 ml of [6M guanidine-HCl, 10 mM Tris (pH 7), 100 mM NaCl].

Finally, the adsorbed Histag-p62 was eluted with 7 ml of [20 mM Hepes (pH 7), 20 mM NaCl, and 0.05X NP-40,10 mM EDTA].

The protein concentration of the eluate was 2.5 mg/ml, determined by a Protein Assay Kit (Pierce Chemical Co.). The purity of Hi stag-p62 i n the eluate was determined by Sypro orange staining (Molecular Probes) after SDS-polyacrylamide electrophoresis thereof. The eluted Histag-p62 was frozen at-80°C.

Example 2. Preparation of OGT from a Rat Brain Adult male rats were sacrificed by anesthetization. Brains were rapidly removed and immersed in a buffer containing 0.25 M sucrose, 10 mM Tris, pH 7.4,1 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride and 2 pg/ml leupeptin.

All of the following procedures were performed at 4°C.

After blood vessels were quickly eliminated, the brain tissues were minced into 5 mm x 5 mm pieces. The minced tissues were homogenized with a Glass/Teflon homogenizer for five strokes in 3 volumes (v/w) of the buffer. The homogenate was filtered through two layers of cheesecloth and was diluted to 5 volumes of the said buffer, and then was centrifuged at 600 x g for 10 minutes. The supernatant was centrifuged in the other tubes at 20,000 x g for 10 minutes for clarification. The clarified supernatant was mixed with twice volume of 25 mM HEPES, pH 7.2,10 mM MgCl2 and 30% polyethyleneglycol. The mixture was centrifuged at 20,000 x g for 20 min. The supernatant was discarded and the pellet was resuspended in a homogenization buffer [25 mM Hepes, pH 7.0,10 mM MgCl2 and 1 mM EDTA] to give a final volume of 1 ml per lg of rat liver. The suspension was centrifuged at 20,000 x g for clarification and the supernatant was stored at-80°C. Protein concentration thereof was 7.5 mg/ml, determined by a Protein Assay Kit (Pierce Chemical Co.).

Example 3. Preparation of OGT from a Rat Liver OGT enzyme preparation from rat liver was done according to Haltiwanger, RS, et al. (J. Biol. Chem., 267, 9005-9013 (1992)).

1) Homoqenization of Rat Liver.

Ten Sprague-Dawley rats (7 or 8 week old, 200 to 350 g of body weight) were sacrifice by anesthetization, and their livers were removed and were rapidity frozen in liquid nitrogen. The frozen tissues were stored at-81°C. Ten livers (total 110g) were suspended in 220 ml of buffer A [10 mM Tris-HCl, pH 7.5,10 mM MgCl2, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (added freshly)], and the suspension were homogenized using a Polytron homogenizer (Kinematica AG). The insoluble materials were removed by centrifugation at 27,500 g for 35 minutes and the supernatant was recovered.

2) Ammonium Sulfate Precipitation.

The supernatant was filtered through a glass fiber-filter (GF/C, manufactured by Whatman), and 220 ml of the filtrate was collected and 38g of ammonium sulfate was added to 30% saturation thereof. After ammonium sulfate was dissolved, the filtrate was incubated overnight at 4°C, and then centrifugated at 12,000 g for 20 minutes. The supernatant was discarded and the pellets were dissolved in 55 ml of buffer B [10 mM Tris-HCI, pH 8.0,0.25 M ammonium sulfate, 1 mM DTT] using a Potter homogenizer. The insoluble materials were removed by centrifugation at 12,000 g for 15 minutes.

3) Hydrophobic Interaction Chromatocfraphy on Phenyl-Sepharose 4B.

The supernatant obtained in 2) was loaded onto a phenyl-Sepharose 4B column (70m1 ; +15 x length 2.5 cm) previously equilibrated with 500 ml of buffer B) at a flow rate of approximately 20 ml/hour. The column was washed with 200 ml of buffer B at a flow rate of approximately 50 ml/hour, and then the column was washed with 300 ml of buffer C [10 mM Tris-HCI, pH 8.0,0.1 M ammonium sulfate, 1 mM DTT]. The adsorbed OGT was eluted with buffer D [10 mM Tris-HCI, pH 8.0,60% ethylene glycol, 1 mM DTT] at a flow rate of approximately 50 ml. Fractions (10 ml each) were collected throughout the chromatography and they were employed to determine protein concentration and an activity of OGT. The fractions having OGT activity were collected (total 60 ml).

4) Anion Exchange Chromatoqraphy on Q-Sepharose Fast Flow.

The fractions obtained in 3) were diluted 4-fold with buffer E [20 mM Tris-HCl, pH 7.5,40% ethylene glycol, 1 mM DTT]. The diluted solution was loaded onto a Q-Sepharose Fast Flow column (20ml ; 4 x length 2.5 cm) previously equilibrated with 200 ml of buffer E at a flow rate of approximately 50 ml/hour and washed with 100 ml of buffer E at the same flow rate. The adsorbed OGT was eluted with a linear gradient from OM to 0.3 M of NaCl in 200ml of buffer E linear gradient. The active fractions (at around 0.2 to 0.25M NaCl) were collected (total 31 ml). The amount of the obtained proteins was determined by a Bio Rad Protein Assay Kit (Bio-Rad laboratories). The fractions were stored at-20°C.

Example 4. Preparation of Rabbit Anti-OGT Antisera A nucleotide encoding a polypeptide consists of the 877th amino acid (glutamate) to the 1036th amino acid (alanine) of rat O-GlcNAc transferase plIO subunit (GenBank Accession No. U76557; SEQ ID NO : 6) was amplified by a polymerase chain reaction using a rat adipocyte cDNAlibrary as a template and a pair of oligonucleotides as primers as follows: 5'TTCGGCGCGCCAACAATATGCACAAAATATGGGCCT 3' (SEQ ID NO : 7) 5'GCATTAATTAATCAGGCTGACTCAGTGACTTCAAC 3' (SEQ ID NO : 8).

The amplified cDNA was inserted into a prokaryotic expression vector pQE32 (QIAGEN Inc.), and then the recombinant vector having a nucleotide encoding a part of OGT was obtained. The nucleotide sequence was determined. E. Coli M15-pREP4 (QIAGEN Inc.) was transformed by said recombinant vector.

The transformant was grown in 0.5L of Luria-Bertani medium (Difco Laboratories) at 37°C to a mid-log phase. Then, 2mM of IPTG was added thereto and the culture was incubated for 4.5 hours. The resultant cells were harvested by centrifugation at 6,000 x g for 10 minutes at 4°C, and the pellets were solubilized in 20 ml of solubilization buffer (pH 8.2) containing 6M guanidine-HCl and 0. 1M Na2HPO4 for 1 hour at 24°C. After solubilization, the supernatant was clarified by centrifugation at 10, 000 x g for 10 minutes at 4°C and then loaded onto a pre-equilibrated column (2.5ml) packed with TALON resin (Clontech, Palo Alto, CA). The column was washed with 8 ml of solubilization buffer (pH was adjusted at 8.2), followed by 8 ml solubilization buffer (pH was adjusted at 7). The adsorbed proteins were eluted with phosphate buffered saline (referred to as"PBS") supplemented with 100uM EDTA and 2M urea, and then the eluates were dialyzed against 2M urea in PBS.

The protein concentration of the obtained fraction was adjusted to 1 mg/ml, followed by the immunization of New Zealand White rabbits. The resultant OGT antisera isolated from the total blood of the immunized rabbits were verified by Western blotting. They were termed"1897K FB".

Example 5. OGT-TCA Assay In a 0.5 ml or 1. 5-ml tube made of polypropylene (Eppendorf), 5 pl of buffer C200 mM Hepes, pH 7.0 and 50 mM MgCl2], 1µl (0.1µCi) of Uridine diphosphate N-acetyl-D-glucosamine [glucosamin-6-3H (N)] (New England Nuclear, 20-45 Ci/mmol)), 1µl of the acceptor protein (0.22lit) solution, 5p1 of labeled UDP (final 0 to 30µM, as an OGT inhibitor) solution, and 281il of distilled water were added and were mixed. Then, 10pl of OGT enzyme (25µg) obtained in Example 2 were added. After 1 hour of incubation at room temperature, the reaction was stopped by adding 100>l of 15% TCA. The soluble materials were recovered by centrifugation at 20,000 x g for 20 seconds. The pellets were washed with 200V1 of 5% TCA.

The washed pellets were resuspended in 100pl of distilled water containing 0.5% SDS (sodium dodesylsulphate) and the suspension was sonicated gently for 1 minute. Then, the suspension was transferred into a scintillation vial with another 50p1 of the 0.5% SDS solution and 2 ml of ULTIMA GOLD (Packard Instrument), the tritium was counted by a liquid scintillation counter.

Figure 1 shows that UDP inhibited an activity of OGT in a dose- dependent manner. The IC50 value of UDP on OGT avtivity was 0.59pM.

Example 6. OGT-TALON assay In a 1.5-ml tube made of polypropylene (Eppendorf), 5µl of 10 x assay buffer (200 mM Hepes, pH 7.0. and 50 mM MgCl2), 1ul tritium-labeled (0. 1µCi) uridine diphosphate-N-acetyl-D-glucosamine [glucosamine-6-3H (N)] (New England Nuclear, 20-45 Ci/mmol), 1pl of the acceptor protein (0.22pg) solution, and 231il of distilled water were added and mixed. Then, 20V1 of OGT enzyme (0 to 50pg) obtained in Example 2 was added. After 1 hour of incubation at room temperature, 70pal of a TALON bead slurry (35pl of beads + 35u1 of a buffer containing 20 mM Hepes, pH 7.0 and 5 mM MgCl2) were added thereto and the resultant suspension was incubated at room temperature for 10 minutes. Then, the tube was centrifuged at 20,000 x g for 20 seconds and the supernatant was discarded.

The beads were washed six times with 4001il of a buffer containing 20 mM Hepes, pH 8.0,20 mM NaCl, 0.05% Nonidet P-40. Then, the beads were transferred to a scintillation vial with 100ill and another 50µl of distilled water, and then 2 ml of a scintillant cocktail (ULTIMA GOLD ; Packard Instrument Company) was added thereto. The beta ray of tritium was counted by a liquid scintillation counter.

Figure 2 shows the results. The count increased by the additon of OGT in a dose dependent manner.

Example 7. OGT-Immunopurified TALON Assay In a 1. 5-ml tube made of polypropylene (Eppendorf), 100µl (otherwise indicated in Figure 3) of OGT enzyme (400p9) obtainedin Example 2 was incubated with 1u1 (otherwise indicated in Figure 3) of anti-OGT antisera 1897K FB obtained in Example 4, and lllal of a buffer [250 mM Hepes, pH 7.0,100 mM MgCl2, 10 mM EDTA]. After 40 minutes of incubation at room temperature, 40pl (otherwise indicated) of protein A-agarose (Sigma Chemical Co.) beads slurry (1: 1 with a buffer containing 20 mM Hepes, pH 7.0,5 mM MgCl2) were added thereto and the resulted suspension was incubated for 20 minutes at room temperature with rotation. Then, the beads were recovered by centrifuging at 20.000 x g for 20 seconds. After the supernatant was discarded, the beads were washed four times with 400p1 of the buffer [20 mM Hepes, pH 7.0,5 mM MgCl2].

A mixture of 5µl of a buffer [200 mM Hepes, pH 7.0,50 mM MgCl2)], 1µl (0.1µCi, otherwise indicated in Figure 3) of Uridine diphoshate N-acetyl-D-glucosamine [glucosamine-6-3H (N)] (New England Nuclear, 20-45 Ci/mmol), 1>l of Histag-p62 (0. 2µg) obtained in Example 1, and 43>l of distilled water, was added to the OGT-bound Protein A-agarose beads. After 2 hours of incubation at room temperature with rotation, the tube was centrifuged at 20,000 x g for 20 seconds, and 40µl of the supernatant was transferred to the other tube.

Then, 70µl of a TALON bead slurry (35p1 of beads + 35pl of a buffer containing 20 mM Hepes, pH 7.0 and 5 mM MgCI2) was added thereto, and the resultant suspension was incubated at room temperature for 10 minutes.

Then, the tube was centrifuged at 20, 000 x g for 20 seconds.

After the supernatant was discarded, the beads were washed six times with 400µl of a buffer [20 mM Hepes, pH 8.0,20 mM NaCl, 0.05% Noni det P-40]. Then, the beads were transferred to a scintillation vial with 100ut and another 50µl of distilled water, and then 2 ml of ULTIMA GOLD (Packard Instrument) was added thereto. The radioactivity of tritium was counted by a liquid scintillation counter.

Figure 3 shows the results. The radioactivity was increased by the addition of the anti-OGT antibody 1897K FB (Fig. 3A), of protein A-agarose bead slurry (Fig. 3B), of OGT (Fig. 3C), and of 3H-UDP-GlcNAc (Fig. 3D) in a dose dependent manner.

Example 8. OGT-FLASH PLATE-assav A mixture of 6.59 ml distilled water, 800ll ml of a buffer (200 mM Hepes, pH 7.0,50'mM MgC12-6H20), 46u1 of 35% bovine serum albumin (Sigma Chemical Co.), 100pl (10uCi) of Uridine diphosphate-N-acetyl glucosamine [glucosamine-6-3H (N)] (New England Nuclear, 20-45 Ci/mmol), 7. 6µl of 1 M DTT, and 64µl of the OGT (8.3pg) obtained in Example 3 were mixed. The resultant mixture was transferred to a well on a Ni-Chelate Flash Plate (New England Nuclear) at a volume of 95µl/well. Then, 1pl of labeled UDP was added thereto.

5il of Histag-p61 (0. 6µg) obtained in Example was added thereto and mixed therewith. After incubation for 4 hours at room temperature, 101il of 20 mM labeled UDP was added to each well to stop the reaction.

Then, the plate was sealed with Top Seal (Packard Instrument), and was incubated overnight at 4°C. Then, the radioactivity of tritium was counted with a Top Count liquid scintillation counter (Packard Instrument).

Figure 4 shows that UDP inhibit an activity of OGT in a dose-dependent manner.