BASE EDITING ENZYMES CROSS-REFERENCE [0001] This application claims the benefit of U.S. Provisional Application Nos.: 63/276,461, filed on November 5, 2021; 63/289,998, filed on December 15, 2021; 63/342,824, filed on May 17, 2022; 63/356,888, filed on June 29, 2022; and 63/378,171, filed on October 3, 2022; each of which is entitled “BASE EDITING ENZYMES” and is incorporated herein by reference in its entirety. This application is related to PCT Patent Application No. PCT/US2021/049962, which is incorporated by reference herein in its entirety. BACKGROUND [0002] Cas enzymes along with their associated Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) guide ribonucleic acids (RNAs) appear to be a pervasive (~45% of bacteria, ~84% of archaea) component of prokaryotic immune systems, serving to protect such microorganisms against non-self nucleic acids, such as infectious viruses and plasmids by CRISPR-RNA guided nucleic acid cleavage. While the deoxyribonucleic acid (DNA) elements encoding CRISPR RNA elements may be relatively conserved in structure and length, their CRISPR-associated (Cas) proteins are highly diverse, containing a wide variety of nucleic acid- interacting domains. While CRISPR DNA elements have been observed as early as 1987, the programmable endonuclease cleavage ability of CRISPR complexes has only been recognized relatively recently, leading to the use of recombinant CRISPR systems in diverse DNA manipulation and gene editing applications. SEQUENCE LISTING [0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on November 4, 2022, is named 55921-742_601_SL.xml and is 2,274,288 KB in size. SUMMARY [0004] In some aspects, the present disclosure provides for a method of deaminating a cytosine residue in a eukaryotic nucleic acid sequence in a cell, comprising: contacting to said eukaryotic nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said eukaryotic nucleic acid sequence is a mammalian, primate, or human nucleic acid sequence. In some embodiments, said cell is a mammalian, primate, or human cell. In some embodiments, said eukaryotic nucleic acid sequence comprises single-stranded DNA (ssDNA) or ribonucleic acid (RNA). In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 970-982, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 808, 810-811, 819, 826, 752, 777, or 823, or a variant thereof. In some embodiments, said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA). In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 810-811. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase. In some embodiments, said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence. In some embodiments, said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof. [0005] In some aspects, the present disclosure provides for a method of deaminating a cytosine residue in a primate nucleic acid sequence in a cell, comprising: contacting to a primate nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 599-638, 660-675, 828-835, or a variant thereof. In some embodiments, said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA), single-stranded DNA (ssDNA) or ribonucleic acid (RNA). In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase. In some embodiments, said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence. In some embodiments, said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof. [0006] In some aspects, the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in a mammalian organism, wherein said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668- 671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof [0007] In some aspects, the present disclosure provides for a nucleic acid encoding any of the polypeptides described herein. [0008] In some aspects, the present disclosure provides for a vector comprising any of the nucleic acids described herein. [0009] In some aspects, the present disclosure provides for a fusion polypeptide comprising: (a) a domain with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof; and (b) a nucleic acid binding domain, an endonuclease domain, or a nickase domain. In some embodiments, said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof. In some embodiments, said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, or a variant thereof. In some embodiments, said fusion polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said fusion protein comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said fusion protein comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 877-916 or 968-969, or a variant thereof. [0010] In some aspects, the present disclosure provides for system comprising: (a) any of the fusion proteins (e.g. endonuclease-base editor or endonuclease-deaminase fusions); and (b) an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain. In some embodiments, said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, 1099-1105, or a variant thereof. [0011] In some aspects, the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof, wherein said polypeptide comprises a substitution at least one of residues T2, D7, E10, M13, W24, G32, K38, G45, G51, A63, E66, R75, C91, G93, H97, A107, E108, D109, P110, H124, A126, H129, F150, or S165, or any combination thereof relative to SEQ ID NO: 50 when optimally aligned. In some embodiments, said substitution comprises T2X ₁ , D7X ₁ , E10X ₁ , M13X ₄ , W24X ₁ , G32X ₁ , K38X ₂ , G45X ₂ , G51X ₅ , A63X ₇ , E66X ₅ , E66X ₂ , R75H, C91R, G93X ₆ , H97X ₆ , H97X ₅ , A107X ₅ , E108X ₂ , D109N, P110H, H124X ₆ , A126X ₂ , H129R, H129N, F150P, F150S, S165X5, or any combination thereof relative to SEQ ID NO: 50 or MG68-4 when optimally aligned, wherein X ₁ is A or G; X ₂ is D or E; X ₃ is N or Q; X ₄ is R or K; X ₅ is I, L, M, or V; X ₆ is F, Y, or W; and X ₇ is S or T. In some embodiments, said polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 836-860, or a variant thereof. In some embodiments, said polypeptide comprises any one of SEQ ID NOs: 839, 841, 843, 844, 847, 848, 849, 850, 851, 852, 859, or a variant thereof. In some embodiments, said substitution comprises W24G, G51V, E108D, P110H, F150P, D7G, E10G, or H129N, or any combination thereof, relative to SEQ ID NO: 50 or MG68-4 when optimally aligned. In some embodiments, said polypeptide further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain. In some embodiments, said polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. [0012] In some aspects, the present disclosure provides for a system comprising:(a) any of the polypeptides or fusion polypeptides described herein; and (b) an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain. In some embodiments, said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, 1099-1105, or a variant thereof; [0013] In some aspects, the present disclosure provides for a method of deaminating a cytosine residue in a cell, comprising introducing to said cell: (a) a vector encoding a polypeptide with cytosine deaminase activity; and (b) a vector encoding a FAM72A protein. In some embodiments, said vector encoding said FAM72A protein comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1115, or a variant thereof, or encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970- 982, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain. In some embodiments, said polypeptide with cytosine deaminase activity comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. [0014] In some aspects, the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising (i) a sequence with cytosine deaminase activity; and (ii) a sequence derived from a FAM72A protein. In some embodiments, said sequence with cytosine deaminase activity has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said sequence derived from said FAM72A protein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof. In some embodiments, the polypeptide further comprises an endonuclease sequence comprising a RuvC domain and an HNH domain, wherein said endonuclease sequence is a sequence of a class 2, type II endonuclease. In some embodiments, said RuvC domain lacks nuclease activity. In some embodiments, said endonuclease comprises a nickase. In some embodiments, said class 2, type II endonuclease sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. [0015] In some aspects, the present disclosure provides for a method of editing a cytosine residue to a thymine residue in a cell, comprising contacting to said cell any of the cytosine deaminase fusion polypeptides described herein. In some embodiments, said cell is a prokaryotic, eukaryotic, mammalian, primate, or human cell. [0016] In some aspects, the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising: a plurality of domains derived from a Class 2, Type II endonuclease, wherein said domains comprise RUVC-I, REC, HNH, RUVC-III, and WED domains; and a domain comprising a base editor sequence, wherein said base editor sequence is inserted:(a) within said RUVC-I domain; (b) within said REC domain; (c) within said HNH domain; (d) within said RUV-CIII domain; (e) within said WED domain; (f) prior to said HNH domain; (g) prior to said RUV-CIII domain; or (h) between said RUVC-III and said WED domain. In some embodiments, said Class 2, Type II endonuclease comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said Class 2, Type II endonuclease comprises a sequence having at least 80% sequence identity to SEQ ID NO: 1647, or a variant thereof. In some embodiments, said base editor sequence comprises a deaminase sequence. In some embodiments, said deaminase sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, 50, 51, 385-443, 448-475, or a variant thereof. In some embodiments, said deaminase sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said deaminase sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof. In some embodiments, said deaminase has at least 80% sequence identity to SEQ ID NO: 386, or a variant thereof. In some embodiments, said deaminase sequence comprises a substitution of one of residues T2, D7, E10, M13, W24, G32, K38, G45, G51, A63, E66, R75, C91, G93, H97, A107, E108, D109, P110, H124, A126, H129, F150, or S165, or any combination thereof relative to SEQ ID NO: 50 or MG68-4 when optimally aligned. In some embodiments, said engineered nucleic acid editing polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1128-1160, or a variant thereof. In some embodiments, said engineered nucleic acid editing polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1137, 1140, 1142, 1143, 1146, 1149, 1151-1158, or a variant thereof. In some embodiments, said engineered nucleic acid editing polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1139,1152,1158, or a variant thereof. [0017] In some aspects, the present disclosure provides for polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof, wherein said polypeptide comprises a substitution of a wild-type residue for a non-wild-type residue at residue 109 and one other residue comprising any one of 24, 37, 49, 52, 83, 85, 107, 110, 112, 120, 123, 124, 147, 148, 150, 156, 157, 158, 166, 167, or 129, or any combination thereof relative to SEQ ID NO: 386 when optimally aligned. In some embodiments, said sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 386. In some embodiments, the polypeptide comprises a substitution of 109N and at least one other substitution comprising any one of 24R, 37L, 49A, 52L, 83S, 85F, 107V, 110S, 112R, 120N, 123N, 124Y, 147C, 148Y, 148R, 150Y, 156V, 157F, 158N, 166I, or 129N, or any combination thereof relative to SEQ ID NO: 386 when optimally aligned. In some embodiments, the peptide comprises any of the substitutions depicted in FIG.34B. In some embodiments, said polypeptide has at least 80% sequence identity to any one of SEQ ID NOs: 1161-1183, or a variant thereof. In some embodiments, said polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1170, 1179, or 1166, or a variant thereof. In some embodiments, said polypeptide further comprises an endonuclease or a nickase. In some embodiments, said polypeptide comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof [0018] In some aspects, the present disclosure provides for a polypeptide with cytosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444- 447, 599-675, 744-835, 970-982, or a variant thereof; wherein said polypeptide comprises at least one of the alterations described in Table 12C. In some embodiments, said polypeptide has at least one substitution of a wild-type amino acid for a non-wild-type amino acid comprising any one of W90A, W90F, W90H, W90Y, Y120F, Y120H, Y121F, Y121H, Y121Q, Y121A, Y121D, Y121W, H122Y, H122F, H122I, H122A, H122W, H122D, Y121T, R33A, R34A, R34K, H122A, R33A, R34A, R52A, N57G, H122A, E123A, E123Q, W127F, W127H, W127Q, W127A, W127D, R39A, K40A, H128A, N63G, R58A, H121F, H121Y, H121Q, H121A, H121D, H121W, R33A, K34A, H122A, H121A, R52A, P26R, P26A, N27R, N27A, W44A, W45A, K49G, S50G, R51G, R121A, I122A, N123A, Y88F, Y120F, P22R, P22A, K23A, K41R, K41A, E54A, E54A, E55A, K30A, K30R, M32A, M32K, Y117A, K118A, I119A, I119H, R120A, R121A, P46A, P46R, N29A, R27A, or N50G, or any combination thereof, optionally relative to an APOBEC polypeptide. In some embodiments, the polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1208-1315, or a variant thereof [0019] In some aspects, the present disclosure provides for a polypeptide with cytosine deaminase activity comprising: a cytosine deaminase sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 835, 1275, 668, 774, 818, 671, 667, 650, 827, 819, 823, 814, 813, 817, 628, 826, 1223, 834, 618, 621, 669, 833, 830, or a variant thereof; and an endonuclease or a nickase. In some embodiments, said endonuclease or said nickase comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said cytosine deaminase sequence has at least 80% sequence identity to any one of SEQ ID NOs: 1275, 835, or 774, or a combination thereof. [0020] In some aspects, the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, 1015-1098, or a variant thereof, wherein said polypeptide comprises any of the combinations of substitutions of a wild-type residue for a non-wild-type residue recited in Table 12D. In some embodiments, said polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1556- 1638, or a variant thereof. In some embodiments, said polypeptide further comprises an endonuclease or a nickase. In some embodiments, said polypeptide comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof [0021] In some aspects, the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, 1015-1098, or a variant thereof, wherein said polypeptide comprises any of the combinations of substitutions of a wild-type residue for a non-wild-type residue recited in Table 13. In some embodiments, said sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 386, or a variant thereof. In some embodiments, said polypeptide further comprises an endonuclease or a nickase. In some embodiments, said polypeptide comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, 1647, or a variant thereof. In some embodiments, said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. [0022] In some aspects, the present disclosure provides for a method of editing an APOA1 locus in a cell, comprising contacting to said cell (a) an RNA-guided endonuclease; and (b) an engineered guide nucleic acid structure, wherein said engineered guide nucleic acid structure is configured to form a complex with said endonuclease and said engineered guide nucleic acid structure comprises a spacer sequence configured to hybridize to a region of said APOA1 locus, wherein said engineered guide nucleic acid structure comprises a targeting sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides of any one of SEQ ID NOs: 1455-1478 or a reverse complement thereof. In some embodiments, said engineered guide nucleic acid structure has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1431-1454. In some embodiments, said engineered guide nucleic acid structure comprises any of the nucleotide modifications recited in Table 13A. In some embodiments, said RNA-guided endonuclease is a class 2, type II endonuclease. In some embodiments, said RNA-guided endonuclease has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. [0023] In some aspects, the present disclosure provides for a method of editing an ANGPTL3 locus in a cell, comprising contacting to said cell (a) an RNA-guided endonuclease; and (b) an engineered guide nucleic acid structure, wherein said engineered guide nucleic acid structure is configured to form a complex with said endonuclease and said engineered guide nucleic acid structure comprises a spacer sequence configured to hybridize to a region of said ANGPTL3 locus, wherein said engineered guide nucleic acid structure comprises a targeting sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides of any one of SEQ ID NOs: 1484-1488 or a reverse complement thereof. In some embodiments, said engineered guide nucleic acid structure has at least 80% identity to any one of SEQ ID NOs: 1479-1483. In some embodiments, said engineered guide nucleic acid structure comprises any of the nucleotide modifications recited in Table 13A. In some embodiments, said RNA-guided endonuclease is a class 2, type II endonuclease. In some embodiments, said RNA-guided endonuclease has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. [0024] In some aspects, the present disclosure provides for a method of editing a TRAC locus in a cell, comprising contacting to said cell (a) an RNA-guided endonuclease; and (b) an engineered guide nucleic acid structure, wherein said engineered guide nucleic acid structure is configured to form a complex with said endonuclease and said engineered guide nucleic acid structure comprises a spacer sequence configured to hybridize to a region of said TRAC locus, wherein said engineered guide nucleic acid structure comprises a targeting sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides of any one of SEQ ID NOs: 1491- 1492 or a reverse complement thereof. In some embodiments, said engineered guide nucleic acid structure has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1489-1490. In some embodiments, aid engineered guide nucleic acid structure comprises any of the nucleotide modifications recited in Table 13A. In some embodiments, said RNA-guided endonuclease is a class 2, type II endonuclease. In some embodiments, said RNA-guided endonuclease has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof. [0025] In some aspects, the present disclosure provides for an engineered adenosine base editor polypeptide, wherein said polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1647-1653. [0026] In some aspects, the present disclosure provides for a method of deaminating a cytosine residue in a eukaryotic nucleic acid sequence in a cell, comprising: contacting to said eukaryotic nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said eukaryotic nucleic acid sequence is a mammalian, primate, or human nucleic acid sequence. In some embodiments, said cell is a mammalian, primate, or human cell. In some embodiments, said eukaryotic nucleic acid sequence comprises single-stranded DNA (ssDNA) or ribonucleic acid (RNA). In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 970-982, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 808, 810-811, 819, 826, 752, 777, or 823, or a variant thereof. In some embodiments, said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA). In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 810-811. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase. In some embodiments, said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, or 1122-1127, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence. In some embodiments, said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof. [0027] In some aspects, the present disclosure provides for a method of deaminating a cytosine residue in a primate nucleic acid sequence in a cell, comprising: contacting to said primate nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 599-638, 660-675, or 828-835, or a variant thereof. In some embodiments, said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA), single-stranded DNA (ssDNA) or ribonucleic acid (RNA). In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase. In some embodiments, said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, or 1122-1127, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence. In some embodiments, said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof. [0028] In some aspects, the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in a mammalian organism, wherein said nucleic acid encodes a sequence having at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identityto any one of SEQ ID NOs: 1- 49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof. [0029] In some aspects, the present disclosure provides for a vector comprising any of the nucleic acids described herein. In some embodiments, the vector is a non-viral or a viral vector. In some embodiments the vector is a plasmid, minicircle, or plasmid vector. In some embodiments, the viral vector is an AAV vector. [0030] In some aspects, the present disclosure provides for a fusion polypeptide comprising: (a) a domain with cytosine deaminase activity comprising a sequence having at least 80% identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof; and (b) a nucleic acid binding domain, an endonuclease domain, or a nickase domain. In some embodiments, said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof. In some embodiments, said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, or a variant thereof. In some embodiments, said fusion polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, or a variant thereof. In some embodiments, said fusion protein comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. In some embodiments, said fusion protein comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 877-916 or 968-969, or a variant thereof. [0031] In some aspects, the present disclosure provides for a system comprising: (a) any of the the fusion polypeptides described herein; and (b) an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain. In some embodiments, said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, or 1099-1105, or a variant thereof. [0032] In some aspects, the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof, wherein said polypeptide comprises a substitution at least one of residues T2, D7, E10, M13, W24, G32, K38, G45, G51, A63, E66, R75, C91, G93, H97, A107, E108, D109, P110, H124, A126, H129, F150, or S165, or any combination thereof relative to SEQ ID NO: 50 when optimally aligned. In some embodiments, said substitution comprises T2X ₁ , D7X ₁ , E10X ₁ , M13X ₄ , W24X ₁ , G32X ₁ , K38X ₂ , G45X ₂ , G51X ₅ , A63X ₇ , E66X ₅ , E66X ₂ , R75H, C91R, G93X6, H97X6, H97X5, A107X5, E108X2, D109N, P110H, H124X6, A126X2, H129R, H129N, F150P, F150S, S165X5, or any combination thereof relative to SEQ ID NO: 50 when optimally aligned, wherein X ₁ is A or G; X ₂ is D or E; X ₃ is N or Q; X ₄ is R or K; X ₅ is I, L, M, or V; X6 is F, Y, or W; and X7 is S or T. In some embodiments, said polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity any one of SEQ ID NOs.836-860, or a variant thereof. In some embodiments, said polypeptide comprises any one of SEQ ID NOs: 839, 841, 843, 844, 847, 848, 849, 850, 851, 852, or 859. In some embodiments, said substitution comprises W24G, G51V, E108D, P110H, F150P, D7G, E10G, or H129N, or any combination thereof, relative to SEQ ID NO: 50 when optimally aligned. In some embodiments, said polypeptide further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain. In some embodiments, said polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, or a variant thereof. In some embodiments, said polypeptide comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. [0033] In some aspects, the present disclosure provides for a system comprising: (a) any of the polypeptides for base editor fusions described herein (e.g. endonuclease deaminase fusions); and (b) an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain. In some embodiments, said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, or 1099-1105. [0034] In some aspects, the present disclosure provides for a method of deaminating a cytosine residue in a cell, comprising introducing to said cell: (a) a vector encoding a polypeptide with cytosine deaminase activity; and (b) a vector encoding a FAM72A protein. In some embodiments, said vector encoding said FAM72A protein comprises a sequence having at least 80% identity to SEQ ID NO: 1115, or encodes a sequence having at least 80% identity to SEQ ID NO: 1121. In some embodiments, said polypeptide with cytosine deaminase activity comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain. In some embodiments, said polypeptide with cytosine deaminase activity comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, or a variant thereof. In some embodiments, said polypeptide with cytosine deaminase activity comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof. [0035] In some aspects, the present disclosure provides for an engineered nucleic acid editing system, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, wherein said endonuclease is configured to be deficient in nuclease activity; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease. In some embodiments, said RuvC domain lacks nuclease activity. In some embodiments, said class 2, type II endonuclease comprises a nickase mutation. In some embodiments, said class 2, type II endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. In some embodiments, said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned. In some embodiments, said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease. In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, or a variant thereof, wherein said endonuclease is a class 2, type II endonuclease, and wherein said endonuclease is configured to be deficient in nuclease activity; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease. In some embodiments, said endonuclease comprises a nickase mutation. In some embodiments, said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. In some embodiments, said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. In some embodiments, said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390. In some embodiments, said RuvC domain lacks nuclease activity. In some embodiments, said endonuclease is derived from an uncultivated microorganism. In some embodiments, said endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, said endonuclease further comprises an HNH domain. In some embodiments, said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof. In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising, an engineered guide ribonucleic acid structure comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to an endonuclease, wherein said engineered ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof; a class 2, type II endonuclease configured to bind to said engineered guide ribonucleic acid; and a base editor coupled to said endonuclease. In some embodiments, said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390. In some embodiments, said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598. In some embodiments, said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. In some embodiments, said base editor is an adenine deaminase. In some embodiments, said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof. In some embodiments, said base editor is a cytosine deaminase. In some embodiments, said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58- 66, or a variant thereof. In some embodiments, the system further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67. In some embodiments, said engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides. In some embodiments, said engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising said guide ribonucleic acid sequence and said tracr ribonucleic acid sequence. In some embodiments, said guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, said guide ribonucleic acid sequence is 15-24 nucleotides in length. In some embodiments, said endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. In some embodiments, said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof. In some embodiments, said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker. In some embodiments, said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73 or 78, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, residue 8 relative to SEQ ID NO: 77, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. In some embodiments, said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned. In some embodiments, a polypeptide comprises said endonuclease and said base editor. In some embodiments, said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, said system further comprises a source of Mg ²⁺ . In some embodiments: (a) said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, 73, 74, 76, 78, 77, or 78, or a variant thereof; (b) said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non-degenerate nucleotides of any one of SEQ ID NOs: 88, 89, 91, 92, 94, 96, 95, or 488; (c) said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 361, 363, 365, 367, or 368; or (d) said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NOs: 58 or 595, or a variant thereof. In some embodiments: (a) said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, or 78, or a variant thereof; (b) said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non- degenerate nucleotides of at least one of SEQ ID NOs: 88, 89, or 96; (c) said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 362, or 368; or (d) said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 594, or a variant thereof. In some embodiments, said sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm. In some embodiments, said sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment. In some embodiments, said endonuclease is configured to be catalytically dead. In some embodiments, said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. [0036] In some aspects, the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein said endonuclease is derived from an uncultivated microorganism. [0037] In some aspects, the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes an endonuclease having at least 70% sequence identity to any one of SEQ ID NOs: 70-78 coupled to a base editor. In some embodiments, said endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. In some embodiments, said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof. In some embodiments, said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human. [0038] In some aspects, the present disclosure provides for a vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism. [0039] In some aspects, the present disclosure provides for a vector comprising the nucleic acid of any of the aspects or embodiments described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to binding to said endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus. [0040] In some aspects, the present disclosure provides for a cell comprising the vector of any of the aspects or embodiments described herein. [0041] In some aspects, the present disclosure provides for a method of manufacturing an endonuclease, comprising cultivating the cell of any of the aspects or embodiments described herein. [0042] In some aspects, the present disclosure provides for a method for modifying a double- stranded deoxyribonucleic acid polynucleotide comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM). In some embodiments, said endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker. In some embodiments, said endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. [0043] In some aspects, the present disclosure provides for a method for modifying a double- stranded deoxyribonucleic acid polynucleotide, comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to said endonuclease, and an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein said PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 70-78 or 597. In some embodiments, said class 2, type II endonuclease is covalently coupled to said base editor or coupled to said base editor through a linker. In some embodiments, said base editor comprises a sequence with at least 70%, at least 80%, at least 90% or at least 95% identity to a sequence selected from SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. In some embodiments, said base editor comprises an adenine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said adenine to guanine. In some embodiments, said adenine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof. In some embodiments, said base editor comprises a cytosine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said cytosine to uracil. In some embodiments, said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof. In some embodiments, said complex further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, said double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of said engineered guide ribonucleic acid structure and a second strand comprising said PAM. In some embodiments, said PAM is directly adjacent to the 3' end of said sequence complementary to said sequence of said engineered guide ribonucleic acid structure. In some embodiments, said class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease. In some embodiments, said class 2, type II endonuclease is derived from an uncultivated microorganism. In some embodiments, said double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. [0044] In some aspects, the present disclosure provides for a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus said engineered nucleic acid editing system of any of the aspects or embodiments described herein, wherein said endonuclease is configured to form a complex with said engineered guide ribonucleic acid structure, and wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus. In some embodiments, said engineered nucleic acid editing system comprises an adenine deaminase, said nucleotide is an adenine, and modifying said target nucleic acid locus comprises converting said adenine to a guanine. In some embodiments, said engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, said nucleotide is a cytosine and modifying said target nucleic acid locus comprises converting said adenine to a uracil. In some embodiments, said target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA. In some embodiments, said target nucleic acid locus is in vitro. In some embodiments, said target nucleic acid locus is within a cell. In some embodiments, said cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, said cell is within an animal. In some embodiments, said cell is within a cochlea. In some embodiments, said cell is within an embryo. In some embodiments, said embryo is a two-cell embryo. In some embodiments, said embryo is a mouse embryo. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering the nucleic acid of any of the aspects or embodiments described herein or the vector of any of the aspects or embodiments described herein. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding said endonuclease. In some embodiments, said nucleic acid comprises a promoter to which said open reading frame encoding said endonuclease is operably linked. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA containing said open reading frame encoding said endonuclease. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding said engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter. [0045] In some aspects, the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to said endonuclease. In some embodiments, said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. [0046] In some aspects, the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to said endonuclease. In some aspects, the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein said endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity.; and a base editor coupled to said endonuclease. In some embodiments, said endonuclease is derived from an uncultivated microorganism. In some embodiments, said endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, said endonuclease further comprises an HNH domain. In some embodiments, said tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680. In some embodiments, said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. In some embodiments, said base editor is an adenine deaminase. In some embodiments, said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50- 51, 57, 385-443, 448-475, or 595, or a variant thereof. In some embodiments, said base editor is a cytosine deaminase. In some embodiments, said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof. [0047] In some aspects, the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising: an endonuclease, wherein said endonuclease is configured to be deficient in endonuclease activity; and a base editor coupled to said endonuclease, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447,488-475, or 595, or a variant thereof. In some embodiments, said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, said endonuclease is configured to be catalytically dead. In some embodiments, said endonuclease is a Class II, type II endonuclease or a Class II, type V endonuclease. In some embodiments, said endonuclease comprises a sequence having at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. In some embodiments, said endonuclease comprises a nickase mutation. In some embodiments, said endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. In some embodiments, said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598. In some embodiments, said base editor is an adenine deaminase. In some embodiments, said adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 50-51, 385-443, or 448-475, or a variant thereof. In some embodiments, said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 385-390, or 595, or a variant thereof. In some embodiments, said base editor is a cytosine deaminase. In some embodiments, said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, or a variant thereof. In some embodiments, the polypeptide further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor. In some embodiments, said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, said endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. In some embodiments, said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof. In some embodiments, said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker. [0048] In some aspects, the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a sequence having at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447, or 488-475, or a variant thereof. In some embodiments, said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human. [0049] In some aspects, the present disclosure provides for a vector comprising the nucleic acid of any of the aspects or embodiments described herein. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus. [0050] In some aspects, the present disclosure provides for a cell comprising the vector of any one of the aspects or embodiments described herein. [0051] In some aspects, the present disclosure provides for a method of manufacturing a base editor, comprising cultivating said cell of any one of the aspects or embodiments described herein. [0052] In some aspects, the present disclosure provides for a system comprising: (a) the nucleic acid editing polypeptide of any of the aspects or embodiments described herein; and (b) an engineered guide ribonucleic acid structure configured to form a complex with said nucleic acid editing polypeptide comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease. In some embodiments, said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680. [0053] In some aspects, the present disclosure provides for a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus said engineered nucleic acid editing polypeptide of any of the aspects or embodiments described herein or said system of any of the aspects or embodiments described herein, wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus. [0054] In some aspects, the present disclosure provides for an engineered nucleic acid editing system, comprising: (a) an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease. In some embodiments, the endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs: 70-78. [0055] In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising: (a) an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs: 70-78, wherein the endonuclease comprises a RuvC domain lacking nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease. [0056] In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 360-368, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease comprises a RuvC domain lacking nuclease activity; and (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease. [0057] In some embodiments, the endonuclease is derived from an uncultivated microorganism. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680. [0058] In some aspects, the present disclosure provides an engineered nucleic acid editing system comprising, (a) an engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to an endonuclease, wherein the tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680; and a class 2, type II endonuclease configured to bind to the engineered guide ribonucleic acid. [0059] In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368. In some embodiments, the base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51 and 385-475. In some embodiments, the base editor is an adenine deaminase. In some embodiments, the adenosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57. In some embodiments, the base editor is a cytosine deaminase. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66. [0060] In some embodiments, the engineered nucleic acid editing system further comprises a uracil DNA glycosylase inhibitor. In some embodiments, the uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67. [0061] In some embodiments, the engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides. In some embodiments, the engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising the guide ribonucleic acid sequence and the tracr ribonucleic acid sequence. In some embodiments, the guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. In some embodiments, the endonuclease is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker. In some embodiments, a polypeptide comprises the endonuclease and the base editor. In some embodiments, the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, the endonuclease comprises SEQ ID NO: 370. In some embodiments, the system further comprises a source of Mg ^2+. [0062] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 70; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 88; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 360. [0063] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 71; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 89; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 361. [0064] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 73; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 91; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 363. [0065] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 75; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 93; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 365. [0066] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 76; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 94; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 366. [0067] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 77; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 95; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 367. [0068] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 78; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 96; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 368. [0069] In some embodiments, the base editor comprises an adenine deaminase. In some embodiments, the adenine deaminase comprises SEQ ID NO: 57. In some embodiments, the base editor comprises a cytosine deaminase. In some embodiments, the cytosine deaminase comprises SEQ ID NO: 58. In some embodiments, the engineered nucleic acid editing system described herein further comprises a uracil DNA glycosylation inhibitor. In some embodiments, the uracil DNA glycosylation inhibitor comprises SEQ ID NO: 67. [0070] In some embodiments, the sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm. In some embodiments, the sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment. [0071] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein the endonuclease is derived from an uncultivated microorganism. [0072] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes an endonuclease having at least 70% sequence identity to any one of SEQ ID NOs: 70-78 coupled to a base editor. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. In some embodiments, the organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human. [0073] In some aspects, the present disclosure provides a vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism. In some embodiments, the vector comprises the nucleic acid described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a tracr ribonucleic acid sequence configured to binding to the endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus. In some aspects, the present disclosure provides a cell comprising the vector described herein. In some aspects, the present disclosure provides a method of manufacturing an endonuclease, comprising cultivating the cell described herein. [0074] In some aspects, the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM). [0075] In some embodiments, the endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker. In some embodiments, the endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs: 70-78. [0076] In some aspects, the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide, comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to the endonuclease, and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 360-368. [0077] In some embodiments, the class 2, type II endonuclease is covalently coupled to the base editor or coupled to the base editor through a linker. In some embodiments, the base editor comprises a sequence with at least 70%, at least 80%, at least 90% or at least 95% identity to a sequence selected from SEQ ID NOs: 1-51 and 385-475. In some embodiments, the base editor comprises an adenine deaminase; the double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying the double-stranded deoxyribonucleic acid polypeptide comprises converting the adenine to guanine. In some embodiments, the adenine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57. [0078] In some embodiments, the base editor comprises a cytosine deaminase; the double- stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying the double- stranded deoxyribonucleic acid polypeptide comprises converting the cytosine to uracil. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66. [0079] In some embodiments, the complex further comprises a uracil DNA glycosylase inhibitor. In some embodiments, the uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide ribonucleic acid structure and a second strand comprising said PAM. In some embodiments, the PAM is directly adjacent to the 3' end of the sequence complementary to the sequence of the engineered guide ribonucleic acid structure. [0080] In some embodiments, the class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease. In some embodiments, the class 2, type II endonuclease is derived from an uncultivated microorganism. In some embodiments, the double- stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. [0081] In some aspects, the present disclosure provides a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus the engineered nucleic acid editing system described herein, wherein the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure, and wherein the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies a nucleotide of the target nucleic locus. [0082] In some embodiments, the engineered nucleic acid editing system comprises an adenine deaminase, the nucleotide is an adenine, and modifying the target nucleic acid locus comprises converting the adenine to a guanine. In some embodiments, the engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, the nucleotide is a cytosine and modifying the target nucleic acid locus comprises converting the adenine to a uracil. In some embodiments, the target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is within a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, the cell is within an animal. [0083] In some embodiments, the cell is within a cochlea. In some embodiments, the cell is within an embryo. In some embodiments, the embryo is a two-cell embryo. In some embodiments, the embryo is a mouse embryo. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering the nucleic acid described herein or the vector described herein. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. [0084] In some embodiments, the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked. In some embodiments, delivering the engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter. [0085] In some aspects, the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; and a base editor coupled to the endonuclease. In some embodiments, the endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs: 70-78. [0086] In some aspects, the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs: 70-78, wherein the endonuclease comprises a RuvC domain lacking nuclease activity; and a base editor coupled to the endonuclease. [0087] In some aspects, the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 360-368, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease comprises a RuvC domain lacks nuclease activity; and a base editor coupled to the endonuclease. [0088] In some embodiments, the endonuclease is derived from an uncultivated microorganism. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680. In some embodiments, the base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51 and 385-475. In some embodiments, the base editor is an adenine deaminase. In some embodiments, the adenosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57. In some embodiments, the base editor is a cytosine deaminase. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58. In some embodiments, the adenosine cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66. [0089] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive. INCORPORATION BY REFERENCE [0090] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS [0091] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also “Figure” and “FIG.” herein), of which: [0092] FIG.1 depicts example organizations of CRISPR loci of different classes and types. [0093] FIG.2 shows the structure of a base editor plasmid containing a T7 promoter driving expression of the systems described herein. [0094] FIG.3 shows plasmid maps for systems described herein. MGA contains TadA*(from ABE8.17m)-SV40 NLS and MGC contains APOBEC1 (from BE3) linked to a uracil glycosylase inhibitor and an SV40 NLS. [0095] FIG.4 shows predicted catalytic residues in the RuvCI domains of selected endonucleases described herein which are mutated to disrupt nuclease activity to generate nickase enzymes. [0096] FIG.5 depicts an example method for cloning a single guide RNA expression cassette into the systems described herein. One fragment comprises a T7 promoter plus spacer. The other fragment comprises spacer plus single guide scaffold sequence plus bidirectional terminator. The fragments are assembled into expression plasmids, resulting in functional constructs that can simultaneously express sgRNAs and base editors. [0097] FIGS.6A and 6B show sgRNA designs for lacZ targeting in E. coli. The spacer length used for the systems described herein was 22 nucleotides. For selected systems described herein, three sgRNAs targeting lacZ in E. coli were designed to determine editing windows. [0098] FIG.7 shows the nickase activity of selected mutated effectors.600bp double-stranded DNA fragments labeled with a fluorophore (6-FAM) on both 5’ ends were incubated with purified enzymes supplemented with their cognate sgRNAs. The reaction products were resolved on a 10% TBE-Urea denaturing gel. Double-stranded cleavage yields bands of 400 and 200 bases. Nickase activity yields bands of 600 and 200 bases. [0099] FIGS.8A, 8B, and 8C shows Sanger sequencing results demonstrating base edits by selected systems described herein. [00100] FIG.9 shows how the systems described herein expand base-editing capabilities with the endonucleases and base editors described herein. [00101] FIGs.10A and 10B show base editing efficiencies of adenine base editors (ABEs) comprising TadA (ABE8.17m) and MG nickases. TadA is a tRNA adenine deaminase, and TadA (ABE8.17m) is an engineered variant of E. coli TadA.12 MG nickases fused with TadA (ABE8.17m) were constructed and tested in E. coli. Three guides were designed to target lacZ. Numbers shown in boxes indicate percentages of A to G conversion quantified by Edit R. ABE8.17m was used as the positive control for the experiment. [00102] FIGs.11A and 11B show base editing efficiencies of cytosine base editors (CBEs) comprising rat APOBEC1, MG nickases, and the uracil glycosylase inhibitor of Bacillus subtilis bacteriophage (UGI (PBS1)). APOBEC1 is a cytosine deaminase.12 MG nickases fused to rAPOBEC1 on their N-terminus and UGI on their C-terminus were constructed and tested in E. coli. Three guides were designed to target lacZ. The numbers shown in boxes indicate percentages of C to T conversion quantified by Edit R. BE3 was used as the positive control in the experiment. [00103] FIG.12A and 12B show effects of MG uracil glycosylase inhibitors (UGIs) on the base-editing activities of CBEs. FIG.12A depicts a graph showing base-editing activity of MGC15-1 and variants, which comprise an N-terminal APOBEC1, the MG15-1 nickase, and a C-terminal UGI. Three MG UGIs were tested for improvements of cytosine base editing activities in E. coli. Panel FIG.12B is a graph showing base editing activity of BE3, which comprises an N-terminal rAPOBEC1, the SpCas9 nickase, and a C-terminal UGI. Two MG UGIs were tested for improvements of cytosine base editing activities in HEK293T cells. Editing efficiencies were quantified by Edit R. [00104] FIGS.13A and 13B depicts maps of edited sites showing editing efficiencies of cytosine base editors comprising A0A2K5RDN7, an MG nickases, and an MG UGI. The constructs comprise an N-terminal A0A2K5RDN7, an MG nickases, and a C-terminal MG69-1. For simplicity, the identities of MG nickases are shown in the figure. BE3 was used as the positive control for base editing. An empty vector was used for the negative control. Three independent experiments were performed on different days. Abbreviations: R, repeat; NEG, negative control. [00105] FIGs.14A and 14B shows a positive selection method for TadA characterization in E. coli. FIG.14A shows a map of one plasmid system used for TadA selection. The vector comprises CAT (H193Y), a sgRNA expression cassette targeting CAT, and an ABE expression cassette. In this figure, N-terminal TadA from E. coli and a C-terminal SpCas9 (D10A) from Streptococcus pyogenes are shown. FIG.14B shows sequencing traces demonstrating that when introduced/transformed into E. coli cells, the A2 position of CAT (H193Y)’s template strand is edited, reverting the H193Y mutant to wild type and restoring its activity. Abbreviations: CAT, chloramphenicol acetyltransferase. [00106] FIGs.15A and 15B shows mutations caused by TadA enable high tolerance of chloramphenicol (Cm). FIG.15A shows photographs of growth plates where different concentrations of chloramphenicol were used to select for antibiotics resistance of E. coli. In this example, wild type and two variants of TadA from E. coli (EcTadA) were tested. FIG.15B shows a results summary table demonstrating that ABEs carrying mutated TadA show higher editing efficiencies than the wild type. In these experiments, colonies were picked from the plates the table. [00107] FIG.16A shows photographs of growth plates to investigate MG TadA activity in chloramphenicol (ABEs comprised N-terminal TadA variants and C-terminal SpCas9 (D10A) nickase). For simplicity, identities of deaminases are shown. In this experiment, colonies were [00108] FIG.16B summarizes the editing efficiencies of MG TadA candidates and demonstrates that MG68-3, and MG68-4 drove base edits of adenine. [00109] FIGs.17A and 17B showsan improvement of base editing efficiency of MG68- 4_nSpCas9 via D109N mutation on MG68-4. FIG.17A shows photographs of growth plates For simplicity, identities of deaminases are shown. Adenine base editors in this experiment are comprise N-terminal TadA variants and C-terminal SpCas9 (D10A) nickase. Panel (b) shows a summary table depicting editing efficiencies of MG TadA candidates. FIG.17B demonstrates thatMG68-4 and MG68-4 (D109N) showed base edits of adenine, with the D109N mutant showing increased activity. In this experiment, colonies were picked from the plates with greater [00110] FIGs.18A and 18B show base editing of MG68-4 (D109N) _nMG34-1. FIG.18A shows photographs of growth plates of an experiment where an ABE comprising N-terminal chloramphenicol. FIG.18B shows a summary table depicting editing efficiencies with and without sgRNA. In this experiment, colonies were picked from the plates with greater than or [00111] FIG.19 shows 28 MG68-4 variants designed for improvements of MG68-4-nMG34-1 base editing activity (SEQ ID NOs: 448-475) .12 residues were selected for targeted mutagenesis to improve editing of the enzymes. [00112] FIG.20 shows the results of a gel-based deaminase assay showing activity of deaminases from several selected Families (MG93, MG138, and MG139). Enzymes were expressed in a bacterial (E. coli codon optimized) Purexpress cell lysate-derived in vitro transcription-translation system and incubated with 5’FAM-labeled ssDNA and USER enzyme (uracil DNA glycosylase and endonuclease VIII) at 37 °C for 2.5 h. The resulting DNA was resolved on a denaturing polyacrylamide gel and imaged. The positive control is a sequence with a U synthetically incorporated at the same position as the target C and the negative control is a sequence with no U or C. [00113] FIG.21 shows a diagram illustrating base editing efficiencies of adenine base editors at specific nucleotide sites using MG68-4v1 fusing with either nMG34-1 or nSpCas9.9 guides were designed to target genomic loci of HEK293T cells. Abbreviations: MG68-4v1, MG68-4 (D109N); nMG34-1, MG34-1 nickase; nSpCas9, SpCas9 nickase. [00114] FIGs.22A, 22B, 22C, 22D, 22E, and 22F show in vivo base editing with engineered MG34-1 and MG35-1 nickases. Panels (A) and (B) show base editing in the E. coli genome at four target loci. FIG.22A shows ABE-MG34-1 base editor vs. a reference ABE-SpCas9 (both with TadA*(8.8m) deaminase). FIG.22B shows CBE-MG34-1 base editor vs. a reference CBE- SpCas9 (both with rAPOBEC1 deaminase and PBS1 UGI). FIG.22C shows base editing in human HEK293T cells with an ABE-MG34-1 nickase at three target loci. The target sequence for each locus in panels A, B, and C is shown above each heatmap. Expected edit positions are represented on the sequence by a subscript number and at each position on the heatmap (squares). Heatmaps in FIGs.22 A, B, and C represent the percentage of NGS reads supporting an edit. Values in FIGs.22 (A) and (B) represent the mean of two independent experiments, while values in panel (C) represent the mean of three independent biological replicates. FIG.22D shows an E. coli survival assay. E. coli is transformed with a plasmid containing the ABE, a non-functional chloramphenicol acetyltransferase (CAT H193Y) gene, and an sgRNA that either targets the CAT gene (target spacer) or not (non-target spacer). E. coli survival under chloramphenicol selection is dependent on the ABE base editing the non-functional CAT gene to its wild type sequence. FIG.22E, top panel shows a diagram of an ABE construct with an engineered MG35- 1 nickase containing a C-terminal TadA*-(7.10) monomer and a SV40 NLS fused to the C- terminus. FIG.22E, bottom panel: transformed E. coli was grown on plates containing Carbecillin and 0.1 mM IPTG. Colonies grown on plates containing chloramphenicol Experiments were performed in duplicate. [00115] FIGs.23A and 23B depict a gel-based deaminase assay showing activity of deaminases from one selected Family (MG139). Enzymes were expressed in a bacterial (E. coli codon optimized) Purexpress cell lysate-derived in vitro transcription-translation system and incubated with 5’FAM-labeled ssDNA and USER enzyme (uracil DNA glycosylase and endonuclease VIII) at 37 °C for 2.5 h. The resulting DNA was resolved on a denaturing polyacrylamide gel and imaged, which is shown in FIG.23A. The positive control is a sequence with a U synthetically incorporated at the same position as the target C and the negative control is a sequence with no U or C. FIG.23B depicts Percentage of deamination activity of all the active cytidine deaminases on ssDNA. The taxonomic classification of the cytidine deaminases are shown. [00116] FIG.24 depicts a gel-based deaminase assay showing ssDNA and dsDNA activities of deaminases from several selected Families (MG93, MG138 and MG139). Enzymes were expressed in a bacterial (E. coli codon optimized) Purexpress cell lysate-derived in vitro transcription-translation system and incubated with 5’FAM-labeled ssDNA or dsDNA and USER enzyme (uracil DNA glycosylase and endonuclease VIII) at 37 °C for 2.5 h. The resulting DNA was resolved on a denaturing polyacrylamide gel and imaged. The positive control for ssDNA activity is a sequence with a U synthetically incorporated at the same position as the target C and the negative control is a sequence with no U or C. The positive control for dsDNA activity is DddA toxin deaminase that has been documented as selective for a dsDNA substrate (Mok, B.Y., de Moraes, M.H., Zeng, J. et al. A bacterial cytidine deaminase toxin enables CRISPR-free mitochondrial base editing. Nature 583, 631–637 (2020). https://doi.org/10.1038/s41586-020- 2477-4) [00117] FIGs.25A, 25B, and 25C depict data demonstrating that Cytosine Base Editors (CBEs) containing novel cytidine deaminases with spCas9, MG3-6, or MG34-1 effectors show varying editing levels in HEK293 cells. Each novel cytidine deaminase is fused via a linker to the N- terminus of the effector (spCas9, MG3-6, or MG34-1). A uracil glycosylase inhibitor domain (UGI or MG69-1) is fused to the C-terminus of the effector, followed by a Nuclear Localization Signal (NLS). Each CBE was transiently transfected into HEK293 cells and targeted to 5 distinct genomic locations with corresponding sgRNAs (spacer sequence indicated, targeted cytosines underlined). Editing levels (C to T (%)) of spacer sequence and surrounding cytosines are indicated for CBEs with each distinct cytidine deaminase effector (n=3). [00118] FIGs.26A, 26B, and 26C depicts the activity of cytidine deaminases (CDAs) fused to MG3-6. Cytidine deaminases were fused to MG3-6 and their activity was assessed by targeting an engineered site in a reporter cell line. FIG.26A shows relative activity of various CDAs, controls used were a highly active CBE from literature A0A2K5RDN7, as well as rAPOBEC1. FIG.26B shows quantification of activity of various CDAs in comparison to the highly active CDA A0A2K5RDN7. FIG.26C shows MG139-52 activity highlighting the G-A conversion suggesting editing of the opposite strand - the strand in the DNA/RNA heteroduplex in the R- loop. [00119] FIGs.27A and 27B depict a toxicity assay in mammalian cells. Toxicity of CDAs was measured by stable expression of CDAs as CBEs (fused to MG3-6). HEK293T cells stably expressing CBEs were grown in puromycin for 3 days, alive cells were stained with crystal violet. Crystal violet dye was then solubilized with 1% SDS and quantified in a plate reader. FIG.27A shows a picture of cells stained with crystal violet; FIG.27B shows quantification of FIG.27A. Absorbance was taken in a plate reader at 570nm. [00120] FIG.28 depicts mutations identified from chloramphenicol selection in E. coli. r1v1 variant was the starting variant for the evolution experiment.24 variants were identified and the associated mutations were shown in the table. [00121] FIG.29 depicts beneficial mutations identified from variant screening in HEK293T. The predicted structure of MG68-4 is aligned with tRNA ^Arg2 from S. aureus TadA (PDB 2B3J). Key mutated residues are highlighted in the structural display. [00122] FIG.30 depicts screening of MG68-4 variants in HEK293T cells. Four guides were used to screen the activity, editing window, and sequence preference of engineered variants. [00123] FIG.31 depicts the ABE-MG35-1 E. coli survival assay sequencing results. Surviving colonies were picked from plates under chloramphenicol selection for the first experimental replicate and Sanger-sequenced. Sequencing of four of five selected colonies show a mutation from A back to G on the negative strand, restoring CAT function from Y193 back to H on the positive strand (boxed nucleotides). A bystander base edit was observed in two of the five sequenced colonies. [00124] FIG.32 depicts increased cytosine base editing efficiency upon Fam72a expression. [00125] FIG.33 depicts data demonstrating that structurally optimized adenine base editors (ABEs) show varying editing levels in HEK293 cells. Each of 33 ABEs was constructed by inserting the MG68-4 (D109N) deaminase upstream, downstream, or within the MG3-6_3-8 (D13A) nickase enzyme and cloned into the pCMV vector. These plasmids were co-transfected with a plasmid containing one of 8 sgRNAs targeting the HEK293 genome. Data shown is from a sgRNA targeting the ACAGACAAAACTGTGCTAGACA sequence. Editing levels (A to G (%)) of A5, A7, A8, A9, and A10 within the spacer sequence are indicated as well as cell viability of each individual experiment (n=2). [00126] FIG.34A – FIG.34B depicts rational design of MG68-4 variants. FIG.34A depicts structural alignment of E. coli TadA (PDB:1z3a) and the predicted structure of MG68-4. tRNA structure was retrieved from S. aureus TadA (PDB: 2b3j). FIG.34B depicts mutations identified from EcTadA for developments of adenine base editors (ABE7.10, ABE8.8m, ABE8.17m, and ABE8e) and equivalent residues of EcTadA on MG68-4. The mutations of EcTadA were installed to MG68-4 accordingly. H129N was identified from a bacterial selection in E. coli. In general, nuclear localization signal (SV40) was positioned on the C-terminus. For 2NLS constructs, one SV40 was used on the N-terminus and one SV40 was used on the C-terminus. For simplicity, deaminase sequences of adenine base editors are shown in the table. Abbreviations: MGA0.1, MG68-4; MGA1.1, MG68-4 (D109N); MGA2.1, MG68-4 (D109N/H129N); RD, rationally designed variants. [00127] FIG.35 depicts screening of adenine base editors in HEK293T cells. The top three variants are highlighted. The starting variant is MGA1.1. For 2NLS constructs, one SV40 was used on the N-terminus and one SV40 was used on the C-terminus. Abbreviations: MGA0.1, MG68-4; MGA1.1, MG68-4 (D109N); MGA2.1, MG68-4 (D109N/H129N); RD, rationally designed variants. [00128] FIG.36 depicts a table summarizing the base editing activity of rationally designed ABE variants described herein. [00129] FIG.37 depicts a gel-based deaminase assay showing activity of variant deaminases from several selected Families (MG93, MG139, and MG152). Enzymes were expressed in a bacterial (E. coli codon optimized) Purexpress cell lysate-derived in vitro transcription- translation system and incubated with 5’FAM-labeled ssDNA and USER enzyme (uracil DNA glycosylase and endonuclease VIII) at 37 °C for 2.5 h. The resulting DNA was resolved on a denaturing polyacrylamide gel and imaged. The positive control is a sequence with a U synthetically incorporated at the same position as the target C and the negative control is a sequence with no U or C. [00130] FIG.38A – FIG.38C depicts a gel-based deaminase with dual fluorophore assay. FIG. 38A depicts a schematic of substrate design. Substrates were designed for minimal overlap between the two fluorophores. Emission for Cy3 is around 560 nm and the emission peak for Cy5.5 is around 700 nm. FIGs.38B and 38C depict TBE-Urea Gel Images imaged using a Cy3 and Cy5.5 filter, respectively. RF157 is a single nucleotide substrate with a FAM molecule to act as a positive control to confirm the USER enzyme is cutting in the reaction and provide confirmation that the filter works and can discriminate between either fluorophore. A mastermix is used as a negative control to provide a baseline measurement for the uncut substrate. FIG. 38B: Deaminases that preferentially cut the substrate at T at the -1 position give a fluorescent product of 65nts. Substrates cut at C at the -1 position give a product of 45 nts. Deaminases active on both C or T at the -1 position will give a product of 30 nts. FIG.38C: Deaminase that preferentially cut substrate at G at the -1 position give a fluorescent product of 65nts. Substrates cut at C at the -1 position give a product of 45 nts. Deaminases active on both A or G at the -1 position will give a product of 30 nts. [00131] FIG.39 depicts the percentage of deamination for each -1 position to the target Cytidine for each variant (MG93 and MG152 families) tested in this study. [00132] FIG.40 depicts the percentage of deamination for each -1 position to the target Cytidine for each variant (MG139 family) tested in this study. [00133] FIG.41A – FIG.41C depicts a summary of activity data for novel and engineered CDAs as CBEs in mammalian cells. FIG.41A depicts the maximum detected editing efficiency for all tested CDAs across 5 engineered spacers. FIG.41B depicts the maximum detected activity normalized to internal positive control across 5 engineered spacers. The internal experimental positive control used for normalization was a highly active CDA “A0A2K5RDN7”. FIG.41C depicts side by side comparison of one of the lead candidates “139-52-V6” versus the highly active positive control “A0A2K5RDN7” with 2 guides.139-52-V6 shows similar editing efficiencies in comparison to the highly active tested CDA. [00134] FIG.42 depicts the -1 nt preference of CDAs with more than 1% editing activity as CBEs in mammalian cells. The comparison of the -1 nt preference in mammalian cells vs in vitro is shown. -1 preference observed in mammalian cells as CBEs is by the most part comparable to the in vitro preference. The in vitro preference shows a more relaxed pattern than the CBE activity in mammalian cells. [00135] FIG.43A – FIG.43C depicts an example of MG139-52 wt and mutated at N27 to A, MG139-52v6 that show differences of activity on ssDNA and/or on RNA:DNA duplex. FIG. 43A depicts a structural prediction of MG139-52 using A3H as template (pdb: 5W3V). The targeted mutation at N27 is indicated by an arrow and is located far away for the catalytic center and the recognition loop 7. FIG.43B depicts a cartoon showing the DNA/RNA heteroduplex in the R-loop that is targeted by 139-52 WT. CRISPResso output shows the G-A conversion indicative of deamination in the DNA strand forming a DNA/RNA heteroduplex. FIG.43C depicts CRISPREsso output showing that the G-A change in the DNA/RNA heteroduplex was abrogated with the N27A variant. Instead, such modification happens outside the DNA/RNA heteroduplex, suggesting that deamination in the DNA/RNA heteroduplex has been impaired. [00136] FIG.44 depicts the editing window of lead CDAs in comparison to the highly active CDA A0A2K5RDN7. The editing window shown corresponds to ~110nts. The R loop (Cas9 target) is shown as a square. Lead candidates 152-6 and 139-52-V6 have smaller editing windows than A0A2K5RDN7, a favorable feature to avoid off target edits. Engineered CDA 139-52-V6 shows a smaller editing window than its WT counterpart 139-52. [00137] FIG.45 depicts the mammalian cytotoxicity of stably expressed CDAs as CBEs. CDAs, expressed as CBEs, were stably expressed in mammalian cells by lentiviral integration. The cytotoxicity was measured as fold change relative to a low activity low cytotoxic CDA (rAPOBEC). The lead candidates (high editing efficiency) show medium cytotoxic activity under these conditions. It is understood that the cytotoxic activity will be reduced when the system is expressed transiently. [00138] FIG.46A – FIG.46B depicts the dimeric design of MG68-4 variants. FIG.46A depicts the predicted structure of MG68-4 and structural alignment of MG68-4 with SaTadA (PDB code: 2b3j). The distance between N-terminus of the first monomer and C-terminus of the second monomer is shown. FIG.46B depicts base editing efficiency comparing the monomeric and dimeric designs. TadA*8.8m was used for benchmarking. The target sequence is shown in the bar chart. Conversion of A to G was obtained from the highest editing position A8. All deaminases were fused to the N-terminus of MG34-1 (D10A). The editing was evaluated in HEK293T cells. [00139] FIG.47 depicts the effect of D109Q mutation to base substitution of C to G. A to G and C to G conversions were obtained from the target sequences 633 and 634, respectively. The editing efficiencies of residue C6 of target sequence 633 and residue A8 of target sequence 634 are shown. All deaminases were fused to the N-terminus of MG34-1 (D10A). The editing efficiency was evaluated in HEK293T cells. [00140] FIG.48 depicts base editing efficiency of the combinatorial library in HEK293T cells. Beneficial mutations identified from rational design and directed evolution were installed into MG68-4 to make the combinatorial library. The variants were inserted into 3- 68_DIV30_M_RDr1v1_B. The editing efficiency was evaluated in HEK293T cells. [00141] FIG.49 depicts the effects of MG68-4 dimerization and/or MG68-4 amino acid sequence variants within the 3-68_DIV30 scaffold on A to G conversion percentage in HEK293T cells. [00142] FIG.50A – FIG.50B depicts data demonstrating that the MG35-1 nickase can function as the scaffold of an adenine base editor in E. Coli cells. FIG.50A depicts a schematic of the MG35-1 adenine base editor (ABE) containing a C-terminal TadA*-(7.10) monomer and an SV40 NLS fused to the C-terminus. FIG.50B depicts a chloramphenicol selection experiment used to assess MG35-1 ABE base editing. A plasmid containing the MG35-1 ABE, a non- functional chloramphenicol acetyltransferase (CAT) gene, and a sgRNA that either targets the CAT gene (targeting sgRNA) or does not target the CAT gene (non-targeting sgRNA) are transformed into BL21(DE3) (Lucigen) E. Coli cells. E. Coli survival under chloramphenicol selection was dependent on the MG35-1 ABE editing the non-functional CAT gene to its wildtype sequence. Transformed E. Coli was plated on plates containing chloramphenicol mM IPTG. Colonies grown on plates containing chloramphenicol concentrations of 0, 2, 3, 4, as n=2. [00143] FIG.51 depicts the activity of 3-6/8 ABE at Apoa1. High A to G conversion was observed with 26 Apoa1 guides. For all spacers shown in the graph, base conversion at all A positions within the spacer region is shown. [00144] FIG.52 depicts the activity of 3-6/8 ABE at Angptl3. High A to G conversion was observed with 5 Angptl3 guides. For all spacers shown in the graph, base conversion at all A positions within the spacer region is shown. [00145] FIG.53 depicts the activity of 3-6/8 ABE at Trac. High A to G conversion was observed with 2 Trac guides. For all spacers shown in the graph, base conversion at all A positions within the spacer region is shown. [00146] FIG.54 depicts the background 3-6/8 ABE activity at Apoa1. Primer pairs for active guides were tested on mock-nucleofected samples to assay background editing at targeted regions. Scale is from 0 to 1%. [00147] FIG.55A – FIG.55E depicts an E. coli survival assay with an nMG35-1 ABE. E. coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT Y193) gene, and an sgRNA that either targets the CAT gene (targeting spacer) or not (scramble spacer). FIG.55A depicts a diagram showing the target sequences with the expected TAM. Cell growth is dependent on the ABE base editing the non- functional CAT gene (A at position 17 from the TAM/PAM, boxed) to restore activity. FIGs. 55B-55E depicts the base editing activity in E. coli of base editors comprising nMG35-1 fused to the TadA deaminase with linkers of various lengths. The X axis shows the linkers listed in Table 14. [00148] FIG.56A – FIG.56D depicts the evaluation of nMG35-1 ABE base editing in an E. coli survival assay under chloramphenicol selection, where cell growth is dependent on the ABE base editing the non-functional CAT gene stop codon and restoring activity. FIGs.56A-56B depict diagrams showing the target sequences with the expected TAM. The “A” base at position 11 (A) or 10 (B) from the TAM (boxes) is expected to edit to “G” in order to revert the stop codon to glutamine and restore chloramphenicol (cm) resistance. FIG.56C: E. coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT), and an sgRNA that either targets the CAT gene (targeting spacer) or not (no spacer). Transformed E. coli was grown on plates containing chloramphenicol concentrations of 0, 2, 4, ABE targeting both STOP98Q and STOP122Q contains both stop codons in the same gene that need to be reverted for CAT gene functionality. MIC: minimum inhibitory concentration. FIG. 56D chloramphenicol for the nMG35-1 ABE double reversion of STOP98Q and STOP122Q in the CAT gene. The chromatogram of the colony that does not show reversion (colony 3) reveals a smaller peak for A to G conversion that is likely obscured due to co-transformation with an unedited plasmid. [00149] FIG.57 depicts data demonstrating that truncation of the predicted PLMP domain at the N-terminus of MG35-1 ablates function of the MG35-1 ABE in E. coli. E. coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT), and an sgRNA that either targets the CAT gene (WT (top row) or PLMP domain truncation (bottom row) MG35-1 ABE) or a non-target spacer (middle row: WT MG35-1 ABE with a scrambled spacer). Transformed E. coli was grown on plates containing Carbecillin and 0.1 mM IPTG. MIC: minimum inhibitory concentration. BRIEF DESCRIPTION OF THE SEQUENCE LISTING [00150] The Sequence Listing filed herewith provides exemplary polynucleotide and polypeptide sequences for use in methods, compositions and systems according to the disclosure. Below are exemplary descriptions of sequences therein. [00151] SEQ ID NOs: 1-47 show the full-length peptide sequences of MG66 deaminases suitable for the engineered nucleic acid editing systems described herein. [00152] SEQ ID NOs: 48-49 show the full-length peptide sequences of MG67 deaminases suitable for the engineered nucleic acid editing systems described herein. [00153] SEQ ID NOs: 50-51 show the full-length peptide sequences of MG68 deaminases suitable for the engineered nucleic acid editing systems described herein. [00154] SEQ ID NOs: 52-56 show the sequences of uracil DNA glycosylase inhibitors suitable for the engineered nucleic acid editing systems described herein. [00155] SEQ ID NOs: 57-66 show the sequences of reference deaminases. [00156] SEQ ID NO: 67 shows the sequence of a reference uracil DNA glycosylase inhibitor. [00157] SEQ ID NO: 68 shows the sequence of an adenine base editor. [00158] SEQ ID NO: 69 shows the sequence of a cytosine base editor. [00159] SEQ ID NOs: 70-78 show the full-length peptide sequences of MG nickases suitable for the engineered nucleic acid editing systems described herein. [00160] SEQ ID NOs: 79-87 shows the protospacer and PAM used in in vitro nickase assays described herein. [00161] SEQ ID NOs: 88-96 show the peptide sequences of single guide RNA used in in vitro nickase assays described herein. [00162] SEQ ID NOs: 97-156 show the sequences of spacers when targeting E. coli lacZ. [00163] SEQ ID NOs: 157-176 show the sequences of primers when conducting site directed mutagenesis. [00164] SEQ ID NOs: 177-178 show the sequences of primers for lacZ sequencing. [00165] SEQ ID NOs: 179-342 show the sequences of primers used during amplification. [00166] SEQ ID NOs: 343-345 show the sequences of primers for lacZ sequencing. [00167] SEQ ID NOs: 346-359 show the sequences of primers used during amplification. [00168] SEQ ID NOs: 360-368 show protospacer adjacent motifs suitable for the engineered nucleic acid editing systems described herein. [00169] SEQ ID NOs: 369-384 show nuclear localization sequences (NLS’s) suitable for the engineered nucleic acid editing systems described herein. [00170] SEQ ID NOs: 385-443 show the full-length peptide sequences of MG68 deaminases suitable for the engineered nucleic acid editing systems described herein. [00171] SEQ ID NOs: 444-447 show the full-length peptide sequences of MG121 deaminases suitable for the engineered nucleic acid editing systems described herein. [00172] SEQ ID NOs: 448-475 show the full-length peptide sequences of MG68 deaminases suitable for the engineered nucleic acid editing systems described herein. [00173] SEQ ID NOs: 476 and 477 show sequences of adenine base editors. [00174] SEQ ID NOs: 478-482 show sequences of cytosine base editors. [00175] SEQ ID NOs: 483-487 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein. [00176] SEQ ID NOs: 488 and 489 show the sgRNA scaffold sequences for MG15-1 and MG34- 1. [00177] SEQ ID NOs: 490-522 show the sequences of spacers used to target genomic loci in E. coli and HEK293T cells. [00178] SEQ ID NOs: 523-585 show the sequences of primers used during amplification and Sanger sequencing. [00179] SEQ ID NOs: 584-585 show the sequences of primers used during amplification. [00180] SEQ ID NO: 586 shows the sequence of an adenine base editor. [00181] SEQ ID NO: 587 shows the sequence of a cytosine base editor. [00182] SEQ ID NOs: 588-589 show sequences of adenine base editors. [00183] SEQ ID NOs: 590-593 show the full-length peptide sequences of linkers suitable for the engineered nucleic acid editing systems described herein. [00184] SEQ ID NO: 594 shows the sequence of a cytosine deaminase. [00185] SEQ ID NO: 595 shows the sequence of an adenosine deaminase. [00186] SEQ ID NO: 596 shows the sequence of an MG34 active effector suitable for the engineered nucleic acid editing systems described herein. [00187] SEQ ID NO: 597 shows the sequence of an MG34 nickase suitable for the engineered nucleic acid editing systems described herein. [00188] SEQ ID NO: 598 shows the sequence of an MG34 PAM. [00189] SEQ ID NOs: 599-638 show the full-length peptide sequences of MG138 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00190] SEQ ID NOs: 639-659 show the full-length peptide sequences of MG139 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00191] SEQ ID NOs: 660-662 show the full-length peptide sequences of MG141 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00192] SEQ ID NOs: 663-664 show the full-length peptide sequences of MG142 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00193] SEQ ID NOs: 665-675 show the full-length peptide sequences of MG93 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00194] SEQ ID NOs: 676-678 show sequences of adenine base editors. [00195] SEQ ID NOs: 679-680 show the sgRNA scaffold sequences for MG34-1 and SpCas9. [00196] SEQ ID NOs: 681-689 show spacer sequences used to target genomic loci in guide RNAs. [00197] SEQ ID NOs: 690-707 show sequences of primers used to amplify genomic targets of adenine bae editors (ABE) for next generation sequencing (NGS) analysis. [00198] SEQ ID NO: 708 shows the sequence of a blasticidin (BSD) resistance cassette. [00199] SEQ ID NOs: 709-719 show spacer sequences used to target genomic loci in guide RNAs. [00200] SEQ ID NOs: 720-726 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein. [00201] SEQ ID NOs: 728-729 show sequences of adenine base editors. [00202] SEQ ID NOs: 730-736 show spacer sequences used to target genomic loci in guide RNAs. [00203] SEQ ID NOs: 737-738 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein. [00204] SEQ ID NOs: 739-740 show sequences of cytidine base editors. [00205] SEQ ID NO: 741 shows the sequence of a plasmid suitable for encoding the A1CF gene. [00206] SEQ ID NO: 742 shows the sequence of an RNA used to test CDAs for RNA activity. [00207] SEQ ID NO: 743 shows the sequence of a labelled primer for poisoned primer extension assay used to test CDAs for RNA activity. [00208] SEQ ID NOs: 744-827 show the full-length peptide sequences of MG139 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00209] SEQ ID NO: 828 shows the full-length peptide sequence of an MG93 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein. [00210] SEQ ID NO: 829 shows the full-length peptide sequence of an MG142 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein. [00211] SEQ ID NOs: 830-835 show the full-length peptide sequences of MG152 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00212] SEQ ID NOs: 836-860 show sequences of adenine base editors. [00213] SEQ ID NOs: 861-864 show spacer sequences used to target genomic loci in guide RNAs. [00214] SEQ ID NOs: 865-872 show sequences of primers used to amplify genomic targets of adenine bae editors (ABE) for next generation sequencing (NGS) analysis. [00215] SEQ ID NOs: 873-875 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein. [00216] SEQ ID NO: 876 shows the sgRNA scaffold sequence for MG34-1. [00217] SEQ ID NOs: 877-916 show sequences of cytosine base editors. [00218] SEQ ID NOs: 917-931 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein. [00219] SEQ ID NOs: 932-961 show sequences of primers used to amplify genomic targets of adenine base editors (ABE) for next generation sequencing (NGS) analysis. [00220] SEQ ID NO: 962 shows a site engineered in mammalian cell line with 5 PAMs compatible with Cas9 and MG3-6 editing. [00221] SEQ ID NOs: 963-967 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein. [00222] SEQ ID NOs: 968-969 show sequences of cytosine base editors. [00223] SEQ ID NO: 970 shows the full-length peptide sequence of an MG139 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein. [00224] SEQ ID NOs: 971-977 show the full-length peptide sequences of MG93 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00225] SEQ ID NOs: 978-981 show the full-length peptide sequences of MG138 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein. [00226] SEQ ID NO: 982 shows the full-length peptide sequence of MG142 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein. [00227] SEQ ID NO: 983-1014 shows the full-length peptide sequence of MG128 deaminases suitable for the engineered nucleic acid editing systems described herein. [00228] SEQ ID NO: 1015-1026 shows the full-length peptide sequence of MG129 deaminases suitable for the engineered nucleic acid editing systems described herein. [00229] SEQ ID NO: 1027-1031 shows the full-length peptide sequence of MG130 deaminases suitable for the engineered nucleic acid editing systems described herein. [00230] SEQ ID NO: 1032-1040 shows the full-length peptide sequence of MG131 deaminases suitable for the engineered nucleic acid editing systems described herein. [00231] SEQ ID NO: 1041-1043 shows the full-length peptide sequence of MG132 deaminases suitable for the engineered nucleic acid editing systems described herein. [00232] SEQ ID NO: 1044-1057 shows the full-length peptide sequence of MG133 deaminases suitable for the engineered nucleic acid editing systems described herein. [00233] SEQ ID NO: 1058-1061 shows the full-length peptide sequence of MG134 deaminases suitable for the engineered nucleic acid editing systems described herein. [00234] SEQ ID NO: 1062-1069 shows the full-length peptide sequence of MG135 deaminases suitable for the engineered nucleic acid editing systems described herein. [00235] SEQ ID NO: 1070-1081 shows the full-length peptide sequence of MG136 deaminases suitable for the engineered nucleic acid editing systems described herein. [00236] SEQ ID NO: 1082-1098 shows the full-length peptide sequence of MG137 deaminases suitable for the engineered nucleic acid editing systems described herein. [00237] SEQ ID NOs: 1099-1105 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein. [00238] SEQ ID NOs: 1106-1111 show the sequences of MG35 PAMs. [00239] SEQ ID NO: 1112 shows the DNA sequence of a gene encoding the ABE-MG35-1 adenine base editor. [00240] SEQ ID NO: 1113 shows the protein sequence of the ABE-MG35-1 adenine base editor. [00241] SEQ ID NO: 1114 shows the nucleotide sequence of a plasmid encoding a Cas9-based cytosine base editor (CBE). [00242] SEQ ID NO: 1115 shows the nucleotide sequence of a plasmid encoding Fam72a. [00243] SEQ ID NOs: 1116-1117 show the sequences of Cas9-CBE target sites. [00244] SEQ ID NOs: 1118-1119 show the sequences of NGS amplicons. [00245] SEQ ID NO: 1120 shows the full-length peptide sequence of an MG35 nuclease. [00246] SEQ ID NO: 1121 shows the full-length peptide sequence of Fam72A. [00247] SEQ ID NOs: 1121-1127 shows the full-length peptide sequences of MG35 nucleases. [00248] SEQ ID NOs: 1128-1160 shows the full-length peptide sequences of MG3-6/3-8 adenine base editors. [00249] SEQ ID NOs: 1161-1186 shows the full-length peptide sequences of MG34-1 adenine base editors. [00250] SEQ ID NOs: 1187-1195 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein. [00251] SEQ ID NOs: 1196-1204 show spacer sequences used to target genomic loci in guide RNAs. [00252] SEQ ID NO: 1205 shows the nucleotide sequence of a plasmid encoding an MG3-6/3-8 adenine base editor. [00253] SEQ ID NO: 1206 shows the nucleotide sequence of a plasmid encoding an sgRNA suitable for an MG3-6/3-8 adenine base editor described herein. [00254] SEQ ID NO: 1207 shows the nucleotide sequence of a plasmid encoding an MG34-1 adenine base editor. [00255] SEQ ID NOs: 1208-1269 show the full-length peptide sequences of MG93 deaminases suitable for the engineered nucleic acid editing systems described herein. [00256] SEQ ID NOs: 1270-1296 show the full-length peptide sequences of MG139 deaminases suitable for the engineered nucleic acid editing systems described herein. [00257] SEQ ID NOs: 1297-1311 show the full-length peptide sequences of MG152 deaminases suitable for the engineered nucleic acid editing systems described herein. [00258] SEQ ID NOs: 1312-1313 show the full-length peptide sequences of MG138 deaminases suitable for the engineered nucleic acid editing systems described herein. [00259] SEQ ID NOs: 1314-1315 show the full-length peptide sequences of MG139 deaminases suitable for the engineered nucleic acid editing systems described herein. [00260] SEQ ID NOs: 1316-1319 show the nucleotide sequences of 5’-FAM-labeled ssDNAs. [00261] SEQ ID NOs: 1320-1321 show the nucleotide sequences of Cy5.5-labeled ssDNAs. [00262] SEQ ID NOs: 1322-1355 show sequences of cytidine base editors. [00263] SEQ ID NOs: 1356-1362 show the full-length peptide sequences of MG34-1 adenine base editors. [00264] SEQ ID NOs: 1363-1415 show the full-length peptide sequences of MG3-6/3-8 adenine base editors. [00265] SEQ ID NOs: 1416-1417 show the nucleotide sequences of sgRNAs suitable for use with MG34-1 adenine base editors described herein. [00266] SEQ ID NO: 1418 shows the nucleotide sequence of an sgRNA suitable for use with MG3-6/3-8 adenine base editors described herein. [00267] SEQ ID NOs: 1419-1420 show the DNA sequences of target sites suitable for targeting by MG34-1 adenine base editors described herein. [00268] SEQ ID NO: 1421 shows a DNA sequence of a target site suitable for targeting by MG3- 6/3-8 adenine base editors described herein. [00269] SEQ ID NO: 1422 shows the nucleotide sequence of a plasmid suitable for expression of an MG34-1 adenine base editor described herein. [00270] SEQ ID NO: 1423 shows the nucleotide sequence of a plasmid suitable for expression of an MG3-6/3-8 adenine base editor described herein. [00271] SEQ ID NO: 1424 shows the full-length peptide sequence of an MG35-1 adenine base editor. [00272] SEQ ID NO: 1425-1426 show the nucleotide sequences of plasmids suitable for expression of MG35-1 adenine base editors and sgRNAs described herein. [00273] SEQ ID NOs: 1427-1428 show the nucleotide sequences of sgRNAs suitable for use with MG35-1 adenine base editors described herein. [00274] SEQ ID NOs: 1429-1430 show the DNA sequences of target sites suitable for targeting by MG35-1 adenine base editors described herein. [00275] SEQ ID NOs: 1431-1454 show the nucleotide sequences of sgRNAs engineered to function with an MG3-6/3-8 adenine base editor in order to target APOA1. [00276] SEQ ID NOs: 1455-1478 show the DNA sequences of APOA1 target sites. [00277] SEQ ID NOs: 1479-1483 show the nucleotide sequences of sgRNAs engineered to function with an MG3-6/3-8 adenine base editor in order to target ANGPTL3. [00278] SEQ ID NOs: 1484-1488 show the DNA sequences of ANGPTL3 target sites. [00279] SEQ ID NOs: 1489-1490 show the nucleotide sequences of sgRNAs engineered to function with an MG3-6/3-8 adenine base editor in order to target TRAC. [00280] SEQ ID NOs: 1491-1492 show the DNA sequences of TRAC sites. [00281] SEQ ID NOs: 1493-1516 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of APOA1. [00282] SEQ ID NOs: 1517-1521 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of ANGPTL3. [00283] SEQ ID NOs: 1522-1523 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of TRAC. [00284] SEQ ID NOs: 1524-1547 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of APOA1. [00285] SEQ ID NOs: 1548-1552 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of ANGPTL3. [00286] SEQ ID NOs: 1553-1554 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of TRAC. [00287] SEQ ID NO: 1555 shows the nucleotide sequence of a plasmid suitable for use in mRNA production. [00288] SEQ ID NOs: 1556-1562 show the full-length peptide sequences of MG131 adenine deaminase variants. [00289] SEQ ID NOs: 1563-1566 show the full-length peptide sequences of MG134 adenine deaminase variants. [00290] SEQ ID NOs: 1567-1574 show the full-length peptide sequences of MG135 adenine deaminase variants. [00291] SEQ ID NOs: 1575-1589 show the full-length peptide sequences of MG137 adenine deaminase variants. [00292] SEQ ID NOs: 1590-1599 show the full-length peptide sequences of MG68 adenine deaminase variants. [00293] SEQ ID NOs: 1600-1602 show the full-length peptide sequences of MG132 adenine deaminase variants. [00294] SEQ ID NOs: 1603-1616 show the full-length peptide sequences of MG133 adenine deaminase variants. [00295] SEQ ID NOs: 1617-1624 show the full-length peptide sequences of MG136 adenine deaminase variants. [00296] SEQ ID NOs: 1625-1633 show the full-length peptide sequences of MG129 adenine deaminase variants. [00297] SEQ ID NOs: 1634-1638 show the full-length peptide sequences of MG130 adenine deaminase variants. [00298] SEQ ID NOs: 1639-1644 show the full-length peptide sequences of MG34-1 adenine base editors. [00299] SEQ ID NOs: 1645-1646 show the nucleotide sequences of ssDNA substrates suitable for testing adenine deaminase activity in vitro. DETAILED DESCRIPTION [00300] While various embodiments of the invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed. [00301] The practice of some methods disclosed herein employ, unless otherwise indicated, techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA. See for example Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012); the series Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds.); the series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th Edition (R.I. Freshney, ed. (2010)) (which is entirely incorporated by reference herein). [00302] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.” [00303] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within one or more than one standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value. [00304] As used herein, a “cell” generally refers to a biological cell. A cell may be the basic structural, functional or biological unit of a living organism. A cell may originate from any organism having one or more cells. Some non-limiting examples include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant (e.g., cells from plant crops, fruits, vegetables, grains, soy bean, corn, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkin, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, ferns, clubmosses, hornworts, liverworts, mosses), an algal cell, (e.g.,, Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens C. Agardh, and the like), seaweeds (e.g., kelp), a fungal cell (e.g.,, a yeast cell, a cell from a mushroom), an animal cell, a cell from an invertebrate animal (e.g., fruit fly, cnidarian, echinoderm, nematode, etc.), a cell from a vertebrate animal (e.g., fish, amphibian, reptile, bird, mammal), a cell from a mammal (e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a non-human primate, a human, etc.), and etcetera. Sometimes a cell is not originating from a natural organism (e.g., a cell can be a synthetically made, sometimes termed an artificial cell). [00305] The term “nucleotide,” as used herein, generally refers to a base-sugar-phosphate combination. A nucleotide may comprise a synthetic nucleotide. A nucleotide may comprise a synthetic nucleotide analog. Nucleotides may be monomeric units of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide may include ribonucleoside triphosphates adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such nucleotide derivatives that confer nuclease resistance on the nucleic acid molecule containing them. The term nucleotide as used herein may refer to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Illustrative examples of dideoxyribonucleoside triphosphates may include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. A nucleotide may be unlabeled or detectably labeled, such as using moieties comprising optically detectable moieties (e.g., fluorophores). Labeling may also be carried out with quantum dots. Detectable labels may include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels. Fluorescent labels of nucleotides may include aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS). Specific examples of fluorescently labeled nucleotides can include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer, Foster City, Calif; FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5- dUTP available from Amersham, Arlington Heights, Ill.; Fluorescein-15-dATP, Fluorescein-12- dUTP, Tetramethyl-rodamine-6-dUTP, IR770-9-dATP, Fluorescein-12-ddUTP, Fluorescein-12- Chromosome Labeled Nucleotides, BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR- 14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, fluorescein-12-UTP, fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, tetramethylrhodamine-6- UTP, tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12- dUTP available from Molecular Probes, Eugene, Oreg. Nucleotides can also be labeled or marked by chemical modification. A chemically-modified single nucleotide can be biotin-dNTP. Some non-limiting examples of biotinylated dNTPs can include, biotin-dATP (e.g., bio-N6- ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP). [00306] The terms “polynucleotide,” “oligonucleotide,” and “nucleic acid” are used interchangeably to generally refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, either in single-, double-, or multi- stranded form. A polynucleotide may be exogenous or endogenous to a cell. A polynucleotide may exist in a cell-free environment. A polynucleotide may be a gene or fragment thereof. A polynucleotide may be DNA. A polynucleotide may be RNA. A polynucleotide may have any three-dimensional structure and may perform any function. A polynucleotide may comprise one or more analogs (e.g., altered backbone, sugar, or nucleobase). If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. Some non-limiting examples of analogs include: 5-bromouracil, peptide nucleic acid, xeno nucleic acid, morpholinos, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein linked to the sugar), thiol containing nucleotides, biotin linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queuosine, and wyosine. Non-limiting examples of polynucleotides include coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro- RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, cell-free polynucleotides including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes, and primers. The sequence of nucleotides may be interrupted by non-nucleotide components. [00307] The terms “transfection” or “transfected” generally refer to introduction of a nucleic acid into a cell by non-viral or viral-based methods. The nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof. See, e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88. [00308] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to generally refer to a polymer of at least two amino acid residues joined by peptide bond(s). This term does not connote a specific length of polymer, nor is it intended to imply or distinguish whether the peptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers comprising at least one modified amino acid. In some cases, the polymer may be interrupted by non-amino acids. The terms include amino acid chains of any length, including full length proteins, and proteins with or without secondary or tertiary structure (e.g., domains). The terms also encompass an amino acid polymer that has been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other manipulation such as conjugation with a labeling component. The terms “amino acid” and “amino acids,” as used herein, generally refer to natural and non-natural amino acids, including, but not limited to, modified amino acids and amino acid analogues. Modified amino acids may include natural amino acids and non-natural amino acids, which have been chemically modified to include a group or a chemical moiety not naturally present on the amino acid. Amino acid analogues may refer to amino acid derivatives. The term “amino acid” includes both D- amino acids and L-amino acids. [00309] As used herein, the “non-native” can generally refer to a nucleic acid or polypeptide sequence that is not found in a native nucleic acid or protein. Non-native may refer to affinity tags. Non-native may refer to fusions. Non-native may refer to a naturally occurring nucleic acid or polypeptide sequence that comprises mutations, insertions or deletions. A non-native sequence may exhibit or encode for an activity (e.g., enzymatic activity, methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitinating activity, etc.) that may also be exhibited by the nucleic acid or polypeptide sequence to which the non-native sequence is fused. A non- native nucleic acid or polypeptide sequence may be linked to a naturally-occurring nucleic acid or polypeptide sequence (or a variant thereof) by genetic engineering to generate a chimeric nucleic acid or polypeptide sequence encoding a chimeric nucleic acid or polypeptide. [00310] The term “promoter”, as used herein, generally refers to the regulatory DNA region which controls transcription or expression of a gene and which may be located adjacent to or overlapping a nucleotide or region of nucleotides at which RNA transcription is initiated. A promoter may contain specific DNA sequences which bind protein factors, often referred to as transcription factors, which facilitate binding of RNA polymerase to the DNA leading to gene transcription. A ‘basal promoter’, also referred to as a ‘core promoter’, may generally refer to a promoter that contains all the basic elements to promote transcriptional expression of an operably linked polynucleotide. Eukaryotic basal promoters can contain a TATA-box or a CAAT box. [00311] The term “expression”, as used herein, generally refers to the process by which a nucleic acid sequence or a polynucleotide is transcribed from a DNA template (such as into mRNA or other RNA transcript) or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. [00312] As used herein, “operably linked”, “operable linkage”, “operatively linked”, or grammatical equivalents thereof generally refer to juxtaposition of genetic elements, e.g., a promoter, an enhancer, a polyadenylation sequence, etc., wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a regulatory element, which may comprise promoter or enhancer sequences, is operatively linked to a coding region if the regulatory element helps initiate transcription of the coding sequence. There may be intervening residues between the regulatory element and coding region so long as this functional relationship is maintained. [00313] A “vector” as used herein, generally refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which may be used to mediate delivery of the polynucleotide to a cell. Examples of vectors include plasmids, viral vectors, liposomes, and other gene delivery vehicles. The vector generally comprises genetic elements, e.g., regulatory elements, operatively linked to a gene to facilitate expression of the gene in a target. [00314] As used herein, “an expression cassette” and “a nucleic acid cassette” are used interchangeably generally to refer to a combination of nucleic acid sequences or elements that are expressed together or are operably linked for expression. In some cases, an expression cassette refers to the combination of regulatory elements and a gene or genes to which they are operably linked for expression. [00315] A “functional fragment” of a DNA or protein sequence generally refers to a fragment that retains a biological activity (either functional or structural) that is substantially similar to a biological activity of the full-length DNA or protein sequence. A biological activity of a DNA sequence may be its ability to influence expression in a manner attributed to the full-length sequence. [00316] As used herein, an “engineered” object generally indicates that the object has been modified by human intervention. According to non-limiting examples: a nucleic acid may be modified by changing its sequence to a sequence that does not occur in nature; a nucleic acid may be modified by ligating it to a nucleic acid that it does not associate with in nature such that the ligated product possesses a function not present in the original nucleic acid; an engineered nucleic acid may synthesized in vitro with a sequence that does not exist in nature; a protein may be modified by changing its amino acid sequence to a sequence that does not exist in nature; an engineered protein may acquire a new function or property. An “engineered” system comprises at least one engineered component. [00317] As used herein, “synthetic” and “artificial” are used interchangeably to refer to a protein or a domain thereof that has low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) to a naturally occurring human protein. For example, VPR and VP64 domains are synthetic transactivation domains. [00318] The term “tracrRNA” or “tracr sequence”, as used herein, can generally refer to a nucleic acid with at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% sequence identity or sequence similarity to a wild type example tracrRNA sequence (e.g., a tracrRNA from S. pyogenes S. aureus, etc.). tracrRNA can refer to a nucleic acid with at most about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity or sequence similarity to a wild type example tracrRNA sequence (e.g., a tracrRNA from S. pyogenes S. aureus, etc.). tracrRNA may refer to a modified form of a tracrRNA that can comprise a nucleotide change such as a deletion, insertion, or substitution, variant, mutation, or chimera. A tracrRNA may refer to a nucleic acid that can be at least about 60% identical to a wild type example tracrRNA (e.g., a tracrRNA from S. pyogenes S. aureus, etc.) sequence over a stretch of at least 6 contiguous nucleotides. For example, a tracrRNA sequence can be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100 % identical to a wild type example tracrRNA (e.g., a tracrRNA from S. pyogenes S. aureus, etc.) sequence over a stretch of at least 6 contiguous nucleotides. Type II tracrRNA sequences can be predicted on a genome sequence by identifying regions with complementarity to part of the repeat sequence in an adjacent CRISPR array. [00319] As used herein, a “guide nucleic acid” can generally refer to a nucleic acid that may hybridize to another nucleic acid. A guide nucleic acid may be RNA. A guide nucleic acid may be DNA. The guide nucleic acid may be programmed to bind to a sequence of nucleic acid site- specifically. The nucleic acid to be targeted, or the target nucleic acid, may comprise nucleotides. The guide nucleic acid may comprise nucleotides. A portion of the target nucleic acid may be complementary to a portion of the guide nucleic acid. The strand of a double-stranded target polynucleotide that is complementary to and hybridizes with the guide nucleic acid may be called the complementary strand. The strand of the double-stranded target polynucleotide that is complementary to the complementary strand, and therefore may not be complementary to the guide nucleic acid may be called noncomplementary strand. A guide nucleic acid may comprise a polynucleotide chain and can be called a “single guide nucleic acid.” A guide nucleic acid may comprise two polynucleotide chains and may be called a “double guide nucleic acid.” If not otherwise specified, the term “guide nucleic acid” may be inclusive, referring to both single guide nucleic acids and double guide nucleic acids. A guide nucleic acid may comprise a segment that can be referred to as a “nucleic acid-targeting segment” or a “nucleic acid-targeting sequence.” A nucleic acid-targeting segment may comprise a sub-segment that may be referred to as a “protein binding segment” or “protein binding sequence” or “Cas protein binding segment”. [00320] The term “sequence identity” or “percent identity” in the context of two or more nucleic acids or polypeptide sequences, generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a local or global comparison window, as measured using a sequence comparison algorithm. Suitable sequence comparison algorithms for polypeptide sequences include, e.g., BLASTP using parameters of a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment for polypeptide sequences longer than 30 residues; BLASTP using parameters of a wordlength (W) of 2, an expectation (E) of 1000000, and the PAM30 scoring matrix setting gap costs at 9 to open gaps and 1 to extend gaps for sequences of less than 30 residues (these are the default parameters for BLASTP in the BLAST suite available at https://blast.ncbi.nlm.nih.gov); CLUSTALW with parameters of ; the Smith-Waterman homology search algorithm with parameters of a match of 2, a mismatch of -1, and a gap of -1; MUSCLE with default parameters; MAFFT with parameters retree of 2 and maxiterations of 1000; Novafold with default parameters; HMMER hmmalign with default parameters. [00321] As used herein, the term “RuvC_III domain” generally refers to a third discontinuous segment of a RuvC endonuclease domain (the RuvC nuclease domain being comprised of three discontiguous segments, RuvC_I, RuvC_II, and RuvC_III). A RuvC domain or segments thereof can generally be identified by alignment to documented domain sequences, structural alignment to proteins with annotated domains, or by comparison to Hidden Markov Models (HMMs) built based on documented domain sequences (e.g., Pfam HMM PF18541 for RuvC_III). [00322] As used herein, the term “HNH domain” generally refers to an endonuclease domain having characteristic histidine and asparagine residues. An HNH domain can generally be identified by alignment to documented domain sequences, structural alignment to proteins with annotated domains, or by comparison to Hidden Markov Models (HMMs) built based on documented domain sequences (e.g., Pfam HMM PF01844 for domain HNH). [00323] As used herein, the term “base editor” generally refers to an enzyme that catalyzes the conversion of one target base or base pair into another (e.g. A:T to G:C, C:G to T:A) without requiring the creation and repair of a double-strand break. In some embodiments, the base editor is a deaminase. [00324] As used herein, the term “deaminase” generally refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine or adenosine (e.g.., an engineered adenosine deaminase that deaminates adenosine in DNA). In some embodiments, the deaminase or deaminase domain is a cytidine (or cytosine) deaminase, catalyzing the hydrolytic deamination of cytidine (or cytosine) or deoxycytidine to uridine (or uracil) or deoxyuridine, respectively. In some embodiments, the deaminase or deaminase domain is a cytidine (or cytosine) deaminase domain, catalyzing the hydrolytic deamination of cytosine (or cytosine) to uracil (or uridine). In some embodiments, the deaminase or deaminase domain is a naturally- occurring deaminase from an organism, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, mouse, or bacterium (e.g. E. coli). In some embodiments, the deaminase or deaminase domain is a variant of a naturally-occurring deaminase from an organism that does not occur in nature. [00325] The term “optimally aligned” in the context of two or more nucleic acids or polypeptide sequences, generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that have been aligned to maximal correspondence of amino acids residues or nucleotides, for example, as determined by the alignment producing a highest or “optimized” percent identity score. [00326] Included in the current disclosure are variants of any of the enzymes described herein with one or more conservative amino acid substitutions. Such conservative substitutions can be made in the amino acid sequence of a polypeptide without disrupting the three-dimensional structure or function of the polypeptide. Conservative substitutions can be accomplished by substituting amino acids with similar hydrophobicity, polarity, and R chain length for one another. Additionally, or alternatively, by comparing aligned sequences of homologous proteins from different species, conservative substitutions can be identified by locating amino acid residues that have been mutated between species (e.g., non-conserved residues) without altering the basic functions of the encoded proteins. Such conservatively substituted variants may include variants with at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of the endonuclease protein sequences described herein. In some embodiments, such conservatively substituted variants are functional variants. Such functional variants can encompass sequences with substitutions such that the activity of one or more critical active site residues or guide RNA binding residues of the endonuclease are not disrupted. [00327] Also included in the current disclosure are variants of any of the enzymes described herein with substitution of one or more catalytic residues to decrease or eliminate activity of the enzyme (e.g. decreased-activity variants). In some embodiments, a decreased activity variant as a protein described herein comprises a disrupting substitution of at least one, at least two, or all three catalytic residues. In some embodiments, any of the endonucleases described herein can comprise a nickase mutation. In some embodiments, any of the endonucleases described herein can comprise a RuvC domain lacking nuclease activity. In some embodiments, any of the endonucleases described herein can be configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, any of the endonucleases described herein can comprise can be configured to lack endonuclease activity or be catalytically dead. [00328] Conservative substitution tables providing functionally similar amino acids are available from a variety of references (see, for e.g., Creighton, Proteins: Structures and Molecular Properties (W H Freeman & Co.; 2nd edition (December 1993)). The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) [00329] Overview [00330] The discovery of new CRISPR enzymes with unique functionality and structure may offer the potential to further disrupt deoxyribonucleic acid (DNA) editing technologies, improving speed, specificity, functionality, and ease of use. Relative to the predicted prevalence of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) systems in microbes and the sheer diversity of microbial species, comparatively few functionally characterized CRISPR enzymes exist in the literature. This is partly because a huge number of microbial species may not be readily cultivated in laboratory conditions. Metagenomic sequencing from natural environmental niches that represent large numbers of microbial species may offer the potential to drastically increase the number of new CRISPR systems documented and speed the discovery of new oligonucleotide editing functionalities. A recent example of the fruitfulness of such an approach is demonstrated by the 2016 discovery of CasX/CasY CRISPR systems from metagenomic analysis of natural microbial communities. [00331] CRISPR systems are RNA-directed nuclease complexes that have been described to function as an adaptive immune system in microbes. In their natural context, CRISPR systems occur in CRISPR (clustered regularly interspaced short palindromic repeats) operons or loci, which generally comprise two parts: (i) an array of short repetitive sequences (30-40bp) separated by equally short spacer sequences, which encode the RNA-based targeting element; and (ii) ORFs encoding the nuclease polypeptide directed by the RNA-based targeting element alongside accessory proteins/enzymes. Efficient nuclease targeting of a particular target nucleic acid sequence generally requires both (i) complementary hybridization between the first 6-8 nucleic acids of the target (the target seed) and the crRNA guide; and (ii) the presence of a protospacer-adjacent motif (PAM) sequence within a defined vicinity of the target seed (the PAM usually being a sequence not commonly represented within the host genome). Depending on the exact function and organization of the system, CRISPR systems are commonly organized into 2 classes, 5 types and 16 subtypes based on shared functional characteristics and evolutionary similarity (see FIG.1). [00332] Class I CRISPR systems have large, multisubunit effector complexes, and comprise Types I, III, and IV. [00333] Type I CRISPR systems are considered of moderate complexity in terms of components. In Type I CRISPR systems, the array of RNA-targeting elements is transcribed as a long precursor crRNA (pre-crRNA) that is processed at repeat elements to liberate short, mature crRNAs that direct the nuclease complex to nucleic acid targets when they are followed by a suitable short consensus sequence called a protospacer-adjacent motif (PAM). This processing occurs via an endoribonuclease subunit (Cas6) of a large endonuclease complex called Cascade, which also comprises a nuclease (Cas3) protein component of the crRNA-directed nuclease complex. Type I nucleases function primarily as DNA nucleases. [00334] Type III CRISPR systems may be characterized by the presence of a central nuclease, known as Cas10, alongside a repeat-associated mysterious protein (RAMP) that comprises Csm or Cmr protein subunits. Like in Type I systems, the mature crRNA is processed from a pre- crRNA using a Cas6-like enzyme. Unlike type I and II systems, type III systems appear to target and cleave DNA-RNA duplexes (such as DNA strands being used as templates for an RNA polymerase). [00335] Type IV CRISPR systems possess an effector complex that comprises a highly reduced large subunit nuclease (csf1), two genes for RAMP proteins of the Cas5 (csf3) and Cas7 (csf2) groups, and, in some cases, a gene for a predicted small subunit; such systems are commonly found on endogenous plasmids. [00336] Class II CRISPR systems generally have single-polypeptide multidomain nuclease effectors, and comprise Types II, V and VI. [00337] Type II CRISPR systems are considered the simplest in terms of components. In Type II CRISPR systems, the processing of the CRISPR array into mature crRNAs does not require the presence of a special endonuclease subunit, but rather a small trans-encoded crRNA (tracrRNA) with a region complementary to the array repeat sequence; the tracrRNA interacts with both its corresponding effector nuclease (e.g. Cas9) and the repeat sequence to form a precursor dsRNA structure, which is cleaved by endogenous RNAse III to generate a mature effector enzyme loaded with both tracrRNA and crRNA. Type II nucleases are known as DNA nucleases. Type 2 effectors generally exhibit a structure comprising a RuvC-like endonuclease domain that adopts the RNase H fold with an unrelated HNH nuclease domain inserted within the folds of the RuvC- like nuclease domain. The RuvC-like domain is responsible for the cleavage of the target (e.g., crRNA complementary) DNA strand, while the HNH domain is responsible for cleavage of the displaced DNA strand. [00338] Type V CRISPR systems are characterized by a nuclease effector (e.g. Cas12) structure similar to that of Type II effectors, comprising a RuvC-like domain. Similar to Type II, most (but not all) Type V CRISPR systems use a tracrRNA to process pre-crRNAs into mature crRNAs; however, unlike Type II systems which requires RNAse III to cleave the pre-crRNA into multiple crRNAs, type V systems are capable of using the effector nuclease itself to cleave pre- crRNAs. Like Type-II CRISPR systems, Type V CRISPR systems are again known as DNA nucleases. Unlike Type II CRISPR systems, some Type V enzymes (e.g., Cas12a) appear to have a robust single-stranded nonspecific deoxyribonuclease activity that is activated by the first crRNA directed cleavage of a double-stranded target sequence. [00339] Type VI CRISPR systems have RNA-guided RNA endonucleases. Instead of RuvC-like domains, the single polypeptide effector of Type VI systems (e.g. Cas13) comprises two HEPN ribonuclease domains. Differing from both Type II and V systems, Type VI systems also may not require a tracrRNA in some instances for processing of pre-crRNA into crRNA. Similar to type V systems, however, some Type VI systems (e.g., C2C2) appear to possess robust single- stranded nonspecific nuclease (ribonuclease) activity activated by the first crRNA directed cleavage of a target RNA. [00340] Because of their simpler architecture, Class II CRISPR have been most widely adopted for engineering and development as designer nuclease/genome editing applications. [00341] One of the early adaptations of such a system for in vitro use can be found in Jinek et al. (Science.2012 Aug 17;337(6096):816-21, which is entirely incorporated herein by reference). The Jinek study first described a system that involved (i) recombinantly-expressed, purified full- length Cas9 (e.g., a Class II, Type II enzyme) isolated from S. pyogenes SF370, (ii) purified mature ~42 nt crRNA bearing a ~20 nt 5’ sequence complementary to the target DNA sequence to be cleaved followed by a 3’ tracr-binding sequence (the whole crRNA being in vitro transcribed from a synthetic DNA template carrying a T7 promoter sequence); (iii) purified tracrRNA in vitro transcribed from a synthetic DNA template carrying a T7 promoter sequence, and (iv) Mg ²⁺ . Jinek later described an improved, engineered system wherein the crRNA of (ii) is joined to the 5’ end of (iii) by a linker (e.g., GAAA) to form a single fused synthetic guide RNA (sgRNA) capable of directing Cas9 to a target by itself. [00342] Mali et al. (Science.2013 Feb 15; 339(6121): 823–826.), which is entirely incorporated herein by reference, later adapted this system for use in mammalian cells by providing DNA vectors encoding (i) an ORF encoding codon-optimized Cas9 (e.g., a Class II, Type II enzyme) under a suitable mammalian promoter with a C-terminal nuclear localization sequence (e.g., SV40 NLS) and a suitable polyadenylation signal (e.g., TK pA signal); and (ii) an ORF encoding an sgRNA (having a 5’ sequence beginning with G followed by 20 nt of a complementary targeting nucleic acid sequence joined to a 3’ tracr-binding sequence, a linker, and the tracrRNA sequence) under a suitable Polymerase III promoter (e.g., the U6 promoter). [00343] Base editing [00344] Base editing is the conversion of one target base or base pair into another (e.g. A:T to G:C, C:G to T:A) without requiring the creation and repair of a double-strand break. The base editing may be achieved with the help of DNA and RNA base editors that allow the introduction of point mutations at specific sites, in either DNA or RNA. Generally, DNA base editors may comprise a fusion of a catalytically inactive nuclease and a catalytically active base-modification enzyme that acts on single-stranded DNAs (ssDNAs). RNA base editors may comprise of similar, RNA-specific enzymes. Base editing may increase the efficiency of gene modification, while reducing the off-target and random mutations in the DNA. [00345] DNA base editors are engineered ribonucleoprotein complexes that act as tools for single base substitution in cells and organism. They may be created by fusing an engineered base- modification enzyme and a catalytically deficient CRISPR endonuclease variant that cannot cut dsDNA, but it is able to unfold the dsDNA in a protospacer adjacent motif (PAM) sequence- dependent manner, such that a guide RNA can find its complementary target to indicate a ssDNA scission site. The guide RNA anneals to the complementary DNA, displacing a fragment of ssDNA and directing the CRISPR ‘scissors’ to the base modification site. The cellular repair machinery will repair the nicked non-edited strand using information from the complementary edited template. [00346] So far, two types of DNA editors, cytosine base (CBEs) and adenine base editors (ABEs) have been developed. They were shown to efficiently and precisely edit point mutations in DNA with minimal off-target DNA editing (see Nat Biotechnol.2017;35:435-437, Nat Biotechnol.2017;35:438-440 and Nat Biotechnol.2017;35:475-480, each of which is entirely incorporated herein by reference). However, recent findings indicate that off-target modifications are present in DNA, and that many off-target modifications are also introduced into RNA by DNA base editors. [00347] MG Base Editors [00348] In some aspects, the present disclosure provides for an engineered nucleic acid editing system, comprising: (a) an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to the endonuclease. In some embodiments, the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. In some cases, the RuvC domain lacks nuclease activity. In some cases, the endonuclease comprises a nickase mutation. In some cases, the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some cases the ribonucleic acid sequence configured to bind to the endonuclease comprises a tracr sequence. [00349] In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising: (a) an endonuclease having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein the endonuclease is configured to be deficient in nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to the endonuclease. In some cases the ribonucleic acid sequence configured to bind to the endonuclease comprises a tracr sequence. In some cases, the RuvC domain lacks nuclease activity. In some cases, the endonuclease comprises a nickase mutation. In some cases, the endonuclease is configured to cleave one strand of a double- stranded target deoxyribonucleic acid. [00350] In some aspects, the present disclosure provides for an engineered nucleic acid editing system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein the endonuclease is a class 2, type II endonuclease, and the endonuclease is configured to be deficient in nuclease activity.; and (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to the endonuclease. In some cases, the ribonucleic acid sequence configured to bind to the endonuclease comprises a tracr sequence. In some cases, the endonuclease comprises a nickase mutation. In some cases, the RuvC domain lacks nuclease activity. In some cases, the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. [00351] In some embodiments, the endonuclease is derived from an uncultivated microorganism. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the tracr ribonucleic acid sequence comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof . In some embodiments, the tracr ribonucleic acid sequence comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof. [00352] In some aspects, the present disclosure provides an engineered nucleic acid editing system comprising, (a) an engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to an endonuclease, wherein the tracr ribonucleic acid sequence comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof ; and a class 2, type II endonuclease configured to bind to the engineered guide ribonucleic acid. [00353] In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360, 362, or 368. In some embodiments, the base editor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1- 51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof . In some embodiments, the base editor is an adenine deaminase. In some embodiments, the adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof . In some embodiments, the base editor is a cytosine deaminase. In some embodiments, the cytosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof . [00354] In some embodiments, the engineered nucleic acid editing system further comprises a uracil DNA glycosylase inhibitor. In some embodiments, the uracil DNA glycosylase inhibitor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. [00355] In some embodiments, the engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides. In some embodiments, the engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising the guide ribonucleic acid sequence and the tracr ribonucleic acid sequence. In some embodiments, the guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of the endonuclease. [00356] The NLS can comprise any of the sequences in Table 1 below, or a combination thereof: Table 1: Example NLS Sequences that can be used with Effectors According to the Disclosure [00357] In some embodiments, the endonuclease is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker. In some embodiments, linkers joining any of the enzymes or domains described herein can comprise one or multiple copies of a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SGGSSGGSSGSETPGTSESATPESSGGSSGGS, SGSETPGTSESATPESA, GSGGS, SGSETPGTSESATPES, SGGSS, or GAAA, or any other linker sequence described herein. In some embodiments, a polypeptide comprises the endonuclease and the base editor. In some embodiments, the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, the endonuclease comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. In some embodiments, the system further comprises a source of Mg ^2+. [00358] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 70, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 88; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 360. [00359] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 71, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 89; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 361. [00360] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 73, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 91; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 363. [00361] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 75, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 93; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 365. [00362] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 76, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 94; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 366. [00363] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 77, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 95; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 367. [00364] In some embodiments, the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 78, or a variant thereof; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 96; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 368. [00365] In some embodiments, the base editor comprises an adenine deaminase. In some embodiments, the adenine deaminase comprises SEQ ID NO: 57, or a variant thereof. In some embodiments, the base editor comprises a cytosine deaminase. In some embodiments, the cytosine deaminase comprises SEQ ID NO: 58, or a variant thereof. In some embodiments, the engineered nucleic acid editing system described herein further comprises a uracil DNA glycosylation inhibitor. In some embodiments, the uracil DNA glycosylation inhibitor comprises SEQ ID NO: 67, or a variant thereof. [00366] In some embodiments, the sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm. In some embodiments, the sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment. [00367] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein the endonuclease is derived from an uncultivated microorganism. [00368] In some aspects, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes an endonuclease having at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof coupled to a base editor. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C- terminus of said endonuclease. In some embodiments, the organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human. [00369] In some aspects, the present disclosure provides a vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism. In some embodiments, the vector comprises the nucleic acid described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a tracr ribonucleic acid sequence configured to binding to the endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus. In some aspects, the present disclosure provides a cell comprising the vector described herein. In some aspects, the present disclosure provides a method of manufacturing an endonuclease, comprising cultivating the cell described herein. [00370] In some aspects, the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM). [00371] In some embodiments, the endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker. In some embodiments, the endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof . [00372] In some aspects, the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide, comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to the endonuclease, and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598, or a variant thereof . [00373] In some embodiments, the class 2, type II endonuclease is covalently coupled to the base editor or coupled to the base editor through a linker. In some embodiments, the base editor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof . In some embodiments, the base editor comprises an adenine deaminase; the double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying the double-stranded deoxyribonucleic acid polypeptide comprises converting the adenine to guanine. In some embodiments, the adenine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57, or a variant thereof. [00374] In some embodiments, the base editor comprises a cytosine deaminase; the double- stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying the double- stranded deoxyribonucleic acid polypeptide comprises converting the cytosine to uracil. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58, or a variant thereof. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66, or a variant thereof. [00375] In some embodiments, the complex further comprises a uracil DNA glycosylase inhibitor. In some embodiments, the uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide ribonucleic acid structure and a second strand comprising said PAM. In some embodiments, the PAM is directly adjacent to the 3' end of the sequence complementary to the sequence of the engineered guide ribonucleic acid structure. [00376] In some embodiments, the class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease. In some embodiments, the class 2, type II endonuclease is derived from an uncultivated microorganism. In some embodiments, the double- stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. [00377] In some aspects, the present disclosure provides a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus the engineered nucleic acid editing system described herein, wherein the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure, and wherein the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies a nucleotide of the target nucleic locus. [00378] In some embodiments, the engineered nucleic acid editing system comprises an adenine deaminase, the nucleotide is an adenine, and modifying the target nucleic acid locus comprises converting the adenine to a guanine. In some embodiments, the engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, the nucleotide is a cytosine and modifying the target nucleic acid locus comprises converting the adenine to a uracil. In some embodiments, the target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is within a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, the cell is within an animal. [00379] In some embodiments, the cell is within a cochlea. In some embodiments, the cell is within an embryo. In some embodiments, the embryo is a two-cell embryo. In some embodiments, the embryo is a mouse embryo. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering the nucleic acid described herein or the vector described herein. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. [00380] In some embodiments, the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked. In some embodiments, delivering the engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter. [00381] In some aspects, the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity. In some embodiments, the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof . [00382] In some aspects, the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to the endonuclease. [00383] In some aspects, the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to the endonuclease. [00384] In some embodiments, the endonuclease is derived from an uncultivated microorganism. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the ribonucleic acid sequence configured to bind the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof. In some embodiments, the ribonucleic acid sequence configured to bind the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof . In some embodiments, the base editor comprises a sequence with at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof . In some embodiments, the base editor is an adenine deaminase. In some embodiments, the adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof . In some embodiments, the base editor is a cytosine deaminase. In some embodiments, the cytosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof . [00385] Systems of the present disclosure may be used for various applications, such as, for example, nucleic acid editing (e.g., gene editing), binding to a nucleic acid molecule (e.g., sequence-specific binding). Such systems may be used, for example, for addressing (e.g., removing or replacing) a genetically inherited mutation that may cause a disease in a subject, inactivating a gene in order to ascertain its function in a cell, as a diagnostic tool to detect disease-causing genetic elements (e.g. via cleavage of reverse-transcribed viral RNA or an amplified DNA sequence encoding a disease-causing mutation), as deactivated enzymes in combination with a probe to target and detect a specific nucleotide sequence (e.g. sequence encoding antibiotic resistance int bacteria), to render viruses inactive or incapable of infecting host cells by targeting viral genomes, to add genes or amend metabolic pathways to engineer organisms to produce valuable small molecules, macromolecules, or secondary metabolites, to establish a gene drive element for evolutionary selection, to detect cell perturbations by foreign small molecules and nucleotides as a biosensor.

Table 2: Sequence Listing of Protein and Nucleic Acid Sequences Referred to Herein

EXAMPLES Example 1 – Plasmid construction for base editors [00386] To create base editing enzymes that utilize CRISPR functionality to target their base editing, effector enzymes were fused in various configurations to the examplary deaminases described herein. This process involved a first stage of constructing vectors suitable for generating the fusion enzymes. Two entry plasmid vectors, MGA, and MGC, were first constructed. [00387] To construct the MGA (Metagenomi adenine base editor) entry plasmid containing T7 promoter-His tag-TadA*(ABE8.17m)-SV40 NLS, three DNA fragments were amplified from pAL6. To construct the MGC (Metagenomi cytosine base editor) entry plasmid containing T7 promoter-His tag-APOBEC1(BE3)-UGI-SV40 NLS, APOBEC1 and UGI-SV40 NLS were amplified from pAL9 and two pieces of vector backbones were amplified from pAL6 (see FIG. 3). [00388] To introduce mutations into the effectors, source plasmids containing MG1-4, MG1-6, MG3-6, MG3-7, MG3-8, MG4-5, MG14-1, MG15-1, or MG18-1 effector gene sequences were amplified by Q5 DNA polymerase with forward primers incorporating appropriate mutations and reverse primers. The linear DNA fragments were then phosphorylated and ligated. The DNA templates were digested with DpnI using KLD Enzyme Mix (New England Biolabs) per the manufacturer’s instructions. [00389] To generate the pMGA and pMGC expression plasmids, genes were amplified from plasmids carrying mutated effectors and cloned into MGA and MGC entry plasmids via XhoI and SacII sites, respectively. To clone sgRNA expression cassettes comprising T7 promoter- sgRNA-bidirectional terminator into BE expression plasmids, one set of primers (P366 as the forward primer) was used to amplify a T7 promoter-spacer sequence while another set of primers (P367 as the reverse primer) was used to amplify spacer sequence-sgRNA scaffold-bidirectional terminator, in which pTCM plasmids were used as templates (see FIG.2). The two fragments were assembled into pMGA and pMGC via XbaI sites, resulting pMGA-sgRNA and pMGC- sgRNA, respectively. Table 3 – Summary of constructs made for ABE screening systems described herein [00390] All amplified DNA fragments were purified by QIAquick Gel Extraction Kit (Qiagen), assembled via NEBuilder HiFi DNA Assembly (New England Biolabs), and the resulting assemblies were propagated via Endura Electrocompetent cells (Lucergen) per the manufacturer’s instructions (see FIGS.4 & 5). The DNA sequences of all cloned genes were confirmed at ELIM BIOPHARM. Table 4 – Conserved catalytic residues parsed out for selected systems described herein [00391] Example 2 – Protein expression and purification [00392] The T7 promoter driven mutated effector genes in the pMGA and pMGC plasmids were expressed in E. coli BL21 (DE3) cells in Magic Media per manufacturer’s instructions (Thermo) by transformation with each of the respective plasmids described in Example 1 above. After a 40 hour incubation at 16°C the transformed cells were harvested, suspended in lysis buffer (HisTrap equilibration buffer: 20 mM Tris (Sigma T2319-100 ML), 300 mM sodium chloride (VWR VWRVE529-500 ML), 5% glycerol, 10 mM MgCl2, with 10 mM imidazole (Sigma 68268-100 ML-F); pH 7.5) and EDTA-free protease inhibitor (Pierce), and frozen in the -80°C freezer. The cells were then thawed on ice, sonicated, clarified, and filtered before affinity purification. The protein was applied to Cytiva 5 ml HisTrap FF column on the Akta Avant FPLC per the manufacturer’s specifications and the protein was eluted in an isocratic elution of 20 mM Tris (Sigma T2319-100 ML), 300 mM sodium chloride (VWR VWRVE529-500 ML), 5% glycerol, 10 mM MgCl ² , with 250 mM imidazole (Sigma 68268-100 ML-F); pH 7.5. Eluted fractions containing the His-tagged effector proteins were concentrated and buffer exchanged into 50 mM Tris-HCl, 300 mM NaCl, 1 mM TCEP, 5% glycerol; pH 7.5. The protein concentration was determined by bicinchoninic acid assay (Thermo) and adjusted after determining the relative purity by SDS PAGE densitometry in Image Lab (Bio-Rad) (see FIG.7). [00393] Example 3 – In vitro nickase assay [00394] 6-carboxyfluorescein (6-FAM) labeled primers P141 and P146 (SEQ ID NOs: 179 and 180) synthesized by IDT were used to amplify linear fragments of LacZ containing targeting sequences of effectors using Q5 DNA polymerase. DNA fragments containing the T7 promoter followed by sgRNAs containing 20-bp or 22-bp spacer sequences were transcribed in vitro using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) per manufacturer’s instructions. Synthetic sgRNAs with the sequences corresponding to the named sgRNAs in the sequence listing were purified by Monarch RNA Cleanup Kit (New England Biolabs) according to the users manual and concentrations were measured by Nanodrop. [00395] To determine DNA nickase activity, each of the purified mutated effectors was first supplemented with its cognate sgRNA. Reactions were initiated by adding the linear DNA substrate in a 15 µL reaction mixture containing 10 mM Tris pH 7.5, 10 mM MgCl ₂ , and 100 mM NaCl, 150 nM enzyme, 150 nM RNA, and 15 nM DNA. The reaction was incubated at 37ºC for 2h. Digested DNA was purified using AMPure XP SPRI paramagnetic beads (Beckman Coulter) and eluted with 6 µL TE buffer (10 mM Tris, 1 mM EDTA; pH 8.0). The nicked DNA was resolved on a 10% TBE-Urea denaturing gel (Biorad) and imaged by ChemiDoc (Bio-Rad) (see FIG.7, which shows that the depicted enzymes display nickase activity by production of bands 600 and 200 bases versus 400 and 200 bases in the case of the wild-type enzyme). The results indicated that all the tested nickase mutants in FIG.7 displayed their expected nickase activity instead of wild type cleavage activity with the exception of MG4-5 (D17A), which was inconclusive. [00396] Example 4 – Base editor introduction into E. coli [00397] Plasmids were transformed into Lucergen’s electrocompetent BL21(DE3) cells according to the manufacturer’s instructions. After electroporation, cells were recovered with expression recovery media at 37°C for 1h and spread on LB plates containing 100 L/mg ampicillin and 0.1 mM IPTG. After overnight growth at 37°C, colonies were picked and lacZ gene was amplified by Q5 DNA polymerase (New England Biolabs) with primers P137 and P360. The resulting PCR products were purified and sequenced by Sanger sequencing at ELIM BIOPHARM. Base edits were determined by examining whether there exists C to T conversion or A to G conversion in the targeted protospacer regions for cytosine base editors or adenine base editors, respectively. [00398] To evaluate editing efficiency in E. coli, plasmids were transformed into electrocompetent BL21(DE3) (Lucergen) and the electroporated cells were recovered with expression recovery media at 37°C for 1h.10 µL of recovered cells were then inoculated into 990 µL SOB containing 100 µL/mg ampicillin and 0.1 mM IPTG in a 96-well deep well plate, and grown at 37°C for 20h.1 µL cells induced for base editor expression were used for amplification of the lacZ gene in a 20 µL PCR reaction (Q5 DNA polymerase) with primers P137 and P360. The resulting PCR products were purified and sequenced by Sanger sequencing at ELIM BIOPHARM. Quantification of editing efficiency was processed by Edit R as described in Example 12. Table 5 – The MG base editors described herein with associated PAM and deaminases [00399] Example 5 – Protein nucleofection and amplicon seq in mammalian cells (prophetic) [00400] Nucleofection is conducted in mammalian cells (e.g. K-562, Neuro-2A or RAW264.7) according to the manufacturer’s recommendations using a Lonza 4D nucleofector and the Lonza SF Cell Line 4D-Nucleofector X Kit S (cat. no. V4XC-2032). After formulating the SF Synthego is combined with 18 pmol of base editor enzymes (e.g. ABE8e) and incubated for 5 followed by protein solution, and the mixture is triturated to mix. Cells are nucleofected with poly-d-lysine plate (Corning). Cells are then treated in the same way as lipofected cells above for genomic DNA extraction after three more days of culture. [00401] Following Illumina barcoding, PCR products are pooled and purified by electrophoresis with a 2% agarose gel using a Monarch DNA Gel Extraction Kit (New England Biolabs), eluting Kit (Thermo Fisher Scientific) and sequenced on an Illumina MiSeq instrument (paired-end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols. [00402] Sequencing reads are demultiplexed using the MiSeq Reporter (Illumina) and FASTQ files are analyzed using CRISPResso2. Dual editing in individual alleles is analyzed by a Python script. Base editing values are representative of n = 3 independent biological replicates collected by different researchers, with the mean ± s.d. shown. Base editing values are reported as a percentage of the number of reads with adenine mutagenesis over the total aligned reads. [00403] Example 6 – Plasmid nucleofection and whole genome seq in mammalian cells (prophetic) [00404] All plasmids are assembled by the uracil-specific excision reagent (USER) cloning method. Guide RNA plasmids for SpCas9, SaCas9 and all engineered variants are assembled. Plasmids for mammalian cell transfections are prepared using the ZymoPURE Plasmid Midiprep kit (Zymo Research Corporation). HEK293T cells (ATCC CRL-3216) are cultured in Dulbecco’s modified Eagle’s medium (Corning) supplemented with 10% fetal bovine serum (ThermoFisher Scientific) and maintained at 37 °C with 5% CO2. [00405] HEK293T cells are seeded on 48-well poly-d-lysine plates (Corning) in the same culture (ThermoFisher Scientific) using 750 ng base editor plasmid, 250 ng guide RNA plasmid and 10 ng green fluorescent protein as a transfection control. Cells are cultured for 3 d with media exchanged following the first day, then washed with Å~1 PBS (ThermoFisher Scientific), each transfected well. The mixture is incubated at 37 °C for 1 h then heat inactivated at 80 °C for 30 min. Genomic DNA lysate is subsequently used immediately for high-throughput sequencing (HTS). [00406] HTS of genomic DNA from HEK293T cells is performed. Following Illumina barcoding, PCR products are pooled and purified by electrophoresis with a 2% agarose gel using quantified with Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific) and sequenced on an Illumina MiSeq instrument (paired end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols. [00407] Example 7 – Determining editing window (prophetic) [00408] To examine the editing window regions, the cytosine showing the highest C–T conversion frequency in a specified sgRNA is normalized to 1, and other cytosines at positions spanning from 30 nt upstream to 10 nt downstream of the PAM sequence (total 43 bp) of the same sgRNA are normalized subsequently. Then normalized C–T conversion frequencies are classified and compared according to their positions for all tested sgRNAs of a specified base editor. A comprehensive editing window (CEW) is defined to span positions with an average C– T conversion efficiency exceeding 0.6 after normalization. [00409] To examine the substrate preference for each cytidine deaminase, C sites are initially classified according to their positions in sgRNA targeting regions and those positions containing analysis. Selected C sites are then compared depending on base types upstream or downstream of the edited cytosine (NC or CN). For cytidine deaminases showing efficient C–T conversion at both N-terminus and C–terminus of the endonuclease, the substrate preference is evaluated by integrating respective NT- and CT-CBEs together. For statistical analysis, one-way ANOVA is used and p < 0.05 is considered as significant [00410] Example 8a – Testing off-target analysis with whole genome sequencing and transcriptomics in mammalian cells (prophetic) [00411] HEK293T cells are plated on 48-well poly-d-lysine-coated plates 16 to 20 h before lipofection at a density of 3.104 cells per well in DMEM+GlutaMAX medium (Thermo Fisher Scientific) without antibiotics.750 ng nickase or base editor expression plasmid DNA is combined with 250 ng of sgRNA expression plasmid DNA in 15 µl Opti-MEM+GlutaMAX. This is combined with 10 µl of lipid mixture, comprising 1.5 µl Lipofectamine 2000 and 8.5 µl Opti-MEM + GlutaMAX per well. Cells are harvested 3 d after transfection and either DNA or RNA was harvested. For DNA analysis, cells are washed once in PBS, and then lysed in 100 µl QuickExtract Buffer (Lucigen) according to the manufacturer’s instructions. For RNA harvest, the MagMAX mirVana Total RNA Isolation Kit (Thermo Fisher Scientific) is used with the KingFisher Flex. [00412] Genomic DNA from mammalian cells is fragmented and adapter-ligated using the Nextera DNA Flex Library Prep Kit (Illumina) using 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions. Library size and concentration is confirmed by Fragment Analyzer (Agilent) and DNA is sent to Novogene for WGS using an Illumina HiSeq system. [00413] All targeted NGS data is analyzed by performing four general operations: (1) alignment; (2) duplicate marking; (3) variant calling; and (4) background filtration of variants to remove artifacts and germline mutations. The mutation reference and alternate alleles are reported relative to the plus strand of the reference genome. [00414] For whole Transcriptome sequencing, mRNA selection is performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs). RNA library preparation is performed using NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs). Based on the RNA input amount, a cycle number of 12 is used for the PCR enrichment of adapter-ligated DNA. NEBNext Sample Purification Beads (New England BioLabs) is used throughout for all of the size selection performed by this method. NEBNext Multiplex Oligos for Illumina (New England BioLabs) is used for the multiplex indexes in accordance with the PCR recipe outlined in the protocol. Before sequencing, samples are quality checked using the High Sensitivity D1000 ScreenTape on the 4200 TapeStation System (Agilent). The libraries are pooled and sequenced using a NovaSeq (Novogene). Targeted RNA sequencing is then performed. Complementary DNA is generated by PCR with reverse transcription (RT-PCR) from the isolated RNA using the SuperScript IV One-Step RT-PCR System with EZDnase (Thermo Fisher Scientific) according to the manufacturer’s instructions. [00415] The following program is used: 58 °C for 12 min; 98 °C for 2 min; followed by PCR cycles that varied by amplicon: for CTNNB1 and IP90; 32 cycles of (98 °C for 10 s; 60 °C for 10 sec; 72 °C for 30 sec). Following the combined RT-PCR, amplicons are barcoded and sequenced using an Illumina MiSeq sequencer as described above. The first 125 nucleotides in each amplicon, beginning at the first base after the end of the forward primer in each amplicon, are aligned to a reference sequence and used for analysis of maximum A-to-I frequencies in each amplicon. Off-target DNA sequencing is performed using primers, using a two-stage PCR and barcoding method to prepare samples for sequencing using Illumina MiSeq sequencers as above. [00416] Example 8b – Analysis of off-target edits by whole genome sequencing and transcriptomics (prophetic) [00417] Transfected cells prepared as in Example 8a are harvested after 3 days and the genomic DNA isolated using the Agencourt DNAdvance Genomic DNA Isolation Kit (Beckman Coulter) according to the manufacturer's instructions. On-target and off-target genomic regions of interest are amplified by PCR with flanking HTS primer pairs. PCR amplification is carried out with Phusion high-fidelity DNA polymerase (ThermoFisher) according to the manufacturer's instructions using 5 ng of genomic DNA as a template. Cycle numbers are determined separately for each primer pair as to ensure the reaction was stopped in the linear range of amplification (30, 28, 28, 28, 32, and 32 cycles for EMX1, FANCF, HEK293 site 2, HEK293 site 3, HEK293 site 4, and RNF2 primers, respectively). PCR products are purified using RapidTips (Diffinity Genomics). Purified DNA is amplified by PCR with primers containing sequencing adaptors. The products are gel-purified and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher) and KAPA Library Quantification Kit-Illumina (KAPA Biosystems). Samples are sequenced on an Illumina MiSeq as previously described. [00418] Sequencing reads are automatically demultiplexed using MiSeq Reporter (Illumina), and individual FASTQ files are analyzed with a custom Matlab script. Each read is pairwise aligned to the appropriate reference sequence using the Smith-Waterman algorithm. Base calls with a Q- score below 31 are replaced with N's and are thus excluded in calculating nucleotide frequencies. This treatment yields an expected MiSeq base-calling error rate of approximately 1 in 1,000. Aligned sequences in which the read and reference sequence contained no gaps are stored in an alignment table from which base frequencies were tabulated for each locus. Indel frequencies were quantified with a custom Matlab script. [00419] Sequencing reads are scanned for exact matches to two 10-bp sequences that flank both sides of a window in which indels might occur. If no exact matches were located, the read is excluded from analysis. If the length of this indel window exactly matched the reference sequence the read is classified as not containing an indel. If the indel window is two or more bases longer or shorter than the reference sequence, then the sequencing read is classified as an insertion or deletion, respectively. [00420] Example 9 – Mouse editing experiments (prophetic) [00421] It is envisaged that a base editor comprising a novel DNA targeting nuclease domain fused to a novel deaminase domain can be validated as a therapeutic candidate by testing in appropriate mouse models of disease. [00422] One example of an appropriate model comprises mice that have been engineered to express the human PCSK9 protein, for example, as described by Herbert et al (10.1161/ATVBAHA.110.204040). The PCSK9 protein regulates LDL receptor (LDLR) levels and influences serum cholesterol levels. Mice expressing the human PCSK9 protein exhibit elevated levels of cholesterol and more rapid development of atherosclerosis. PCSK9 is a validated drug target for the reduction of lipid levels in people at increased risk of cardiovascular disease due abnormally high plasma lipid levels (https://doi.org/10.1038/s41569-018-0107-8). Reducing the levels of PCSK9 via genome editing is expected to permanently lower lipid levels for the life-time of the individual thus providing a life-long reduction in cardiovascular disease risk. One genome editing approach can involve targeting the coding sequence of the PCSK9 gene with the goal of editing a sequence to create a premature stop codon and thus prevent the translation of the PCSK9 mRNA into a functional protein. Targeting a region close to the 5’ end of the coding sequence is useful in order to block translation of the majority of the protein. To create a stop codon (TGA, TAA, TAG) with high efficiency and specificity will require targeting a region of the PCSK9 coding sequence wherein the editing window will be placed over an appropriate sequence such that the highest frequency editing event results in a stop codon. Therefore, the availability of multiple base editing systems with a wide range of PAMs or a base editing system with a degenerate PAM is useful to access a larger number of potential target sites in the PCSK9 gene. In addition, additional editing systems wherein the frequency of off-target editing is low (e.g. in the range of 1% or less of the on-target editing events) are also useful to perform gene editing in this context. [00423] The efficiency of base editing required for a therapeutic effect is in the range of 50% or higher in order to achieve a significant reduction in plasma lipid levels. An example of the use of a base editor to create a stop codon in the PCSK9 gene is that of Carreras et al (https://doi.org/10.1186/s12915-018-0624-2) in which between 10% and 34% of the PCSK9 alleles were edited to create a stop codon. While this level of editing was sufficient to result in a measurable reduction in plasma lipid levels in the mice, a higher editing efficiency will be required for therapeutic use in humans. [00424] To identify a base-editing (BE) system and a guide that are optimal for introducing the stop codons in the PCSK9 gene, a screen may be performed in a mouse liver cell line such as Hepa1-6 cells. In silico screening may first be used to identify guides that target the PCSK9 gene with the various BE systems available. To select among the large number of possible guides an in-silico analysis may be performed to determine which guides have an editing window that encompasses a sequence that when edited may create a stop codon. Preference may then be given to those guides that are closer to the 5’ end of the coding sequence. The resulting set of guides and BE proteins may be combined to form a ribonucleoprotein complex (RNP) and may be nucleofected into Hepa1-6 cells. After 72 h the efficiency of editing at the target site may be determined by NGS analysis. Based on these in vitro results the one or more BE/guide combinations that resulted in the highest frequency of stop codon formation may be selected for in vivo testing. [00425] For application in a human therapeutic setting a safe and effective method of delivering the base editing components comprising the base editor and the guide RNA is required. In vivo delivery methods can be divided in to viral or non-viral methods. Among viral vectors the Adeno Associated Virus (AAV) is the virus of choice for clinical use due to its safety record, efficient delivery to multiple tissues and cell types and established manufacturing processes. The large size of base editors (BE) exceeds the packaging capacity of AAV which interferes with packaging in a single Adeno Associated Virus. While approaches that package BE into two AAV using split intein technology have been demonstrated to be successful in mice (https://doi.org/10.1038/s41551-019-0501-5), the requirement for 2 viruses can complicate development and manufacture. An additional disadvantage of AAV is that while the virus does not have a mechanism for promoting integration into the genome of host cells, and most of the AAV genomes remain episomal, a fraction of the AAV genomes do become integrated at random double strand breaks that occur naturally in cells (Curr Opin Mol Ther.2009 August; 11(4): 442– 447). This may lead to the persistence of gene sequences expressing the BE for the life-time of the organism. Moreover, AAV genomes persist as episomes inside the nucleus of transduced cells and can be maintained for years which may result in the long-term expression of BE in these cells and thus an increased risk of off-target effects because the risk of an off-target event occurring is a function of the time over which the editing enzyme is active. Adenovirus (Ad) such as Ad5 can efficiently deliver DNA payloads to the liver of mammals and can package up to 45 kb of DNA. However, adenoviruses are understood to induce a strong immune response in mammals (http://dx.doi.org/10.1136/gut.48.5.733), including in patients which can result in serious adverse events including death (https://doi.org/10.1016/j.ymthe.2020.02.010). [00426] Non-viral delivery vectors (reviewed in doi:10.1038/mt.2012.79) which include lipid nanoparticles and polymeric nanoparticles have several advantages compared to viral delivery vectors including lower immunogenicity and transient expression of the nucleic acid cargo. The transient expression elicited by non-viral delivery vectors is particularly suited to genome editing applications because it is expected to minimize off target events. In addition, non-viral delivery unlike viral vectors has the potential for repeat administration to achieve the therapeutic effect. There is also no theoretical limit to the size of the nucleic acid molecules that can be packaged in non-viral vectors, although in practice the packaging becomes less efficient as the size of the nucleic acid increases and the particles size may increase. [00427] A BE may be delivered in vivo using a non-viral vector such as a lipid nanoparticle (LNP) by encapsulating a synthetic mRNA encoding the BE together with the guide RNA into the LNP. This can be performed using any suitable methodology, for example as described by Finn et al (DOI: 10.1016/j.celrep.2018.02.014) or Yin et al (doi:10.1038/nbt.3471). LNP can deliver their cargo with a bias to the hepatocytes of the liver, which is also a target organ/cell type when attempting to interfere with the expression of the PCSK9 gene. In order to demonstrate proof of concept for this approach we envisage that a BE comprised of a novel genome editing protein fused to a deaminase domain may be encoded in a synthetic mRNA and packaged in a LNP together with an appropriate guide RNA that targets the selected site in the PCSK9 gene of the mouse. In the case of mice that were engineered to express the human PCSK9 gene the guide may be designed to target selectively the human PCSK9 gene or both the human and mouse PCSK9 genes. Following injection of these LNP the editing efficiency at the on-target site in the genome of the liver cells may be analyzed by amplicon sequencing or other methods such as tracking of indels by decomposition (doi: 10.1093/nar/gku936). The physiologic impact may be determined by measuring lipid levels in the blood of the mice, including total cholesterol and triglyceride levels using standard methods. [00428] Another example of a disease that may be modeled in mice to evaluate a novel BE is Primary Hyperoxaluria type I. Primary Hyperoxaluria type I (PH1) is a rare autosomal recessive disease caused by defects in the AGXT gene that encodes the enzyme alanine-glyoxylate aminotransferase. This results in a defect in glyoxylate metabolism and the accumulation of the toxic metabolite oxalate. One approach to treating this disease is to reduce the expression of the enzyme glycolate oxidase (GO) that produces glyoxylate from glycolate and thereby reducing the amount of substrate (glyoxylate) available for the formation of oxalate. PH1 can be modeled in mice in which both copies of the AGXT gene have been knocked out (agxt -/- mice) resulting in a significant 3-fold increase in oxalate levels in the urine compared to wild type controls. The agxt -/- mice can therefore be used to assess the efficacy of a novel base editor designed to create a stop codon in the coding sequence of the endogenous mouse GO gene. To identify a BE system and a guide that is optimal for introducing stop codons in the GO gene, a screen may be performed in a mouse liver cell line such as Hepa1-6 cells. In silico screening may first be used to identify guides that target the GO gene with the various BE systems available. To select among the large number of possible guides an in-silico analysis may be performed to determine which guides have an editing window that encompasses a sequence that when edited may create a stop codon. In some instances, guides closer to the 5’ end of the coding sequence may be utilized. The resulting set of guides and BE proteins may be combined to form a ribonucleoprotein complex (RNP) and may be nucleofected in to Hepa1-6 cells. After 72 h, the efficiency of editing at the target site may be determined by NGS analysis. Based on these in vitro results the one or more BE/guide combinations that resulted in the highest frequency of stop codon formation may be selected for in vivo testing in mice. [00429] The BE and guide may be delivered to the mice using an AAV virus with a split intein system to express the BE and a 3rd AAV to deliver the guide. Alternatively, an Adenovirus type 5 may be used to deliver the BE and guide in a single virus because of the >40Kb packaging capacity of Adenovirus. Further, the BE may be delivered as a mRNA together with the guide RNA packaged in an appropriate LNP. After intravenous injection of the LNP into the agxt -/- mice the oxalate levels in the urine may be monitored over time to determine if oxalate levels were reduced which may indicate that the BE was active and had the expected therapeutic effect. To determine if the BE had introduced the stop codons, the appropriate region of the GO gene can be PCR amplified from the genomic DNA extracted from livers of treated and control mice. The resultant PCR product can be sequenced using Next Generation Sequencing to determine the frequency of the sequence changes. [00430] Example 10 – Gene Discovery of new deaminases [00431] 4 Tbp (tera base pairs) of proprietary and public assembled metagenomic sequencing data from diverse environments (soil, sediments, groundwater, thermophilic, human, and non- human microbiomes) were mined to discover novel deaminases. HMM profiles of documented deaminases were built and searched against all predicted proteins using HMMER3 (hmmer.org) to identify deaminases from our databases. Predicted and reference (e.g., eukaryotic APOBEC1, bacterial TadA) deaminases were aligned with MAFFT and a phylogenetic tree was inferred using FastTree2. Novel families and subfamilies were defined by identifying clades composed of sequences disclosed herein. Candidates were selected based on the presence of critical catalytic residues indicative of enzymatic function (see e.g. SEQ ID NOs: 1-51, 385-386, 387-443, 444- 447, 488-475, 599-675, 744-835, or 970-982). [00432] Example 11 – Plasmid Construction [00433] DNA fragments of genes were synthesized at either Twist Bioscience or Integrated DNA Technologies (IDT). Plasmid DNA was amplified in Endura electrocompetent cells (Lucigen) and isolated by QIAprep Spin Miniprep Kit (Qiagen). Vector backbones were prepared by restriction enzyme digestion of plasmids. Inserts were amplified by Q5 High-Fidelity DNA polymerase (New England Biolabs) using primers (SEQ ID NOs: 690-707) ordered either from Elim BIOPHARM or IDT. Both vector backbones and inserts were purified by gel extraction using the Gel DNA Recovery Kit (Zymo Research). One or multiple DNA fragments were assembled into the vectors through NEBuilder HiFi DNA assembly (New England Biolabs) (SEQ ID NOs.483-487, 720-726, or 737-738). [00434] Example 12 – Assessment of Base Edit Efficiency in E. coli by sequencing [00435] 5 ng extracted DNA prepared as in Example 4 was used as the template and primers (P137 and P360) were used for PCR amplification, and the resulting products were submitted for Sanger sequencing at ELIM BIOPHARM. Primers used for sequencing are shown in Tables 6 and 7 (Seq ID NOs.523-531). Table 6 – Primers used for base editing analysis of lacZ gene in E. coli Table 7 – Primers used for base editing analysis of the effect of uracil glycosylase inhibitor (UGI) in E. coli [00436] FIGs.8A-8C shows example base edits by enzymes interrogated by this experiment, as assessed by Sanger sequencing. [00437] FIGs.10A-10B shows base editing efficiencies of adenine base editors (ABEs) using TadA (ABE8.17m) (SEQ ID NO: 596) and MG nickases according to Table 3. TadA is a tRNA adenine deaminase; TadA (ABE8.17m) is an engineered variant of E. coli TadA. Twelve MG nickases fused with TadA (ABE8.17m) were constructed and tested in E. coli. Three guides were designed to target lacZ. Numbers shown in boxes indicate percentages of A to G conversion quantified by Edit R at each position. ABE8.17m was used as the positive control for the experiment. [00438] FIGs.11A-11B shows base editing efficiencies of cytosine base editors (CBEs) comprising rat APOBEC1, MG nickases, and uracil glycosylase inhibitor of Bacillus subtilis bacteriophage (UGI (PBS1)). APOBEC1 is a cytosine deaminase.12 MG nickases fused with rAPOBEC1 on N-terminus and UGI on C-terminus were constructed and tested in E. coli. Three guides were designed to target lacZ. Numbers shown in boxes indicate percentages of C to T conversion quantified by Edit R. BE3 was used as the positive control in the experiment. [00439] FIG.12 shows effects of MG uracil glycosylase inhibitors (UGIs) on base editing activity when added to CBEs. (a) MGC15-1 comprises of N-terminal APOBEC1, MG15-1 nickase, and C-terminal UGI. Three MG UGIs were tested for improvements of cytosine base editing activities in E. coli. (b) BE3 comprises N-terminal rAPOBEC1, SpCas9 nickase, and C- terminal UGI. Two MG UGIs were tested for improvements of cytosine base editing activities in HEK293T cells. Editing efficiencies were quantified by Edit R. [00440] Example 13 – Cell Culture, Transfections, Next Generation Sequencing, and Base Edit Analysis [00441] HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (Gibco) supplemented with 10% (v/v) fetal bovine serum (Gibco) at 37 ºC with 5% CO ₂ .5 x 10 ⁴ cells were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before were used for transfection per well per manufacturer’s instructions. Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) per manufacturer’s instructions. Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers listed in Tables 8 and 9 (SEQ ID NOs.538- 585) and extracted DNA as the templates. Table 8 – Primers used for base edit analysis of the effect of UGI in HEK293T Table 9a – Primers used to amplify targeted regions in HEK293T cells transfected with A0A2K5RND7-MG nickase-MG69-1

[00442] PCR products were purified using the HighPrep PCR Clean-up System (MAGBIO) per manufacturer’s instructions. The effect of uracil glycosylase inhibitor (UGI) on base editing of candidate enzymes was analyzed by submitting PCR products to Elim BIOPHARM for Sanger sequencing, and the efficiency was quantified by Edit R. To analyze base editing of A0A2K5RND7-MG nickase-MG69-1, adapters used for next generation sequencing (NGS) were appended to PCR products by subsequent PCR reactions using KAPA HiFi HotStart ReadyMix PCR Kit (Roche) and primers compatible with TruSeq DNA Library Prep Kits (illumina). DNA concentrations of the resulting products were quantified by TapeStation (Agilent), and samples were pooled together to prepare the library for NGS analysis. The resulting library was quantified by qPCR with Aria Real-time PCR System (Agilent) and high through sequencing was performed with an Illumina Miseq instrument per manufacturer’s instructions. Sequencing data was analyzed for base edits by Cripresso2. [00443] FIGs.13A-13B shows maps of sites targeted by base editors showing base editing efficiencies of cytosine base editors comprising CMP/dCMP-type deaminase domain-containing protein (uniprot accession A0A2K5RDN7), MG nickases, and MG UGI. The constructs comprise N-terminal A0A2K5RDN7, MG nickases, and C-terminal MG69-1. For simplicity, the identities of MG nickases are shown in the figure. BE3 (APOBEC1) was used as a positive control for base editing. An empty vector was used for the negative control. Three independent experiments were performed on different days. Abbreviations: R, repeat; NEG, negative control. Table 9b: Protein Domains used in constructs in Example 13 [00444] Example 14 – Positive Selection of base editor mutants in E. coli [00445] FIG.14 shows a positive selection method for TadA characterization in E. coli. Panel (a) shows a map of one plasmid system used for TadA selection. The vector comprises CAT (H193Y), a sgRNA expression cassette targeting CAT, and an ABE expression cassette. In this figure, N-terminal TadA from E. coli and a C-terminal SpCas9 (D10A) from Streptococcus pyogenes are shown. Panel (b) shows sequencing traces demonstrating that when introduced/transformed into E. coli cells, the A2 position of CAT (H193Y)’s template strand is edited, reverting the H193Y mutant to wild type and restoring its activity. Abbreviations: CAT, chloramphenicol acetyltransferase. [00446] was incubated at 37 ºC until colonies were pickable. Colony PCR were used to amplify the genomic region containing base edits, and the resulting products were submitted for Sanger sequencing at ELIM BIOPHARM. Primers used for PCR and sequencing are listed in Table 10 (SEQ ID NOs.532-537). Table 10 – Primers used for base edit analysis of CAT (H193Y) [00447] FIG.15 shows mutations caused by TadA enable high tolerance of chloramphenicol (Cm). Panel (a) shows photographs of growth plates where different concentrations of chloramphenicol were used to select for antibiotics resistance of E. coli. In this example, wild type and two variants of TadA from E. coli (EcTadA) were tested. Panel (b) shows a results summary table demonstrating that ABEs carrying mutated TadA show higher editing efficiencies than the wild type. In these experiments, colonies were picked from the plates with greater than effectors (SpCas9) and construct organization are shown in the figures above. [00448] FIGs.16A-16B shows investigation of MG TadA activity in positive selection. FIG. 16A shows photographs of growth plates from an experiment where 8 MG68 TadA candidates variants and C-terminal SpCas9 (D10A) nickase). For simplicity, identities of deaminases are shown. Panel (b) shows a summary table depicting editing efficiencies of MG TadA candidates. FIG.16B demonstrates that MG68-3 and MG68-4 drove base edits of adenine. In this [00449] FIG.17 shows an improvement of base editing efficiency of MG68-4_nSpCas9 via D109N mutation on MG68-4. Panel (a) shows photographs of growth plates where wild type identities of deaminases are shown. Adenine base editors in this experiment comprise N-terminal TadA variants and C-terminal SpCas9 (D10A) nickase. Panel (b) shows a summary table depicting editing efficiencies of MG TadA candidates. Panel (b) demonstrates that MG68-4 and MG68-4 (D109N) showed base edits of adenine, with the D109N mutant showing increased activity. In this experiment, colonies were picked from the plates with greater than or equal to 0.5 [00450] FIG.18 shows base editing of MG68-4 (D109N) _nMG34-1. Panel (a) shows photographs of growth plates of an experiment where an ABE comprising N-terminal MG68-4 chloramphenicol. Panel (b) shows a summary table depicting editing efficiencies with and without sgRNA. In this experiment, colonies were picked from the plates with greater than or [00451] FIG.19 shows 28 MG68-4 variants designed for improvements of MG68-4-nMG34-1 base editing activity.12 residues were selected for targeted mutagenesis to improve editing of the enzymes. [00452] Example 15 – Plasmid construction for E. coli optimized constructs [00453] All plasmids for cytidine deaminase expression were prepared by Twist Biosciences. Each construct was codon optimized for E. coli expression and inserted into the XhoI and BamHI restriction sites of the pET-21(+) vector. Sequences were designed to exclude BsaI restriction sites. The following sequence was appended to the beginning of each construct: 5’- GAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGGCAGCAGTCATCATC ATCACCATCAC-3’. This sequence encodes a ribosomal binding site and an N-terminal hexahistidine tag. At the end of each CDA sequence, a stop codon was added to prevent incorporation of the C- terminal HisTag encoded by pET-21(+). [00454] Example 16 – Plasmid construction for mammalian optimized constructs [00455] All plasmids for cytidine deaminase expression in mammalian cells were codon optimized and ordered from Twist Biosciences. Each construct was codon optimized for H. sapiens expression. Restriction sites avoided were: BsaI, SphI, EcoRI, BmtI, BstX, BlpI and BamHI. The following sequence was appended 5’ of the codon optimized sequences: ACCGGTGCTAGCCCACC. This sequence contains a BmtI restriction site to be used for downstream cloning and a Kozak sequence for maximum translation. The following sequence was appended 3’ of the codon optimized CDA: AGCGCATGC. This sequence contains a SphI restriction site to allow for downstream cloning - stop codon was removed in all constructs. [00456] Example 17 – Cell culture, transfections, next generation sequencing, and base edit analysis [00457] HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 ºC with 5% CO2.2.5 x 10 ⁴ cells were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection.300 ng expression plasmid and 1 were used for transfection per well per manufacturer’s instructions. Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) per manufacturer’s instructions. Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers (SEQ ID NOs: 690-707, 865-872, and 932-961) and extracted DNA as the templates. PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) per manufacturer’s instructions. To analyze base substitutions of adenine base editors, adapters used for next generation sequencing (NGS) were appended to PCR products by subsequent PCR reactions using KAPA HiFi HotStart ReadyMix PCR Kit (Roche) and primers compatible with TruSeq DNA Library Prep Kits (illumina). DNA concentrations of the resulting products were quantified by TapeStation (Agilent), and samples were pooled together to prepare the library for NGS analysis. The resulting library was quantified by qPCR with Aria Real-time PCR System (Agilent) and high through sequencing was performed with an Illumina Miseq instrument per manufacturer’s instructions. Sequencing data was analyzed for base edits by Crispresso2. [00458] Example 18 – In Vitro Deaminase in-gel assay [00459] Linear DNA constructs containing the cytidine deaminases were amplified from the previously mentioned plasmids from Twist via PCR. All constructs were cleaned via SPRI Cleanup (Lucigen) and eluted in a 10mM tris buffer. Enzymes were expressed from the PCR templates in an in-vitro transcription-translation system, PURExpress (NEB), at 37°C for 2 hours. Deamination reactions were prepared by mixing 2uLs of the PURExpress reaction with 2uM 5’-FAM labeled ssDNA (IDT) and 1U USER Enzyme (NEB) in 1x Cutsmart Buffer (NEB). The reactions were incubated at 37°C for 2 hours and then quenched by adding 4 units of proteinase K (NEB) and incubation at 55°C for 10 minutes. The reaction was further treated by addition of 11uL of 2x RNA loading dye and incubation at 75°C for 10 minutes. All reaction conditions were analyzed by gel electrophoresis in a 10% denaturing gel (Biorad). DNA bands were visualized by a Chemi-Doc imager (Biorad) and band intensities were quantified using BioRad Image Lab v6.0. Successful deamination is observed by the visualization of a 10bp fluorescently labeled band in the gel (FIG.20). The results indicated that MG93-3 through MG93-7, MG93-11, MG138-17, MG138-20, MG138-23, MG139-12, and MG139-19 through MG139-21 were capable of deaminating cytidine-containing substrates. [00460] The in vitro activity of more than 90 novel cytidine deaminases on a ssDNA substrate FIG.23).38 of these cytidine deaminases displayed ssDNA deamination activity, including 5 that are capable of substantially total deamination of the target cytidine (MG139-84/SEQ ID NO:808, MG139- 86/SEQ ID NO:810, MG139-87/SEQ ID NO:811, MG139-95/SEQ ID NO:819, and MG139- 102/SEQ ID NO:826, see e.g. FIG.23). Additionally, some of the deaminases also showed greater than 50% deamination of the target cytosine (MG139-30/SEQ ID NO:752, MG139- 55/SEQ ID NO:777, MG139-99/SEQ ID NO:823). While most of the reported DNA cytidine deaminases operate predominantly on ssDNA, often with a preference for the base immediately FIG.24), verifying that MG139-86 and MG139-87 are capable of also deaminating dsDNA substrates. [00461] Example 19 – NGS-based deep deamination in vitro assay [00462] We created an ssDNA library with a single target C to determine cytosine deaminase NNNCNNN flanked by 21-nt and 21-nt regions comprising adenine, an upstream 20nt randomized barcode, and two conserved primer binding site was synthesized (Integrated DNA Technologies). [00463] This yielded an oligonucleotides pool with 4096 unique substrate sequences. Unique barcodes were included on each oligo to determine the original variable region post-sequencing in case of non-target C deamination events. First, deaminases were expressed from the PCR templates in an in-vitro transcription-translation system, PURExpress (NEB), at 37°C for 2 hours. Then the PURExpress was then incubated with 0.5 pmol of the substrate oligonucleotide pool for 1 h at 37 °C in 50 mM Tris, pH 7.5, 75 mM NaCl. [00464] A. Half of the treated pool was amplified using the Accel-NGS 1S Plus kit (Swift) to create a dsDNA pool. This pool was then further amplified with unique dual indexes and sequenced on a MiSeq for >15,000 reads per sample. [00465] treated with T4 DNA polymerase at 12 °C for 20 min to create a dsDNA pool. Using the conserved regions this pool was amplified with unique dual indexes (IDT) and sequenced on a MiSeq for >15,000 per samples. [00466] Example 20 – Lentivirus production and transduction [00467] HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 ºC with 5% CO ₂ . The day before transfection, cells were seeded at 5x10 ⁶ per dish. The day of transfection, 8g MG3-6 or Cas9 were mixed together and packaged into Mirus LT1 transfection reagent (Mirus Bio). The mixture was transfected into HEK293T cells. Lentiviruses were collected 3 days post- transfection, filtered through a 0.4uM filter, and immediately used for transducing cells. of polybrene. [00468] Example 21 – Adenine and cytidine base editors in E. coli and mammalian cells [00469] To demonstrate that MG34-1, a small type II CRISPR nuclease, can be used as a base editor, a construct comprising TadA*(8.17m)-nMG34-1 (ABE-MG34-1, SEQ ID NO: 727), where TadA*(8.17m) is an engineered TadA from E. coli, and a construct comprising rAPOBEC1-nMG34-1-UGI (PBS) (CBE-MG34-1, SEQ ID NO: 739), where rAPOBEC1 is rat APOBEC1 and UGI (PBS) is the uracil glycosylase inhibitor of Bacillus subtilis bacteriophage, were generated. TadA*(8.17m)-nSpCas9 (SEQ ID NO: 728) and rAPOBEC1-nSpCas9-UGI (PBS) (SEQ ID NO: 740) were generated as positive controls for editing profile analysis. Four guides that target lacZ gene in E. coli (SEQ ID NOs: 729-736) were designed and prepared for each base editor construct. Plasmids were transformed into BL21(DE3), recovered in recovery carbenicillin and 0.1 mM IPTG. After growing cells at 37 ºC for 16 to 20 h, colony PCR was used to amplify the targeted regions in E. coli genome, and the resulting products were analyzed with Sanger sequencing at Elim BIOPHARM (FIGs.22A-22C). Sequencing results indicated that both ABE-MG34-1 and CBE-MG34-1 edited target loci in the E. coli genome at levels and within editing windows comparable to the positive control SpCas9 base editors (FIGs.22A and 22B). Further, TadA*(8.17m)-nMG34-1 showed higher base substitution on two targeted loci. ABE-MG34-1 also displayed base editing in human cells with up to 22% editing efficiency across three different genomic targets (FIG.22C). [00470] To determine whether the SMART HNH endonuclease-associated RNA and ORF (HEARO) enzymes can be used as base editors, an ABE was constructed by fusing a TadA*- (7.10) deaminase monomer to the C-terminus of an engineered MG35-1 containing a D59A mutation (FIG.22E). The A to G editing of this ABE was tested in a positive selection single- plasmid E. coli system in which the ABE is required to revert a chloramphenicol acetyltransferase (CAT) gene containing a Y193 mutation back to H193 to survive chloramphenicol selection (FIG.22D). This plasmid contains a sgRNA with a spacer either targeting the mutant CAT gene or a scrambled, non-targeting spacer region (control). An enrichment of colonies was detected with E. coli transformed with the ABE-MG35-1 targeting FIG.22E). Sanger transformed with the target spacer contained the expected Y193H reversion (Table 11 and FIG. 31). Table 11 – E. coli survival assay with ABE-MG35-1 confirm reversion of the CAT gene function. Experiments were performed as n=2. [00471] It is understood that the four colonies without the reverted CAT sequence contain more unedited than edited copies of the selection construct, as a single reverted CAT gene is sufficient E. coli the targeting spacer contained the Y193H reversion, indicating a detectable level of editing without chloramphenicol selection. However, the colony growth enrichment under chloramphenicol selection for the targeting ABE-MG35-1 condition confirmed that the MG35-1 nickase is a successful component for base editing. At 623 aa long, the ABE-MG35-1 represents the smallest, nickase-based adenine base editor to date (Table 12). Table 12 – Size comparison of SMART nucleases vs. references Base editor (ABE and CBE) size is approximated based on linkers and number of NLS signals added. *For ABE, size was estimated with one TadA monomer. [00472] Example 22 – Adenine base editor in mammalian cells [00473] In a previous experiment, MG68-4v1 (predicted as a tRNA adenosine deaminase) was able to convert adenine to guanine, resulting in bacterial survival under chloramphenicol selection. Next, two base editors fusing deaminase with nickase, MG68-4v1-nMG34-1 and MG68-4v1-nSpCas9 were constructed. As a positive control for deaminase activity, an active variant engineered by Gaudelli et al. and created TadA*(8.8m)-nMG34-1 was used. To ensure genomic loci are able to be accessed by base editors, we selected guides that have shown activity for SpCas9 in mammalian cells. Out of 9 sites tested, MG68-4v1-nMG34-1 showed 11.3% editing efficiency at position 8 of site 2. When MG68-4v1 was fused to nSpCas9, the base editor exhibited 22.3% efficiency at position 5 of site 1 and 4.4 % efficiency at position 6 of site 8. The replacement of MG68-4v1 with TadA*(8.8m) in MG68-4v1-nMG34-1 showed 7.3% and 9.7% at position 5 and 7 of site 1, respectively. The efficiencies were increased to 16.5% and 19.5% at position 6 and 8 of site 2, respectively. Besides, 4.1% and 3.4% editing were observed at position 7 and 8 when targeting to site 7. Taken together, these results indicate that MG68-4v1 and nMG34-1 demonstrate base editing activity in mammalian cells (FIG.21). [00474] Example 23 – Activity in mammalian cells (cytidine deaminase assay in tissue culture cells) (prophetic) [00475] The cytidine deaminase assay in cells is designed so that when the mutated stop codon ACG is mutated to ATG by a cytidine deaminase, cells can translate the blasticidin gene and therefore acquire resistance to this antibiotic. Upon transducing a reporter cell line (ACG containing cell) with a library of cytidine deaminases fused to Cas9 or MG3-6, it is expected that a fraction of cells will mutate the ACG to ATG and therefore gain resistance to blasticidin. Cells that have acquired such resistance and thus survive the selection assay are later subjected to next generation sequencing (NGS) to unveil the identity of the successful cytidine deaminase displaying cytidine base editor activity. [00476] Example 24 – Mammalian constructs for Cytosine Base Editors (CBEs) [00477] Plasmids for CBEs using the nickase forms of spCas9, MG3-6, and MG34-1 were constructed using NEB HiFi assembly mix and DNA fragments containing the novel cytidine deaminases, the nuclease enzymes, and UNG sequence. For constructs containing spCas9, pAL318 was digested with the NotI and XmaI restriction enzymes. For constructs containing MG3-6, pAL320 was digested with the NcoI restriction enzyme. For constructs containing MG34-1, pAL226 was digested with the NotI and BamHI restriction enzymes. [00478] For experiments targeting the engineered cell line (SEQ ID NO.962), CDAs were fused with MG3-6 nickase. For cloning CDA constructs in the MG3-6 nickase backbone, CDAs were ordered as gene fragments from Twist and digested with SphI and BmtI. The plasmid backbone containing MG3-6 was digested with SphI and BmtI, and the gene fragments were ligated using T4 DNA ligase. The plasmid backbone contains a mU6 promoter for cloning gRNAs targeting the engineered sites. The spacers targeting the engineered sites using MG3-6 are shown in SEQ ID NOs.963-967. [00479] CBEs were constructed using various combinations of cytidine deaminases, nickase effectors, and uracil glycosylase inhibitors (FIGs.25A-25C). Overall, 14 cytidine deaminases (13 novel cytidine deaminases (MG139-12 (SEQ ID NO.970), MG93-3 (SEQ ID NO.971), MG93-4 (SEQ ID NO.972), MG93-5 (SEQ ID NO.973), MG93-6 (SEQ ID NO.974), MG93-7 (SEQ ID NO.975), MG93-9 (SEQ ID NO.976), MG93-11 (SEQ ID NO.977), MG138-17 (SEQ ID NO.978), MG138-20 (SEQ ID NO.979), MG138-23 (SEQ ID NO.980), MG138-32 (SEQ ID NO.981), and MG142-1 (SEQ ID NO.982)) that were shown to be active in vitro and the A0A2K5RDN7 cytidine deaminase were each fused with 3 effectors (spCas9 (SEQ ID NOs.877- 889 and 968), MG3-6 (SEQ ID NOs.890-902 and 969), or MG34-1 (SEQ ID NOs.903-916)) to generate 42 distinct CBEs. Fusions containing spCas9 were fused with a C-terminal UGI, and fusions containing MG3-6 or MG34-1 were fused with a C-terminal MG69-1 UGI. Each CBE was tested with 5 sgRNAs (spCas9 (SEQ ID NOs.917-921), MG3-6 (SEQ ID NOs.922-926), or MG34-1 (SEQ ID NOs.927-931)) targeting the HEK293 genome. Editing levels (C to T (%)) are shown for all cytosines within 5bp of the spacer region. Numerous CBEs showed detectable editing levels when transiently transfected into HEK293 cells. When fused to spCas9, both MG93-4 and MG138-20 exceeded 5% editing at certain sites with MG93-3, MG93-7, and A0A2K5RDN7 exceeding 10% editing. When fused to MG3-6, MG93-4 and A0A2K5RDN7 exceeded 5% editing at certain sites. When fused to MG34-1, MG93-4, MG93-6, and MG93-9 exceeded 5% editing at certain sites, MG93-3, MG93-7, and MG139-12 exceeded 10% editing, and MG93-11 and A0A2K5RDN7 exceeded 20% editing. Numerous novel cytidine deaminases have been identified that are compatible with spCas9, MG3-6, and MG34-1 and are able to deaminate cytosines in mammalian cells. [00480] In order to test the novel CDAs and assay for -1 nucleotide preferences, the CDAs were fused to MG3-6 and targeted a reporter cell line with 5 engineered PAMs in tandem (sequence ID no.962).14 CDAs were tested using this system, and many show >1% editing (Panel (a) of FIG. 26). The highest activity observed for a novel CDA fused to MG3-6 was 38.4% for MG152-6, with the second highest showing 17.6% for MG139-52. Their relative activity in comparison to A0A2K5RDN7 is shown in Panel (b) of FIG.26. Interestingly, it was also observed that the highly active MG139-52 might deaminate the DNA strand that is part of the DNA/RNA heteroduplex in the R-loop (as well as the ssDNA); an example of this is shown in Panel (c) of FIG.26. This activity (DNA deamination when the DNA is in a DNA/RNA heteroduplex) may highly improve off target effects as well as editing window, both of which may be beneficial for cytotoxicity. [00481] Example 25 – Cytosine base editors toxicity in mammalian cells [00482] HEK293T cells were transduced with lentiviruses carrying newly discovered CDAs fused to MG3-6. Successful transformants were selected by using 2 µg/mL of puromycin for 3 days. Death cells were washed with PBS and surviving cells were fixed and stained with 50% methanol and 1% crystal violet (Panel (a) of FIG.27). Cells were then photographed in a chemidoc and the absorbance was measured by dissolving the crystal violet in 1% SDS and taking measurements at 570 nm (Panel (b) of FIG.27). [00483] The highly active CDA A0A2K5RDN7 shows high editing efficiency, but it also exhibits a high degree of cell toxicity (Panel (a) of FIG.27). The deaminases were assayed as base editors (fused to MG3-6) and stably expressed in HEK293T cells. MG93-3 and MG93-4 both showed much less cellular toxicity than A0A2K5RDN7. Quantification of the toxicity assay (Panel (b) of FIG.27) shows that MG93-3 and MG93-4 are less toxic than rAPOBEC. [00484] Example 26 – Directed evolution of adenosine deaminase in E. coli [00485] MG68-4 harboring a D109N mutation can improve DNA editing efficiency in E. coli. For simplicity, this variant was designated r1v1. To further improve the efficiency for editing in mammalian cells, the deaminase portion of MG68-4 (D109N)-nMG34-1 was randomly mutagenized by error prone PCR. The resulting library was tested for the editing activity of variants by an E. coli positive selection using chloramphenicol acetyltransferase with H193Y mutation. [00486] To perform this experiment, the gene fragment of MG68-4 (D109N) was mutagenized by GeneMorph II Random mutagenesis kit according to the manufacturer’s instructions. In general, 500 ng DNA template was used, and 20 cycles of PCR reaction was carried out to get a mutation frequency ranging from 0 to 4.5 mutations/kb. The vector pAL478 carrying nMG34-1, CAT (H193Y), and single guide expression cassette was linearized by SacII and KpnI digestion. PCR products from random mutagenesis were then cloned into the linearized vector by NEBuilder HiFi DNA assembly kit. The assembled product was transformed into BL21(DE3) picked and sequenced by Sanger sequencing at Elim Biopharmaceuticals. Colonies carrying point mutations on MG68-4 (D109N) were grown in 96-well deep well plates and pooled together. Plasmids of these cells were isolated using QIAprep Spin Miniprep Kit (Qiagen) and MG68-4 variants were subcloned into pAL478 by digestion and ligation using restriction enzymes (SacII and KpnI) and T4 DNA ligase, respectively. The resulting library was transformed into Endura electrocompetent cells (Lucigen), amplified, and isolated by miniprep. Collected DNA was transformed into BL21(DE3) and tested for deaminase activity using chloramphenicol selection contain mutations that facilitated deaminase activity of the MG68 enzyme and survival under and sequenced by Sanger sequencing. [00487] A total of 25 variants (r2v1 to r2v24 (SEQ ID NOs.837-860) were uncovered and mutations were confirmed by Sanger sequencing. Through this evolution process, 24 residues were identified that were mutated to other amino acids (FIG.28). These mutants contained mutations at T2 (e.g. T2A), D7 (e.g. D7G), E10 (e.g. E10G), M13 (e.g. M13R), W24 (e.g. W24G), G32 (e.g. G32A), K38 (e.g. K38E), G45 (e.g. G45D), G51 (e.g. G51V), A63 (e.g. A63S), E66 (e.g. E66V or E66D), R75 (e.g. R75H), C91 (e.g. C91R), G93 (e.g. G93W), H97 (e.g. H97Y or H97L), A107 (e.g. A107V), E108 (e.g. E108D), D109 (e.g. D109N), P110 (e.g. P110H), H124 (e.g. H124Y), A126 (e.g. A126D), H129 (e.g. H129R or H129N), F150 (e.g. F150P or F150S), S165 (e.g. S165L). [00488] Example 27 – Adenine base editors in mammalian cells [00489] Variants of adenine base editors identified from E. coli selection in Example 27 were codon-optimized for mammalian cell expression and tested in HEK293T cells. Four guides were designed to test A to G conversion in cells (SEQ ID NOs.861-864 for spacers and SEQ ID NO. 876 for MG34-1 guide scaffold).11 variants (r2v3, r2v5, r2v7, r2v8, r2v11, r2v12, r2v13, r2v14, r2v15, r2v16, and r2v23 (SEQ ID NOs.839, 841, 843, 844, 847, 848, 849, 850.851, 852, and 859) outperformed r1v1 in the first three guides screened. When the mutations were displayed on the predicted structure of MG68-4, it was found that five residues (W24, G51, E108, P110, and F150) surrounding the active site were changed. Notably, r2V7 (D7G and E10G (SEQ ID NO. 843)) and r2V16 (H129N (SEQ ID NO.852)), while containing mutations away from the active site, displayed greater improvement of editing efficiencies than other mutations (FIG.29). With this round of screening, editing efficiency of r1v1 was increased from 2.8% to 7.9% on r2v7 and from 2.8% to 9.09% on r2v16 when guide 2 was used (FIG.30). [00490] Example 28 – Deaminase Activity on ssRNA (prophetic) [00491] This protocol was adapted from Wolfe, et. al. (NAR Cancer, 2020, Vol.2, No.41 doi: 10.1093/narcan/zcaa027). Linear DNA constructs containing the CDA and A1CF, a cofactor, are amplified from constructs prepared by Twist (SEQ ID NO.741) using the same primers developed for the in gel assay on ssDNA. Constructs are cleaned by PCR Spin Column Cleanup (Qiagen) and analyzed by gel electrophoresis. Enzymes are expressed from the PCR templates in an in vitro transcription-translation system, PURExpress (NEB), at 37°C for 2.5 hours. Deamination reactions are prepared by mixing 2uLs of the PURExpress reaction (CDA and A1CF) with 2uM ssRNA substrate (IDT, SEQ ID NO.742) in the presence of an RNAse inhibitor and incubating at 37C for 2 hours.5’ FAM labeled DNA primer (IDT, SEQ ID NO. 743) is then added to a concentration of 1.3 uM. The reaction is heated at 95 °C for 10 minutes and then allowed to cool gradually to room temperature for at least 30 minutes. Then, a reverse transcription mastermix comprising 5 mM DTT, Protoscript II RT (NEB) (5 U / L), Protoscript II Buffer (NEB) (1x), RNAseOut (ThermoFisher) (0.4 U / L), dTTP (0.25 mM), dCTP (0.25 mM), dATP (0.25 mM), and ddGTP (5 mM) is added. A full length transcription product is produced when the RNA substrate is deaminated. In contrast, when there is no deamination, a “C” will remain in the RNA substrate, and the reverse transcription reaction will terminate upon incorporation of ddGTP opposite this C. The reaction is incubated at 42 °C for one hour, and then at 65 °C for 10 minutes. Aliquots are then mixed with 2x RNA loading dye (NEB) and heated at 75 °C for 10 minutes, then cooled on ice for two minutes. Samples are loaded onto 10% or 15% Urea- TBE denaturing gels (Biorad). DNA bands are visualized by a Chemi-Doc imager (Biorad). Successful deamination is observed by the visualization of a full length (55 bp) fluorescently labeled band in the gel. Non-deaminated products appear as shorter (43bp) fluorescently labeled bands. [00492] Example 29 – Increased cytosine base editing efficiency upon Fam72a expression [00493] Fam72a has been documented as opposing uracil DNA glycosylase (UDG) during B cell somatic hypermutation and class-switch recombination to prevent mismatch-repair-based correction of m d Immunoglobulin alleles. Expression of Fam72a during engineered cytosine base editing may suppress UDG activity and thereby increase the conversion targeted of C into T. [00494] HEK293 cells (150,000) were lipofected using JetOptimus according to the manufacturer’s instructions with plasmids encoding a Cas9-CBE fusion (pMG3078; 500 ng), a plasmid encoding either sgRNA PE266 or PE691 (250 ng), and a plasmid encoding either Fam72a (pMG3072; 500 ng) or not. Cells were harvested 72 hours post-transfection, genomic DNA prepared, and the degree of base editing was determined via computational analysis of next-generation sequencing reads (FIG.32). The CMV-driven Fam72a expression construct demonstrated increased CBE activity at two loci when Fam72a was co-expressed with a Cas9- based cytosine base editor. It was determined that Fam72a can be useful to improve cytosine base editing (CBE) with any type of cytosine base editor, not just Cas9-based constructs. [00495] Example 30 – Structural optimization of adenine base editors [00496] 33 rationally-designed ABE variants were constructed for use in mammalian cells under control of a CMV promoter (SEQ ID NOs: 1128-1160). Eights constructs contained ABEs with a MG68-4 (D109N) adenine deaminase fused to either the N- or C-terminus of a MG3-6/3-8 nickase enzyme (D13A) with linker lengths of 20, 36, 48, and 62 amino acid residues. Additionally, 25 constructs contained ABEs with an MG68-4 (D109N) adenine deaminase inlaid within the RUVC-I, REC, HNH, RUVC-III, or WED domains with 18 amino acid linkers fused to either end. These constructs are summarized in Table 12A. Table 12A: Rationally-designed ABE Variants from Example 30 * Inlaid denotes the upstream native residue after which the deaminase is inserted. For example, Inlaid 887AA” indicates that the deaminase is inlaid between amino acids 887 and 888. [00497] Plasmids expressing the 33 ABE variants were separately transiently co-transfected into HEK293 cells with plasmids expressing 8 sgRNAs (SEQ ID NOs: 1188-1195) targeting a specific locus in the human genome. After 72 hours, cells were harvested and analyzed for on- target editing (FIG.36 and Table 12B).

[00498] Sequencing results showed that 19 of the 33 ABEs were capable of on-target editing at a level of at least 1% editing when co-expressed with an sgRNA targeting the TRAC locus (FIG. 33). Constructs used in this experiment included 3-68_DIV1_M_RDr1v1_B, 3- 68_DIV2_M_RDr1v1_B, 3-68_DIV3_M_RDr1v1_B, 3-68_DIV4_M_RDr1v1_B, 3- 68_DIV5_M_RDr1v1_B, 3-68_DIV6_M_RDr1v1_B, 3-68_DIV7_M_RDr1v1_B, 3- 68_DIV8_M_RDr1v1_B, 3-68_DIV9_M_RDr1v1_B, 3-68_DIV10_M_RDr1v1_B, 3- 68_DIV11_M_RDr1v1_B, 3-68_DIV12_M_RDr1v1_B, 3-68_DIV13_M_RDr1v1_B, 3- 68_DIV14_M_RDr1v1_B, 3-68_DIV15_M_RDr1v1_B, 3-68_DIV16_M_RDr1v1_B, 3- 68_DIV17_M_RDr1v1_B, 3-68_DIV18_M_RDr1v1_B, 3-68_DIV19_M_RDr1v1_B, 3- 68_DIV20_M_RDr1v1_B, 3-68_DIV21_M_RDr1v1_B, 3-68_DIV22_M_RDr1v1_B, 3- 68_DIV23_M_RDr1v1_B, 3-68_DIV24_M_RDr1v1_B, 3-68_DIV25_M_RDr1v1_B, 3- 68_DIV26_M_RDr1v1_B, 3-68_DIV27_M_RDr1v1_B, 3-68_DIV28_M_RDr1v1_B, 3- 68_DIV29_M_RDr1v1_B, 3-68_DIV30_M_RDr1v1_B, 3-68_DIV31_M_RDr1v1_B, 3- 68_DIV32_M_RDr1v1_B, and 3-68_DIV33_M_RDr1v1_B (FIG.36). The construct with the highest levels of editing of any A residue within the spacer region was 3- 68_DIV30_M_RDr1v1_B, with a maximum on-target editing rate of 13.3% (n=2) (FIG.33). Also of note was 3-68_DIV12_M_RDr1v1_B, which displayed similar editing levels between A5 (5.86%) and A10 (6.18%), indicating that v12 may have an altered base editing window within the spacer region relative to the other active ABEs. In addition to evaluating on-target editing, the cell viability of each base editor/sgRNA co-transfection was visually assessed. Cells transfected with numerous constructs, including 3-68_DIV30_M_RDr1v1_B and 3- 68_DIV12_M_RDr1v1_B, had high cell viability, whereas many cells transfected with the N- or C-terminally fused constructs had low cell viability. [00499] Example 31 – Engineering of the adenosine deaminase [00500] As tRNA adenosine deaminase (TadA) from E. coli has been engineered to target DNA and improve the base editing activity in mammalian cells, it was postulated that porting analogous mutations documented to improve editing in EcTadA to MG68-4 (D109N) may improve the deaminase activity. By surveying the literature, mutations of EcTadA from ABE7.10, ABE8.8m, ABE8.17m, and ABE8e were collected. The equivalent residues on MG68- 4 were parsed out through multiple sequence alignment and structural alignment.22 rationally designed variants on top of MG68-4 (D109N) were generated and fused to the N-terminus of MG34-1 (D10A) (SEQ ID NOs: 1161-1183). To import base editors into the nucleus, a nuclear localization signal (NLS) was incorporated to the c-terminus of the enzyme. The effect of dual NLS system (e.g. on both N- and C-termini) on editing efficiency was evaluated (FIGs.34A and 34B) (SEQ ID NOs: 1184-1186). Genes of base editors and guide RNAs were coexpressed by CMV and U6 promoters, respectively. In this experiment, single plasmids carrying required editing components (SEQ ID NOs: 1187 and 1207) were transfected into HEK293T cells, and editing efficiencies were evaluated through NGS. The results showed that the top three performers (RD9, RD18, and RD5) achieved 27.4%, 26.6%, and 23.8% A to G conversion on A8, respectively. A 45% increase in editing efficiency was obtained when comparing RD9 (MG68-4 (D109N/T112R)) to MGA1.1 (MG68-4 (D109N)). The two-NLS design had comparable activity to the one-NLS design. MGA1.1_2NLS achieved 11.4% conversion, which is lower than 19.2% MGA1.1 (FIG.35). [00501] Example 32 – Engineered CBEs to relax sequence selectivity of CDA at -1 position of the target cytosine and improved on-target activity on DNA [00502] Two approaches were taken toward mutagenesis to improve the editing activity and selectivity for cytosine base editors (CBEs). First, as it was hypothesized that low or mid-editing efficiency and nickase-independent deamination events of wild-type CBEs may be caused by the intrinsic DNA/RNA binding affinities of the cytidine deaminase(s), mutagenesis (point mutation) of cytidine deaminases to alter intrinsic DNA/RNA affinity was considered. Second, as a loop adjacent to the active site has been identified as important for determining selectivity at the -1 position relative to the targeted cytosine in related families of base editors (loop 7, Kolhi et al., J. Biol. Chem.2009, 284, 22898-22904), experiments to swap loop 7 sequences among cytosine base editors were considered. [00503] Utilizing structural-based homology models of APOBEC1 (Wolfe et al., NAR Cancer 2020, 2, 1-15), AID (Kolhi et al., J. Biol. Chem.2009, 284, 22898-22904), and APOBEC3A (Shi et al., Nat Struct Mol Biol.2017, 24, 131-139), the putative loop 7 of novel cytidine deaminases described herein were predicted and identified in order to develop a loop 7 swapping experiment to relax the sequence selectivity of these candidates. Several residues were also targeted for mutation to increase activity on DNA and reduce RNA activity (Yu et al., Nature Communications 2020, 11, 2052). A total of 108 CDA variants (with MG93, MG139 and MG152 families) were designed with either a point mutation or a loop 7 swapping with AID deaminase that is documented to have a 5’RC selectivity (SEQ ID NOs: 1208-1315). Table 12C: Cytosine Base Editor Mutants Investigated in Example 32 [00504] Example 33 – In vitro activity of novel CDA variants from the MG93, MG139, and MG152 families [00505] In vitro deaminase in-gel assay [00506] Linear DNA constructs containing the CDA were amplified from the previously mentioned plasmids from Twist via PCR. All constructs were cleaned via SPRI Cleanup (Lucigen) and eluted in a 10mM tris buffer. Enzymes were expressed from the PCR templates in an in vitro transcription-translation system, PURExpress (NEB), at 37 °C for 2 hours. FAM labeled ssDNA (IDT) (4 different ssDNA substrates were used with different -1 nucleobase (A or C or T or G) next to the target cytidine (SEQ ID NOs: 1316-1319; FIG.37 Cy3 and Cy5.5 labeled ssDNA (IDT, 2 different substrates with either AC vs GC or CC vs TC, SEQ ID NOs: 1320-1321; FIG.38) and 1U USER Enzyme (NEB) in 1x Cutsmart Buffer (NEB). The reactions were incubated at 37 °C for 2 hours and then quenched by adding 4 units of proteinase K (NEB) and incubating at 55 °C for 10 minutes. The reaction was further treated by conditions were analyzed by gel electrophoresis in a 10% denaturing gel (Biorad). DNA bands were visualized by a Chemi-Doc imager (Biorad) and band intensities were quantified using BioRad Image Lab v6.0 (FIG.39). Successful deamination is observed by the visualization of a 10bp fluorescently labeled band in the gel. [00507] The deamination of cytosine (C) is catalyzed by cytidine deaminases and results in uracil (U), which has the base-pairing properties of thymine (T). Most documented cytidine deaminases operate on RNA, and the few examples that are documented to accept DNA require single- stranded DNA (ssDNA). The in vitro activity of 108 CDAs on 4 ssDNA substrates containing FIGs.37 and 38). The percentage of deamination for each nucleobase at 1- nt position was also calculated to evaluate if the selected mutations altered the sequence selectivity of the designed variants in vitro (FIGs.39 and 40). Notably, several variants display a more relaxed sequence base selectivity for MG93 and MG139 families (FIGs.39 and 40) and were selected for downstream in vivo mammalian cell activity as full CBEs. [00508] Example 34 – Mammalian editing activity of novel and engineered CDAs as CBEs [00509] In order to test the activity of novel CDAs as well as engineered variants, an engineered cell line was devised with 5 consecutive PAMs compatible with MG3-6 and Cas9. This cell line allows for gRNA tiling to test editing efficiency and find -1 nt selectivity. [00510] In order to test the novel and engineered CDAs, the CDAs were cloned in a plasmid backbone containing MG3-6. The CDAs were cloned in the N termini. Once the cloning of novel and variant CDAs was confirmed, they were transiently transfected into the engineered HEK293T cells using lipofectamine 2000. A total of 32 novel CDAs and 2 engineered variants (139-52-V6 and 93-4-V16) were tested in the gRNA tiling experiment described above (SEQ ID NOs: 1322-1355). Out of the 34 tested CDAs, 22 showed editing activity higher than 1% (FIG. 41A). The top performers were MG152-6, MG139-52v6, MG93-4, MG139-52, MG139-94, MG93-7, MG93-3, MG139-12, MG139-103, MG139-95, MG139-99, MG139-90, MG139-89, MG139-93, MG138-30, MG139-102, MG93-4v16, MG152-5, MG138-20, MG138-23, MG93-5, MG152-4, and MG152-1. When the editing activity was normalized per experimental condition relative to a positive control (documented high activity CDA: A0A2K5RDN7), it was observed that 9 candidates showed at least 20% the activity of the A0A2K5RDN7 positive control (FIG. 41B). Amongst these 9 candidates, 3 of them showed at least 50% the activity of A0A2K5RDN7; 139-52-V6, 152-6, and 139-52 showed 95%, 65%, and 60% of the activity, respectively. FIG. 41C shows side by side comparison of 2 targeting spacers.139-52-V6 shows essentially the same editing activity as A0A2K5RDN7, as observed in FIG.41C. [00511] To characterize the -1nt selectivity, 16 candidates of interest were selected. The -1 nt mammalian cell selectivity was calculated by selecting the top 4 modified cytosines per guide RNA and calculating the ratio per -1 position. The analysis was restricted to cytosines with >1% editing. The average ratio for all 5 guides were plotted. The -1nt in vitro selectivity was plotted by calculating the sum of percentage cleavages (percent cleavage measures percent deamination) per -1 nt selectivity and then calculating the ratio per -1 nucleotide. The mammalian cell and in vitro -1 nt selectivity is shown in FIG.42. Notably, different CDA families are documented as having different –1 nt selectivities, and their selectivities tend to be conserved amongst proteins belonging to the same family. For example, the MG93 family is documented to be selective for T as -1, while the MG139 family is documented to be selective for C as -1. Importantly, the active candidates are documented to have different –1 nt selectivities: 152-6 is selective for T in the -1 position, whereas the 139-52 (WT and engineered variant) has a strong selectivity for C at the -1 position. Having candidates with strong -1 nt selectivities is advantageous, since having a tighter nt selectivity improves off target activity. Candidates with different and strong -1 nt selectivities allow for targeting of different loci with minimal off target activity. Notably, candidates with unusual -1 selectivities were identified. Candidates with purine selectivities include 139-12 and 138-20, with A and G selectivities. These properties may generate variants with G and/or A -1 selectivities with high editing efficiencies. [00512] The candidate 139-52 was documented as having deaminase activity on both ssDNA and on the DNA strand forming a DNA/RNA heteroduplex (also shown in FIG.43B). Having exclusive activity in the DNA forming a DNA/RNA heteroduplex may be advantageous in terms of guide-independent off target activity and smaller editing window, as such engineering for this feature is an important venue. When the 139-52-V6 mutant was generated, it was interestingly noted that it abolished the deaminase activity in the DNA/RNA heteroduplex, thus shedding light on the potential importance of this residue for such activity. [00513] The 139-52-V6, 152-6, and 139-52 candidates have high editing efficiencies (FIGS. 41A, 41B, and 41C) and different -1 nt selectivities (FIG.42). Seeking to characterize them further, how wide their targeting window was in relation to the R-loop formation (spacer targeting) was analyzed.2 out of the 3 candidates (152-6 and 139-52-V6) show a tighter editing window when compared to the high editing positive control A0A2K5RDN7 (FIG.44). Having a tighter editing window may help to prevent off-target activities. The engineered candidate 139- 52-V6 has a smaller editing window than its WT counterpart (FIG.44), shedding light on the importance of this mutation. The mutation improved the on-target editing efficiency (FIGS.41A and 41B), while narrowing the editing window (FIG.44). [00514] Moreover, the cytotoxicity of all CDA candidates was measured by stably expressing the candidates in mammalian cells through lentiviral transduction. Each CDA candidate was cloned as CBE (using MG3-6 as partner), lentiviruses were produced, and cells were transduced.3 days post-transduction, cells were selected for viral integration and CBE expression by puromycin selection. The puromycin cassette was downstream of CBEs with a 2A peptide; thus, cells surviving selection expressed the CBEs. Surviving cells were dyed with crystal violet, crystal violet was then solubilized with SDS, and absorbance was taken in a plate reader. It was determined that different CDAs have various levels of cytotoxicity (FIGS.45). The 139-52-V6, 152-6, and 139-52 candidates show a promising cytotoxicity profile under these conditions. It is expected that when the candidates are expressed transiently, this effect may diminish greatly. [00515] Example 35 – Using low activity CDAs with nickases with improved target binding affinity (prophetic) [00516] Analyzing the editing windows and cytotoxic profiles demonstrated that it may be advantageous to use CDAs with slower deamination kinetics in conjunction with effector enzymes with higher residency time in the targets. In order to create such systems, a long form tracr RNA (see e.g. Workman et al. Cell 2021, 184, 675-688, which is incorporated by reference herein in its entirety) is used in the gRNA in conjunction with CDAs with various kinetics (low, medium, and high). These systems may improve on target editing efficiencies of low and medium CDAs, while generating a narrower editing window and a more favorable cytotoxic profile. [00517] Example 36 – Adenine Deaminase Engineering (prophetic) [00518] To improve on-target activity on ssDNA and minimize cellular RNA-unguided deamination, all beneficial mutations previously identified from rational design and directed evolution in the literature were used to design new adenine deaminase (ADA) variants from novel deaminases families (MG129-MG137 and MG68 families, SEQ ID NOs: 1556-1638). [00519] Table 12D: Adenosine Deaminase Mutants Designed in Example 36 [00520] In vitro activity of novel ADA variants from MG129-MG137 and MG68 families [00521] In vitro deaminase in-gel assay [00522] Linear templates for candidate deaminases are amplified using plasmids from TWIST via PCR. Products are cleaned using SPRI beads (Lucigen) and eluted in 10 mM tris. Enzymes are then expressed in PURExpress(NEB) at 37 °C for 2 hours. Deamination reactions are SEQ ID NO: 1645) labeled with Cy5.5, 1 U EndoV(NEB), and 10X NEB4 Buffer. Reactions are incubated at 37 °C for 20 hours. Samples are quenched by adding 4 units of proteinase K (NEB) RNA loading dye and incubated at 75 °C for 10 minutes. All reaction conditions are analyzed by gel electrophoresis in a 10% (TBE-urea) denaturing gel (Biorad). DNA bands are visualized by a Chemi-Doc imager (Biorad) and band intensities are quantified using BioRad Image Lab v6.0. Successful deamination is observed by the visualization of an intermediate fluorescently labeled band in the gel. [00523] In vitro NGS-based screening for in vitro deamination [00524] Linear templates for candidate deaminases are amplified using plasmids from TWIST via PCR. Products are cleaned using SPRI beads (Lucigen) and eluted in 10 mM tris. Enzymes are then expressed in PURExpress(NEB) at 37 °C for 2 hours. Deamination reactions are prepared by mixing PURExpress reactions (2 L) with a 250 nM single-stranded DNA substrate (IDT, SEQ ID NO: 1646) and 1U of NEB4 buffer. Reactions are incubated at 37 °C for 2 hours. Reactions are quenched by incubating at 95 °C for 10 minutes, adding 90 L of water at 95 °C, and placing on ice for 2 minutes.1 L of digest reaction is used per PCR reaction (oligos IDT). Reactions are then cleaned using column purification (Zymo), eluted in 10 mM tris, and sequenced. [00525] Example 37 – Engineering of ABE using nMG34-1 (D10A) nickase [00526] Plasmid construction [00527] DNA fragments of genes were either synthesized at Twist Bioscience or Integrated DNA Technologies (IDT). Plasmid DNA was amplified in Endura electrocompetent cells (Lucigen) and isolated by QIAprep Spin Miniprep Kit (Qiagen). Vector backbones were prepared by restriction enzyme digestion of plasmids. Inserts were amplified by Q5 High-Fidelity DNA polymerase (New England Biolabs) using primers ordered either from Elim BIOPHARM or IDT. Both vector backbones and inserts were purified by gel extraction using the Gel DNA Recovery Kit (Zymo Research). One or multiple DNA fragments were assembled into the vectors through NEBuilder HiFi DNA assembly (New England Biolabs). The plasmid sequence used for expression of nMG34-1 (D10A) adenine base editor and sgRNA are shown in SEQ ID NO: 1422. [00528] Cell culture, transfections, next generation sequencing, and base edit analysis [00529] HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 ºC with 5% CO ₂ .2.5 x 10 ⁴ cells (passage 3-8) were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection. For the dual plasmid system, 300 ng expression plasmid along with 100 well according to the manufacturer’s instructions. For the single plasmid system, 300 ng plasmid Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions. Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers and extracted DNA as the templates. PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. After 72 hours, individual wells were visually assessed for cell viability based on cell growth and presence of floating cells in media. Following the visual assessment of cell viability, cells were harvested and genomic DNA was extracted. PCR primers appropriate for use in NGS-based DNA sequencing were generated, optimized, and used to amplify the individual target sequences for each guide RNA. The amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. [00530] Results [00531] MG68-4 is predicted to be a tRNA adenosine deaminase. As the natural enzymes of E. coli TadA (EcTadA) and S. aureus TadA (SaTadA) are both dimers, MG68-4 was suspected be a dimer as well. It has been shown that using a protein fusion of engineered EcTadA homodimer can increase the editing efficiency (Gaudelli, N. M. et al. Programmable base editing of AT to GC in genomic DNA without DNA cleavage. Nature 2017, 551, 464-471). As such, a series of MG68-4 (D109N) homodimers was designed and fused with nMG34-1 (D10A). To design the linkers between two monomers, the length between the N-terminus of the first monomer and the C-terminus of the second monomer was estimated using Visual Molecular Dynamics (VMD) (Humphrey, W. et al. VMD - Visual Molecular Dynamics, J. Mol. Graph.1996, 14, 33-38), and the model suggested 5.2 nm (FIG.46A). The fusions were optimized by varying linker lengths ranging from 32 to 64 amino acids, and a negative control with 5 amino acids was included (SEQ ID NOs: 1356-1362). The result indicated that the best linker length was 64 amino acids, which might provide enough flexibility to accommodate the distance between monomers. With this optimized linker, an increase of 87% editing was obtained compared to the monomeric design of MG68-4 fused with nMG34-1 (D109N) (FIG.46B). [00532] Previously, MG68-4 (D109N)-nMG34-1 (D10A) was observed to have C to G edit on the sixth position when using guide 633 (SEQ ID NO: 1416). To reduce the promiscuous activity toward cytosine, the approach that was used by Jeong (Jeong, Y. K. et al. Adenine base editor engineering reduces editing of bystander cytosines. Nat. Biotechnol.2021, 39, 1426-1433) was applied, where Q was installed at D108 position in EcTadA. By incorporating Q into the D109 position of MG68-4, the ABE showed 64% reduction of C to G edit on C6 position using guide 633 while maintaining comparable A to G edit on A8 position using guide 634 (SEQ ID NO: 1417). To increase editing efficiency, two beneficial mutations (H129N and D7G/E10G) were incorporated along with D109Q. The results showed that the editing efficiencies of new mutants were reduced, suggesting incompatibility of mutations (SEQ ID NOs: 1639-1644) (FIG.47). [00533] Example 38 – Engineering of ABE using nMG3-6/3-8 (D13A) nickase [00534] Plasmid construction [00535] DNA fragments of genes were either synthesized at Twist Bioscience or Integrated DNA Technologies (IDT). Plasmid DNA was amplified in Endura electrocompetent cells (Lucigen) and isolated by QIAprep Spin Miniprep Kit (Qiagen). Vector backbones were prepared by restriction enzyme digestion of plasmids. Inserts were amplified by Q5 High-Fidelity DNA polymerase (New England Biolabs) using primers ordered either from Elim BIOPHARM or IDT. Both vector backbones and inserts were purified by gel extraction using the Gel DNA Recovery Kit (Zymo Research). One or multiple DNA fragments were assembled into the vectors through NEBuilder HiFi DNA assembly (New England Biolabs). The plasmid sequences used for expression of the nMG3-6/3-8 adenine base editor and sgRNA are shown in SEQ ID NO: 1423. [00536] Cell culture, transfections, next generation sequencing, and base edit analysis [00537] HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 ºC with 5% CO ₂ .2.5 x 10 ⁴ cells (passage 3-8) were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection. For the dual plasmid system, 300 ng expression plasmid along with 100 well according to the manufacturer’s instructions. For the single plasmid system, 300 ng plasmid Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions. Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers and extracted DNA as the templates. PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. After 72 hours, individual wells were visually assessed for cell viability based on cell growth and presence of floating cells in media. Following the visual assessment of cell viability, cells were harvested and genomic DNA extracted. PCR primers appropriate for use in NGS-based DNA sequencing were generated, optimized, and used to amplify the individual target sequences for each guide RNA. The amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. [00538] Results [00539] Through directed evolution of the predicted tRNA adenosine deaminase of MG68-4 (D109N)-nMG34-1 (D10A) in E. coli, two mutants (D109N/D7G/E10G and D109N/H129N) were observed to outperform the D109N mutant for higher editing A to G efficiency in HEK293T cells. Through rational design based on the reported mutations of EcTadA (Gaudelli, N. M. et al. Programmable base editing of AT to GC in genomic DNA without DNA cleavage. Nature 2017, 551, 464-471; Gaudelli N. M. et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat. Biotechnol.2020, 38, 892-900; and Richter M. F. et al. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat. Biotechnol.2020, 38, 883-891) for MG68-4, five mutants (V83S, L85F, T112R, D148R, and A155R) fused with nMG34-1 (D10A) were observed to be beneficial on top of D109N mutation. All identified mutations were combined, and a combinatorial library was designed to interrogate enzymatic performance of the adenosine deaminase (Table 13) (SEQ ID NOs: 1363-1409). Table 13: Mutations installed in the combinatorial library of MG68-4. All Mg68-4 variants are inserted into 3-68_DIV30_M_RDr1v1_B [00540] All variants were inserted into 3-68_DIV30_M nickase chassis, where 3-68, DIV, and M stood for MG3-6/3-8 nickase, domain inlaid version 30, and monomer, respectively. The screening of the resulting ABEs revealed that 27 variants outperformed CL2 (MG68-4 (D109M)). The highest editing efficiency was observed when V83S/L85F/D109N were combined together, and the effect of improving editing was supported by increased activities of V83S/D109N and L85F/D109N observed in CL4 and CL5, respectively. In addition to CL16, CL22 also demonstrated high editing efficiency. In this variant, the mutation of V83S was replaced by T112R in the V83S/L85F/D109N triple mutant (FIG.48). [00541] In order to increase A to G base editing percentage of the 3-68_DIV30_M adenine base editor, a 3-68_DIV30_D ABE was designed in which two MG68-4 (D109N) monomers are connected by a 65AA linker and inlaid within the 3-68 scaffold at the same V30 insertion site as 3-68_DIV30_M (SEQ ID NOs: 1410-1411). This dimeric form of the 3-68 ABE increased editing at position A10 of a site within the TRAC gene when co-transfected with a plasmid expressing sgRNA68 (SEQ ID NO: 1421) from 8% (3-68_DIV30_M) to 18% (3-68_DIV30_D) sgRNA68. The influence of two different MG68-4 variants (H129N or D7G/E10G) was also tested on 3-68_DIV30_M and 3-68_DIV30_D already containing D109N (SEQ ID NOs: 1412- 1415). For 3-68_DIV30_D, the H129N or D7G/E10G mutation was installed within the second MG68-4 D109N, and the first deaminase remained MG68-4 D109N. The H129N and D7G/E10G variants were identified using an error-prone PCR library of MG68-4 fused to MG34-1 and selecting for A to G conversion in E. Coli. After addition of either the H129N or D7G/E10G variants, in both the monomeric and dimeric MG68-4 D109N, editing was slightly lower as compared to the 3-68_DIV30 MG68-4 D109N ABE in the equivalent monomeric/dimeric form (FIG.49). [00542] Example 39 – Engineering of nMG35-1 as a base editor [00543] E. coli selection [00544] A nickase MG35-1 containing a D59A mutation with a C-terminally fused TadA*-(7.10) monomer along with a C-terminus SV40 NLS was constructed to test MG35-1 adenine base editor (ABE) activity (SEQ ID NOs: 1424-1426). This ABE was tested with its compatible sgRNA containing either a 20 nucleotide spacer sequence targeting the chloramphenicol acetyltransferase (CAT) gene or a non-targeting spacer sequence of the same 20 nucleotides in a scrambled order (SEQ ID NOs: 1429-1430). The CAT gene contains a H193Y mutation that renders the CAT gene nonfunctional against chloramphenicol selection. The ABE, sgRNA, and non-functional CAT gene were cloned into a pET-21 backbone containing Ampicillin resistance. E. Coli were left at 37 ºC for 40 hours. Colonies were sequenced by Elim Biopharmaceuticals, Inc. [00545] Results [00546] In order to determine whether the SMART II enzymes can be used as base editors, an adenine base editor (ABE) was constructed by fusing a TadA*-(7.10) monomer to the C-terminus of a nickase form of MG35-1 containing a D59A mutation (SEQ ID NO: 1424). The A to G editing of this ABE was tested in a positive selection single-plasmid E. Coli system in which the ABE is required to revert a chloramphenicol acetyltransferase (CAT) gene containing a Y193 mutation back to H193 in order for the E. Coli cell to survive chloramphenicol selection. This plasmid contained an sgRNA with a spacer either targeting the mutant CAT gene or a scrambled, non-targeting spacer region. An enrichment of colonies was detected with E. Coli transformed with the MG35-1 ABE targeting the CAT gene when plated on plates containing 2, 3, and 4 chloramphenicol. Sanger sequencing confirmed that 26/30 colonies picked from the 2, 3, and 4 reversion. It is likely that the 4 colonies without the reverted CAT sequence contain more unedited than edited copies of the selection construct as one reverted CAT gene is sufficient to E. Coli plate transformed with the targeting MG35-1 ABE contained the Y193H reversion, indicating a detectable level of editing even without chloramphenicol selection. The colony growth enrichment from chloramphenicol selection of the targeting MG35-1 ABE condition from the CAT gene Y193H reversion confirms that the MG35-1 nickase can function as an ABE in E. Coli cells (FIG.50). [00547] Example 40 – Guide screening for the nMG3-6/3-8 ABE in mouse hepatocytes [00548] Cell culture, transfections, next generation sequencing, and base edit analysis for screens [00549] Hepa1-6 cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus 1X NEAA (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) and 1% pen-strep at 37 ºC with 5% CO2.1 x 10 ⁵ cells were nucleofected with 500 ng IVT mRNA and 150 pmol chemically-synthesized sgRNA (IDT) using a Lonza-4D nucleofector (program EH-100). Cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions. Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers appropriate for use with NGS-based DNA sequencing (SEQ ID NOs: 1493-1554) and extracted DNA as the templates. PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. [00550] mRNA production [00551] Sequences for base editor mRNA were codon optimized for human expression (GeneArt), then synthesized and cloned into a high copy ampicillin plasmid (Twist Biosciences). Synthesized constructs encoding T7 promoter, UTRs, base editor ORF, and NLS sequences were digested from the Twist backbone with HindII and BamHI (NEB), and ligated into a pUC19 plasmid backbone (SEQ ID NO: 1555) with T4 DNA ligase and 1x reaction buffer (NEB). The complete base editor mRNA plasmid comprised an origin of replication, ampicillin resistance cassette, the synthesized construct, and an encoded polyA tail. Base editor mRNA was synthesized via in vitro transcription (IVT) using the linearized base editor mRNA plasmid. This plasmid was linearized by incubation at 37 °C for 16 hours with SapI (NEB) enzyme. The reaction buffer. The linearized plasmid was purified with Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v), precipitated in EtOH, and resuspended in nuclease-free water at an adjusted (NEB), and Nl-methyl pseudo-UTP (TriLink); 18750 U/mL Hi-T7 RNA Polymerase (NEB); 4 mM CleanCap AG (TriLink); 2.5 U/mL Inorganic E. coli pyrophosphatase (NEB); 1000 U/mL murine RNase Inhibitor (NEB); and 1x transcription buffer. After 1 hr, IVT was stopped, and plasmid DNA was digested with the addition of 250 U/mL DnaseI (NEB) and incubated for 10 min at 37 °C. Purification of base editor mRNA was performed using an Rneasy Maxi Kit (Qiagen) using the standard manufacturer’s protocol. Transcript concentration was determined by UV (NanoDrop) and further analyzed by capillary gel electrophoresis on a Fragment Analyzer (Agilent). [00552] Results [00553] To test the activity of the engineered dimeric form of the 3-68 ABE described above, 527 MG3-6/3-8 chemically-synthesized guides targeting four therapeutically relevant loci in the mouse genome were designed and purchased from IDT. These guides were co-transfected with in vitro synthesized mRNA in Hepa1-6 (a mouse immortalized mouse hepatocyte cell line) via nucleofection, and A to G conversion was assayed three days post-nucleofection. Guides were rank-ordered by percent total deamination within the spacer region, and deeper analysis of active guides was restricted to guides with >80% in-spacer deamination and with high number of NGS reads. Altogether, total spacer A to G deamination above 10% was observed at 31 distinct guides across three loci (SEQ ID NOs: 1431-1492; FIGs.51-53) with two guides showing conversion rates of 89% and 95% (Apoa1 D11 and Apoa1 F12, respectively). Table 13A: Guide sequences used in Example 40

r = native ribose base, m = 2’-O methyl modified base, F = 2’-fluoro modified base, * = phosphorothioate bond [00554] While the pattern of base conversion varied across spacers, detectable conversion was observed across an editing of A4 to A15. To assess background at these genomic regions, NGS primer pairs used for the experimental samples were used in mock nucleofected samples and showed low to undetectable background conversion (0-0.12%) (FIG.54). In summary, engineered dimeric 3-68 ABE exhibits high editing activity in mammalian cells at three independent loci and across a large panel of guides. [00555] Example 41 – mRNA cytidine base editors [00556] To test the activity of the engineered cytidine deaminases at scale, 527 chemically- synthesized guides suitable for use with MG3-6/3-8 to target four therapeutically relevant loci in the mouse genome were designed and purchased from IDT. These guides were co-transfected with in vitro synthesized mRNA in Hepa1-6 (a mouse immortalized mouse hepatocyte cell line) via nucleofection, and C to T conversion was assayed three days post-nucleofection. Prior to harvesting, individual wells were visually assessed for cell viability based on cell growth and presence of floating cells in media. The 3-68152-6 CBE did not show appreciable cytotoxicity compared to mock samples. [00557] Cell culture, transfections, next generation sequencing, and base edit analysis for screens (prophetic) [00558] Hepa1-6 cells are grown and passaged in Dulbecco’s Modified Eagle’s Medium plus 1X NEAA (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) and 1% pen-strep at 37 ºC with 5% CO ₂ .1 x 10 ⁵ cells are nucleofected with 500 ng IVT mRNA and 150 pmol chemically synthesized sgRNA (IDT) using a Lonza-4D nucleofector (program EH-100). Cells are grown for 3 days, visually assessed for viability, harvested, and gDNA is extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions. Targeted regions for base edits are amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers appropriate for use with NGS-based DNA sequencing and extracted DNA as the templates. PCR products are purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. Amplicons are sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing. [00559] Example 42 – Base editing preferences for nMG35-1 ABE [00560] As described in Example 39, E. coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT Y193) gene, and an sgRNA that either targets the CAT gene (targeting spacer) or not (scrambled spacer). Cell growth is dependent on the ABE base editing the non-functional CAT gene (A at position 17 from the TAM) (FIG.55A) to its wild-type variant (H193) and restoring activity. Multiple linkers were evaluated for nMG35-1 fusions to the TadA deaminase monomer (Table 14). Table 14: Linkers evaluated for nMG35-1 fusions with a TadA deaminase. [00561] Results [00562] Base editing was tested in an E. coli positive selection assay targeting the chloramphenicol acetyltransferase (CAT) gene that was expressed from the same plasmid co- expressing the MG35-1 ABE containing various linkers. The nMG35-1 ABE construct with the 17 amino acid linker (XTEN) outperformed other linkers in base editing experiments (FIG.55B- 55E). In addition, when analyzing the adenine positions across the targeting spacer that were edited by the nMG35-1 ABE, the A at the 9th position (in the middle of the spacer region) showed the highest editing levels in E. coli (FIG.55D). [00563] Example 43 – The nMG35-1 ABE edits additional target sites in E. coli [00564] E. coli positive selection [00565] As described in Example 39, a single plasmid construct encompassing a nickase MG35- 1 (D59A mutation), a C-terminally fused TadA*-(7.10) monomer, and a C-terminus SV40 NLS (SEQ ID NO: 369) was tested as a base editor with its compatible sgRNA containing a 20 bp spacer sequence targeting the chloramphenicol acetyltransferase (CAT) gene. A non-targeting sgRNA lacking a spacer sequence was used as negative control. The CAT gene contained either an engineered stop codon (at amino acid positions 98 or 122) or a H193Y mutation that renders the CAT gene nonfunctional (FIGs.56A and 56B). The ABE construct, sgRNA, and non- functional CAT gene were cloned into a pET-21 backbone containing Ampicillin resistance. Ten E. coli cells and containing transformed cells was plated onto plates containing chloramphenicol concentrations of mutations were verified in the resulting colonies by Sanger sequencing (Elim Biopharmaceuticals, Inc). [00566] Results [00567] The A to G editing of the nMG35-1 ABE was tested in a positive selection single- plasmid E. coli system in which the ABE is required to revert a chloramphenicol acetyltransferase (CAT) gene stop codon mutation back to glutamine or a tyrosine mutation back to histidine (FIGs.56A and 56B) in order for E. coli to survive growth under chloramphenicol selection. Four distinct non-functional CAT genes were tested for reversion by the nMG35-1 ABE: three single mutations (a stop codon at residue 98 reversion to Q; a stop codon at residue 122 reversion to Q; and Y at residue 193 reversion to H) and a double mutation in which a CAT gene contains two stop codons at both residues 98 and 122 (both need to be reverted to Q simultaneously to restore CAT gene functionality). These four conditions were tested alongside paired negative controls in which the non-functional CAT genes were co-expressed with sgRNAs missing a spacer sequence. The nMG35-1 ABE successfully edited the four conditions, including the double mutant reversion, as shown by an enrichment of E. coli colonies when grown on FIG.56C, “targeting” row). Few colonies stop codon mutations at residues 98 and 122 (FIG.56C, “targeting” row). Sanger sequencing of that 17 of 18 colonies showed the expected A to G edit at both target sites (FIG.56D). No E. coli transformed with the non- targeting guide (FIG.56C, “no spacer” row), confirming that the nMG35-1-ABE is a successful base editor in E. coli. [00568] When the predicted 3D structure of MG35-1 is aligned to the cryoEM structure of an IscB nuclease (PDB: 7UTN), the PLMP domain of IscB aligns with amino acid (AAs) positions 1-53 of MG35-1. A nickase nMG35-1 ABE with a deletion of AAs 1-53 was tested in the bacterial positive selection assay in which the ABE needs to revert a Y193 mutation to H within the CAT gene to restore CAT functionality (FIG.57). When these AAs were truncated from the nMG35-1 ABE, E. coli was unable to survive chloramphenicol selection at the minimum MG35-1 drive efficient base editing of the MG35-1 ABE in E. coli cells. [00569] Example 44 – Base editing in human cells with nMG35-1-ABE (prophetic) [00570] In order to demonstrate that an nMG35-1-ABE system is capable of base editing in human cells, a nickase MG35-1 (D59A mutation), a C-terminally fused TadA(8.8m) deaminase monomer, and a C-terminus SV40 NLS fusion system is constructed. HEK293T cells are grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 ºC with 5% CO2. About 2.5 x 10 ⁴ cells are seeded on 96-well cell culture plates treated for cell attachment (Costar), and grown for 20 to 24 h (spent media are refreshed with new media before transfection). Each plate well receives 300 according to the manufacturer’s instructions. Transfected cells are grown for three days, harvested, and genomic DNA is extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions. Targeted regions for base edits are amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with target-specific primers and PCR products purified with the HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. To analyze nMG35-1-ABE base editing in human cells, adapters used for next generation sequencing (NGS) are appended to PCR products by subsequent PCR reactions using the KAPA HiFi HotStart ReadyMix PCR Kit (Roche) and primers compatible with TruSeq DNA Library Prep Kits (Illumina). DNA concentrations of the resulting products are quantified by TapeStation (Agilent), and samples are pooled to prepare the library for NGS analysis. The resulting library is quantified by qPCR with the Aria Real-time PCR System (Agilent), and high throughput sequencing is performed with an Illumina Miseq instrument per manufacturer’s instructions. [00571] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the invention shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

EMBODIMENTS The following embodiments are not intended to be limiting in any way. Embodiment 1. An engineered nucleic acid editing system, comprising: (a) an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, wherein said endonuclease is configured to be deficient in nuclease activity; (b) a base editor coupled to said endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.a ribonucleic acid sequence configured to bind to said endonuclease. Embodiment 2. The engineered nucleic acid editing system of Embodiment 1, wherein said RuvC domain lacks nuclease activity. Embodiment 3. The engineered nucleic acid editing system of Embodiment 1, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. Embodiment 4. The engineered nucleic acid editing system of Embodiment 1 or Embodiment 2, wherein said class 2, type II endonuclease comprises a nickase mutation. Embodiment 5. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 4, wherein said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. Embodiment 6. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 5, wherein said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. Embodiment 7. The engineered nuclease system of any one of Embodiment 1-Embodiment 5, wherein said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned. Embodiment 8. An engineered nucleic acid editing system comprising: (a) an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs: 70-78, 596, or 597-598, or a variant thereof; (b) a base editor coupled to said endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.a ribonucleic acid sequence configured to bind to said endonuclease. Embodiment 9. An engineered nucleic acid editing system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, or a variant thereof, wherein said endonuclease is a class 2, type II endonuclease, and wherein said endonuclease is configured to be deficient in nuclease activity; (b) a base editor coupled to said endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.a ribonucleic acid sequence configured to bind to said endonuclease. Embodiment 10. The engineered nucleic acid editing system of Embodiment 9, wherein said endonuclease comprises a nickase mutation. Embodiment 11. The engineered nucleic acid editing system of Embodiment 9, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. Embodiment 12. The engineered nucleic acid editing system of Embodiment 9, wherein said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. Embodiment 13. The engineered nucleic acid editing system of Embodiment 9, wherein said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. Embodiment 14. The engineered nucleic acid editing system of Embodiment 9, wherein said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390. Embodiment 15. The engineered nucleic acid editing system of any one of Embodiment 8- Embodiment 14, wherein said endonuclease comprises a RuvC domain lacking nuclease activity. Embodiment 16. The engineered nucleic acid editing system of any one of Embodiment 8- Embodiment 15, wherein said endonuclease is derived from an uncultivated microorganism. Embodiment 17. The engineered nucleic acid editing system of any one of Embodiment 8- Embodiment 16, wherein said endonuclease has less than 80% identity to a Cas9 endonuclease. Embodiment 18. The engineered nucleic acid editing system of any one of Embodiment 8- Embodiment 17, wherein said endonuclease further comprises an HNH domain. Embodiment 19. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 18, wherein said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof. Embodiment 20. An engineered nucleic acid editing system comprising, (a) an engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to an endonuclease, wherein said engineered ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof; and (b) a class 2, type II endonuclease configured to bind to said engineered guide ribonucleic acid; and (c) a base editor coupled to said endonuclease. Embodiment 21. The engineered nucleic acid editing system of Embodiment 20, wherein said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598. Embodiment 22. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 21, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. Embodiment 23. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 22, wherein said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390. Embodiment 24. The engineered nucleic acid editing system of any of embodiments Embodiment 1-Embodiment 22, wherein said base editor is an adenine deaminase. Embodiment 25. The engineered nucleic acid editing system of Embodiment 23, wherein said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof. Embodiment 26. The engineered nucleic acid editing system of any of Embodiment 1- Embodiment 22, wherein said base editor is a cytosine deaminase. Embodiment 27. The engineered nucleic acid editing system of Embodiment 26, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, 594, 58-66, or 599-675, or a variant thereof. Embodiment 28. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 27, comprising a uracil DNA glycosylase inhibitor (UGI) coupled to said endonuclease or said base editor. Embodiment 29. The engineered nucleic acid editing system of Embodiment 28, wherein said uracil DNA glycosylase inhibitor (UGI) comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67. Embodiment 30. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 29, wherein said engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides. Embodiment 31. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 29, wherein said engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising said guide ribonucleic acid sequence and said ribonucleic acid sequence configured to bind to an endonuclease. Embodiment 32. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 31, wherein said guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. Embodiment 33. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 32, wherein said guide ribonucleic acid sequence is 15-24 nucleotides in length. Embodiment 34. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 33, further comprising one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. Embodiment 35. The engineered nucleic acid editing system of Embodiment 34, wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof. Embodiment 36. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 35, wherein said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker. Embodiment 37. The engineered nucleic acid editing system of Embodiment 36, wherein a polypeptide comprises said endonuclease and said base editor. Embodiment 38. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 37, wherein said endonuclease is configured to cleave one strand of a double- stranded target deoxyribonucleic acid. Embodiment 39. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 38, wherein said system further comprises a source of Mg ²⁺ . Embodiment 40. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 39, wherein: a) said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, 73, 74, 76, 78, 77, or 78, or a variant thereof; b) said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non-degenerate nucleotides of any one of SEQ ID NOs: 88, 89, 91, 92, 94, 96, 95, or 488; c) said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 361, 363, 365, 367, or 368; or d) said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NOs: 58 or 595, or a variant thereof. Embodiment 41. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 39, wherein: a) said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, or 78, or a variant thereof; b) said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non-degenerate nucleotides of at least one of SEQ ID NOs: 88, 89, or 96; c) said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 362, or 368; or d) said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 594, or a variant thereof. Embodiment 42. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 41, wherein said sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm. Embodiment 43. The engineered nucleic acid editing system of Embodiment 42, wherein said sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment. Embodiment 44. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 43, wherein said endonuclease is configured to be catalytically dead. Embodiment 45. A nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein said endonuclease is derived from an uncultivated microorganism. Embodiment 46. A nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes an endonuclease having at least 70% sequence identity to any one of SEQ ID NOs: 70-78 coupled to a base editor. Embodiment 47. The nucleic acid of any one of emboiments Embodiment 44-Embodiment 46, wherein said endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. Embodiment 48. The nucleic acid of Embodiment 47, wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof. Embodiment 49. The nucleic acid of any one of Embodiment 44-Embodiment 48, wherein said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human. Embodiment 50. A vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism. Embodiment 51. A vector comprising the nucleic acid of any of embodiments Embodiment 44- Embodiment 49. Embodiment 52. The vector of any of Embodiment 50-Embodiment 51, further comprising a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and b) a ribonucleic acid sequence configured to binding to said endonuclease. Embodiment 53. The vector of any of Embodiment 50-Embodiment 52, wherein the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus. Embodiment 54. A cell comprising the vector of any of Embodiment 50-Embodiment 53. Embodiment 55. A method of manufacturing an endonuclease, comprising cultivating said cell of Embodiment 54. Embodiment 56. A method for modifying a double-stranded deoxyribonucleic acid polynucleotide comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a) an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein said RuvC domain lacks nuclease activity; b) a base editor coupled to said endonuclease; and c) an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM). Embodiment 57. The method of Embodiment 56, wherein said endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker. Embodiment 58. The method of Embodiment 56 or Embodiment 57, wherein said endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. Embodiment 59. The method of any one of Embodiment 56-Embodiment 57, wherein said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73 or 78, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, residue 8 relative to SEQ ID NO: 77, or residue 10 relative to SEQ ID NO: 597 when optimally aligned. Embodiment 60. The method of any one of Embodiment 56-Embodiment 57, wherein said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned. Embodiment 61. A method for modifying a double-stranded deoxyribonucleic acid polynucleotide, comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to said endonuclease, and an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein said PAM comprises a sequence selected from the group consisting of SEQ ID NOs:70- 78 or 597. Embodiment 62. The method of Embodiment 61, wherein said class 2, type II endonuclease is covalently coupled to said base editor or coupled to said base editor through a linker. Embodiment 63. The method of Embodiment 61 or Embodiment 62, wherein said base editor comprises a sequence with at least 70%, at least 80%, at least 90% or at least 95% identity to a sequence selected from SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. Embodiment 64. The method of any one of Embodiment 61-Embodiment 63, wherein said base editor comprises an adenine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said adenine to guanine. Embodiment 65. The method of Embodiment 64, wherein said adenine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50- 51, 57, 385-443, 448-475, or 595, or a variant thereof. Embodiment 66. The method of any one of Embodiment 61-Embodiment 63, wherein said base editor comprises a cytosine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said cytosine to uracil. Embodiment 67. The method of Embodiment 66, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1- 49, 444-447, 594, 58-66, or 599-675, or a variant thereof. Embodiment 68. The method of any one of Embodiment 61-Embodiment 67, wherein said complex further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor. Embodiment 69. The method of Embodiment 68, wherein said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. Embodiment 70. The method of any one of Embodiment 61-Embodiment 69, wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of said engineered guide ribonucleic acid structure and a second strand comprising said PAM. Embodiment 71. The method of Embodiment 70, wherein said PAM is directly adjacent to the 3' end of said sequence complementary to said sequence of said engineered guide ribonucleic acid structure. Embodiment 72. The method of any one of Embodiment 61-Embodiment 71, wherein said class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease. Embodiment 73. The method of any one of Embodiment 61-Embodiment 72, wherein said class 2, type II endonuclease is derived from an uncultivated microorganism. Embodiment 74. The method of any one of Embodiment 61-Embodiment 73, wherein said double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. Embodiment 75. A method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus said engineered nucleic acid editing system of any one of embodiments 1-Embodiment 44, wherein said endonuclease is configured to form a complex with said engineered guide ribonucleic acid structure, and wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus. Embodiment 76. The method of Embodiment 75, wherein said engineered nucleic acid editing system comprises an adenine deaminase, said nucleotide is an adenine, and modifying said target nucleic acid locus comprises converting said adenine to a guanine. Embodiment 77. The method of Embodiment 75, wherein said engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, said nucleotide is a cytosine and modifying said target nucleic acid locus comprises converting said adenine to a uracil. Embodiment 78. The method of any one of Embodiment 75-Embodiment 77, wherein said target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA. Embodiment 79. The method of any one of Embodiment 75-Embodiment 78, wherein said target nucleic acid locus is in vitro. Embodiment 80. The method of any one of Embodiment 75-Embodiment 78, wherein said target nucleic acid locus is within a cell. Embodiment 81. The method of Embodiment 80, wherein said cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. Embodiment 82. The method of any one of Embodiment 80-Embodiment 81, wherein said cell is within an animal. Embodiment 83. The method of Embodiment 82, wherein said cell is within a cochlea. Embodiment 84. The method of any one of Embodiment 80-Embodiment 81, wherein said cell is within an embryo. Embodiment 85. The method of Embodiment 84, wherein said embryo is a two-cell embryo. Embodiment 86. The method of Embodiment 84, wherein said embryo is a mouse embryo. Embodiment 87. The method of any one of Embodiment 75-Embodiment 86, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering the nucleic acid of any of embodiments Embodiment 46-Embodiment 49 or the vector of any of embodiments Embodiment 50-Embodiment 53. Embodiment 88. The method of any one of Embodiment 75-Embodiment 87, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding said endonuclease. Embodiment 89. The method of Embodiment 88, wherein said nucleic acid comprises a promoter to which said open reading frame encoding said endonuclease is operably linked. Embodiment 90. The method of any one of Embodiment 75-Embodiment 89, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA comprising said open reading frame encoding said endonuclease. Embodiment 91. The method of any one of Embodiment 75-Embodiment 86, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a polypeptide. Embodiment 92. The method of any one of Embodiment 75-Embodiment 86, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding said engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter. Embodiment 93. An engineered nucleic acid editing polypeptide, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein said RuvC domain lacks nuclease activity; and a base editor coupled to said endonuclease. Embodiment 94. The engineered nucleic acid editing polypeptide of Embodiment 93, wherein said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. Embodiment 95. An engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein said endonuclease comprises a RuvC domain lacking nuclease activity; and a base editor coupled to said endonuclease. Embodiment 96. An engineered nucleic acid editing polypeptide, comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein said endonuclease is a class 2, type II endonuclease, and wherein said endonuclease comprises a RuvC domain lacks nuclease activity; and a base editor coupled to said endonuclease. Embodiment 97. The engineered nucleic acid editing polypeptide of Embodiment 95 or Embodiment 96, wherein said endonuclease is derived from an uncultivated microorganism. Embodiment 98. The engineered nucleic acid editing polypeptide of any one of Embodiment 93- Embodiment 97, wherein said endonuclease has less than 80% identity to a Cas9 endonuclease. Embodiment 99. The engineered nucleic acid editing polypeptide of any one of Embodiment 95- Embodiment 98, wherein said endonuclease further comprises an HNH domain. Embodiment 100. The engineered nucleic acid editing polypeptide of any one of Embodiment 95-Embodiment 99, wherein said tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680. Embodiment 101. The engineered nucleic acid editing polypeptide of any one of Embodiment 93-Embodiment 100, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. Embodiment 102. The engineered nucleic acid editing polypeptide of any one of Embodiment 93-Embodiment 101, wherein said base editor is an adenine deaminase. Embodiment 103. The engineered nucleic acid editing polypeptide of Embodiment 102, wherein said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof. Embodiment 104. The engineered nucleic acid editing polypeptide of any one of Embodiment 93-Embodiment 101, wherein said base editor is a cytosine deaminase. Embodiment 105. The engineered nucleic acid editing polypeptide of Embodiment 104, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof. Embodiment 106. An engineered nucleic acid editing polypeptide, comprising: an endonuclease, wherein said endonuclease is configured to be deficient in endonuclease activity; and a base editor coupled to said endonuclease, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447, 488-475, 595, or 599-675, or a variant thereof. Embodiment 107. The engineered nucleic acid editing polypeptide of Embodiment 106, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. Embodiment 108. The engineered nucleic acid editing polypeptide of Embodiment 106, wherein said endonuclease is configured to be catalytically dead. Embodiment 109. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 108, wherein said endonuclease is an endonuclease. Embodiment 110. The engineered nucleic acid editing polypeptide of Embodiment 109, wherein said endonuclease is a Class II, type II endonuclease or a Class II, type V endonuclease. Embodiment 111. The engineered nucleic acid editing polypeptide of Embodiment 106, wherein said endonuclease comprises a sequence having at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. Embodiment 112. The engineered nucleic acid editing polypeptide of any one of Embodiment 109-Embodiment 111, wherein said endonuclease comprises a nickase mutation. Embodiment 113. The engineered nucleic acid editing polypeptide of Embodiment 112, wherein said endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597. Embodiment 114. The engineered nucleic acid editing polypeptide of any one of Embodiment 109-Embodiment 113 wherein said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598. Embodiment 115. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 114, wherein said base editor is an adenine deaminase. Embodiment 116. The engineered nucleic acid editing polypeptide of Embodiment 115, wherein said adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 50- 51, 385-443, 448-475, or 595, or a variant thereof. Embodiment 117. The engineered nucleic acid editing polypeptide of Embodiment 116, wherein said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 385-390, or 595, or a variant thereof. Embodiment 118. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 114, wherein said base editor is a cytosine deaminase. Embodiment 119. The engineered nucleic acid editing polypeptide of Embodiment 118, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, or a variant thereof. Embodiment 120. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 119, further comprising a uracil DNA glycosylase inhibitor (UGI) coupled to said endonuclease or said base editor. Embodiment 121. The engineered nucleic acid editing polypeptide of Embodiment 120, wherein said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof. Embodiment 122. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 121, wherein a polypeptide comprising said endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. Embodiment 123. The engineered nucleic acid editing polypeptide of Embodiment 122, wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369- 384, or a variant thereof. Embodiment 124. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 123, wherein said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker. Embodiment 125. A nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447, 488-475, or 595, or a variant thereof. Embodiment 126. The nucleic acid of Embodiment 125, wherein said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human. Embodiment 127. A vector comprising the nucleic acid of any of Embodiment 125-Embodiment 126. Embodiment 128. The vector of Embodiment 127, wherein the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus. Embodiment 129. A cell comprising the vector of any one of Embodiment 127-Embodiment 128. Embodiment 130. A method of manufacturing a base editor, comprising cultivating said cell of Embodiment 129. Embodiment 131. A system comprising: (a) the nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 124; and (b) an engineered guide ribonucleic acid structure configured to form a complex with said nucleic acid editing polypeptide comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.ribonucleic acid sequence configured to bind to said endonuclease. Embodiment 132. The system of Embodiment 131, wherein said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680. Embodiment 133. A method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus said engineered nucleic acid editing polypeptide of any one of embodiments Embodiment 106-Embodiment 124 or said system of any one of embodiments Embodiment 131-Embodiment 132, wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus. Embodiment 134. A nucleic acid editing polypeptide, comprising: an adenosine deaminase, comprising a polypeptide sequence comprising a substitution at at least one residue selected from the group consisting of residue 24, residue 83, residue 85, residue 107, residue 109, residue 112, residue 124, residue 143, residue 147, residue 148, residue 154, or residue 158 relative to SEQ ID NO: 386 when optimally aligned. Embodiment 135. The nucleic acid editing polypeptide of Embodiment 134, wherein said residue substituted is selected from W24, V83, L85, A107, D109, T112, H124, A143, S147, D148, R154, and K158. Embodiment 136. The nucleic acid editing polypeptide of Embodiment 134 or Embodiment 135, wherein said substitution is a conservative substitution. Embodiment 137. The nucleic acid editing polypeptide of Embodiment 134 or Embodiment 135, wherein said substitution is a non-conservative substitution. Embodiment 138. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 137, comprising a substitution at W24, wherein said substitution is W24R. Embodiment 139. The nucleic acid editing polypeptide of any one of Embodiment 134 - Embodiment 138, comprising a substitution at V83, wherein said substitution is V83S. Embodiment 140. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 139, comprising a substitution at L85, wherein said substitution is L85F. Embodiment 141. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 140, comprising a substitution at A107, wherein said substitution is A107V. Embodiment 142. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 141, comprising a substitution at D109, wherein said substitution is D109N. Embodiment 143. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 142, comprising a substitution at T112, wherein said substitution is T112R. Embodiment 144. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 143, comprising a substitution at H124, wherein said substitution is H124Y. Embodiment 145. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 144, comprising a substitution at A143, wherein said substitution is A143N. Embodiment 146. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 145, comprising a substitution at S147, wherein said substitution is S147C. Embodiment 147. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 146, comprising a substitution at D148, wherein said substitution is D148Y or D148R. Embodiment 148. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 147, comprising a substitution at R154, wherein said substitution is R154P. Embodiment 149. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 148, comprising a substitution at K158, wherein said substitution is K158N. Embodiment 150. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 149, wherein said adenosine deaminase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any one of SEQ ID NOs: 50-51 or 385-443. Embodiment 151. The engineered nucleic acid editing polypeptide of any one of Embodiment 134-Embodiment 150, further comprising an endonuclease, wherein said endonuclease is configured to be deficient in endonuclease activity. Embodiment 152. The engineered nucleic acid editing polypeptide of Embodiment 151, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. Embodiment 153. The engineered nucleic acid editing polypeptide of Embodiment 151, wherein said endonuclease is configured to be catalytically dead. Embodiment 154. The engineered nucleic acid editing polypeptide of any one of Embodiment 151-Embodiment 153, wherein said endonuclease is a Cas endonuclease. Embodiment 155. The engineered nucleic acid editing polypeptide of Embodiment 154, wherein said endonuclease is a Class II, type II endonuclease or a Class II, type V endonuclease. Embodiment 156. The engineered nucleic acid editing polypeptide of Embodiment 155, wherein said endonuclease comprises a sequence having at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof. Embodiment 157. The engineered nucleic acid editing polypeptide of any one of Embodiment 151-Embodiment 156, wherein said endonuclease comprises a nickase mutation. Embodiment 158. The engineered nucleic acid editing polypeptide of Embodiment 157, wherein said endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597. Embodiment 159. The engineered nucleic acid editing polypeptide of any one of Embodiment 151-Embodiment 156, wherein said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598.