SEQUENCE LISTING

This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.

TECHNICAL FIELD

The present invention relates to a bacterial delivery system comprising a live Escherichia coli bacterium comprising at least one exogenous polynucleotide encoding an shRNA that is capable of modifying a target RNA in a eukaryotic cell after transfer into the eukaryotic cell. The present invention further relates to medical applications and in-vitro methods using the bacterial delivery system of the invention.

BACKGROUND

Current gene silencing tools such as siRNA and shRNA are known as a specific means to inhibit expression of a gene of interest. However, to apply these methods in a clinical setting, efficient delivery of the relevant siRNA or shRNA to the target cell is necessary. Presently, delivery of siRNA or shRNA into eukaryotic cells in vivo has been very difficult. As pointed out by Ahmed and Lage in 2018 (Bacteria-mediated delivery of RNAi effector molecules against viral HPV16-E7 eradicates oral squamous carcinoma cells (OSCC) via apoptosis. Cancer Gene 77)er (2019) 26, 166-17), while the power of siRNAs or shRNAs as a specific means to inhibit the expression of a gene of interest by triggering the RNAi pathway has been demonstrated in many investigations, the major obstacle of this technology for clinical application has not been resolved. The issue lies in the difficulty in delivering the RNAi effectors to target cells and tissues.

One alternate delivery strategy that has been attempted is so-called transkingdom RNAi (tkRNAi) delivery, where non-pathogenic bacteria is used to produce and deliver therapeutic siRNA encoding plasmid DNA into target cells to hijack the cellular RNAi machinery. In 2006, Xiang et al. (Short hairpin RNA-expressing bacteria elicit RNA interference in mammals. Nature Biotechnology 24(6), 697-702) could show that E. coli could be used via an oral route to target colon cancer cells and deliver CTNNB1 shRNA. However, efficient silencing was observed at an MOI of 1:1000. Similarly, in 2018, Ahmed and Lage (cited above) treated cells with bacteria carrying shRNA cassettes at an MOI of 1:500, 1:1000, 1:2000 and 1:4000 and the authors used mainly an MOI of 1:500 or 1:1000 to see an effect in their various assays. For most clinical applications, this would not be feasible.

Thus there remains a need for improved delivery systems and methods of delivery of gene silencing tools into eukaryotic, specifically mammalian, cells in vivo.

SUMMARY OF THE INVENTION

In order to meet this need, the present invention provides a bacterial delivery system for use in-vivo and in-vitro delivery of gene silencing tools into eukaryotic cells and organisms.

Specifically, the invention relates to a bacterial delivery system comprising a live Escherichia coli bacterium comprising an exogenous polynucleotide encoding an shRNA episomally maintained or integrated into its genome (preferably integrated into its genome), wherein

(i) the exogenous polynucleotide is operably linked to a constitutive promoter that is functional in the bacterium;

(ii) the bacterium comprises a polynucleotide encoding an RNA polymerase that synthesizes the shRNA;

(iii) the RNase III gene (SEQ ID NO:1) has been deleted from the Escherichia coli bacterium;

(iv) the bacterium is capable of transferring the shRNA into the cytoplasm of a eukaryotic target cell; and

(v) the shRNA is capable of silencing RNA of the eukaryotic target cell and/or is capable of modifying the protein expression of the eukaryotic target cell.

In a preferred aspect, the polynucleotide encoding the shRNA comprises a loop sequence separating the sense and antisense strand of the shRNA cassettes at least 90% identical to SEQ. ID NO:2. Furthermore, in one application, the shRNA is capable of silencing the expression of a protein (e.g., encoded by oncogenes) relevant to cancer cells in humans (e.g. relevant to cancer progression), such as PLK1 (SEQ ID NO:5) used in Example 4 or any one of EGFR, ERBB2, ERK/MAPK, AKT1 VEGF, BRCA1, MYC, KRAS, PIK3CA, JUN, SOX2, CDK4, CDK2, E1A, or E2F. E1A and E2F are oncogenes causing HPV dependent cervical cancer.

As mentioned above, the bacterial delivery system requires a constitutively active promoter, such as an EM7 promoter, a Ptrc promoter (SEQ ID NO:3), a PTet promoter, a PN25 promoter (SEQ ID NO:4) or a Pcon5 promoter. In a preferred aspect, the promoter is a Ptrc or a PN25 promoter.

Furthermore, the bacterium of the invention can also comprise one or more exogenous polynucleotides selected from the group consisting of: (i) a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.;

(ii) a polynucleotide encoding a phospholipase, preferably phospholipase C (pic) derived from Clostridium spp. or Listeria spp.;

(iii) a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cell, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; and

(iv) a polynucleotide encoding bacteriocin release protein (BRP), and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic host cell.

In a preferred aspect, the bacterium comprises all of the above nucleotides (i) to (iv).

Thus a preferred bacterial delivery system of the invention comprises a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cells, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.;a polynucleotide encoding bacteriocin release protein (BRP) and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic host cell; and a transcriptional promoter selected from PN25 promoter or Ptrc promoter.

In the context of the invention, the bacterium used in the delivery system may be engineered to be a DAP auxotroph.

The bacterial delivery system of the invention may be used in vitro and in vivo. Specifically, the bacterial delivery system may be used in the prevention or treatment of mammalian disease, preferably human disease.

For example, the system may be used in the prevention or treatment of cancer, CNS disease, inflammatory bowel disease, inflammatory disease, liver fibrosis, liver cirrhosis, autoimmune disease, connective tissue disorder or genetic disorder optionally selected from the group consisting of metabolic disorders, cystic fibrosis, Huntington's disease, muscular dystrophy and muscular atrophy. In a preferred aspect, the system of the invention may be used to treat cancer, wherein the cancer can be selected from the group consisting of brain tumor, glioblastoma, colorectal cancer, ovarian cancer, prostate cancer, pancreatic cancer, lung cancer, gastric cancer, liver cancer, or cancers caused by a viral infection or a bacterial infection; optionally wherein the cancer is caused by HPV, EBV, Kaposi, Polyoma, CMV, herpes, HBV or H. pylori infection, preferably wherein the cancer is squamous cell carcinoma caused by HPV infection, optionally wherein the squamous cell carcinoma caused by HPV infection is cervical cancer, head-and-neck cancer, oropharyngeal cancer, anal cancer, penile cancer, vaginal cancer or vulvar cancer, and wherein the HPV refers to one or more HPV strains causing cancer or genital warts.

When the system is used to treat or prevent disease, the system can be administered by one of the following routes: oral, inhalation, intratumoral, intravenous, subcutaneous, or local in-body application, preferably intranasal, intradermal, intrarectal, or intravaginal. The bacterial delivery system, when used to treat or prevent disease, can be delivered at a multiplicity of infection (MOI) of 0.1 to 500, preferably 1 to 100 or any value in between.

As mentioned above, the bacterial delivery system can also be used in an in-vitro method for delivering shRNA into a mammalian cell, preferably a human cell or a human cancer cell. Such a delivery method may comprise or consist of the steps:

(i) engineering an Escherichia coli bacterium so that the RNase III gene (SEQ ID NO:1) is deleted and at least one exogenous polynucleotide encoding an shRNA is preferably integrated into the genome or episomally maintained in a plasmid vector, wherein the polynucleotide is operably linked to a constitutive promoter, preferably a Ptrc promoter (SEQ. ID NO:3) or a PN25 promoter (SEQ ID NO:4), that is functional in the bacterium;

(ii) transcribing the exogenous polynucleotide in the bacterium using an RNA polymerase; and

(iii) contacting the bacterium with the mammalian cell allowing the transfer of the exogenous shRNA into the cytoplasm of a mammalian cell; wherein the shRNA is capable of silencing RNA of the mammalian target cell and/or is capable of modifying the protein expression of the mammalian target cell.

In a preferred in vitro method of the invention, the bacterium can be further engineered to be a DAP auxotroph and can further comprise one or more polynucleotides selected from the group consisting of:

(i) a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.;

(ii) a polynucleotide encoding a phospholipase, preferably phospholipase C (pic) derived from Clostridium spp. or Listeria spp.;

(iii) a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cells, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; and (iv) a polynucleotide encoding bacteriocin release protein (BRP), and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic cell.

FIGURES

Figure 1: Plasmid vector used in Experiment 1 pUC57-PAraBAD_T7_rrnB-Tl-TT

Figure 2: Plasmid vector used in Experiment 1 pET9a_PT7_IRES_EGFP_poly-A98-TT-Lambda

Figure 3: EGFP delivery from bacterial cells to SiHa cells in Example 1

Figure 4: Depicts the percentage of mammalian cells invaded by the engineered bacteria after defined periods of time and at different multiplicities of infection (MOIs, which defines the concentration of bacteria to mammalian cells) in Vero and Hela cells, respectively.

Figure 5: Shows the cellular entry of invasive E. coli at different time points. The average number of internalized bacteria per mammalian cell is shown. The number of internalized E. coli bacteria increases over time and with increasing MOI in Vero and Hela cells, respectively. Different cell lines vary in their susceptibility to bacterial invasion.

Figure 6: Depicts internalized E. coli at 30 min (A) and 6 h (B) post bacterial invasion (white arrow) in Vero cells. After the cell invasion, the bacteria self-lyse within the phagosome. (A) At the 30 min time point, the bacteria are still intact; (B) at the 6h time point, the bacteria are already lysed and disintegrated. Cargo release from the vacuole occurs after bacterial lysis and is trafficked to the nucleus (said E. coli is engineered to trigger this event).

Figure 7: Bacterially-mediated FAK1 mRNA transfer into FAKl ^/_ cells as visualized by RNA fluorescence in situ hybridization (FISH). Deletion of RNase III from RBT1 E. coli strain (invasive DAP auxotroph E. coli strain) results in increased stability of the delivered mRNA cargo. Arrows point to mRNA molecules in the cytoplasm. The right panel photo is taken using the same exposure time as in the left panel. The resulting bacterial strain after the RNase III deletion we here name RBT2.

Figure 8: Examples of the plasmid maps used to express the shRNA molecules against PLK1 and EGFP. The shRNA cassettes are maintained episomally in plasmids and are driven by the Ptrc (SEQ ID NO: 3) or the PN25 (SEQ. ID NO:4) bacterial promoter. Terminators such as the rrnB T1 terminator or the lambda terminator can be used in these constructs. The loop sequence separating the sense and antisense strand of the shRNA cassettes can be 5'-TTCAAGAGA-3' (SEQ. ID NO:2). The plasmids were transformed into the RBT2 E. coli strain.

Figure 9: Bacterially-mediated knock-down of PLK1 (SEQ ID NO:5) in HeLa cells has a cytotoxic effect in HeLa cells. An shRNA construct was generated against PLK1 and transformed into the RBT1 E. coli strain (invasive DAP auxotroph E. coli strain). (A) Scrambled shRNA sequences were used as a control. Nuclei counts stained with DAPI were done at day 4 post bacteria inoculation with the cells. Intensely DAPI stained nuclei denote apoptotic cells. (B) A 40-50% reduction in the cell viability was observed after PLK1 shRNA-mediated knock-down (marked by asterisks).

Figure 10: Bacterially-mediated knock-down of EGFP in HeLa-EGFP-expressing cells. Two different shRNA constructs were generated against EGFP (shRNA-1 and shRNA-2) and transformed into the RBT1 E. coli strain (invasive DAP auxotroph E. coli strain). Scrambled shRNA sequences were used as a control. EGFP intensity measurements were taken at day 5 post bacteria inoculation with the cells. Mean EGFP intensity was calculated relative to the signal in cells treated with scrambled shRNA, and was further normalized to cell nuclei numbers. A 20-30% reduction in the EGFP signal was observed after EGFP shRNA-mediated knock-down (marked by asterisks).

DETAILED DESCRIPTION

We describe here an innovative bacterial delivery system which combines the use of live Escherichia coli bacteria for the delivery of shRNA.

The present invention relates to a bacterial delivery system. In the context of the present invention, the "bacterial delivery system" is defined as a live Escherichia coli bacterium that has been genetically modified by deletion of the RNaselll gene (SEQ ID NO:1) and by targeting a eukaryotic cell. In this regard, the term "a" bacterium of course also covers a bacterial cell line. Obviously, the bacterial delivery system would need more than one bacterium to target more than one cell, such as a tissue.

It was surprisingly found that deletion of the RNaselll gene (SEQ. ID NO:1) in E.coli led to higher shRNA stability, which in turn allowed for a lower MOI to be used for the treatment of mammalian cells with the bacterial delivery system of the invention. Deletion of RNaselll from E.coli was studied in early 2001 by Timmons et al. (Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans; 2001 Jan 24;263(l-2):103-12) and it was found that ingested E.coli with RNaselll deletions allowed for maintenance of bacteria induced RNAi phenotypes in Caenorhabditis elegans. However, this method was not applied to the delivery of shRNA to mammalian cells or organisms. In the present invention, as shown in Figure 7 and Example 4, it was found that such a deletion of RNaselll led to higher RNA stability. This in turn, led to a decreased MOI, as fewer E.coli were necessary to observe gene silencing. One of the drawbacks of the prior art shRNA delivery with bacteria described in Ahmend and Lage (2019) or in earlier studies by Xian (2006) cited above was that high MOI was necessary for efficient silencing. Silencing was observed only at an MOI of 1:1000 in Xiang et al, and in Ahmed and Lage the authors used mainly an MOI of 1:500 or 1:1000 to see an effect in their various assays. For most clinical applications, this would be much too high. The present bacterial delivery system was found to be effective at a MOI of 1:0.1 to 1:500, preferably 1:1 to 1:100 or any value in between. While the exact dosage for application to a full organism would depend on the route of administration and the target cells and could vary, it would still be significantly lower than that of the prior art. In this regard, it would also be possible to simply disrupt or inactivate RNasell I activity by introducing mutations into the coding sequence or deleting parts of the RNaselll without deleting the whole gene. These should have the same effect as deleting RNaselll completely and would be considered equivalent. Methods for gene deletion or disruption in E.coli are well known and do not need to be described in detail here. Thus deletion of the polynucleotide encoding RNaselll would have the same effect as disrupting the polynucleotide encoding RNaselll, disrupting a promoter which is operably linked with said polypeptide encoding the RNaselll, or disrupting the expression of control sequences of the polynucleotide encoding RNaselll, such as ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences, wherein the RNase III genomic sequences corresponds to SEQ. ID NO:1.

The term "live" bacteria refers to bacteria that have an active metabolism and are usually able to replicate. In this regard, a live bacterium may be engineered to be either a prototroph, or an auxotroph. A prototroph is an organism able to synthesize all the compounds needed for its growth. Prototrophic bacteria do not have specific requirements in nutrients (e.g. amino acids and nucleotides) for their growth and division. In contrast, an auxotroph is an organism unable to synthesize a particular organic compound required for its growth. For proper growth (and division) of an auxotrophic bacterium, the compound needs to be administered in the culture/growth medium. In a preferred embodiment, the bacterial strains used may be diaminopimelic acid (DAP) auxotroph.

The bacterial delivery system of the invention comprises a live bacterium which, in turn, comprises at least one shRNA expressing transcriptional unit maintained episomally or integrated into its genome. In the context of the invention, "episomally" means the maintenance and stabilization of a circular dsDNA element (plasmid, BAC) which is capable of independent replication and segregation and can be implemented in various copy numbers per bacterial cells. The polynucleotide can also be "integrated" into the bacterial genome. Methods and positions for integrating exogenous polynucleotides into bacterial genomes are well known. Strains of bacteria are commercially available with specific integration sites already prepared.

In the context of the invention, the bacterial delivery system is able to transfer shRNA into the eukaryotic cells in vitro and in vivo.

An shRNA (short hairpin RNA) is an artificial RNA molecule with a tight hairpin turn that can be used to silence gene expression in a targeted way via RNA interference, that is by using the cellular RNAi machinery. Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors. In a preferred embodiment of the invention, the shRNA comprises a loop sequence separating the sense and antisense strand of the shRNA cassettes at least 90% identical to SEQ ID NO:2. Generally, the regions of the target mRNA of interest used for the shRNA are selected based on the specific target. In general, such regions are 20-25 nucleotides. For example, for PLK1 shRNA used in Example 4, the shRNA motif corresponds to a twofold, 21 nucleotide inverted repeat separated by a loop sequence of SEQ. ID NO:5.

In order to allow for transcription of the polynucleotide encoding the shRNA and production of the shRNA in the bacterium, the polynucleotide is operably linked to a constitutive promoter that is functional in the bacterium. Promoters for gene expression in bacteria are well known, such as a T7 (EM7) promoter, a Ptrp promoter, or a Plac promoter or the bacteriophage originated Plambda, PN25 promoters. In the context of the present invention, a Ptrc promoter (a hybrid of Plac and Ptrp) or other constitutively active promoters were implemented (PN25, EM7). In general, any promoter that drives expression in bacteria can be used to maximize shRNA yield, though in the present invention, constitutive promoters are preferred.

For the transcription of the shRNA to be possible, the bacterium must comprise a polynucleotide encoding an RNA polymerase that binds to the promoter and synthesizes the exogenous RNA. Preferably, these constitutive promoters are recognized by the bacterial endogenous RNA polymerase complex (RNAP) optimally by utilizing the housekeeping Sigma factor.

In addition, the bacterium is capable of transferring the shRNA into the cytoplasm of a eukaryotic cell. Methods for RNA transfer are well known. Invasive bacteria strains, such as Listeria, Shigella and Salmonella can invade the host cells naturally. This property can be transferred to other bacteria such as E. coll through transfer of genes encoding an invasion factor, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain. Thus in one embodiment of the invention, the bacterium used in the bacterial delivery system of the invention comprises an invasion factor.

Other accessory elements can be included into the bacterium to facilitate transfer of the shRNA into the eukaryotic cell. For example, the bacterium can include a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp., a Phospholipase, preferably phospholipase C (pic), preferably derived from Clostridium spp. or Listeria spp., a bacteriocin release protein (BRP) together and bacteriophage lambda lysozyme, and holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic host cell.

In the context of the invention, the eukaryotic cell can be a plant or an animal cell. Preferably, the cell is a mammalian cell, even more preferably a primate cell and most preferably a human cell. In certain embodiments, the cell is a cancer cell.

In one specific embodiment, the bacterial delivery system is used to deliver shRNA into a eukaryotic cell, preferably a mammalian cell. The bacterial delivery system of the invention may be used in therapy, for example in the prevention or treatment of mammalian disease, preferably human disease. Specifically, the bacterial delivery system of the invention could be used in the prevention or treatment of cancer, CNS disease, inflammatory bowel disease, inflammatory disease, liver fibrosis, liver cirrhosis, autoimmune disease, connective tissue disease or a genetic disorder such as metabolic disorders, cystic fibrosis, Huntington's disease, muscular dystrophy and muscular atrophy.

When the bacterial delivery system is used to prevent or treat cancer, the cancer can be selected from the group consisting of brain tumor, glioblastoma, colorectal cancer, ovarian cancer, prostate cancer, pancreatic cancer, lung cancer, gastric cancer, liver cancer, or cancers caused by a viral infection or a bacterial infection such as H. pylori infection. Cancers caused by viral infection can be those caused by HPV (human papilloma virus), EBV (Epstein-Barr virus), Kaposi, Polyoma, CMV (Cytomegalovirus), herpes, HBV (hepatitis B virus). When the cancer is squamous cell carcinoma caused by HPV infection, the squamous cell carcinoma can be cervical cancer, head-and-neck cancer, oropharyngeal cancer, anal cancer, penile cancer, vaginal cancer or vulvar cancer. In some cases, the cancer is caused by strains causing genital warts.

The bacterial delivery system can be used in a method for the prevention and/or treatment of the medical conditions described herein. As such, the term "treating" or "treatment" includes administration of the bacterial delivery system to a patient to modify the cellular mRNA levels and protein expression of the diseased cells.

Furthermore, the term "prevention" or "prophylaxis" as used interchangeably herein, refers to any medical or public health procedure whose purpose is to prevent a medical condition described herein. As used herein, the terms "prevent", "prevention" and "preventing" refer to the reduction in the risk of acquiring or developing a given condition. Also meant by "prevention" is the reduction or inhibition of the recurrence of a medical condition.

The bacterial delivery system of the present invention can be administered to a patient which is a vertebrate, preferably a mammal or bird. Examples of suitable mammals include, but are not limited to, a mouse, a rat, a cow, a goat, a sheep, a pig, a dog, a cat, a horse, a guinea pig, a canine, a hamster, a mink, a seal, a whale, a camel, a chimpanzee, a rhesus monkey and a human, with a human being preferred. Examples of suitable birds include, but are not limited to, a turkey, a chicken, a goose, a duck, a teal, a mallard, a starling, a Northern pintail, a gull, a swan, Guinea fowl or water fowl to name a few. Human patients are a preferred embodiment of the present invention.

The bacterial delivery systems, methods and uses described herein are applicable to both human therapy and veterinary applications.

The bacterial delivery systems for use in the methods of present invention can be administered in any suitable unit dosage form. Administration may be oral, by inhalation, intratumoral, intravenous, subcutaneous, or local in-body application, such as intranasal, intradermal, intrarectal, or intravaginal application.

Suitable oral formulations can be in the form of suspension, syrup, elixir, and the like. Pharmaceutically acceptable excipients, lubricants, and sweetening or flavoring agents can be included in the oral pharmaceutical compositions. If desired, conventional agents for modifying tastes, and colors can also be included.

For injectable formulations, the pharmaceutical compositions can be in admixture with suitable excipients in a suitable vial or tube to form a composition suitable for injection.

In addition, the invention relates to in-vitro methods of bactofection. "Bactofection" refers to the use of bacteria for direct gene transfer into a target organism, organ or tissue following invasion.

As mentioned above, the bacterial delivery system can also be used in an in-vitro method for delivering shRNA into a eukaryotic cell, preferably a mammalian cell such as a human cell or a human cancer cell. Such a delivery method may comprise or consist of the steps:

(i) engineering an Escherichia coli bacterium so that the RNase III gene (SEQ ID NO:1) is deleted and at least one exogenous polynucleotide encoding an shRNA is integrated into the genome or episomally maintained in a plasmid vector, wherein the polynucleotide is operably linked to a constitutive promoter, preferably a Ptrc promoter (SEQ. ID NO:3) or a PN25 promoter (SEQ ID NO:4), that is functional in the bacterium;

(ii) transcribing the exogenous polynucleotide in the bacterium using an RNA polymerase; and

(iii) contacting the bacterium with the eukaryotic cell allowing the transfer of the exogenous shRNA into the cytoplasm of a eukaryotic cell; wherein the shRNA is capable of silencing RNA of the eukaryotic target cell and/or is capable of modifying the protein expression of the eukaryotic target cell.

In a preferred in vitro method of the invention, the bacterium can be further engineered to be a DAP auxotroph and can further comprise one or more polynucleotides selected from the group consisting of:

(i) a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.;

(ii) a polynucleotide encoding a phospholipase, preferably phospholipase C (pic) derived from Clostridium spp. or Listeria spp.; (iii) a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cell, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; and

(iv) a polynucleotide encoding bacteriocin release protein (BRP), and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic cell.

In the methods of the invention the eukaryotic cell can be any a plant or an animal cell, preferably a mammalian cell, a human cell, or a human cancer cell.

The term "contacting" as used herein refers to the bringing of a bacterium comprising an exogenous polynucleotide encoding an shRNA episomally maintained or integrated into its genome and a eukaryotic cell spatially into close proximity so that the exogenous RNA can be transferred from the bacterium into the eukaryotic cell. This can for example mean that the bacterium comprises a polynucleotide encoding an invasion factor such as invasion derived from Yersinia species that allows the bacterium to invade the eukaryotic cell.

It must be noted that as used herein, the singular forms "a", "an", and "the", include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a gene modification" includes one or more of such different modifications and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.

Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or sometimes when used herein with the term "having".

When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element.

In the examples below, it can be seen that the bacterial delivery system of the invention is capable of invading eukaryotic target cells and delivering RNA to these cells. In addition, as can be seen from Example 4, E.coli with deletions of RNaselll delivered more RNA to the target cells than E.coli without this deletion, see Figure 7. Furthermore, using the plasmid vectors according to Figure 8, it was shown that bacterially-mediated knock-down of PLK1 in HeLa cells has a cytotoxic effect in HeLa cells, as can be seen in Figure 9. Specifically, as described in Example 4, an shRNA construct was generated against PLK1 and transformed into the RBT2 E. coli strain (invasive DAP auxotroph E. coli strain). In Figure 9A it was observed that scrambled shRNA sequences, which do not correspond to a eukaryotic RNA but are random and were used as a control, do not have an impact on cell viability. Figure 9B further shows a 40-50% reduction in the cell viability after PLK1 shRNA-mediated knock-down. In addition, the results of the bacterially-mediated knock-down of EGFP in HeLa-EGFP-expressing cells is shown in Figure 10. Two different shRNA constructs were generated against EGFP (shRNA-1 and shRNA-2) and transformed into the RBT2 E. coli strain (invasive DAP auxotroph E. coli strain). Again scrambled shRNA sequences were used as a control. A 20-30% reduction in the EGFP signal was observed after EGFP shRNA-mediated knock-down. Thus it was shown that delivery of PLK1 and EGFP shRNA was effective in silencing expression using the bacterial delivery system of the invention. This can be applied to other target genes, as will be shown in further experiments.

The invention is also characterized by the following items:

1. A bacterial delivery system (e.g., for delivering shRNA into a mammalian cell) comprising a live Escherichia coli bacterium comprising at least one exogenous polynucleotide encoding an shRNA integrated into its genome or maintained episomally in a plasmid, wherein

(i) the exogenous polynucleotide is operably linked to a constitutive promoter that is functional in the bacterium;

(ii) the bacterium comprises a polynucleotide encoding an RNA polymerase that synthesizes the shRNA;

(iii) the RNase III gene (SEQ ID NO:1) has been deleted from the Escherichia coli bacterium;

(iv) the bacterium is capable of transferring the shRNA into the cytoplasm of a eukaryotic target cell; and

(v) the shRNA is capable of silencing RNA of the eukaryotic target cell and/or is capable of modifying the protein expression of the eukaryotic target cell.

2. The system of any one of the preceding items, wherein the polynucleotide encoding the shRNA comprises a loop sequence separating the sense and antisense strand of the shRNA cassettes at least 90% identical to SEQ. ID NO:2.

3. The system of any one of the preceding items, wherein the shRNA is capable of silencing human PLK1 (SEQ ID NO:5), EGFR, ERBB2, ERK/MAPK, AKT1 VEGF, BRCA1, MYC, KRAS, PIK3CA, JUN, S0X2, CDK4, CDK2, E1A, or E2F (e.g., oncogenes responsible for cancer progression). The system of any one of the preceding items, wherein the promoter is selected from a T7 promoter, a Ptrc promoter (SEQ. ID NO:3), a PTet promoter, a PN25 promoter (SEQ ID NO:4) or a Pcon5 promoter. The system of any one of the preceding claims, wherein the bacterium further comprises one or more polynucleotides selected from the group consisting of:

(i) a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.;

(ii) a polynucleotide encoding a phospholipase, preferably phospholipase C (pic) derived from Clostridium spp. or Listeria spp.;

(iii) a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cells, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; and

(iv) a polynucleotide encoding bacteriocin release protein (BRP), and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic host cell. The system of any one of the preceding items, wherein the Escherichia coli bacterium comprises:

(i) a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cells, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; further peferably (i) is integrated into the genome of said Escherichia coli bacterium (e.g., for making it more safe and/or resistant against horizontal transfer to other bacteria);

(ii) a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.; further peferably (ii) is integrated into the genome of said live Escherichia coli bacterium (e.g., for making it more safe and/or resistant against horizontal transfer to other bacteria);

(iii) a polynucleotide encoding bacteriocin release protein (BRP), and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic host cell; and (iv) a transcriptional promoter selected from PN25 promoter or Ptrc promoter. The system of any one of the preceding items, wherein the bacterium is engineered to be a DAP auxotroph. The system of any one of the preceding items, for use as a medicament and/or in therapy. The system of any one of the preceding items, for use in the prevention or treatment of mammalian disease, preferably human disease. The system of any one of the preceding items for use in the prevention or treatment of cancer, CNS disease, inflammatory bowel disease, inflammatory disease, liver fibrosis, liver cirrhosis, autoimmune disease, connective tissue disorder or genetic disorder optionally selected from the group consisting of metabolic disorders, cystic fibrosis, Huntington's disease, muscular dystrophy and muscular atrophy. The system of any one of the preceding items, wherein the cancer is selected from the group consisting of brain tumor, glioblastoma, colorectal cancer, ovarian cancer, prostate cancer, pancreatic cancer, lung cancer, gastric cancer, liver cancer, or cancers caused by a viral infection or a bacterial infection; optionally wherein the cancer is caused by HPV, EBV, Kaposi, Polyoma, CMV, herpes, HBV or H. pylori infection, preferably wherein the cancer is squamous cell carcinoma caused by HPV infection, optionally wherein the squamous cell carcinoma caused by HPV infection is cervical cancer, head-and-neck cancer, oropharyngeal cancer, anal cancer, penile cancer, vaginal cancer or vulvar cancer, and wherein the HPV refers to one or more HPV strains causing cancer or genital warts. The system of any one of the preceding items, wherein the system is administered as oral, inhalation, intratumoral, intravenous, subcutaneous, or local in-body application, preferably intranasal, intradermal, intrarectal, or intravaginal. The system of any one of the preceding items, wherein the Escherichia coli bacterium is delivered at a multiplicity of infection (MOI) of 0.1 to 100. An in-vitro method for delivering shRNA into a mammalian cell, preferably a human cell or a human cancer cell, comprising the steps of:

(i) engineering an Escherichia coli bacterium so that the RNase III gene (SEQ. ID NO:1) is deleted and at least one exogenous polynucleotide encoding an shRNA is integrated into the genome or is episomally maintained in a plasmid vector, wherein the exogenous polynucleotide is operably linked to a constitutive promoter that is functional in the bacterium;

(ii) transcribing the exogenous polynucleotide in the bacterium using an RNA polymerase; and

(iii) contacting the bacterium with the mammalian cell allowing the transfer of the exogenous RNA into the cytoplasm of a mammalian cell; wherein the exogenous RNA encodes an shRNA that is capable of silencing RNA of the mammalian target gene and/or is capable of modifying the protein expression of the mammalian target. The method of any one of the preceding items, wherein the bacterium is engineered to be a DAP auxotroph further comprises one or more polynucleotides selected from the group consisting of:

(i) a polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.; further peferably (i) is integrated into the genome of said Escherichia coli bacterium (e.g., for making it more safe and/or resistant against horizontal transfer to other bacteria);

(ii) a polynucleotide encoding a phospholipase, preferably phospholipase C (pic) derived from Clostridium spp. or Listeria spp.;

(iii) a polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cells, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain; further peferably (iii) is integrated into the genome of said Escherichia coli bacterium (e.g., for making it more safe and/or resistant against horizontal transfer to other bacteria) and

(iv) a polynucleotide encoding bacteriocin release protein (BRP), and bacteriophage lambda lysozyme, holin and antiholin to enable the said bacterium to self lyse upon entering the eukaryotic cell. The method of any one of the preceding items, wherein the constitutive promoter in the plasmid is a Ptrc promoter (SEQ. ID NO:3) or a PN25 promoter (SEQ ID NO:4). The system or method of any one of preceding items, wherein said at least one exogenous polynucleotide encoding an shRNA is integrated into the genome of said Escherichia coli bacterium. 18. The system or method of any one of preceding items, further comprising a polynucleotide encoding an adhesin polypeptide (e.g., a bacterial adhesin polypeptide, e.g., an E. coli adhesin polypeptide and/or synthetic and/or chimeric and/or fusion adhesin polypeptide, e.g., capable of enabling the bacterium a tissue specificity and/or for improving safety and/or efficiency of said system or method).

19. The system or method of any one of preceding items, wherein said Escherichia coli bacterium is invasive, e.g., capable of invading eukaryotic cells.

20. The system or method of any one of preceding items, wherein said delivering shRNA into a mammalian cell is carried out by the means of bacterial invasion.

21. The system or method of any one of preceding items, wherein said Escherichia coli bacterium is attenuated, e.g., for decreasing environmental release and/or growth control.

22. The system or method of any one of preceding items, wherein:

(i) said polynucleotide encoding a protein capable of lysing the eukaryotic endolysosomal membranes, preferably hemolysin (hly) derived from Listeria spp.; further preferably said polynucleotide is integrated into the genome of said Escherichia coli bacterium, e.g., for making it more safe and/or resistant against horizontal transfer to other bacteria; and/or

(ii) said polynucleotide encoding an invasion factor to enable the bacterium to invade eukaryotic cells, preferably an invasin (inv) derived from Yersinia spp. or another bacteria strain, further preferably said polynucleotide is integrated into the genome of said Escherichia coli bacterium e.g., for making it more safe and/or resistant against horizontal transfer to other bacteria.

EXAMPLES

The following examples illustrate the invention. These examples should not be construed as to limit the scope of the invention. The examples are included for purposes of illustration and the present invention is limited only by the claims.

Example 1

In vitro transfer of RNA from Bacteria into Eukaryotic cells:

The aim of this experiment is to compare the cargo delivery efficacy by means of bactofection: DNA versus RNA. E.co// strains used:

Strains with bacterial lysis in endosome

DHIOb AlpxM CM-inv-hly::endA (DAP prototroph): an Escherichia coli DHIOb strain engineered to have a deletion of IpxM myristoyltransferase involved in lipid A biosynthesis, an invasin gene (inv, derived from Yersinia pseudotuberculosis, binds to betal-integrins on surface of cells and triggers uptake via phagocytosis), and a hemolysin gene (hly, derived from Listeria monocytogenes) replacing the endonuclease endA;

DHIOb AlpxM CM-inv-hly::endA AdapA (diaminopimelic acid auxotroph): the above-described strain plus the deletion of dihydrodipicolinate synthase (dapA).

Strains including PLC (Phospholipase C; bacterial lysis in the cytoplasm)

DHIOb AlpxM /nv::endA hly tonB plc::dapA lysis2.1::dapB (diaminopimelic acid auxotroph): an Escherichia coli DHIOb strain engineered to have a deletion of IpxM myristoyltransferase involved in lipid A biosynthesis, an invasin gene (inv, derived from Yersinia pseudotuberculosis, binds to betal- integrins on surface of cells and triggers uptake via phagocytosis) replacing endA, a hemolysin gene (hly, derived from Listeria monocytogenes) replacing tonB, a phospholipase C (pic) replacing dihydrodipicolinate synthase (dapA), and lysis 2.1 complex (consisting of bacteriocin release protein, bacteriophage lambda lysozyme, holin and antiholin) replacing dihydrodipicolinate reductase (dapB);

DHIOb AlpxM /nv::endA hly::tonB plc::dapA lysis2.1::dapB dapAB rihB (diaminopimelic acid prototroph): the above-described strain and in addition, replacing the rihB pseudogene with a bicistronic transcriptional cassette of the dapA and dapB genes.

Eukaryotic Cell lines:

Vero (African green monkey kidney cell line)

Hela (human cervix carcinoma cell line HPV18)

SiHa (human cervix carcinoma cell line HPV16)

Constructs used:

The bacterial strains (harboring 1 or 2) express T7 RNA polymerase upon induction with arabinose (1) or entry into eukaryotic cell (2). Plasmid constructs a, b, c, and d encode for EGFP under T7 promoter; whereas translation of a and b is only be possible in eukaryotic cells due to the internal ribosomal entry site (IRES). Translation of c and d only occurs in prokaryotic cells. A vector map of plasmids 1 and b is shown in Figure 1 and 2, respectively.

The bacterial strains mentioned above are transformed with constructs.

The bactofection of strains with plasmids la, lb is then compared with 3 (pmax GFP).

This allows for the identification of the best strain for delivering RNA to the host cell. The results of this experiment can be determined by immunostaining and/or flow cytometry

To study the kinetics of bacteria harboring T7 and GFP constructs, time course experiments with bacteria harboring la, lb, lc and Id (as well as only 1 and b) are performed. Growth curves are performed and GFP expression in lc and Id as well as different arabinose level induction potency is measured. For the results shown in Figure 3, SiHa cells were bactofected at MOI 50 and fixed at the indicated timepoints. As can be seen in Figure 3, EGFP delivery could be observed and protein expression was shown in Eukaryotic cells.

Example 2: Engineered E. coli efficiently invade mammalian cells

Cultured HeLa cells were incubated with engineered E. coli and the percentage of invaded cells was quantified from immunostainings at different time points.

Material and Methods

In vitro bactofection assay protocol

On the day before the experiment, mammalian cells were seeded in 12-well plates using (1ml in each well, number of cells depend on the cell line, but usually 0.4xl0 ^s /ml is sufficient) and bacteria were grown in BHI medium (or other, such as 2XYT). The following day, the experiment continues with these overnight bacterial cultures. The OD ₆₀₀ values of bacteria cultures were measured and the number of bacteria/mL of culture was calculated. A bacteria-to-mammalian-cell-ratio (MOI) of 5, 20 and 50 bacteria/cell were calculated and if necessary the bacteria were diluted in DMEM medium. An appropriate number of bacteria was added to each experimental well, mixed gently and incubated for 2h (or different time, e.g. 0.5h, lh, 6h) in the CO ₂ incubator. After 2h (or other) of incubation, the plates were washed 4 times with PBS (room temperature). After washing, 1 ml of mammalian culture media (such as DMEM) containing proper antibiotic (e.g. gentamicin) was added to each well and the plates were placed back in the incubator. Then 3 samples of each bacteria strain were collected on the desired days. The samples were centrifuged at 4000 rpm for 5 min to separate cell supernatant from the cell debris.

Immunostaining Protocol

The cells were washed with lx PBS and fixed 20 minutes at RT with Fixative Solution (44.1 mL DMEM w/o serum, 5.4 mL HCHO (37 %), 0.5 mL IM Hepes pH 6.8) and washed with PBS four times, then the cells were permeabilized 3 minutes at RT with Permeabilization Buffer (PBS lx, 0.1 % Triton X-100, 0.5 % BSA) and washed again with lx PBS four times. Then the cells were blocked 10 minutes at RT with Blocking Buffer (BSA 0.5 % in lx PBS) and the first antibody was diluted in blocking buffer and samples were incubated for 1.5 h. For E. coli staining the Abeam antibody (ab25823) was used in 1:250 dilution, while for VP16 staining the Abeam antibody (abl37967) was used in 1:100 dilution. The cells were washed again with lx PBS four times before the second antibody was diluted in 1:500 in blocking buffer and incubated for 45 minutes at RT. The cells were washed with lx PBS, stained with DAPI, washed again with lx PBS four times and mounted on a slide using mounting solution.

Cells were visualized under the microscope. Pictures were taken, merged and analyzed using ImageJ software.

Results As can be seen from Figure 4, E. coli invades mammalian cells as early as a few minutes post administration. Coincubation of bacteria with mammalian cells for 2h results in 80-100 % invasion efficiency, depending on the bacterial MOI used. Bactofection efficiency seems to be MOI -dependent (the higher the MOI the more efficient the bactofection), but seems to be advantageous up to MOI 50. MOI higher than 50 seems to have deleterious effect on cells in in vitro culture. Figure 4 shows the percentage of HeLa cells invaded by E. coli for 30 minutes, 1 and 2 hours after bactofection. The number of internalized E. coli bacteria increases over time and with increasing MOI. Different cell lines vary in their susceptibility to bacterial invasion . Figures 5 and 6 illustrate the average number of bacteria counted per cell and an example of immunostaining thereto.

Example 3: Engineered E. coli deliver cargo in cultured mammalian cells

E. coli was engineered to carry EGFP as plasmid DNA. The cellular uptake of bacteria was demonstrated by immunostaining and the EGFP signal could be detected in the HeLa cells and Vero cells after bactofection.

Materials and Method

Immunostaining Protocol

The cells were washed with lx PBS and fixed 20 minutes at RT with Fixative Solution (For 50 mL stock use: 44.1 mL DMEM w/o serum, 5.4 mL HCHO (37 %), 0.5 mL IM Hepes pH 6.8). The cells were washed with PBS four times, then the cells were permeabilized 3 minutes at RT with Permeabilization Buffer (PBS lx, 0.1 % Triton X-100, 0.5 % BSA) and washed again with lx PBS four times. Then the cells were blocked 10 minutes at RT with Blocking Buffer (BSA 0.5 % in lx PBS (same as the permeabilization buffer w/o Triton) and the first antibody was diluted in blocking buffer for 1.5 h. For E. coli staining an Abeam antibody (abl37967) was used in 1:250 dilution, while for VP16 staining the Abeam antibody (abll0226) was used in 1:100 dilution. The cells were washed again with lx PBS four times before the second antibody was diluted in 1:500 in blocking buffer for 45 minutes at RT (do it on parafilm with 40-50 pL). The cells were washed with lx PBS, stained with DAPI, washed again with lx PBS four times and mounted on a slide, a drop of mounting solution was used.

Results

As can be seen from Figure 6, at 30 minutes after cell invasion bacteria are still intact (Figure 6 A), while at 6h after cell invasion bacteria are lysed and disintegrated (Figure 6 B). Figure 6 shows the uptake of E. coli into the cultured Vero cells. Example 4:

Bacterial cell lines:

RBT1 E. coli strain DHIOb AdapA -inv-hly::endA (diaminopimelic acid auxotroph) : an Escherichia coli DHIOb strain engineered to have an invasin gene (inv, derived from Yersinia pseudotuberculosis, binds to betal-integrins on surface of cells and triggers uptake via phagocytosis), and a hemolysin gene (hly, derived from Listeria monocytogenes) replacing the endonuclease endA; deletion of dihydrodipicolinate synthase (dapA).

RBT2 E. coli strain is the same as RBT1 E. coli strain in which RNase III has been deleted (ARNase III)

Seq ID NO:1 RNase III gene sequence:

ATGAACCCCATCGTAATTAATCGGCTTCAACGGAAGCTGGGCTACACTTTTAATCAT CAGGAACTGTT GCAGCAGGCATTAACTCATCGTAGTGCCAGCAGTAAACATAACGAGCGTTTAGAATTTTT AGGCGAC TCTATTCTGAGCTACGTTATCGCCAATGCGCTTTATCACCGTTTCCCTCGTGTGGATGAA GGCGATATG AGCCGGATGCGCGCCACGCTGGTCCGTGGCAATACGCTGGCGGAACTGGCGCGCGAATTT GAGTTA GGCGAGTGCTTACGTTTAGGGCCAGGTGAACTTAAAAGCGGTGGATTTCGTCGTGAGTCA ATTCTCG CCGACACCGTCGAAGCATTAATTGGTGGCGTATTCCTCGACAGTGATATTCAAACCGTCG AGAAATTA ATCCTCAACTGGTATCAAACTCGTTTGGACGAAATTAGCCCAGGCGATAAACAAAAAGAT CCGAAAA CGCGCTTGCAAGAATATTTGCAGGGTCGCCATCTGCCGCTGCCGACTTATCTGGTAGTCC AGGTACGT GGCGAAGCGCACGATCAGGAATTTACTATCCACTGCCAGGTCAGCGGCCTGAGTGAACCG GTGGTT GGCACAGGTTCAAGCCGTCGTAAGGCTGAGCAGGCTGCCGCCGAACAGGCGTTGAAAAAA CTGGAG CTGGAATGA

To stabilize the mRNA in the Bacteria, bacterially-mediated FAK1 m RNA transfer into FAKl ^/_ cells as visualized by RNA fluorescence in situ hybridization (FISH) was studied as shown in Figure 7. Deletion of RNase I II (SEQ. ID NO:1) from RBT1 E. coli strain (invasive DAP auxotroph E. coli strain) results in increased stability of the delivered mRNA cargo. Arrows point to mRNA molecules in the cytoplasm. The right panel photo is taken using the same exposure time as in the left panel. The resulting bacterial strain after the RNase II I deletion we here name RBT2.

Gene-deletion in RBT1 bacteria to obtain the pure RBT2 bacteria

Scarless deletion of the rnc gene (b2567) in RBT1 was carried out by standard gene technological methods leading to a scarless deletion and loss of function of RNaselll. All modifications and subsequent steps were monitored by PCR amplification (quality control - QC1) and Sanger-capillary sequencing (QC2). Eukaryotic Cell lines:

HeLa (human cervix carcinoma cell line HPV18)

Plasmid constructs used as shown in Figure 8:

Plasmids maps used to express the shRNA molecules against PLK1 and EGFP. The shRNA cassettes are maintained episomally in plasmids and are driven by the Ptrc or the PN25 bacterial promoter. Terminators such as the rrnB T1 terminator or the lambda terminato r can be used in these constructs. The loop sequence separating the sense and antisense strand of the shRNA cassettes can be 5'-TTCAAGAGA-3' (SEQ ID NO:2). The plasmids are transformed into the RBT2 E. coli strain.

SEQ ID NO: 3 Ptrc promoter

AAACTGCAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAAT TGTCAACAGCTCATTTCA GAATATTTGCCAGATCTAGATGCATTCTTCCGAAGCCCA

SEQ ID NO: 4 PN25 promoter:

TCATAAAAAATTTATTTGCTTTCAGGAAAATTTTTCTGTATAATAGATTCATAAATT TGAGAGAGGAGTT

SEQ ID NO: 5 PLK1 mRNA sequence

GGAGGCTCTGCTCGGATCGAGGTCTGCAGCGCAGCTTCGGGAGCATGAGTGCTGCAG TGACTGCAGGGAAGC TGGCACGGGCACCGGCCGACCCTGGGAAAGCCGGGGTCCCCGGAGTTGCAGCTCCCGGAG CTCCGGCGGCG GCTCCACCGGCGAAAGAGATCCCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTAT GTGCGGGGCCGC TTTTTGGGCAAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAG GTGTTCGCGGGC AAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATGGAA ATATCCATTCACC GCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTCGAGGACAACGACTTCG TGTTCGTGGTGTTG GAGCTCTGCCGCCGGAGGTCTCTCCTGGAGCTGCACAAGAGGAGGAAAGCCCTGACTGAG CCTGAGGCCCGA TACTACCTACGGCAAATTGTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCAT CGAGACCTCAAGCT GGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAAC CAAAGTCGAATAT GACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTG AGCAAGAAAGG GCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGG CAAACCACCTTTTG AGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCA AGCACATCAACCCC GTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATT AACGAGCTGCTTAA TGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACCAT TCCACCAAGGTTTTCG ATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTCACAGTCCTCAATAAAGGC TTGGAGAACCCCC TGCCTGAGCGTCCCCGGGAAAAAGAAGAACCAGTGGTTCGAGAGACAGGTGAGGTGGTCG ACTGCCACCTCA GTGACATGCTGCAGCAGCTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGG TCAGGCAAGAGG AGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGG ACAAGTACGGCCT TGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACACGCCTCAT CCTCTACAATGATG GTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAGTCCTACCTCACCGTGAGTTCCC ATCCCAACTCCTTG ATGAAGAAGATCACCCTCCTTAAATATTTCCGCAATTACATGAGCGAGCACTTGCTGAAG GCAGGTGCCAACA TCACGCCGCGCGAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCA CCCGCAGCGCCAT CATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAGCT CATCTTGTGCCCAC TGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGCACATACCGCCTGAGTC TCCTGGAGGAGT ACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTCCGCTACGCCCGCACTATGGTGGACAAGC TGCTGAGCTCAC GCTCGGCCAGCAACCGTCTCAAGGCCTCCTAATAGCTGCCCTCCCCTCCGGACTGGTGCC CTCCTCACTCCCACC TGCATCTGGGGCCCATACTGGTTGGCTCCCGCGGTGCCATGTCTGCAGTGTGCCCCCCAG CCCCGGTGGCTGG GCAGAGCTGCATCATCCTTGCAGGTGGGGGTTGCTGTATAAGTTATTTTTGTACATGTTC GGGTGTGGGTTCTA CAGCCTTGTCCCCCTCCCCCTCAACCCCACCATATGAATTGTACAGAATATTTCTATTGA ATTCGGAACTGTCCTT TCCTTGGCTTTATGCACATTAAACAGATGTGAATATTC

Protocol for delivery of shRNA with E. coli

HeLa or HeLa-EGFP cells were seeded at a density of 1.2*10e5 cells/mL in DMEM medium supplemented with 10% FBS. The following day cells were inoculated with bacteria carrying the sh RNA constructs against Polo-Like Kinase 1 (PLK1) or EGFP, respectively, at an MOI of 60 for 2 hours. Scrambled sh RNA was used as a control. The cells were then treated with gentamycin at a concentration of 700 pg/mL till samples were taken for testing. Cells were tested on days 3, 4 and 5 for the efficiency of gene knock-down. In the case of PLKl-shRNA bacteria-mediated treatment, the cells were fixed with 4% paraformaldehyde in IM Hepes buffer containing DAPL Pictures were taken with a microscope in a lOx or 20x magnification and the ImageJ software was used to count the number of cell nuclei. In the case of EGFP-shRNA bacteria-mediated treatment, the EGFP signal intensity was measured with a plate reader (Tecan Infinite 200, Ex: 488 / Em: 507). Signal intensity was normalized against cell number after cells were fixed and stained with DAPI, and nuclei were counted as described above.

Results:

As can be seen in Figure 9, bacterially-mediated knock-down of PLK1 in HeLa cells has a cytotoxic effect in HeLa cells. An shRNA construct was generated against PLK1 and transformed into the RBT2 E. coli strain (invasive DAP auxotroph E. coli strain). In Figure 9A it was observed that scrambled shRNA sequences, which do not correspond to a eukaryotic RNA but are random and were used as a control, do not have an impact on cell viability. Nuclei counts stained with DAPI were done at day 4 post bacteria inoculation with the cells. Figure 9B shows a 40-50% reduction in the cell viability after PLK1 shRNA-mediated knock-down (marked by asterisks). The results of the bacterially-mediated knock-down of EGFP in HeLa-EGFP-expressing cells is shown in Figure 10. Two different shRNA constructs were generated against EGFP (shRNA-1 and shRNA-2) and transformed into the RBT2 E. coli strain (invasive DAP auxotroph E. coli strain). Scrambled shRNA sequences were used as a control. EGFP intensity measurements were taken at day 5 post bacteria inoculation with the cells. Mean EGFP intensity was calculated relative to the signal in cells treated with scramble shRNA, and was further normalized to cell nuclei numbers. A 20-30% reduction in the EGFP signal was observed after EGFP shRNA-mediated knock-down (marked by asterisks).