Bacillus sp. strain UAACBES OIL BACTERIAL ISOLATE AS A BIOREDUCTOR IN GREEN BIOSYNTHESIS OF ZINK OXIDE NANOPARTICLES

Field of Invention Engineering

This invention relates to Bacillus sp . strain UAACBES OIL bacteria isolates from the leaves of Surian plant [Toona sinensis (Juss, ) M.Roem] which has potential as a bioreductor (biological reducing agent) on the green biosynthesis process of zinc oxide nanoparticles. This bacterium has the potential to be further developed on the commercial industrial grade of nanoparticles.

Invention background

The massive application of technology is currently triggering research movements to be faster and on target. Nanoparticles are a field of technology which continues to develop and be studied. The biodegradable polymer contained in these particles contains active agents that can be widely applied, especially in the medical field. The potential of zinc oxide nanoparticles in the medical field is as an antioxidant, anti-diabetic agent, antimicrobial, wound healing agent, and anti-inflammatory.

In addition, nanoparticles can be used as molecular imaging to make the image resolution obtained better, especially in molecular diagnostic processes (Ahmed, T. et al. (2021) 'Bioinspired Green Synthesis of Zinc Oxide Nanoparticles from a Native Bacillus cereus Strain RNT6: Characterization and Antibacterial Activity against Rice Panicle Blight Pathogens Burkholderia glumae and B. gladioli' , Nanomaterials, 11 (884) .

Based on these advantages, nanotechnology is worth studying so that it can be applied more broadly in medical and pharmaceutical aspects. ZnO nanoparticles can inhibit the growth of S. aureus bacteria at a concentration of 125 pg/ml. The size of nanoparticles can affect their ability to inhibit bacterial growth, specifically if they are on a scale of 10-30 nm. The antibacterial potential of ZnO is related to its action mechanism in damaging the bacterial cell wall, which can kill the bacteria. Daghdari, S. et al. (2017) 'The effect of ZnO nanoparticles on bacterial load of experimental infectious wounds contaminated with Staphylococcus aureus in mice' , Nanomed Journal, 4 (4) , 232-236.

Nanoparticles can be produced using top-down physics or bottom-up chemical and biological techniques. The physical and chemical synthesizing of nanoparticles involves hazardous chemicals, high production energy, and is not environmentally friendly. This causes the biological method known as green synthesis to become more popular. The green synthesis produces nanoscale particles using microorganisms and plant extracts as bioreductors (Yusof, H. et al. (2020) 'Sustainable microbial cell nanofactory for zinc oxide nanoparticles production by zinc- tolerant probiotic Lactobacillus plantarum strain TA4' , Microbial Cell Factories, 19:10) .

On the other hand, this method is also categorized into the field of nanobiotechnology so that it can increase the discovery of new organisms as bioreductors for the process of synthesizing nanoparticles. The advantages of this method are that it is more cost-effective and energy efficient, less toxic, and environmentally friendly. The green synthesis method used to produce nanoparticles can be carried out intracellularly or extracellularly . In intracellular green synthesis, bacterial pellets will be used to synthesize nanoparticles. Compounds that play a role in the synthesis process are polysaccharides and proteins found in the bacterial cell wall. This causes not all bacteria to have the potential to synthesize metal nanoparticles or metal oxides.

In green extracellular synthesis, the supernatant solution has an important role in the synthesis process. This is because the solution contains biologically active components produced by bacteria. The compounds includes enzymes, proteins, and metabolites produced by these microbes. In addition, the supernatant solution contains the NADPH reductase enzyme, which causes a reduction reaction by transferring electrons to zinc ions to form nanoparticles. Based on Halter, extracellular green synthesis is more profitable to be applied on an industrial scale because it can produce synthetic products on a large scale with simpler purifying method.

Zinc Oxide Nanoparticles are zinc oxide metal compounds with a nanoscale size of 1 - 100 nm. This metal oxide is the most stable in environmental conditions and can be synthesized at low temperatures. Balraj , B. et al. (2016) 'Synthesis and characterization of zinc oxide nanoparticles using marine streptomyces sp . with its investigations on anticancer and antibacterial activity' , Res Chem Intermed, 42 (11) , succeeded in developing a green synthesis method for nanoparticles with a diameter of 20 - 50 nm using Streptoyces sp . as an extracellular bioreductor. In addition other research by Saravanan, M. et al. (2018) 'Green synthesis of an isotropic zinc oxide nanopartices with antibacterial and cytofriendly properties' , Microbial pathogenesis, 115, 57-63 also conducted an extracellular biosynthesis using the supernatant from B. megaterium inoculum. The nanoparticles obtained from this study have a diameter of 45 - 95 nm .

In our invention, zinc oxide nanoparticles are produced using the green synthesis method using bacteria derived from surian leaves. Surian bacterial isolates have the potential as bioreductors for extracellular synthesis of silver (Ag) nanoparticles with optimum absorption ranges from 405 - 434 nm(Sarina, G. et al. (2020) 'Screening of endophytic bacteria from surian leaves ( Toona sinensis (Juss.) M.roem as silver nanoparticles reducing agent' , IOSR-JPBS, 15(2) , 16-22) .

Some of the similar patents that we explored were, No .W02017040401A1 concerning the antimicrobial and enzyme inhibitory zincoxide nanoparti cles . The other patent was No. WO2016043682A1 about anti-bacterial effect of plant-mediated silver nanoparticles using Artemisia nilagirica bacteria.

Invention summary

The bacterial isolate Bacillus sp . strain BES OIL claimed in this invention is a bacterium that has been successfully isolated from the leaves of the Surian plant [ Toona sinensis (Juss , ) M.Roem] stored in slanting agar in a test tube containing Nutrien Agar (NA) at the Sumatran Biota Laboratory Culture Center, Andalas University, Padang City, West Sumatra Province, Indonesia with the Isolate Code of UAAC 22106L.

The bacterial isolates have been tested in the laboratory, and their ability as a biological reducing agent has been proven to reduce ZnSO4 into zinc oxide nanoparticles. Bacillus sp . strain UAACBES OIL bacteria has pale white, coil-shaped colony with wavy edges and flat elevations. This bacteria belongs to the Grampositive type, is rod-shaped, aerobic, and produces spores.

The nucleotide base sequence is then compared with the DNA sequence that has been published in the gene bank through the website (http://blast.ncbi.nlm.nih.gov/Blast) . Phylogenetic tree analysis was carried out using MEGA X software with the neighborjoining method and 1,000 bootstrap replications. This isolate is closely related to Bacillus cereus strain DGA14 with a similarity value of 99.87%.

There was a difference of 0.13% due to a seven base pairs difference in the nucleotide base sequence of the isolate Bacillus sp . strain UAACBES OIL. It can be concluded that this bacterium is a new isolate that has never been reported in the world before.

The product of zinc oxide nanoparticles has been characterized using UV-Vis spectrophotometry. It was confirmed that the product formed was zinc oxide nanoparticles with an absorbance of 0.239 at a wavelength of 357nm.

Brief Description of the Image Figure 1 shows the bacterial isolate Bacillus sp . strain BES OIL claimed in this invention. This bacterium is successfully isolated from the leaves of the Surian plant [ Toona sinensis (Juss , ) M.Roem] . The isolates were stored in slanting agar in test tubes containing Nutrient Agar (NA) media at the Sumatran Biota Laboratory Culture Center, Andalas University, Padang City, West Sumatra Province, Indonesia, with Isolate Code of UAACBES OIL.

Figure 2, the results of Gram staining of Bacillus sp . strain UAACBES OIL in the form of bacilli and purple, including Gram Positive bacteria.

Figure 3 shows the UV-Vis spectrum of the zinc oxide nanoparticle solution produced with the bacterial bioreductor Bacillus sp . strain UAACBES OIL. The absorbance is 0.239 at a wavelength of 357nm.

Figure 4 shows the growth curve of the Bacillus sp . strain UAACBES OIL in Nutrient Broth (NB) medium.

Complete Description of Invention

The rejuvenation of Bacillus sp . strain UAACBES OIL bacterial isolates was performed by taking bacterial isolates using the inoculation loop. Then it was streaked on a sterilized slanted Nutrient Agar medium. The isolates were incubated in an incubator at 37°C for 24 hours.

Microbiological tests were carried out to observe the macroscopic and microscopic morphology of the bacteria. Macroscopic observations were directly related to the characteristics of the bacteria, including color, shape, margins, and elevation of the colony. The microscopic observation was carried out by observing the formation of the bacterial cells stained with Gram and spore staining reagents. The glass slide was examined using a light microscope at l,000x magnification, previously smeared with immersion oil. The first step is to ensure that there is no fat on the glass slide by cleaning it using 70% alcohol and then heating it in a bunsen .

One bacterial loop was taken and heat- fixed . Then, crystal violet dye was added, left for 1 minute , and rinsed with distilled water to remove excess dye . Next , the preparation was dripped with iodine to increase the af finity of the primary dye ( crystal violet ) , left for 1 minute , and then rinsed with distilled water . The alcohol was dripped for 10 seconds or until no more crystal violet dye was flowing . Then, it was stained with safranin dye , left for 30 seconds , rinsed with distilled water, and dried .

Bacillus sp . strain UAACBES O IL has pale white , coil-shaped colonies ; wavy edges , flat elevations ( Figure- 1 ) ; classi fied as Gram-positive type with bacilli shape ( Figure-2 ) , are aerobic, spore- forming, and belongs to the genus Bacill us with the following DNA sequences : CTGATAACTCCGGGAAACCGGGGCTAATACCGGATAACATTTTGAACCGCATGGTTCGAA ATTG AAAGGCGGCTTCGGCTGTCACTTATGGATGGACCCGCGTCGCATTAGCTAGTTGGTGAGG TAAC GGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTG AGAC ACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTG ACGG AGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAA CAAG TGCTAGTTGAATAAGCTGGCACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACG TGCC AGCAGCCGCGGTAATACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCG CGCA GGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAAC TGGG AGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGAGAT ATGG AGGAACACCAGTGGCGAAGGCGACTTTCTGGTCTGTAACTGACACTGAGGCGCGAAAGCG TGGG GAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTA GAGG GTTTCCGCCCTTTAGTGCTGAAGTTAACGCATTAAGCACTCCCGCCCTGGA.

The nucleotide base sequence is then compared with the DNA sequence that has been published in the gene bank through the website (http : / /blast . ncbi . nlm . nih . gov/Blast ) and the following results were obtained :

Table 1 . BLAST results of Bacill us sp . strain UAACBES O IL isolate DNA sequence with the Gene Bank isolates

Max Total Query Per .

Accession Description

Score Score Cover Ident MN809373.1 Bacillus cereus strain DGA14 1382 1382 99% 99,87%

KY622360.1 Bacillus thuringiensis strain 1382 1382 99% 99,87%

LA273

MT903014.1 Bacillus paramycoides strain 1382 1382 99% 99,87% pur-32

KT007498.1 Bacillus subtilis strain 1378 1378 99% 99,73%

DCRUST BT ITG

MZ683209.1 Bacillus cereus strain BP122 1378 1378 99% 99,73%

MN044865.1 Bacillus paramycoides strain 1378 1378 99% 99,73%

ANK10

MH321579.1 Bacillus thuringiensis strain 1378 1378 99% 99,73% chamalong LI

MW642070.1 Bacillus paramycoides strain 1378 1378 99% 99,73%

WHS 338

MZ191750.1 Bacillus subtilis strain RP17 1378 1378 99% 99,73%

MW767015.1 Bacillus tropicus strain S22 1376 1376 99% 99,73%

MW857107.1 Bacillus cereus strain IND02 1376 1376 99% 99,73%

LR535777.1 Bacillus megaterium strain 1376 1376 99% 99,73%

7A7-13

MW850424.1 Bacillus nitrareducens strain 1376 1376 99% 99,73%

MLN 12

MW857094.1 Bacillus pacificus strain BAG 1376 1376 99% 99,73%

N3015

The results of phylogenetic tree analysis using MEGA X software with the neighbor- j oining method with 1,000 bootstrap replications. Isolates are bacteria isolated from sterilized Surian leaves. This isolate is closely related to Bacillus cereus strain DGA14 with a similarity value of 99.87%. There was a difference of 0.13% due to a seven base pairs difference in the nucleotide base sequence of the isolate Bacillus sp . strain UAACBES OIL. It can be concluded that this bacterium is a new isolate that has never been reported in the world.

The bacteria were subcultured into Nutrient Broth (NB) media and shaken with a 250 rpm shaker at 37 °C for 24 hours. The growth rate of the bacteria was observed, and the growth curve was determined (Figure 3) . Screening of bioreductor bacteria was carried out to determine which bacteria have the potential to reduce zinc sulfate precursors to zinc oxide nanoparticles using the Pomastowski method, P. et al. ( 2020 ) published under the title 'Zinc oxide nanocomposites-Extracellular synthesis, physicochemical characterization and antibacterial potential' , Materials, 13, pp . 43-47, with some modification. Bacterial cultures on Nutrient Broth medium were centrifuged at 6, 000 rpm for 30 minutes. Then it was filtered using a 0.2 pm syringe filter to collect the supernatant .

The zinc sul fate precursor solution with a concentration of 0 . 1 g/mL was mixed with 15 ml of supernatant for each bacterial isolate culture collection in a 50 mL Erlenmeyer flask . All samples were shaken at 150 rpm at 37 ° C for seven days . The change in solution color from clear to cloudy white indicated the formation of Zink Oxide nanoparticles . It was further conf irmed by UV-Vis spectrophotometry in a quartz cuvette using distilled water as a reference solvent . The absorption spectrum in the wavelength region of 340-373 nm indicates the formation of Zink Oxide nanoparticles . The nanoparticle was produced using isolate Bacillus sp . strain UAACBES O IL which, in this invention, has an absorbance of 0 . 239 at a wavelength of 357nm ( Figure-4 ) .