TECHNICAL FIELD OF THE INVENTION

The present invention relates to African Swine Fever attenuated viruses wherein genes have been inactivated, which can be used as a vaccine. The attenuated viruses protects pigs against subsequent challenge with virulent virus. The present invention also relates to the use of such attenuated viruses to treat and/or prevent African Swine Fever.

BACKGROUND OF THE INVENTION

African swine fever is a devastating haemorrhagic disease of domestic pigs caused by a large double-stranded DNA virus, African swine fever virus (ASFV). ASFV is the only member of the Asfarviridae family and replicates predominantly in the cytoplasm of cells. Virulent strains of ASFV can kill domestic pigs within about 5-14 days of infection with a mortality rate approaching 100%.

ASFV can infect and replicate in warthogs (Phacochoerus sp.), bushpigs (Potamocherus sp.) and soft ticks of the Ornithodoros species (which are thought to be a vector), but in these species few if any clinical signs are observed and long term persistent infections can be established. ASFV was first described after European settlers brought pigs into areas endemic with ASFV and, as such, is an example of an “emerging infection”. The disease is currently endemic in many sub-Saharan countries and in Europe in Sardinia. ASFV first occurred in Europe in 1957, when it was introduced in Portugal. From there, it spread to Spain and France. Although concerted efforts to eradicate ASFV were undertaken, such as widespread culling and the construction of modern farming facilities, the disease was only eradicated in the 1990s.

In September 2018, an outbreak occurred in wild boars in southern Belgium. Professional observers suspect that importation of wild boars from Eastern European countries by game hunters was the origin of the virus. For control of the outbreak, 4,000 domestic pigs were slaughtered preventively in the Gaume region, and the forest was declared off-limits for recreation. As late as January 2022 ASF cases have been reported in northern Italy, Latvia and Hungary.

Currently, disease outbreaks are controlled by animal quarantine and slaughter. Attempts to vaccinate animals using infected cell extracts, supernatants of infected pig peripheral blood leukocytes, purified and inactivated virions, infected glutaraldehyde-fixed macrophages, or detergent-treated infected alveolar macrophages failed to induce protective immunity. Homologous protective immunity does develop in pigs surviving viral infection. Pigs surviving acute infection with moderately virulent or attenuated variants of ASFV develop long-term resistance to homologous, but rarely to heterologous, virus challenge. Due to the severity of the infection and the potential for large economic losses, mechanisms for the prevention of the infection by ASFV are required.

SUMMARY OF THE INVENTION

The inventors of the present invention have discovered that the inactivation of two genes in the ASFV Armenia/07 strain leads to attenuated strains of the virus which, when used as an immunogenic composition, provide excellent protection against a virus challenge.

Therefore, a first aspect of the present invention relates to an attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Armenia/07 strain in which the O174L gene and the EP402R gene have been inactivated

Another aspect of the present invention relates to an immunogenic composition or a vaccine composition comprising the attenuated ASFV according to the invention and a pharmaceutically suitable carrier or excipient.

A further aspect relates to a recombinant ASFV according to the invention for use in the prevention or treatment of a disease caused by the infection by ASFV.

Yet another aspect relates to a polynucleotide comprising a first, second and third regions, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the ASFV genomic regions which naturally flank the ASFV EP402R gene in the ASFV genome of Armenia/07 strain.

Another aspect relates to a vector comprising the polynucleotide according to the invention.

A further aspect relates to a host cell comprising the polynucleotide according the invention, or the vector according to the invention.

One more aspect of the present invention relates to a method for producing a recombinant African swine fever virus (ASFV) according to any of claims 1 to 15, the method comprising:

(i) modifying viral target cells by

- introducing a polynucleotide as defined in any of claims 18 or 19,

- infecting the cells with an attenuated ASFV strain characterized in that it comprises a modified form of the genome of the ASFV Armenia/07 strain in which the O174L gene is inactivated , and - introducing means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region encoding the EP402R gene,

(ii) maintaining the cells under conditions adequate for the double-strand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R gene by the first region within the polynucleotide introduced in step (i), and

(iii) recovering the recombinant ASFV from the supernatant and/or from the whole cell extract and selecting the ASFV virions which contain the reporter gene.

Another aspect of the present invention relates to an in vitro diagnostic method to differentiate ASFV infected animals from animals which have been vaccinated against African Swine Fever Virus (ASFV) using an immunogenic composition according the invention wherein the EP402R gene and/or the O174L gene is/are replaced by an heterologous gene(s), the method comprising:

(i) testing a sample from said animal for the presence of at least one first marker and of at least one second marker, wherein the first marker is selected from the group consisting: an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product, an antibody against an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the O174L gene, and wherein the second marker is an “ASFV gene deletion marker” or a “gene insertion marker” wherein the ASFV gene deletion marker is selected from the group consisting of the EP402R gene product or the O174L gene product, an antibody against the EP402R gene product or against the O174L gene product and the EP402R gene or a fragment thereof or the O174L gene or a fragment thereof and wherein the gene insertion marker is selected from the group consisting of: the first heterologous gene or a fragment thereof or the second heterologous gene or a fragment thereof, the first heterologous gene product or the second heterologous gene product and an antibody specific for the first heterologous gene product or for the second heterologous gene product and

(ii) identifying the animal as a) having been vaccinated if:

- the first marker and the gene insertion marker are detected or

- the first marker is detected and the ASFV gene deletion marker is not detected b) having been infected if:

- the first marker is detected and the ASFV gene deletion marker is detected or

- the first marker is detected and the gene insertion marked is not detected.

One additional aspect of the present invention relates to a kit comprising reagents adequate for the detection of a at least one first marker and of at least one second marker, wherein the first marker is selected from the group consisting:

- an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product,

- an antibody against an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product and

- an ASFV gene or fragment thereof which is not the EP402R gene or the A2 O174L 38L gene, and wherein the second marker is an “ASFV gene deletion marker” or a “gene insertion marker” wherein the ASFV gene deletion marker is selected from the group consisting of

- the EP402R gene product or the O174L gene product,

- an antibody against the EP402R gene product or against the O174L gene product and

- the EP402R gene or a fragment thereof or the O174L gene or a fragment thereof and wherein the gene insertion marker is selected from the group consisting of:

- the first heterologous gene or a fragment thereof or the second heterologous gene or a fragment thereof,

- the first heterologous gene product or the second heterologous gene product and

- an antibody specific for the first heterologous gene product or for the second heterologous gene product. BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Survival curve (in percentage of survival animals) of two groups of pigs (4 pigs/group). Group of vaccinated animals is displayed in solid line, group of non-vaccinated animals is displayed in dotted-line. Time is displayed in days post vaccination (dpv). Challenge was administrated at 28 dpv.

Figure 2. Body temperatures of (A) vaccinated animals during vaccination period (21 days) and (B) vaccinated (diamonds) and non-vaccinated (squares) animals after challenge. Values correspond to average temperature measured daily after vaccination (dpv). Challenge was administrated at 21 dpv.

Figure 3. Antibodies specific anti-ASFV found by ELISA in sera of vaccinated (diamonds) and non-vaccinated (squares) animals after vaccination and challenge, showed by percentage of neutralization of blocking. More than 50% in considered positive for the presence of anti-ASFV antibodies.

DETAILED DESCRIPTION OF THE INVENTION

The inventors of the present invention have discovered that the inactivation of two genes of the ASFV Armenia/07 strain leads to attenuated strains of the virus which when used as an immunogenic composition provide excellent protection in virus challenging tests.

Recombinant ASFV strain

In a first aspect, the present invention relates to an attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Armenia/07 strain in which the O174L gene and the EP402R gene have been inactivated. The strain will be referred from here onwards as “ASFV strain of the invention”.

The term “African swine fever virus” of its acronym “ASFV” as used herein refers to the causative agent of African swine fever (ASF). ASFV is a large, icosahedral, double-stranded DNA virus with a linear genome containing at least 150 genes. The number of genes differs slightly between different isolates of the virus. ASFV has similarities to the other large DNA viruses, e.g., poxvirus, iridovirus and mimivirus. In common with other viral haemorrhagic fevers, the main target cells for replication are those of monocyte, macrophage lineage. Based on sequence variation in the C-terminal region of the B646L gene encoding the major capsid protein p72, 22 ASFV genotypes (l-XXII) have been identified. All ASFV p72 genotypes have been circulating in eastern and southern Africa. Genotype I has been circulating in Europe, South America, the Caribbean and western Africa. Genotype VIII is confined to four East African countries. In a preferred embodiment of the ASFV strain of the invention, the genome of the ASFV strain of the invention is a modified form of the genome of a genotype II ASFV. In a preferred embodiment of the ASFV strain of the invention, the genome of the ASFV is a modified form of the genome of the Armenia/07 strain having the sequence defined in GenBank under accession number accession no. LR812933 version 1 (LR812933.1) of September 2, 2020 in which the O174L gene and the EP402R gene have been inactivated. In another particular embodiment of the ASFV strain of the invention, the sequence of the genome of the ASFV Armenia/07 strain comprises the sequence of SEQ ID NO: 1.

In a particular embodiment of the ASFV of the invention, the genome of the ASFV is a modified form of a genome which comprises a sequence having at least at least 60%, at least 70%, at least 80%, at least 90% identity with the sequence defined in GenBank under accession number accession no. LR812933.1 or to SEQ ID NO: 1. In a more particular embodiment the ASFV of the invention the genome of the ASFV is a modified form of a genome which comprises a sequence having at least at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% identity with the sequence defined in GenBank under accession number accession no. LR812933.1. It will be understood that those ASFV of the invention containing a genome which is a modification of the genome as defined in GenBank under accession number accession no. LR812933.1 is still characterized by the inactivation of the EP402R and the O174L genes. The terms “identity”, “identical” or “percent identity” in the context of two or more amino acid or nucleotide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotide residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences. Publicly available software programs can be used to align sequences. Appropriate parameters for maximal alignment by particular alignment software can be determined by one skilled in the art. In certain embodiments, the default parameters of the alignment software are used. In certain embodiments, the percentage identity “X” of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y/Z), where Y is the number of nucleotide residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the second sequence is longer than the first sequence, then the global alignment taken the entirety of both sequences into consideration is used, therefore all letters and null in each sequence must be aligned. In this case, the same formula as above can be used but using as Z value the length of the region wherein the first and second sequence overlaps, said region having a length, which is substantially the same as the length of the first sequence.

For instance, 95% identical to a reference sequence according to the present invention, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.

The term “attenuated” as used herein refers to a virus with compromised or abolished virulence in the intended recipient, i.e. the swine. The goal of attenuated virus is to produce a virus that does not produce infection symptoms, or very light infection symptoms, as to when used as a vaccine it stills is able to produce an immune response as to create immunogenic protection when the animal is infected with a wild type virus. The term “wildtype” indicates that the virus existed (at some point) in the field, and was isolated from a natural host, such as a domestic pig, tick or warthog.

The level of attenuation of a virus can be measured by the haemadsorption assay. The term “haemadsorption” as used herein refers to a phenomenon whereby cells infected with ASFV adsorb erythrocytes (red blood cells) on their surface. The degree of haemadsorption induced by an ASFV may be measured using a haemadsorption assay such as described herein. For example, cells may be transfected with a protein or infected with an ASFV, then red blood cells added and the degree of haemadsorption detected by imaging.

In a particular embodiment, the level of attenuation of the ASFV strain of the invention is measured by haemadsorption and the ASFV strain of the invention has reduced haemadsorption when compared to the wild type Armenia/07 strain. In a particular embodiment of the ASFV strain of the invention the haemadsorption capacity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% when compared the wild type Armenia/07 strain.

The ASFV strain of the invention is characterized in that it contains an inactivated EP402R gene and an inactivated O174L gene.

The term “EP402R gene” as used herein refers to the ASFV gene which encodes the CD2v protein, a glycoprotein with a relative molecular weight of about 105 kDa that is responsible for the haemadsorption phenotype of ASFV infected cells in vitro. This ASFV protein is the viral homolog (CD2v) of cellular T-lymphocyte surface adhesion receptor CD2 proteins. Based on sequence data and hydropathy profiles, ASFV CD2v protein resembles typical (CD2) class III transmembrane proteins. Generally, the full-length ASFV CD2v protein contains four different sections: (i) a hydrophobic leader at the N-terminal side of the protein, (ii) a hydrophilic, extracellular domain comprising a multitude of potential N-linked glycosylation sites, (iii) a hydrophobic stretch of amino acids that act as a transmembrane domain, and (iv) a C-terminal hydrophilic, cytoplasmic domain which contains a large number of typical, imperfect repeats of the hexa peptide (PPPKPC).

The gene EP402R nucleotide sequence corresponds to the sequence from position 74133 to position 75215 of the Armenia/07 strain genome with the sequence defined in GenBank under accession number accession no. LR812933.1. In a particular embodiment the gene EP402R comprises the sequence according to SEQ ID NO: 4. In another particular embodiment the EP402R gene comprises a sequence with at least at least 60%, at least 70%, at least 80%, at east 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% identity to SEQ ID NO: 4.

The term “O174L gene” as used herein refers to the ASFV gene which encodes the DNA polymerase beta-like protein (also known as Pol X) which catalyzes the gap-filling reaction during the DNA repair process of the ASFV virus genome; it is highly error prone and plays an important role during the strategic mutagenesis of the viral genome.

The gene O174L nucleotide sequence corresponds to the sequence from position 129000 to position 129524 of the Armenia/07 strain genome with the sequence defined in GenBank under accession number accession no. LR812933.1. In a particular embodiment the gene O174L comprises the sequence according to SEQ ID NO: 5. In another particular embodiment the O174L gene comprises a sequence with at least at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% identity to SEQ ID NO: 5.

The term “inactivated” as used herein refers to a gene whose sequence or a sequence implicated in its expression or its regulation is modified as to not express a product or express a non-functional product. Gene inactivation can be accomplish by several methods well known to the skilled person in the art such as random mutagenesis by transposon insertion mutagenesis and UV irradiation, and targeted mutagenesis such as homologous recombination and CRISP/Cas9 technology (see Examples section). Both techniques allow for the inactivation of a gene by either inserting extra nucleotide sequence into the coding sequence of the gene or, on the contrary, by deleting fragments or the entirety of the gene. In both cases, the result may be a non-functional or non-existent transcription of the gene and therefore a lack of the gene product.

In a particular embodiment of the ASFV strain of the invention, the inactivation of the EP402R gene and/or O174L gene results from a deletion of at least part of the EP402R and/or O174L gene. In a more preferred embodiment the deletion of the EP402R and/or O174L gene is a deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000 base pairs.

In another particular embodiment of the ASFV strain of the invention, the deletion of EP402R gene affects the complete EP402R gene. In yet another particular embodiment of the ASFV strain of the invention, the O174L deletion affects the complete O174L gene.

The inactivated genes of the ASFV strain of the invention may be replaced by a heterologous gene, i.e. a gene which does not exist naturally in ASFV. Therefore, in a particular embodiment of the ASFV strain of the invention the EP402R gene and/or the O174L gene is/are replaced by a heterologous gene. In another particular embodiment of the ASFV strain of the invention the EP402R gene and the O174L gene are replaced by heterologous genes, wherein the heterologous gene replacing the EP402R gene is a first reporter gene and the heterologous gene replacing the O174L gene is a second reporter gene.

The term “reporter gene” refers to a polynucleotide that encodes a molecule that can be detected readily, either directly or by its effect on the host cell (phenotype). Exemplary reporter genes encode enzymes, for example the ADE2 or ADE3 gene products, [beta]- galactosidase and LIRA3, luminescent or fluorescent proteins, such as Green Fluorescent Protein (GFP) and variants thereof, antigenic epitopes (for example Glu-tags), mRNA of distinct sequences, and the like.

In another particular embodiment of the ASFV strain of the invention the EP402R gene is replaced by a first heterologous gene and wherein the O174L gene is replaced by a second heterologous gene and wherein the first and second heterologous genes are different. In a particular embodiment of the ASFV strain of the invention the first reporter gene and/or the second reporter gene are a fluorescence protein selected from a group consisting of: GFP, blue fluorescence protein (BFP), cyan fluorescence protein (CFP), yellow fluorescence protein (YFP), Venus, mOrange, dTomato, DsRed, Red fluorescence protein (RFP) and mCherry.

In another particular embodiment of the ASFV strain of the invention the EP402R gene is replaced by mCherry gene and the O174L is replaced by GFP gene. In order for the reporter genes to be detected, they must be expressed a product which is detectable when produced, such as a polypeptide or protein. In order for the reporter gene to be expressed, it must be under the control of a promoter. The term “promoter” as used herein refers to a region of DNA upstream of a gene where relevant proteins (such as RNA polymerase and transcription factors) bind to initiate transcription of that gene.

In a particular embodiment of the ASFV strain of the invention the attenuated ASFV contains a first and/or a second heterologous gene or genes and wherein said first and/or a second heterologous gene or genes is/are under the control of a promoter of a late ASFV gene. In a particular embodiment the reporter gene is under the control of a promoter of a late ASFV gene. The term “late ASFV gene” in the present context refers to genes that are expressed at later stages of the virus gene expression. Promoter sequences are generally short and A+ T rich and they are recognized by virus-encoded transcription factors specific for the different stages of virus gene expression; early, intermediate and late gene classes have been defined. These are expressed in a cascade with early gene expression occurring from partially uncoated cores using enzymes and other factors packaged in the virus particles. In a particular embodiment of the ASFV of the invention, the promoter is the promoter of the p72 gene. In another particular embodiment of the ASFV of the invention, the promoter of the p72 gene comprises SEQ ID NO: 6.

The term “p72 gene”, also known as “B646L gene”, as used herein refers to the gene which encodes for the protein p72, the major capsid protein, which is the most dominant structural component of the virion and constitutes about ~31 %-33% of the total mass of the virion, 2 making it one of the major antigens detected in infected pigs.

The ASFV of the invention genomic sequence may comprise further mutations in relation to the wild-type strain.

In a particular embodiment of the ASFV of the invention, the recombinant ASFV further comprises an additional deletion in the genome, wherein said deletion results in the removal of the genome fragment from position 1135 to position 27675 of the of the Armenia/07 strain genome with the sequence defined in GenBank under accession number accession no. LR812933.1.

In another particular embodiment of the ASFV of the invention, the recombinant ASFV further comprises an additional inactivation of the genes MGF 360-1 La, MGF 360-1 Lb, MGF 360-2L, KP177R, L83L, L60L, MGF 360-3L, MGF 110-1 L, ASFV G ACD 00090, MGF 110- 2L, MGF 110-3L, ASFV G ACD 00120, MGF 110-4L, MGF 110-5L-6L, MGF 110-7L, ASFV G ACD 00160, 285L, MGF 100-1 R, ASFV G ACD 00190, MGF 110-9L, ASFV G ACD 00210, MGF 110-11 L, MGF 110-14L, MGF 110-12L, MGF 110-13La, ASFV G ACD 00270, MGF 360-4L, ASFV G ACD 00300, MGF 360-6L, ASFV G ACD 00320, ASFV G ACD 00330, ASFV G ACD 00350, ASFV G ACD 00360, X69R, MGF 300-1 L, MGF 300-2R, MGF 300-4L, MGF 360-8L, MGF 360-9L, MGF 360-10L and MGF 360-11 L of the Armenia/07 strain genome with the sequence defined in GenBank under accession number accession no. LR812933.1.

In a particular embodiment of the ASFV strain of the invention, the inactivation of the genes MGF 360-1 La, MGF 360-1 Lb, MGF 360-2L, KP177R, L83L, L60L, MGF 360-3L, MGF 110-1 L, ASFV G ACD 00090, MGF 110-2L, MGF 110-3L, ASFV G ACD 00120, MGF 110- 4L, MGF 110-5L-6L, MGF 110-7L, ASFV G ACD 00160, 285L, MGF 100-1 R, ASFV G ACD 00190, MGF 110-9L, ASFV G ACD 00210, MGF 110-11L, MGF 110-14L, MGF 110-12L, MGF 110-13La, ASFV G ACD 00270, MGF 360-4L, ASFV G ACD 00300, MGF 360-6L, ASFV G ACD 00320, ASFV G ACD 00330, ASFV G ACD 00350, ASFV G ACD 00360, X69R, MGF 300-1 L, MGF 300-2R, MGF 300-4L, MGF 360-8L, MGF 360-9L, MGF 360-10L and MGF 360-11L results from a deletion of at least part of the genes MGF 360-1 La, MGF 360-1 Lb, MGF 360-2L, KP177R, L83L, L60L, MGF 360-3L, MGF 110-1 L, ASFV G ACD 00090, MGF 110-2L, MGF 110-3L, ASFV G ACD 00120, MGF 110-4L, MGF 110-5L-6L, MGF 110-7L, ASFV G ACD 00160, 285L, MGF 100-1 R, ASFV G ACD 00190, MGF 110-9L, ASFV G ACD 00210, MGF 110-11L, MGF 110-14L, MGF 110-12L, MGF 110-13La, ASFV G ACD 00270, MGF 360-4L, ASFV G ACD 00300, MGF 360-6L, ASFV G ACD 00320, ASFV G ACD 00330, ASFV G ACD 00350, ASFV G ACD 00360, X69R, MGF 300-1 L, MGF 300- 2R, MGF 300-4L, MGF 360-8L, MGF 360-9L, MGF 360-10L and MGF 360-11 L.

In another particular embodiment of the ASFV strain of the invention, the deletion of the genes MGF 360-1 La, MGF 360-1 Lb, MGF 360-2L, KP177R, L83L, L60L, MGF 360-3L, MGF 110-1 L, ASFV G ACD 00090, MGF 110-2L, MGF 110-3L, ASFV G ACD 00120, MGF 110-4L, MGF 110-5L-6L, MGF 110-7L, ASFV G ACD 00160, 285L, MGF 100-1 R, ASFV G ACD 00190, MGF 110-9L, ASFV G ACD 00210, MGF 110-11L, MGF 110-14L, MGF 110- 12L, MGF 110-13La, ASFV G ACD 00270, MGF 360-4L, ASFV G ACD 00300, MGF 360-6L, ASFV G ACD 00320, ASFV G ACD 00330, ASFV G ACD 00350, ASFV G ACD 00360, X69R, MGF 300-1 L, MGF 300-2R, MGF 300-4L, MGF 360-8L, MGF 360-9L, MGF 360-10L and MGF 360-11 L affects the complete MGF 360-1 La, MGF 360-1 Lb, MGF 360-2L, KP177R, L83L, L60L, MGF 360-3L, MGF 110-1L, ASFV G ACD 00090, MGF 110-2L, MGF 110-3L, ASFV G ACD 00120, MGF 110-4L, MGF 110-5L-6L, MGF 110-7L, ASFV G ACD 00160, 285L, MGF 100-1 R, ASFV G ACD 00190, MGF 110-9L, ASFV G ACD 00210, MGF 110-11L, MGF 110-14L, MGF 110-12L, MGF 110-13La, ASFV G ACD 00270, MGF 360-4L, ASFV G ACD 00300, MGF 360-6L, ASFV G ACD 00320, ASFV G ACD 00330, ASFV G ACD 00350, ASFV G ACD 00360, X69R, MGF 300-1 L, MGF 300-2R, MGF 300-4L, MGF 360-8L, MGF 360-9L, MGF 360-10L and MGF 360-11 L genes.

In a particular embodiment of the ASFV of the invention, the recombinant ASFV comprises at least one additional mutation selected from the group consisting of:

- two indel and one SNP are located upstream of the mCherry promoter,

- one indel and one SNP are located in the left ITR of the viral genome and

- an SNP into the M1249L gene provoking a silent mutation (Ile243lle).

The M1249L gene nucleotide sequence corresponds to the sequence from position 76458 to position 80207 of the Armenia/07 strain genome with the sequence defined in GenBank under accession number accession no. LR812933.1 version 1 (LR812933.1) of September 2, 2020. The term “indel” as used herein refers to a mutation by insertion, deletion, or insertion and deletion of nucleotides in genomic DNA, which can lead to the alteration of the expression product of the gene wherein the indel occurs. The term “single nucleotide polymorphism” or “SNP” refers to a mutation of a single nucleotide in the genomic DNA. Indels and SNPs may be silent mutations, rarely in the indel case, wherein the expression product is not altered or is altered in an insignificant way for the function of said expression product, or it may lead to altered expression or even a completely non-functional expression product.

In another particular embodiment, the recombinant ASFV strain of the invention contains a genome which comprises the sequence according to SEQ ID NO: 3.

Uses of the recombinant ASFV strain in immunogenic compositions and vaccines

The recombinant ASFV strain of the invention can be used for the generation of immunogenicity in porcine through immunogenic compositions or vaccine compositions. Therefore, another aspect of the invention relates to an immunogenic composition or a vaccine composition, from here onwards the immunogenic composition of the invention, comprising the recombinant ASFV strain of the invention and a pharmaceutically suitable carrier or excipient.

In the context of the present invention, the term “immunogenic composition" refers to a composition that can elicit a cellular and/or humoral immune response but does not necessarily confer full or partial immune protection against African swine fever in mammals. For the avoidance of doubt, however, such immunogenic composition may confer full or partial protection against African swine fever in mammals and this is also preferred. In contrast, a “vaccine" in the context of the present invention does confer full or partial, but at least partial immune protection against African swine fever in mammals.

The terms "protection against African swine fever", "protective immunity", "functional immunity" and similar phrases as used herein refer to a response against African swine fever (virus) generated by administration of the recombinant ASFV of the invention, that results in fewer deleterious effects than would be expected in a non-immunized mammal that has been exposed to African swine fever (virus). That is, the severity of the deleterious effects of the ASFV infection is lessened in a vaccinated mammal. Infection may be reduced, slowed, or possibly fully prevented, in a vaccinated mammal. Herein, where complete prevention of infection is meant, it is specifically stated. If complete prevention is not stated, then the term includes partial prevention.

The term "increased protection" means, but is not limited to, a statistically significant reduction of one or more clinical symptoms, which are associated with infection by a wildtype ASFV, in a vaccinated group of mammals versus a non-vaccinated control group of mammals. The term "statistically significant reduction of clinical symptoms" as used herein refers to, without limitation, that the incidence of at least one clinical symptom in the vaccinated group of mammals is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% lower than in the non-vaccinated control group after the challenge with the wild-type ASFV. In the context of the present invention, the term "long-lasting protection" shall refer to improved efficacy that persists for at least 3 weeks, at least 3 months, at least 6 months, at least 1 year. In the case of livestock, it is most preferred that the long-lasting protection shall persist until the average age at which animals are marketed for meat.

In the context of the present invention, the term "immune response" or "immunological response" refers to the development of a cellular and/or antibody- mediated immune response to the recombinant ASFV of the invention or immunogenic composition of the invention. Usually, an immune or immunological response includes, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the recombinant ASFV strain of the invention. Preferably, the host will display either a therapeutic or a protective immunological (memory) response, such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction in number of symptoms, severity of symptoms, or the lack of one or more of the symptoms associated with the infection of the wild-type ASFV, a delay in the of onset of viremia, reduced viral persistence, a reduction in the overall viral load and/or a reduction of viral excretion.

The immunogenic composition of the invention further comprises a pharmaceutically acceptable carrier or excipient. In the context of the present invention, the term "a pharmaceutically acceptable carrier" includes any solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. In a particular embodiment, the immunogenic composition of the invention comprises stabilizing agents for lyophilization or freeze-drying. In another particular embodiment, the immunogenic composition of the present invention contains an adjuvant. "Adjuvants" as used herein, can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion. The emulsion can be based in particular on light liquid paraffin oil (European Pharmacopeia type); isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri- (caprylate/caprate) or propylene glycol di oleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxy stearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L 121. A further instance of an adjuvant is a compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative. Advantageous adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Adjuvants can also be acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol 974P, 934P and 971 P. Most preferred is the use of Cabopol 971 P. Among the copolymers of maleic anhydride and alkenyl derivative, are the copolymers EMA (Monsanto), which are copolymers of maleic anhydride and ethylene. Further suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), Block copolymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide, or naturally occurring or recombinant cytokines or analogs thereof or stimulants of endogenous cytokine release, among many others.

In the context of the present invention, the term "diluents " can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin and alkali salts of ethylendiamintetracetic acid, among others. As used herein, the term "attenuation" means reducing the virulence of a pathogen.

The ASFV strain of the invention finds use in the prevention or treatment of diseases directly caused by ASFV. Therefore, another aspect of the present invention relates to the ASFV of the invention or the immunogenic composition of the invention for use in the prevention or treatment of a disease caused by the infection of ASFV, from here onwards the treatment use of the invention. The term “prevention”, as used herein, relates to the capacity to prevent, minimize, or hinder the onset or development of a disease or condition before its onset.

As used herein, the terms "treat", "treatment", "treatment", or "amelioration". The term refers to therapeutic treatment, the purpose of which is to reverse, reduce, suppress, delay or stop the progression or severity of the condition associated with the disease or disorder. The term "treatment" includes reducing or alleviating at least one adverse effect or condition of a condition, a disease or disorder, such as an infection. Treatment is usually "effective" when one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if disease progression is delayed or halted. That is, "treatment" includes not only the improvement of symptoms or markers, but also the interruption of at least a condition that indicates the progression or worsening of symptoms that would be expected in the absence of treatment. The beneficial or desirable clinical outcome, whether detectable or not, is a reduction in one or more symptoms, a reduction in the extent of the disease, a stable (ie, not aggravated) condition of the disease. These include, but are not limited to, delayed or slowed progression, amelioration or alleviation of the disease state, and remission (partial or total). The term "treatment" of a disease also includes providing relief from symptoms or side effects of the disease (including symptomatic treatment).

In a particular embodiment of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated intranasal, orally, subcutaneously, intradermal or intramuscularly, preferably intramuscularly. The skilled artisan will recognize that the ASFV of the invention or the immunogenic composition of the invention may also be administered in one, two or more doses, as well as, by other routes of administration. For example, such other routes include intracutaneously, intravenously, intravascularly, intraarterially, intraperitoneally, intrathecally, intratracheally, intracardially, intralobally, intramedullarly, intrapulmonarily and intravaginally. Depending on the desired duration and effectiveness of the treatment, the ASFV of the invention or the immunogenic composition of the invention may be administered once or several times, also intermittently, for instance daily for several days, weeks or months and in different dosages.

In a particular embodiment of the use of the invention, the ASFV of the invention or the immunogenic composition of the invention is administrated in a therapeutically effective dose. The expression “therapeutic effective dose” as used herein refers to an amount of an active agent (i.e., an ingredient such as ASFV of the invention) high enough to deliver the desired benefit, either the treatment or prevention of the disease, but low enough to avoid serious side effects within the scope of medical/veterinary judgment. The particular dose administered according to this invention will of course be determined by the particular circumstances surrounding the case, such as the route of administration, the age of the animals, and the similar considerations. In a particular embodiment of the use of the invention the therapeutic effective dose is from about 10' ² plaque forming units (pfu) to about 10 ⁴ pfu, preferably 10 ² pfu.e

In the context of the present invention, "pfu" is defined as "plaque forming units", a standard value for the quantification of lytic viruses consisting of quantifying the lysis plaques provoked by the virus while infecting cell monolayers growing in semi-solid media. Under these conditions, each virus plaque is originated from one only parental virus particle.

Methods and reagents for obtaining the ASFV of the invention

All previous aspects and their embodiments where applicable are also comprised in the following aspects and their embodiments. All the previous definitions of terms and expressions are equally applied to the current aspects and embodiments, except is specifically stated otherwise.

An aspect of the present invention relates to a polynucleotide comprising a first, second and third regions, from here onwards the first polynucleotide of the invention, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the ASFV genomic regions which naturally flank the ASFV EP402R gene in the ASFV genome in the Armenia/07 strain.

The term “expression cassette” as used herein refers to a distinct component of DNA which comprises a gene and a regulatory sequence, such as a promoter, which allows the expression cassette to produce RNA and protein when inserted into the desired host cell. In a particular embodiment of the first and the second polynucleotide of the invention the expression cassette forming part of the first region comprises a reporter gene which encodes a fluorescent protein.

In another particular embodiment of the first and second polynucleotide of the invention the fluorescent protein is selected from a group consisting of: GFP, BFP, CFP, YFP, Venus, mOrange, dTomato, DsRed, RFP, mCherry and any of their variants.

In a more particular embodiment of the first and second polynucleotide of the invention the reporter gene is under the control of a constitutive promoter, preferably the p72 promoter comprising the sequence according to SEQ ID NO: 6.

The expression “second and third regions are the ASFV genomic regions which naturally flank the ASFV EP402R gene in the ASFV genome in the Armenia/07 strain” in the first polynucleotide of the invention refers to the nucleotide sequence which is before the position 74133 (second region) and after the position 75215 (third region) of the genome of the Armenia/07 strain having the sequence defined in GenBank under accession number accession no. LR812933.1. In a more particular embodiment of the first polynucleotide of the invention the second region comprises the nucleotide sequence between positions 72133 and 74133, or a fragment thereof, of the genome of the Armenia/07 strain having the sequence defined in GenBank under accession number accession no. LR812933.1. In another particular embodiment of the first polynucleotide of the invention the third region comprises the nucleotide sequence between positions 75215 and 77215, or a fragment thereof, of the genome of the Armenia/07 strain having the sequence defined in GenBank under accession number accession no. LR812933.1. In another particular embodiment of the first polynucleotide of the invention the second and third regions consist of about 2000 bp, about 1900 bp, about 1800 bp, about 1700 bp, about 1600 bp, about 1500 bp, about 1400 bp, about 1300 bp, about 1200 bp, about 1100 bp, about 1000 bp, about 900 bp, about 800 bp, about 700 bp, about 600 bp, about 500 bp, preferably 500 bp.

The first polynucleotide of the invention can be comprised in a vector. As such, another aspect of the present invention relates to a vector comprising the first polynucleotide of the invention, from here onwards the vector of the invention.

The term “vector”, as used herein, refers to a vehicle through which a polynucleotide or a DNA molecule can be manipulated or introduced into a cell. The vector can be a linear or circular polynucleotide or it can be a larger polynucleotide or any other type of construction such as the DNA or RNA of a viral genome, a virion or any other biological construct that allows the manipulation of DNA or its introduction in a cell. It is understood that the terms "recombinant vector", "recombinant system" can be used interchangeably with the term vector. A person skilled in the art will understand that there is no limitation as regards the type of vector, which can be used because said vector can be a cloning vector suitable for propagation and for obtaining the polynucleotides or suitable gene constructs or expression vectors in different heterologous organisms suitable for purifying the polynucleotides of the invention. Thus, suitable vectors according to the present invention include expression vectors in prokaryotes such as pET (such as pET14b), pUC18, pUC19, Bluescript and their derivatives, mp18, mp19, pBR322, pMB9, ColEI, pCRI, RP4, phages and shuttle vectors such as pSA3 and pAT28, expression vectors in yeasts such as vectors of the type of 2 micron plasmids, integration plasmids, YEP vectors, centromeric plasmids and the like, expression vectors in insect cells such as the pAC series and pVL series vectors, expression vectors in plants such as vectors of expression in plants such as pl Bl, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series vectors and the like and expression vectors in superior eukaryotic cells based on viral vectors (adenoviruses, viruses associated to adenoviruses as well as retroviruses and lentiviruses) as well as non-viral vectors such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1, pEFI/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXI, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDTI. The vector of the invention can be used to transform, transfect, or infect cells that can be transformed, transfected or infected by said vector. Said cells can be prokaryotic or eukaryotic. By way of example, the vector wherein said DNA sequence is introduced can be a plasmid or a vector that, when it is introduced in a host cell, is integrated in the genome of said cell and replicates together with the chromosome (or chromosomes) in which it has been integrated. Said vector can be obtained by conventional methods known by the persons skilled in the art (Sambrook et al., 2001, “Molecular cloning, to Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory Press, N.Y. Vol 1-3 a).

Another aspect of the invention relates to a host cell comprising the first polynucleotide of the invention or the vector of the invention, from here onwards the host cell of the invention.

The host cell of the invention can be obtained by transformation, transfection or infection of cells by conventional methods known by persons skilled in the art (Sambrook et al., 2001, mentioned above). In a particular embodiment, said host cell is an animal cell transfected or infected with a suitable vector.

Host cells suitable for the comprising the first polynucleotide of the invention, or the vector of the invention include, without being limited to, mammal, plant, insect, fungal and bacterial cells. Bacterial cells include, without being limited to, Gram-positive bacterial cells such as species of the Bacillus, Streptomyces, Listeria and Staphylococcus genus and Gram-negative bacterial cells such as cells of the Escherichia, Salmonella and Pseudomonas genera. Fungal cells preferably include cells of yeasts such as Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha. Insect cells include, without being limited to, Drosophila and Sf9 cells. Plant cells include, among others, cells of crop plants such as cereals, medicinal, ornamental or bulbous plants. Suitable mammal cells in the present invention include epithelial cell lines (human, ovine, porcine, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinomas (human, etc.), glial cells (murine, etc.), hepatic cell lines (from monkey, etc.), CHO (Chinese Hamster Ovary) cells, COS cells, BHK cells, HeLa cells, 911, AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells, D3 cells of the mESC line, human embryonic stem cells such as HS293, BGV01, SHEF1, SHEF2, HS181, NIH3T3 cells, 293T, REH and MCF-7 and hMSC cells.

The ASFV of the invention can be obtained by several methods known to the skilled person in the field such as CRISPR/Cas, TALEN, and Zn-finger nuclease.

A further aspect of the present invention relates to a method for producing a recombinant African swine fever virus (ASFV) according to the invention, from here onwards the method of the invention. The method comprises deleting the EP402R gene (coding for CD2v) from a LAV prototype lacking the O174L gene (coding for the DNA polymerase X). Accordingly, in one aspect, the invention relates to a method comprising:

1) modifying viral target cells by

- introducing a first polynucleotide of the invention,

- infecting the cells with an attenuated ASFV strain characterized in that it comprises a modified form of the genome of the ASFV Armenia/07 strain in which the O174L gene is inactivated, and

- introducing means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region encoding the EP402R gene,

2) maintaining the cells under conditions adequate for the double-strand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R gene by the first region within the polynucleotide introduced in step (i), and

3) recovering the recombinant ASFV from the supernatant and/or from the whole cell extract and selecting the ASFV virions which contain the reporter gene.

Steps (i)

Step (i) of the method of the invention refers to the process of introducing into the viral target cell all the components necessary to create an ASFV virus strain wherein the EP402R gene is inactivated. The viral target cells refers to cells which are naturally infected by the ASFV. In a particular embodiment of the method of the invention, the viral target cells in step (i) are mammalian cells, such as COS cells, BHK cells, HeLa cells, 911 , AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells. In a more particular embodiment the viral target cells is a COS cell line.

In one embodiment, the strain in which the EP402R is inactivated is the Arm-APolX- GFP-AMGFs which has been described in International patent application published as W02022090131 and which is defined in SEQ ID NO:2.

The introduction of a polynucleotide in the viral target cells can be accomplished by several methods well known by the skilled person in the art such as transformation, transfection or infection of cells by conventional methods known by persons skilled in the art (Sambrook et al., 2001 , mentioned above). In a particular embodiment of the method of the invention, the introduction of the first polypeptide of the invention in step (i) is done by transfection. In another particular embodiment of the method of the invention, the expression cassette forming part of the first region comprises a reporter gene which encodes a fluorescent protein. In a more particular embodiment, the reporter gene is under the control of a constitutive promoter. The expression of step (i) of the method of the invention “means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region encoding the EP402R gene” refers to techniques which permit the cleavage of the the bounds between adjacent nucleotides in a double strand of DNA. One such means of creating a double strand DNA break is the CRISPR/Cas9 technique. In a particular embodiment of the method of the invention, the means capable of creating a double strand break in the genome of said attenuated ASFV strain within or at the vicinity of the region encoding the EP402R gene comprises a CRISPR/Cas system.

The term “CRISPR/Cas9 system” as used herein refers to the Class 2 Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems, which form an adaptive immune system in bacteria, and which have been modified for genome engineering. Engineered CRISPR systems contain two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein). The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-defined ~20 nucleotide spacer that defines the genomic target to be modified. Thus, one can change the genomic target of the Cas protein by simply changing the target sequence present in the gRNA.

CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications to various Cas enzymes have extended CRISPR to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live cells, and precisely edit DNA and RNA. Furthermore, the ease of generating gRNAs makes CRISPR one of the most scalable genome editing technologies. This advantage makes CRISPR perfect for genome-wide screens. Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often lead to frameshifts, creating loss of function alleles.

To introduce specific genomic changes, researchers use ssDNA or dsDNA repair templates with 1) homology to the DNA flanking the DSB and 2) a specific edit close to the gRNA PAM site.

Step (77)

Step (ii) of the method of the invention relates to the process of maintain the cells at ideal temperatures, cell number and carbon dioxide (CO2) concentration as for the double strand system to be able to function properly and create double strands in desired locations. In a preferred embodiment of the method of the invention, cells in step (ii) are maintained in a culture medium that comprises 2 mM l-glutamine, nonessential amino acids, an antibiotic, such as gentamicin, and supplements such as fetal bovine serum. In another particular embodiment of the method of the invention the cells are maintained at between about 32°C and 40°C, preferably 37°C in an about 3% to about 10% CO2 atmosphere, preferably 7% CO2 atmosphere, saturated with water vapor for about 12 hours to 36 hours, preferably 24 hours post transfection.

Step (Hi)

Step (iii) of the method of the invention relates to the process of obtaining the recombinant ASFV of the invention, i.e., a strain where the EP402R gene is inactivated. The selection of said virions makes use of the first heterologous gene present in the ASFV of the invention. In a particular embodiment of the method of the invention, the heterologous gene forming part of the first polynucleotide of the invention of the invention is a reporter gene.

The process of recovering recombinant and selecting virions is well known in the art and is exemplified in the Examples section of this description.

In one embodiment, the strain which is obtained is the recombinant virus Arm-APolX- GFP-ACD2v-mCherry-AMGFs according to the nucleotide sequence SEQ ID NO: 3.

DIVA method and kit thereof

All previous aspects and their embodiments where applicable are also comprised in the following aspects and their embodiments. All the previous definitions of terms and expressions are equally applied to the current aspects and embodiments, except is specifically stated otherwise.

The ASFV strain of the invention or the immunogenic composition of the invention, besides being capable of inducing protection of animals against the effects of ASFV infection, is also characterized in that it is “marked”, as the response generated in the animal differs from the response caused by infection with a field or wild-type ASFV. This allows the design of so-called DIVA (Differentiating Infected from Vaccinated Animals) tests based on the detection in the animal the presence or absence of field ASFV-specific antigens and the presence or absence of the antigens which are specific of the inventive ASFV-specific antigens. It will be understood that the presence or absence of antigens can be determined by detecting the antigen itself as well as by detecting in the animal of antibodies against the antigen as well as by detecting the sequence of the polynucleotide encoding the antigen or a a fragment thereof.

Therefore, another aspect of the present invention relates to an in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition according to the invention wherein the EP402R gene and/or the O174L gene is/are replaced by an heterologous gene(s), from here onwards the DIVA method of the invention, the method comprising: (i) testing a sample from said animal for the presence of at least one first marker and of at least one second marker, wherein the first marker is selected from the group consisting: an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product, an antibody against an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the O174L gene, and wherein the second marker is an “ASFV gene deletion marker” or a “gene insertion marker” wherein the ASFV gene deletion marker is selected from the group consisting of the EP402R gene product or the O174L gene product, an antibody against the EP402R gene product or against the O174L gene product and the EP402R gene or a fragment thereof or the O174L gene or a fragment thereof and wherein the gene insertion marker is selected from the group consisting of: the first heterologous gene or a fragment thereof or the second heterologous gene or a fragment thereof, the first heterologous gene product or the second heterologous gene product and an antibody specific for the first heterologous gene product or for the second heterologous gene product and

(i) identifying the animal as a) having been vaccinated if:

- the first marker and the gene insertion marker are detected or

- the first marker is detected and the ASFV gene deletion marker is not detected b) having been infected if:

- the first marker is detected and the ASFV gene deletion marker is detected or

- the first marker is detected and the gene insertion marked is not detected.

The term “sample” as used herein refers to biological material isolated from an organism, preferably an animal. In a particular embodiment of the DIVA method of the invention, the sample is a product derived from blood. Examples of products derived from blood are serum, plasma, red blood cells, etc. In a particular embodiment of the DIVA method of the invention the first and second heterologous genes are reporter genes. In a more particular embodiment of the DIVA method of the invention, the reporter genes are the GFP gene and the mCherry gene.

The term “ASFV-specific antigen” as used herein refers to molecules or molecular structures, preferably proteins, which belong to the ASFV and can bind specifically to an antibody present in the host, which is infected by the ASFV. In a particular embodiment of the DIVA treatment, the ASFV-specific antigen which is not the EP402R gene product or the O174L gene product is a structural ASFV protein selected from pp220, pp62, p72, p54, p30 and CP312R.

The term “antibody”, as used herein, refers to a glycoprotein that exhibits specific binding activity for a particular protein, which is referred to as “antigen”. The term “antibody” comprises whole monoclonal antibodies or polyclonal antibodies, or fragments thereof, and includes human antibodies, humanised antibodies, chimeric antibodies and antibodies of a non-human origin. “Monoclonal antibodies” are homogenous, highly specific antibody populations directed against a single site or antigenic “determinant”. “Polyclonal antibodies” include heterogeneous antibody populations directed against different antigenic determinants.

As used herein, the antibodies suitable for the DIVA method of the invention encompass not only full length antibodies (e.g., IgG), but also antigen-binding fragments thereof, for example, Fab, Fab’, F(ab')2, Fv fragments, human antibodies, humanised antibodies, chimeric antibodies, antibodies of a non-human origin, recombinant antibodies, and polypeptides derived from immunoglobulins produced by means of genetic engineering techniques, for example, single chain Fv (scFv), diabodies, heavy chain or fragments thereof, light chain or fragment thereof, VH or dimers thereof, VL or dimers thereof, Fv fragments stabilized by means of disulfide bridges (dsFv), molecules with single chain variable region domains (Abs), minibodies, scFv-Fc, and fusion proteins comprising an antibody, or any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of a desired specificity. An antibody fragment may refer to an antigen binding fragment. An antibody includes an antibody of any class, namely IgA, IgD, IgE, IgG (or sub-classes thereof), and IgM, and the antibody need not be of any particular class.

In a particular embodiment of the DIVA method of the invention, the detection of the ASFV-specific antigen which is not the EP402R gene product or the O174L gene product, the detection of an antibody against an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product, the detection of the EP402R gene product or of the O174L gene product, the detection of an antibody against the EP402R gene product or against the O174L gene product, the detection of the first heterologous gene product or of the second heterologous gene product or the detection of an antibody specific for the first heterologous gene product or for the second heterologous gene product is done by an immunoassay.

The term "immunoassay", as used herein, includes any immunoassay technique based on the formation or use of immune complexes, that is, resulting from the conjugation of antibodies and antigens, as quantification references of a determined analyte (substance under examination), which can be the antibody or the antigen, using for the measurement a molecule as a marker which produces a detectable signal in response to a specific binding.

Immunoassay techniques which can be used in the context of the present invention are Western-blot or Western transfer, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (competitive enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), immunocytochemical and immunohistochemical techniques, techniques based on the use of protein biochips or microarrays which include specific antibodies or assays based on colloidal precipitation in formats such as dipsticks. In a particular embodiment of the DIVA method the immunoassay is perfomed by enzyme- linked immunosorbent assay (ELISA).

The term “enzyme-linked immunosorbent assay” or its acronym “ELISA” as used herein refers to a commonly used analytical biochemistry assay, that uses a solid-phase type of enzyme immunoassay (EIA) to detect the presence of a ligand (commonly a protein) in a liquid sample using antibodies directed against the protein to be measured. Performing an ELISA involves at least one antibody with specificity for a particular antigen. The sample with an unknown amount of antigen is immobilized on a solid support (usually a polystyrene microtiter plate) either non-specifically (via adsorption to the surface) or specifically (via capture by another antibody specific to the same antigen, in a "sandwich" ELISA). After the antigen is immobilized, the detection antibody is added, forming a complex with the antigen. The detection antibody can be covalently linked to an enzyme or can itself be detected by a secondary antibody that is linked to an enzyme through bioconjugation. Several types of ELISA exist, namely, without limitation, direct ELISA, sandwich ELISA, competitive ELISA and reverse ELISA. Several enzymatic markers which allow the results of the assay to be measured upon completion of the assay, can be used in ELISA. The most commonly used are without limitation, OPD (o-phenylenediamine dihydrochloride) which turns amber to detect HRP (Horseradish Peroxidase) and is often used to as a conjugated protein; TMB (3,3',5,5'-tetramethylbenzidine) which turns blue when detecting HRP and turns yellow after the addition of sulfuric or phosphoric acid; ABTS (2,2'-Azinobis [3-ethylbenzothiazoline-6- sulfonic acid]-diammonium salt) whhhich turns green when detecting HRP; PNPP (p- Nitrophenyl Phosphate, Disodium Salt) which turns yellow when detecting alkaline phosphatase; and ON PG (o-nitrofenil-p-D-galactopiranosido) which turns yellow when detecting beta-galactosidasa (b-Gal).

The detection of genes is well established in the art and can be accomplished by several methods dealing with the detection of nucleotide sequences, mostly based on the polymerase chain reaction (PCR), such as Q-PCR, RT-PCR, sequencing, FISH, etc. In a particular embodiment of the DIVA method of the invention the detection of the presence of an ASFV gene or fragment thereof which is not the EP402R gene or the O174L gene, the EP402R gene or a fragment thereof, the O174L gene or a fragment thereof, the first heterologous gene or a fragment thereof and/or the second heterologous gene or a fragment thereof is done by a polymerase chain reaction.

The reagents required for performing the DIVA method of the invention might all or part of them form a kit. Therefore, another aspect of the present invention relates to a kit, from here onwards the kit of the invention, comprising reagents adequate for the detection of a at least one first marker and of at least one second marker, wherein the first marker is selected from the group consisting:

- an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product,

- an antibody against an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product and

- an ASFV gene or fragment thereof which is not the EP402R gene or the O174L gene, and wherein the second marker is an “ASFV gene deletion marker” or a “gene insertion marker” wherein the ASFV gene deletion marker is selected from the group consisting of

- the EP402R gene product or the O174L gene product,

- an antibody against the EP402R gene product or against the O174L gene product and

- the EP402R gene or a fragment thereof or the O174L gene or a fragment thereof and wherein the gene insertion marker is selected from the group consisting of:

- the first heterologous gene or a fragment thereof or the second heterologous gene or a fragment thereof,

- the first heterologous gene product or the second heterologous gene product and

- an antibody specific for the first heterologous gene product or for the second heterologous gene product.

In the context of the present invention, “kit” is understood as a product of the different reagents for performing the methods described in the present invention, both in those cases in which the detection is performed with antibodies/antigens and in the cases in which the detection is performed with nucleotide sequence techniques such as PCR using primers and probes, in which the different reagents are packaged together to allow for transport and storage. Nevertheless, if the kits defined in the present invention do not comprise the reagents necessary for putting the methods of the invention into practice, such reagents are commercially available and can be found as part of a kit. Suitable materials for packaging the components of the kit include, without being limited to, glass, plastic (polyethylene, polypropylene, polycarbonate and the like), bottles, vials, paper, sachets and the like. Kits can additionally contain instructions for using the different components in the kit. Said instructions can be in printed format or in an electronic device capable of storing instructions such that they can be read by a person, such as electronic storage media (magnetic discs, tapes and the like), optical means (CD-ROM, DVD, USB) and the like. The media can additionally or alternatively contain Internet addresses where said instructions are provided.

In a particular embodiment of the kit of the invention the reagents adequate for the detection of an ASFV gene or fragment thereof which is not the EP402R gene or the 0174L gene or a fragment thereof, for the detection of the EP402R gene or a fragment thereof or the O174L gene or a fragment thereof, for the detection of the first heterologous gene or a fragment thereof or the second heterologous gene or a fragment thereof are probes or primers specific for the gene or fragment thereof.

In a more particular embodiment of the kit of the invention, the ASFV gene or fragment thereof which is not the EP402R gene or the O174L gene is the p72 gene.

As used herein, the term "probe" refers to a nucleic acid which specifically binds to a molecule of interest. Probes are often associated with or capable of associating with a label. A label is a chemical moiety capable of detection. Typical labels comprise dyes, radioisotopes, luminescent and chemiluminescent moieties, fluorophores, enzymes, precipitating agents, amplification sequences, and the like. The specificity of hybridization is dependent on conditions such as the base pair composition of the nucleotides, and the temperature and salt concentration of the reaction. These conditions are readily discernable to one of ordinary skill in the art using routine experimentation.

In another particular embodiment of the kit of the invention, the reagents specific for the detection of an ASFV-specific antigen which is not the EP402R gene product or the O174L gene product, the reagents adequate for the detection of the EP402R gene product or against the O174L gene product or the reagents adequate for the detection of the first heterologous gene product or for the second heterologous gene product is an antibody or antigen-binding fragment thereof specific for the antigen.

In a particular embodiment of the kit of the invention the ASFV-specific antigen which is not the EP402R gene product or the O174L gene product is selected from a group consisting of: pp220, pp62, p72, p54, p30, CP312R, and any combination thereof. In another particular embodiment of the kit of the invention, the heterologous gene product is selected from a group consisting of GFP and mCherry.

In a more particular embodiment of the kit of the invention, ASFV-specific antigen which is not the EP402R gene product or the O174L gene product is p72 and the heterologous gene product is GFP and mCherry.

In another particular embodiment of the kit of the invention, the antibodies are immobilized in a support.

The kit of the invention finds use in performing the DIVA method of the invention. Therefore, another aspect of the present invention is related to the use of the kit of the invention for performing the DIVA method of the invention.

***

The invention will be described by way of the following examples which are to be considered as merely illustrative and not limitative of the scope of the invention.

EXAMPLES

Materials and Methods

Design and generation of CRISPR-Cas9 vector for the deletion of the gene EP402R (CD2v) from the previous generated LAV prototype Arm-APolX-GFP-AMGFs

The CRISPR-Cas9 technique is based on using the cellular repair system to achieve more effectively the generation of recombinant viruses by the Homology Directed Repair (HDR) system. In particular, we adapted this technique to delete the EP402R gene (coding for CD2v) from previous generated LAV prototype Arm-APolX-GFP-AMGFs (International Patent application published as W02022090131) in order to increase its safety and efficacy. Hence, we generated the recombinant virus Arm-APolX-GFP-ACD2v-mCherry-AMGFs according to the nucleotide sequence SEQ ID NO: 3.

Two types of vectors were used: (i) one derived from pSpCas9(BB)-2A-Puro (PX459), (containing the Cas9 nuclease of Streptococcus pyogenes and a gene conferring resistance to Puromycin), in which Nuclear Localization sequence (NLS) has been deleted (pSpCas9(BB)ANLS-2A-Puro); and (ii) a pcDNA3.1 -derived vector containing the flanking sequences of the target gene (EP402R), surrounding the mCherry gene derived from pmCherry-N1 (designed “donor vector”).

For the pSpCas9(BB)ANLS-2A-Puro vectors, we cloned specific gRNAs to interrupt the EP402R gene, coding for CD2v protein. For the design of the gRNA we used Protospacer, based on the sequence of the ASFV strain Arm/07/CBM/c2 (LR812933.1). The designed gRNA sequences were as follow: 5’- TCTTCATTAGATTCAGGTGG -3’ (SEQ ID NO: 7) and 5’- GCTAGCTACATGTGGAAAAGC -3’ (SEQ ID NO: 8) for EP402R gene, which were cloned into the pSpCas9(BB)ANLS-2A-Puro vector following the procedure described in (Ran, F.A., et al, Nat Protoc, 2013. 8(11): p. 2281-2308), generating the following vectors: pSpCas9(BB)ANLS-2A-Puro_EP402R-gRNA-0 and pSpCas9(BB)ANLS-2A-Puro_EP402R- gRNA-8.

For the generation of donor vector we used the previous generated pFL-AEP402R- p72EGFP, in which we have previously cloned the EP402R gene its flanking regions (500pb upstream and 500pb downstream) (73,362 - 75,716), substitute the EP402R gene by EGFP gene from a pEGFP-E3, and finally substitute the CMV promoter by the viral p72 promoter (described in (Garcia-Escudero, R. and E. Vinuela, J Virol, 2000. 74(17): p. 8176-82)) (see description in International Patent application published as W02022090131). Then, we used pFL-AEP402R-p72EGFP as a backbone for the generation of pFL-AEP402R-p72mCherry, by substituting the EGFP gene by a mCherry gene from the pmCherry-N1 vector. For that, we designed specific probes to clone by In-Fusion technology (Clontech), which were as follow: 5’- TATGTACTATATATTAATTATTTAACCTTTCAAGCTGGTCTTC -3’ (SEQ ID NO: 9) and 5’- GGTGGCGACCTATATAATGTTATAAAAATAATTTATTGTT -3’ (SEQ ID NO: 10); and 5’- ATATAGGTCGCCACCATGGTGAGCAAG -3’ (SEQ ID NO: 11) and 5’- AATATATAGTACATATAAGATACATTGATGAGTTTGGACAAACC -3’ (SEQ ID NO: 12). PCR were performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoScientific).

Generation of recombinant virus Arm-APolX-GFP-ACD2v-Cherry-AMGFs by CRISPR-Cas9 technology

The recombinant virus was generated in COS-1 cells, from the American Type Culture Collection (ATCC), grown in Dulbecco modified Eagle medium (DMEM) supplemented with 2 mM l-glutamine, 100 U/ml gentamicin, nonessential amino acids, and 5% fetal bovine serum. Cells were grown at 37°C in a 7% CO2 atmosphere saturated with water vapor. We used Arm-APolX-GFP-AMGFs virus as a backbone for the generation of the Arm-APolX- GFP-ACD2v-Cherry-AMGFs.

COS-1 cells (seeded a 6-well plate at 90% confluence) were co-transfected with specific pSpCas9(BB)ANLS-2A-Puro gRNA (2pg) together with the donor vector (2pg) with FuGene HD (Promega). 24h post transfection, puromycin (Sigma) was added to the media of transfected and no transfected control cells (1 g/ml). After 48h, transfected strain to generate Arm-APolX-GFP-ACD2v-Cherry-AMGFs. At 5 days post infection (dpi) cell and medium was collected and conserved at -80°C.

Isolation of recombinant viruses from wild-type viruses by plaque isolation Collected recombinant virus was used to infect COS-1 cells. After 1h 30 minutes of viral adsorption, inoculum was removed and DMEM 2% fetal bovine serum with Carboxymethylcellulose (CMC) was added. 4-7 dpi viral plaques appear and are identified by optical microscopy. Recombinant Arm-APolX-GFP-ACD2v-Cherry-AMGFs were detected under fluorescent microscopy by red plates (detected by mCherry present in the recombinant viruses). Recombinant plaque was collected by sterile tips in 40pl of DMEM and conserved at -80 °C. After three freeze I thaw cycles, extracted virus are used to infect new COS-1 cells by using the same procedure. This plaque isolation method was repeated at least three times in order to isolate the recombinant apart from the parental virus.

During the isolation procedure, wild type or parental contaminant detection was checked by PCR. For that, 10pl of the isolated plaque is digested with proteinase K (Sigma) in 1.5mM MgCI ₂ , 50mM KCI, 0.45% Tween20, 0.45% NP40 and 10mM TrisHCI pH8.3 buffer, incubated 30 minutes at 45 °C and then 15 minutes at 95 °C to inactivate the proteinase K. The digested isolated plaque was used as a DNA template for PCR to detect the presence of recombinant and parental virus. The oligos used are listed in Table 1.

Table 1 .- Oligos used for the detection of recombinant and parental viruses by PCR

When no parental virus was detected by PCR, recombinant virus was grown by infecting six to eight P100 plates of COS-1 cells. After 3 dpi, total virus was collected and subjected to freeze I thaw cycles. After centrifugation at 3000 rpm 5 minutes at RT, supernatant was collected and centrifuged at 7000 rpm o/n at 4 °C. The pellet was resuspended in fresh DMEM medium and a 10pl sample was collected in order to check for parental virus contamination by PCR, as explained above. Further dilution limit techniques may be required to fully purify the recombinant virus without parental contamination. When no contamination was detected, virus was grown for DNA extraction and next generation sequencing (NGS) analysis.

Viral DNA extraction for NGS analysis

Recombinant virus was grown in 6-8 P100 pre-confluent COS-1 cells. After 3-4 dpi, supernatant containing extracellular virions was collected and centrifuged at 7000 rpm o/n at 4 °C. The pellet was resuspended in cold and filtrated 10mM Tris-HCI pH8.8. and treated with 0.25U/pl DNAsa I (Sigma), 0.25U/pl Nuclease S7 (Sigma) and 20 pg/ml RNAse A (Promega) in 800mM Tris-HCI pH7.5, 200mM NaCI, 20mM CaCh and 120mM MgCh during 2h at 37 °C, and further incubation with 12mM EDTA (Sigma) and 2mM EGTA (Sigma) 10 min at 75 °C. After that, the solution was treated with 200pg/ml proteinase K (Sigma) in 0.5% SDS for 1h at 45 °C. Next, viral DNA was precipitated incubating 1 :1 volume of the sample with phenol:chloroform:isoamilic acid at 25:24:1. After centrifugation at 10000 rpm 3 minutes at RT, watery fraction was transferred and further incubated with: 0.1 volumes of 3M acetic acid pH5.2; 1 l LPA (Sigma) and 2 volumes of cold 100% ethanol for 1h at -80 °C. Then, sample was centrifuged at 13000 rpm for 30 minutes at 4 °C and the supernatant was discarded. Pellet was washed ones with cold 70% ethanol and dry on air. Finally, pellet was resuspended in 10mM Tris pH8.8.

Illumina sequencing and data analysis

A high-quality genomic DNA (100 ng) was submitted to MicrobesNG (Birmingham, UK). Illumina libraries were prepared with NEBNext Ultra DNA Library Prep Kit (New England Biolabs). DNA sample was fragmented in a Covaris instrument and sequenced on an Illumina MiSeq device as paired-end (2 x 250 bp) reads.

Illumina reads from each sequenced sample were trimmed using Trimmomatic v0.36 (Bolger, A.M., M. Lohse, and B. Usadel, Bioinformatics, 2014. 30(15): p. 2114-20) and quality-filtered (QF) with PrinSeq v1.2 (Schmieder, R. and R. Edwards, Bioinformatics, 2011. 27(6): p. 863-4). Only paired QF reads were considered for further analysis. These paired QF reads as referred as Illumina QF reads in the text. Then, resulting paired reads were aligned against the reference sequence for each case, by using Bowtie 2 v2.3.4.1 (Langmead, B. and S.L. Salzberg, Nat Methods, 2012. 9(4): p. 357-9) with default parameters against the Arm/07/CBM/c2 reference sequence (accession number LR812933.1).

Alignment files were then used for the variant calling process with GATK (v4.1.2). Numbers of SNPs (Single Nucleotide Polymorphism) and indels were determined and characterized by their location in coding and non-coding regions, as well as by synonymous or nonsynonymous SNPs. Genetic variants were annotated using SnpEff (Cingolani, P., et al., Fly (Austin), 2012. 6(2): p. 80-92) software (v5.0c). Shortly, a library was generated according to SnpEff manual using the .gbk file from Arm/07/CBM/c2 reference sequences obtained from Genbank. VCF files generated by GATK were annotated using both libraries and the resulting annotated variants were analyzed using Libreoffice Calc. Numbers of SNPs (Single Nucleotide Polymorphism) and indels were determined and characterized by their location in coding and non-coding regions, as well as by synonymous or non- synonymous SNPs.

De-novo assembly of Illumina reads was generated with Unicycler (Wick R. R. et al, PLoS computational biology, 13(6), e1005595), which is an assembly pipeline that works as a SPAdes optimizer to assemble Illumina-only read sets, was used. It tries assemblies at a wide range of k-mer sizes, evaluating each graph and choosing the one that best minimizes both contig and dead ends. With the purpose of improving the process Scaffold_builder (Silva, G. G. et al., 2013, Source Code Biol Med 8, 23) software was used to order those contigs generated by draft sequencing along a reference sequence where gaps are filled with N's and small overlaps are aligned with Needleman_Wunsch algorithm. Due to the presence of gaps in the generated assembly, Gapfiller (Nadalin, F. et al., 2012, BMC Bioinformatics, 13(Suppl 14), S8), a tool that calculates and closes the size of the gaps by using the distance information derived from the paired read data, was used.

Finally, to extend the extremes ends of the viral chromosome assembly, a consensus sequence based on the reads mapped against the reference genome was generated. For that, an in-house script that combines bcftools and seqtk to perform variant calling and quality filter (Q<20), was created. A single contig of 166253 bp was finally obtained.

Animal experiment

Animal experiments were performed at Careside/APQA BSL-3 facilities in South Korea. A total of 8 pigs (Sus scrofa) with healthy condition and same age were used for the experiment. Vaccinated group was composed by 4 pigs and non-vaccinated group was composed by other 4 pigs, which were added at the challenge. Experiments were performed in BSL-3 Ag laboratory in the Korea Zoonoses Research Institute, Jeonbuk National University (Republic of Korea) and in compliance with the animal welfare act and IACUC approved protocol JBNU2022-05 of the investigate institute. Animals were managed with appropriate feeding and water supply system, cleaning, and general veterinary care, etc. Each experimental group was located in separate boxes. Body temperature, clinical score, viremia (from whole blood and swab samples) and serum for ELISA were measured regularly in order to determine specific immune response and protection against ASFV virulent strain challenge ASFV/Korea/pig/PaJu1/2019 (Genbank Access No. MT748042.1).

ASFV real-time qPCR and ELISA

Viremia at different times post vaccination and post challenge was determined by realtime qPCR (RT-qPCR assay). ASFV DNA was isolated by DNeasy Blood & Tissue kit (Qiagen) and qPCR was performed using commercial kit for ASFV qPCR (VetMax, Thermo). For detection of specific antibodies against ASFV, commercial ELISA INgezim PPA COMPAQ (Ingenasa) was used.

Results

Generation of ASFV recombinant virus Arm-APolX-GFP-ACD2v-Cherry-AMGFs by CRISPR-Cas9 technology

ASFV recombinant virus was generated by CRISPR-Cas9 technology in COS-1 cells, in order to generate new attenuated virus with potential use as Live Attenuated Vaccine (LAV). For that, specific vectors detailed above were transfected in COS-1 cells, which were then selected with puromycin and infected with wild-type virus in order to generate the recombinant virus Arm-APolX-GFP-ACD2v-Cherry-AMGFs, as detailed in Material & Methods section.

We used the previous generated LAV prototype Arm-APolX-GFP-AMGFs (International Patent application published as W02022090131) as parental virus. We deleted the gene EP402R, coding for CD2v protein that is believed to be involved in virulence and pathogenesis for its role in hemadsorption (Rodriguez, J.M., et al., J Virol, 1993. 67(9): p. 5312-20.) and in the interaction with host proteins and immune system (Perez-Nunez, D., et al., PLoS One, 2015. 10(4): p. e0123714; Garcia-Belmonte, Revilla and Perez-Nunez), replacing this gene by mCherry, generating the recombinant virus GFP (+) /mCherry (+) Arm-APolX-GFP-ACD2v-Cherry-AMGFs.

Viral DNA from Arm-APolX-GFP-ACD2v-Cherry-AMGFs was extracted and sequenced by NGS, as explained in Materials & Methods section.

Sequence characterization of recombinant virus Arm-APolX-GFP-ACD2v-Cherry- AMGFs

Sequencing runs gave a broad range of paired reads per sample, which were mapped against each correspondent genome reference. Illumina reads from Arm-APolX-GFP- ACD2v-Cherry-AMGFs sample was aligned against ASFV isolate Arm/07/CBM/c2 reference sequence (accession no. LR812933.1). Estimated average coverage was calculated based on the percentage of mapped reads and genome size (Table 2).

The high mean coverage obtained enables to unambiguously characterize the LAV prototype from a genetic point of view. Table 2. Illumina sequencing statistics of ASFV recombinant virus.

Genetic analysis of variability

Genetic variability was analyzed by using sequencing data alignment as explained in Materials & Methods. Numbers of single nucleotide polymorphisms (SNPs) and insertions/deletions (InDeis) were determined and characterized by their location in coding and non-coding regions, as well as by synonymous or non-synonymous SNPs.

Genetic variability analysis from ASFV Arm-APolX-GFP-ACD2v-Cherry-AMGFs showed a very low number of mutations (Table 3), when aligned against the ASFV Arm/07/CBM/c2 reference. We observed that most of the mutations (three indels and two SNPs) dropped into intergenic regions: two indel and one SNP are located upstream of the mCherry promoter, and one indel and one SNP are located in the left ITR of the viral genome. The other SNP dropped into the M1249L provoking a silent mutation (I Ie243lle).

Table 3. Numbers of mutations from variant analysis of ASFV WT isolates and recombinant viruses sequencing data.

De-novo assembly of the genome of Arm-APolX-GFP-ACD2v-Cherry-AMGFs was performed, resulting in a 166253 bp genome length, whose sequence corresponds to SEQ ID NO: 3. We also confirmed the correct substitutions of the O174L and EP402R genes by the GFP and mCherry cassettes, respectively by aligning the Arm-APolX-GFP-ACD2v- Cherry-AMGFs sequencing data against its theoretical mutant genome (data not shown), in silico generated for these purposes.

Arm-APolX-GFP-ACD2v-Cherry-AMGFs protects against a virulent challenge of genotype II ASFV Korean Paju strain

Animal experiment was performed in South Korea under BSL3 conditions. We inoculated 4 pigs intramuscularly with 1.5-10 ⁶ TCID50/ml Arm-APolX-GFP-ACD2v-Cherry- AMGFs per animal that were observed for 28 days post vaccination (dpv) prior to challenge and then until 49 dpv (21 days post challenge, dpc). After challenge, all the control pigs, non- vaccinated, died or were euthanized between 35-38 dpv (7-10 dpc). In contrast, 100% of the vaccinated animals continue healthy and alive three weeks after the challenge (Fig. 1), indicating that Arm-APolX-GFP-ACD2v-Cherry-AMGFs is a promising vaccine candidate against ASFV.

Body temperatures were measured daily during the animal experiment. Animals within the vaccinated group did not present fever during the vaccination period (Fig. 2A). After challenge (Fig. 2B), vaccinated animals only presented fever occasionally at the end of the experiment, at 19-21 dpc. Non-vaccinated animals, however, presented fever from 7 dpc and did not recover normal temperature, until they died or were euthanized (gray line).

Viremia analysis in whole blood extracted from animals showed that in vaccinated animals (#51-54) no viremia at all was detected after vaccination (from 0-28 dpv) (Table 4). However, after the challenge, we detected low levels of viremia from 3 (animal #51), 5 (animals #52-53) or 7 (animal #54) dpc. The viremia remains detectable, although in low levels, in animals #51, #52 and #54 until 21 dpc, where it increased in animals #51 and #53 (Table 4), that probably correspond to the body temperature increase observed at 19-21 dpc (Figure 2).

Viremia was also measured in nose and fecal swabs in order to evaluate virus shedding post vaccination and post challenge (Tables 5 and 6). Vaccinated animals did not present viremia in nose or fecal swabs during vaccination period, except for very low levels in nose swabs at 10 dpv (animal #52), 14 dpv (animals #52 and #53) and 21 dpv (animal #52) (Table 5). In fecal swabs low levels of viremia were detected at 0 dpv (animals #51 and #53) and 3 dpv (animal #51) but then disappeared and found just a very low level at 21 dpv (animals #52 and #54) and at 28 dpv (animal #52) (Table 6). After challenge, only low levels of viremia were detected in nasal swabs at 3 dpc (animals #51 and #53) and 5 dpc (animal #51) that became undetectable until 14 dpc (animals #51 and #54) and then increased at 21 dpc (animals #51, #53 and #54) (Table 5). Similar results were observed with viremia in fecal swabs after challenge (Table 6). While it was undetectable from 0-14 dpc (except for low levels at 0 dpc in animal #52 and at 10 dpc in animal #54) higher levels were detected at 21 dpc (animals #51, #53 and #54), especially in animals #51 and #53. As in the case of viremia detected in blood, this increase detected at 21 dpc in nasal and fecal swabs seemed in concordance with the increase in body temperature detected in vaccinated animals at 19- 21 dpc. Table 4. Viremia detected by qPCR in EDTA blood samples in vaccinated (#51-54) and nonvaccinated (#65-68) animals at the indicated days post vaccination (dpv) and days post challenge (dpc). Challenge was administrated at 28 dpv. Values indicated Ct. ND= no detection of viral DNA.

Table 5. Viremia detected by qPCR in nose swab samples in vaccinated (#51-54) and nonvaccinated (#65-68) animals at the indicated days post vaccination. Values indicated Ct. ND= no detection of viral DNA.

Table 6. Viremia detected by qPCR in fecal swab samples in vaccinated (#51-54) and nonvaccinated (#65-68) animals at the indicated days post vaccination. Values indicated Ct. ND= no detection of viral DNA.

Overall, these results indicate that vaccine prevented viremia in most of the vaccinated animals after challenge in blood and in nose and fecal swabs. However, we detected an increase of the levels of viremia in all cases at 21 dpc that should be analyzed in future animal experiments. Finally, viremia was also checked in different tissues, such as tonsils, lymph nodes (LN), spleen, lung, heart, liver and kidney (Table 7) when animals were euthanized (after 21 dpc). According to what we observed (Tables 4-6) in animals where high levels of viremia were found in blood and nose and fecal swabs, we found also high levels of viremia in all the analyzed tissues (animals #51, #53 and #54). In animal #52, where no viremia was detected at 21 dpc in neither blood nor swabs, only low levels of viremia were found in those tissues, although it was present in all tissues.

Table 7. Viremia detected by qPCR in the indicated tissues in samples of vaccinated (#51- 54) or non-vaccinated (#65-68) animals. Values indicated Ct. ND= no detection of viral DNA.

Concerning anti-ASFV antibodies, as indicated in Figure 3, specific anti-ASFV antibodies were found in all vaccinated animals prior to challenge at 28 dpv although at low levels (<50%). These antibodies were then continuously detected after challenge (7, 14 and 21 dpc), while decreased at 7 dpc to increase again at 14 and especially at 21 dpc. On the other hand, only few specific anti-ASFV antibodies were detected in non-vaccinated animals at 28 dpv (o dpc) but then no were further detected throughout the challenge. These results indicate that antibody-specific response was generated in vaccinated animals, which finally resulted protected against virulent challenge.

Overall, these results indicated that the LAV prototype Arm-APolX-GFP-ACD2v- Cherry-AMGFs is able to induce antibody response in vaccinated animals, and very low levels or no viremia after vaccination/challenge were found in vaccinated animals in blood and in nose and fecal swabs, except for 21 dpc where higher levels were detected in blood, swabs and in all examined tissues, which corresponded to increase body temperature. This last data should be further studied and confirmed in future animal experiments. However, overall, the vaccine induced a protective response against 100% of the animals where challenge was administrated (4 out of 4 animals).