VEACH DARREN (US)
CHEAL SARAH (US)
OUERFELLI OUATHEK (US)
YANG GUANGBIN (US)
KREBS SIMONE (US)
DACEK MEGAN (US)
SCHEINBERG DAVID (US)
CHEUNG NAI-KONG (US)
SANTICH BRIAN (US)
WO2018200562A1 | 2018-11-01 | |||
WO2019177970A1 | 2019-09-19 | |||
WO2019209991A1 | 2019-10-31 | |||
WO2020219715A1 | 2020-10-29 |
US20190038671A1 | 2019-02-07 | |||
US20200140543A1 | 2020-05-07 |
CLAIMS 1. An engineered immune cell comprising: (a) an anti-DOTA C825 antigen binding fragment comprising the amino acid sequence of any one of SEQ ID NOs: 35-39, 41 or 42, and/or a nucleic acid encoding the anti-DOTA C825 antigen binding fragment; and (b) a receptor that binds to a target antigen and/or a nucleic acid encoding the receptor. 2. The engineered immune cell of claim 1, wherein the receptor is a T cell receptor. 3. The engineered immune cell of claim 1 or 2, wherein the receptor is a native cell receptor. 4. The engineered immune cell of claim 1 or 2, wherein the receptor is a non-native cell receptor. 5. The engineered immune cell of any one of claims 1-4, wherein the receptor is a chimeric antigen receptor. 6. The engineered immune cell of claim 5, wherein the nucleic acid encoding the anti- DOTA C825 antigen binding fragment comprises a leader sequence for secretion of the anti- DOTA C825 antigen binding fragment. 7. The engineered immune cell of any one of claims 1-6, wherein the nucleic acid encoding the anti-DOTA C825 antigen binding fragment is operably linked to a promoter. 8. The engineered immune cell of claim 7, wherein the promoter is a constitutive promoter. 9. The engineered immune cell of claim 7, wherein the promoter is a conditional promoter. 10. The engineered immune cell of claim 9, wherein the conditional promoter is induced by binding of the receptor to the target antigen. 11. The engineered immune cell of any one of claims 1-10, wherein the target antigen is a tumor antigen. 12. The engineered immune cell of any one of claims 1-11, wherein the nucleic acid encoding the receptor is operably linked to a constitutive promoter. 13. The engineered immune cell of any one of claims 5-12, wherein the chimeric antigen receptor comprises (i) an extracellular antigen binding domain; (ii) a transmembrane domain; and (iii) an intracellular domain. 14. The engineered immune cell of claim 13, wherein the extracellular antigen binding domain binds to the target antigen. 15. The engineered immune cell of any one of claims 11-14, wherein the tumor antigen is selected from the group consisting of 5T4, alpha 5β1-integrin, 707-AP, A33, AFP, ART-4, B7H4, BAGE, Bcl-2, β-catenin, BCMA, Bcr-abl, MN/C IX antibody, CA125, CA19-9, CAMEL, CAP-1, CASP-8, CD4, CD5, CD19, CD20, CD21 , CD22, CD25, CDC27/m, CD33, CD37, CD45, CD52, CD56, CD80, CD123, CDK4/m, CEA, c-Met, CS-1, CT, Cyp-B, cyclin B1, DAGE, DAM, EBNA, EGFR, ErbB3, ELF2M, EMMPRIN, EpCam, ephrinB2, estrogen receptor, ETV6-AML1, FAP, ferritin, folate-binding protein, GAGE, G250, GD-2, GM2, GnT-V, gp75, gp100 (Pmel 17), HAGE, HER-2/neu, HLA-A*0201-R170I, HPV E6, HPV E7, Ki-67, HSP70-2M, HST-2, hTERT (or hTRT), iCE, IGF-1R, IL-2R, IL-5, KIAA0205, LAGE, LDLR/FUT, LRP, MAGE, MART, MART-1/melan-A, MART-2/Ski, MC1R, mesothelin, MUC, MUC16, MUM-1 -B, myc, MUM-2, MUM-3, NA88-A, NYESO- 1, NY-Eso-B, p53, proteinase-3, p190 minor bcr-abl, Pml/RARα, PRAME, progesterone receptor, PSA, PSCA, PSM, PSMA, ras, RAGE, RU1 or RU2, RORI, SART-1 or SART-3, survivin, TEL/AML1, TGFβ, TPI/m, TRP-1, TRP-2, TRP-2/INT2, tenascin, TSTA tyrosinase, VEGF, and WT1. 16. The engineered immune cell of any one of claims 13-15, wherein the extracellular antigen binding domain comprises a single chain variable fragment (scFv). 17. The engineered immune cell of any one of claims 13-16, wherein the extracellular antigen binding domain comprises a human scFv. 18. The engineered immune cell of any one of claims 13-17, wherein the extracellular antigen binding domain comprises a CD19 scFv of SEQ ID NO: 3 or SEQ ID NO: 4. 19. The engineered immune cell of any one of claims 13-18, wherein the extracellular antigen binding domain comprises a CD19 scFv having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4. 20. The engineered immune cell of any one of claims 13-19, wherein the extracellular antigen binding domain comprises a signal peptide that is covalently joined to the N-terminus of the extracellular antigen binding domain. 21. The engineered immune cell of any one of claims 13-20, wherein the transmembrane domain comprises a CD8 transmembrane domain. 22. The engineered immune cell of any one of claims 13-21, wherein the intracellular domain comprises one or more costimulatory domains. 23. The engineered immune cell of claim 22, wherein the one or more costimulatory domains are selected from a CD28 costimulatory domain, a CD3ζ-chain, a 4-1BBL costimulatory domain, or any combination thereof. 24. The engineered immune cell of any one of claims 1-23, wherein the engineered immune cell is a lymphocyte. 25. The engineered immune cell of claim 24, wherein the lymphocyte is a T cell, a B cell, or a natural killer (NK) cell. 26. The engineered immune cell of claim 25, wherein the T cell is a CD4+ T cell or a CD8+ T cell. 27. The engineered immune cell of any one of claims 1-26, wherein the engineered immune cell is a tumor infiltrating lymphocyte. 28. The engineered immune cell of any one of claims 1-27, wherein the engineered immune cell is derived from an autologous donor or an allogenic donor. 29. A polypeptide comprising a chimeric antigen receptor and an anti-DOTA C825 antigen binding fragment comprising an amino acid sequence of any one of SEQ ID NOs: 35- 39, 41 or 42. 30. The polypeptide of claim 29, further comprising a self-cleaving peptide located between the anti-DOTA C825 antigen binding fragment and the chimeric antigen receptor. 31. The polypeptide of claim 30, wherein the self-cleaving peptide is a P2A self-cleaving peptide. 32. The polypeptide of any one of claims 29-31, wherein the anti-DOTA C825 antigen binding fragment comprises a leader sequence for secretion of the anti-DOTA C825 antigen binding fragment. 33. The polypeptide of any one of claims 29-32, wherein the chimeric antigen receptor comprises (i) an extracellular antigen binding domain; (ii) a transmembrane domain; and (iii) an intracellular domain. 34. The polypeptide of claim 33, wherein the extracellular antigen binding domain binds to a tumor antigen. 35. The polypeptide of claim 34, wherein the tumor antigen is selected from among MUC16, mesothelin, CD19, WT1, PSCA, and BCMA. 36. The polypeptide of any one of claims 33-35, wherein the extracellular antigen binding domain comprises a single chain variable fragment (scFv). 37. The polypeptide of any one of claims 33-36, wherein the extracellular antigen binding domain comprises a CD19 scFv of SEQ ID NO: 3 or SEQ ID NO: 4. 38. The polypeptide of any one of claims 33-37, wherein the extracellular antigen binding domain comprises a CD19 scFv having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4. 39. The polypeptide of any one of claims 33-38, wherein the transmembrane domain comprises a CD8 transmembrane domain. 40. The polypeptide of any one of claims 33-39, wherein the intracellular domain comprises one or more costimulatory domains. 41. The polypeptide of claim 40, wherein the one or more costimulatory domains are selected from a CD28 costimulatory domain, a CD3ζ-chain, a 4-1BBL costimulatory domain, or any combination thereof. 42. A nucleic acid encoding the polypeptide of any one of claims 29-41. 43. The nucleic acid of claim 42, wherein the nucleic acid encoding the polypeptide is operably linked to a promoter. 44. The nucleic acid of claim 43, wherein the promoter is a constitutive promoter. 45. The nucleic acid of claim 43, wherein the promoter is a conditional promoter. 46. The nucleic acid of claim 45, wherein the conditional promoter is inducible by the chimeric antigen receptor binding to an antigen. 47. A vector comprising the nucleic acid of any one of claims 42-46. 48. The vector of claim 47, wherein the vector is a viral vector or a plasmid. 49. The vector of claim 47, wherein the vector is a retroviral vector. 50. A host cell comprising the nucleic acid of any one of claims 42-46 or the vector of any one of claims 47-49. 51. A complex comprising the engineered immune cell of any one of claims 1-28 and a DOTA hapten, wherein the engineered immune cell is configured to bind to the DOTA hapten and a tumor antigen. 52. The complex of claim 51, wherein the DOTA hapten is benzyl-DOTA, NH2-benzyl (Bn) DOTA, DOTA-desferrioxamine, DOTA-Phe-Lys(HSG)-D-Tyr-Lys(HSG)-NH2, Ac- Lys(HSG)D-Tyr-Lys(HSG)-Lys(Tscg-Cys)-NH2, DOTA-D-Asp-D-Lys(HSG)-D-Asp-D- Lys(HSG)-NH2; DOTA-D-Glu-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, DOTA-D-Tyr-D- Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, DOTA-D-Ala-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, DOTA-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-NH2, Ac-D-Phe-D-Lys(DOTA)-D-Tyr-D- Lys(DOTA)-NH2, Ac-D-Phe-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)-NH2, Ac-D-Phe-D- Lys(Bz-DTPA)-D-Tyr-D-Lys(Bz-DTPA)-NH2, Ac-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D- Lys(Tscg-Cys)-NH2, DOTA-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D-Lys(Tscg-Cys)- NH2, (Tscg-Cys)-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D-Lys(DOTA)-NH2, Tscg-D- Cys-D-Glu-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, (Tscg-Cys)-D-Glu-D-Lys(HSG)-D-Glu- D-Lys(HSG)-NH2, Ac-D-Cys-D-Lys(DOTA)-D-Tyr-D-Ala-D-Lys(DOTA)-D-Cys-NH2, Ac-D-Cys-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)-NH2, Ac-D-Lys(DTPA)-D-Tyr-D- Lys(DTPA)-D-Lys(Tscg-Cys)-NH2, Ac-D-Lys(DOTA)-D-Tyr-D-Lys(DOTA)-D-Lys(Tscg- Cys)-NH2, DOTA-RGD, DOTA-PEG-E(c(RGDyK))2, DOTA-8-AOC-BBN, DOTA-PESIN, p-NO2-benzyl-DOTA, DOTA-biotin-sarcosine (DOTA-biotin), 1,4,7,10- tetraazacyclododecane-1,4,7,10-tetraacetic acid mono (N-hydroxysuccinimide ester) (DOTA- NHS), or DOTATyrLysDOTA. 53. The complex of claim 51, wherein the DOTA hapten has the structure of Formula II or a pharmaceutically acceptable salt thereof, wherein M1 is 175Lu3+, 45Sc3+, 69Ga3+, 71Ga3+, 89Y3+, 113In3+, 115In3+, 139La3+, 136Ce3+, 138Ce3+, 140Ce3+, 142Ce3+, 151Eu3+, 153Eu3+, 159Tb3+, 154Gd3+, 155Gd3+, 156Gd3+, 157Gd3+, 158Gd3+, or 160Gd3+; M2 is a radionuclide cation; X1, X2, X3, and X4 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; X5, X6, and X7 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; and n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22. 54. The complex of any one of claims 51-53, wherein M2 is 111In, 67Ga, 51Cr, 58Co, 99mTc, 103mRh, 195mPt, 119Sb, 161Ho, 189mOs, 192Ir, 201Tl, 203Pb, 89Zr, 68Ga, or 64Cu. 55. A method for detecting tumors in a subject in need thereof comprising (a) administering to the subject an effective amount of the complex of claim 54, wherein the complex is configured to localize to a tumor expressing the tumor antigen recognized by the engineered immune cell of the complex; and (b) detecting the presence of tumors in the subject by detecting radioactive levels emitted by the complex that are higher than a reference value. 56. A method for detecting tumors in a subject in need thereof comprising (a) administering to the subject an effective amount of the engineered immune cell of any one of claims 11-28, wherein the engineered immune cell is configured to localize to a tumor expressing the tumor antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; and (c) detecting the presence of tumors in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. 57. The method of claim 55 or 56, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected using positron emission tomography or single photon emission computed tomography. 58. The method of any one of claims 55-57, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected between 4 to 24 hours after the complex or the radiolabeled-DOTA hapten is administered. 59. The method of any one of claims 55-58, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are expressed as the percentage injected dose per gram tissue ( %ID/g). 60. The method of any one of claims 55-59, wherein the ratio of radioactive levels between a tumor and normal tissue is about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1 or 100:1. 61. The method of any one of claims 55-60, wherein the subject is diagnosed with, or is suspected of having cancer. 62. The method of claim 61, wherein the cancer is selected from the group consisting of adrenal cancers, bladder cancers, blood cancers, bone cancers, brain cancers, breast cancers, carcinoma, cervical cancers, colon cancers, colorectal cancers, corpus uterine cancers, ear, nose and throat (ENT) cancers, endometrial cancers, esophageal cancers, gastrointestinal cancers, head and neck cancers, Hodgkin's disease, intestinal cancers, kidney cancers, larynx cancers, leukemias, liver cancers, lymph node cancers, lymphomas, lung cancers, melanomas, mesothelioma, myelomas, nasopharynx cancers, neuroblastomas, non-Hodgkin's lymphoma, oral cancers, ovarian cancers, pancreatic cancers, penile cancers, pharynx cancers, prostate cancers, rectal cancers, sarcoma, seminomas, skin cancers, stomach cancers, teratomas, testicular cancers, thyroid cancers, uterine cancers, vaginal cancers, vascular tumors, and metastases thereof. 63. The method of any one of claims 55-62, wherein the complex, the engineered immune cell, or the radiolabeled-DOTA hapten is administered intravenously, intratumorally, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously, intracerebroventricularly, orally or intranasally. 64. The method of any one of claims 55-63, wherein the complex, the engineered immune cell, or the radiolabeled-DOTA hapten is administered into the cerebral spinal fluid or blood of the subject. 65. A method for monitoring biodistribution of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of the engineered immune cell of any one of claims 1-28, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; and (c) determining the biodistribution of engineered immune cells in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. 66. A method for monitoring biodistribution of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of a complex comprising the engineered immune cell of any one of claims 1-28 and a radiolabeled DOTA hapten, wherein the complex is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; and (b) determining the biodistribution of engineered immune cells in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. 67. A method for monitoring viability of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of the engineered immune cell of any one of claims 1-28, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (d) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (e) determining that the engineered immune cells in the subject are viable when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are comparable to that observed at the first time point. 68. The method of claim 67, further comprising administering to the subject a second effective amount of the radiolabeled-DOTA hapten prior to step (d). 69. A method for monitoring viability of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of a complex comprising the engineered immune cell of any one of claims 1-28 and a radiolabeled DOTA hapten, wherein the complex is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (d) determining that the engineered immune cells in the subject are viable when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are comparable to that observed at the first time point. 70. A method for monitoring expansion of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of the engineered immune cell of any one of claims 1-28, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject a first effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (d) administering to the subject a second effective amount of the radiolabeled-DOTA hapten after step (c); (e) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (f) determining that the engineered immune cells in the subject have expanded when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are higher relative to that observed at the first time point. 71. The method of any one of claims 65-70, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected using positron emission tomography or single photon emission computed tomography. 72. The method of any one of claims 65-71, wherein the engineered immune cell, the radiolabeled-DOTA hapten, or the complex is administered intravenously, intraperitoneally, subcutaneously, intramuscularly, or intratumorally. 73. The method of any one of claims 65-72, wherein the cancer is a carcinoma, a sarcoma, a melanoma, or a hematopoietic cancer. 74. The method of any one of claims 65-73, wherein the cancer is selected from among adrenal cancers, bladder cancers, blood cancers, bone cancers, brain cancers, breast cancers, carcinoma, cervical cancers, colon cancers, colorectal cancers, corpus uterine cancers, ear, nose and throat (ENT) cancers, endometrial cancers, esophageal cancers, gastrointestinal cancers, head and neck cancers, Hodgkin's disease, intestinal cancers, kidney cancers, larynx cancers, leukemias, liver cancers, lymph node cancers, lymphomas, lung cancers, melanomas, mesothelioma, myelomas, nasopharynx cancers, neuroblastomas, non-Hodgkin's lymphoma, oral cancers, ovarian cancers, pancreatic cancers, penile cancers, pharynx cancers, prostate cancers, rectal cancers, sarcoma, seminomas, skin cancers, stomach cancers, teratomas, testicular cancers, thyroid cancers, uterine cancers, vaginal cancers, vascular tumors, and metastases thereof. 75. A kit comprising the engineered immune cell of any one of claims 1-28, and instructions for diagnosing or monitoring the progression of cancer. |
*(G4S)3 linker sequence is shown in boldface [00107] In some embodiments, the anti-DOTA C825 antigen binding fragment is an scFv, a Fab, or a (Fab) 2 . [00108] Exemplary constructs of the present technology include double transduction constructs such as those described in Fig.3A. The amino acid sequences of the constructs described in Fig.3A are shown below: [00109] C825-hinge-GFP ) * The V H and V L sequences of the C825 scFv are underlined, (G4S)3 linker sequence is italicized, and transmembrane domain is in boldface. [00110] 19BBz CAR
* The V H and V L sequences of the CD19 scFv are underlined, (G4S)3 linker sequence is italicized, and the transmembrane domain is in boldface, 41BB is italicized and underlined, and CD3ζ polypeptide is underlined and in boldface. [00111] Other exemplary constructs of the present technology include those described in Figs.3B-3C. The amino acid sequences of the constructs described in Figs.3B-3C are shown below:
* The V H and V L sequences of the C825 scFv and CD19 scFv are underlined, (G4S)3 linker sequence is italicized, the transmembrane domains are in boldface, 41BB is italicized and underlined, and CD3ζ polypeptide is underlined and in boldface. Targeting Ligands and Target Antigens [00112] In some embodiments, the engineered immune cells provided herein express a T- cell receptor (TCR) or other cell-surface ligand that binds to a target antigen, such as a tumor antigen. The cell-surface ligand can be any molecule that directs an immune cell to a target site (e.g., a tumor site). Exemplary cell surface ligands include, for example endogenous receptors, engineered receptors, or other specific ligands to achieve targeting of the immune cell to a target site. In some embodiments, the receptor is a T cell receptor. In some embodiments, the T cell receptor is a wild-type, or native, T-cell receptor that binds to a target antigen. In some embodiments, the receptor, e.g., a T cell receptor, is non-native receptor (e.g., not endogenous to the immune cells). In some embodiments, the receptor is a chimeric antigen receptor (CAR), for example, a T cell CAR, that binds to a target antigen. [00113] In some embodiments, the target antigen expressed by a tumor cell. In some embodiments, the target antigen is expressed on the surface of a tumor cell. In some embodiments, the target antigen is a cell surface receptor. In some embodiments, the target antigen is a cell surface glycoprotein. In some embodiments, the target antigen is secreted by a tumor cell. In some embodiments, the target antigen is localized to the tumor microenvironment. In some embodiments, the target antigen is localized to the extracellular matrix or stroma of the tumor microenvironment. In some embodiments, the target antigen is expressed by one or more cells located within the extracellular matrix or stroma of the tumor microenvironment. [00114] In some embodiments, the target antigen is a tumor antigen selected from among 5T4, alpha 5β1-integrin, 707-AP, A33, AFP, ART-4, B7H4, BAGE, Bcl-2, β-catenin, BCMA, Bcr-abl, MN/C IX antibody, CA125, CA19-9, CAMEL, CAP-1, CASP-8, CD4, CD5, CD19, CD20, CD21 , CD22, CD25, CDC27/m, CD33, CD37, CD45, CD52, CD56, CD80, CD123, CDK4/m, CEA, c-Met, CS-1, CT, Cyp-B, cyclin B1, DAGE, DAM, EBNA, EGFR, ErbB3, ELF2M, EMMPRIN, EpCam, ephrinB2, estrogen receptor, ETV6-AML1, FAP, ferritin, folate-binding protein, GAGE, G250, GD-2, GM2, GnT-V, gp75, gp100 (Pmel 17), HAGE, HER-2/neu, HLA-A*0201-R170I, HPV E6, HPV E7, Ki-67, HSP70-2M, HST- 2, hTERT (or hTRT), iCE, IGF-1R, IL-2R, IL-5, KIAA0205, LAGE, LDLR/FUT, LRP, MAGE, MART, MART-1/melan-A, MART-2/Ski, MC1R, mesothelin, MUC, MUC16, MUM-1 -B, myc, MUM-2, MUM-3, NA88-A, NYESO-1, NY-Eso-B, p53, proteinase-3, p190 minor bcr-abl, Pml/RARα, PRAME, progesterone receptor, PSA, PSCA, PSM, PSMA, ras, RAGE, RU1 or RU2, RORI, SART-1 or SART-3, survivin, TEL/AML1, TGFβ, TPI/m, TRP-1, TRP-2, TRP-2/INT2, tenascin, TSTA tyrosinase, VEGF, and WT1. In certain embodiments, the target antigen is a tumor antigen selected from among BCMA, CD19, mesothelin, MUC16, PSCA, WT1, and PRAME. [00115] In some embodiments, target antigen is a tumor antigen presented in the context of an MHC molecule. In some embodiments, the MHC protein is a MHC class I protein. In some embodiments, the MHC Class I protein is an HLA-A, HLA-B, or HLA-C molecules. In some embodiments, target antigen is a tumor antigen presented in the context of an HLA- A2 molecule. IgG1, afucosylated Fc forms, bispecific, BiTE, and CAR T cell formats or portions thereof can be employed as described herein for the recognition of target antigens present on the surface of a target cell (e.g., a tumor cell) in the context of an MHC molecule. Chimeric Antigen Receptors [00116] In some embodiments, the engineered immune cells provided herein express at least one chimeric antigen receptor (CAR). CARs are engineered receptors, which graft or confer a specificity of interest onto an immune effector cell. For example, CARs can be used to graft the specificity of a monoclonal antibody onto an immune cell, such as a T cell. In some embodiments, transfer of the coding sequence of the CAR is facilitated by nucleic acid vector, such as a retroviral vector. [00117] There are currently three generations of CARs. In some embodiments, the engineered immune cells provided herein express a “first generation” CAR. “First generation” CARs are typically composed of an extracellular antigen binding domain (e.g., a single-chain variable fragment (scFv)) fused to a transmembrane domain fused to cytoplasmic/intracellular domain of the T cell receptor (TCR) chain. “First generation” CARs typically have the intracellular domain from the CD3ζ chain, which is the primary transmitter of signals from endogenous TCRs. “First generation” CARs can provide de novo antigen recognition and cause activation of both CD4 + and CD8 + T cells through their CD3ζ chain signaling domain in a single fusion molecule, independent of HLA-mediated antigen presentation. [00118] In some embodiments, the engineered immune cells provided herein express a “second generation” CAR. “Second generation” CARs add intracellular domains from various co-stimulatory molecules (e.g., CD28, 4-1BB, ICOS, OX40) to the cytoplasmic tail of the CAR to provide additional signals to the T cell. “Second generation” CARs comprise those that provide both co-stimulation (e.g., CD28 or 4-1BB) and activation (e.g., CD3ζ). [00119] In some embodiments, the engineered immune cells provided herein express a “third generation” CAR. “Third generation” CARs comprise those that provide multiple co- stimulation (e.g., CD28 and 4-1BB) and activation (e.g., CD3ζ). [00120] In accordance with the presently disclosed subject matter, the CARs of the engineered immune cells provided herein comprise an extracellular antigen-binding domain, a transmembrane domain and an intracellular domain. [00121] Extracellular Antigen-Binding Domain of a CAR. In certain embodiments, the extracellular antigen-binding domain of a CAR specifically binds a tumor antigen. In certain embodiments, the extracellular antigen-binding domain is derived from a monoclonal antibody (mAb) that binds to a tumor antigen. In some embodiments, the extracellular antigen-binding domain comprises an scFv. In some embodiments, the extracellular antigen- binding domain comprises a Fab, which is optionally crosslinked. In a some embodiments, the extracellular binding domain comprises a F(ab) 2. In some embodiments, any of the foregoing molecules are comprised in a fusion protein with a heterologous sequence to form the extracellular antigen-binding domain. In certain embodiments, the extracellular antigen- binding domain comprises a human scFv that binds specifically to a tumor antigen. In certain embodiments, the scFv is identified by screening scFv phage library with tumor antigen-Fc fusion protein. [00122] In certain embodiments, the extracellular antigen-binding domain of a presently disclosed CAR has a high binding specificity and high binding affinity to a tumor antigen (e.g., a mammalian tumor antigen, such as a human tumor antigen). For example, in some embodiments, the extracellular antigen-binding domain of the CAR (embodied, for example, in a human scFv or an analog thereof) binds to a particular tumor antigen with a dissociation constant (K d ) of about 1 × 10 -5 M or less. In certain embodiments, the K d is about 5 × 10 -6 M or less, about 1 × 10 -6 M or less, about 5 × 10 -7 M or less, about 1 × 10 -7 M or less, about 5 × 10 -8 M or less, about 1 × 10 -8 M or less, about 5 × 10 -9 or less, about 4 × 10 -9 or less, about 3 × 10 -9 or less, about 2 × 10 -9 or less, or about 1 × 10 -9 M or less. In certain non-limiting embodiments, the K d is from about 3 × 10 -9 M or less. In certain non-limiting embodiments, the K d is from about 3 × 10 -9 to about 2 × 10 -7 . [00123] Binding of the extracellular antigen-binding domain (embodiment, for example, in a human scFv or an analog thereof) of a presently disclosed tumor antigen-targeted CAR can be confirmed by, for example, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassay (e.g., growth inhibition), or Western Blot assay. Each of these assays generally detect the presence of protein-antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody, or a scFv) specific for the complex of interest. For example, the scFv can be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is incorporated by reference herein). The radioactive isotope can be detected by such means as the use of a γ counter or a scintillation counter or by autoradiography. In certain embodiments, the extracellular antigen-binding domain of the tumor antigen-targeted CAR is labeled with a fluorescent marker. Non-limiting examples of fluorescent markers include green fluorescent protein (GFP), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, and mKalamal), cyan fluorescent protein (e.g., ECFP, Cerulean, and CyPet), and yellow fluorescent protein (e.g., YFP, Citrine, Venus, and YPet). In certain embodiments, the human scFv of a presently disclosed tumor antigen-targeted CAR is labeled with GFP. [00124] In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to tumor antigen that is expressed by a tumor cell. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to tumor antigen that is expressed on the surface of a tumor cell. In some embodiments, the extracellular antigen- binding domain of the expressed CAR binds to tumor antigen that is expressed on the surface of a tumor cell in combination with an MHC protein. In some embodiments, the MHC protein is a MHC class I protein. In some embodiments, the MHC Class I protein is an HLA- A, HLA-B, or HLA-C molecules. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to tumor antigen that is expressed on the surface of a tumor cell not in combination with an MHC protein. [00125] In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to tumor antigen selected from among 5T4, alpha 5β1-integrin, 707-AP, A33, AFP, ART-4, B7H4, BAGE, Bcl-2, β-catenin, BCMA, Bcr-abl, MN/C IX antibody, CA125, CA19-9, CAMEL, CAP-1, CASP-8, CD4, CD5, CD19, CD20, CD21 , CD22, CD25, CDC27/m, CD33, CD37, CD45, CD52, CD56, CD80, CD123, CDK4/m, CEA, c-Met, CS-1, CT, Cyp-B, cyclin B1, DAGE, DAM, EBNA, EGFR, ErbB3, ELF2M, EMMPRIN, EpCam, ephrinB2, estrogen receptor, ETV6-AML1, FAP, ferritin, folate-binding protein, GAGE, G250, GD-2, GM2, GnT-V, gp75, gp100 (Pmel 17), HAGE, HER-2/neu, HLA-A*0201- R170I, HPV E6, HPV E7, Ki-67, HSP70-2M, HST-2, hTERT (or hTRT), iCE, IGF-1R, IL- 2R, IL-5, KIAA0205, LAGE, LDLR/FUT, LRP, MAGE, MART, MART-1/melan-A, MART-2/Ski, MC1R, mesothelin, MUC, MUC16, MUM-1 -B, myc, MUM-2, MUM-3, NA88-A, NYESO-1, NY-Eso-B, p53, proteinase-3, p190 minor bcr-abl, Pml/RARα, PRAME, progesterone receptor, PSA, PSCA, PSM, PSMA, ras, RAGE, RU1 or RU2, RORI, SART-1 or SART-3, survivin, TEL/AML1, TGFβ, TPI/m, TRP-1, TRP-2, TRP-2/INT2, tenascin, TSTA tyrosinase, VEGF, and WT1. In certain embodiments, the extracellular antigen-binding domain of the expressed CAR binds to tumor antigen selected from among BCMA, CD19, mesothelin, MUC16, PSCA, WT1, and PRAME. Exemplary extracellular antigen-binding domains and methods of generating such domains and associated CARs are described in, e.g., WO2016/191246, WO2017/023859, WO2015/188141, WO2015/070061, WO2012/135854, WO2014/055668, which are incorporated by reference in their entirety, including the sequence listings provided therein. [00126] In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a CD19 tumor antigen. In some embodiments, the extracellular antigen- binding domain of the expressed CAR binds to a CD19 tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a CD19 tumor antigen presented in the context of an HLA-A2 molecule. [00127] In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a “preferentially expressed antigen in melanoma” (PRAME) tumor antigen. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a PRAME tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a PRAME tumor antigen presented in the context of an HLA-A2 molecule. [00128] In some embodiments, extracellular antigen-binding domain of the expressed CAR binds to a WT1 (Wilm’s tumor protein 1) tumor antigen. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a WT1 tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain binds to a WT1 tumor antigen presented in the context of an HLA- A2 molecule. [00129] In some embodiments, extracellular antigen-binding domain of the expressed CAR binds to a MUC16 tumor antigen. In some embodiments, the extracellular antigen- binding domain of the expressed CAR binds to a MUC16 tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain binds to a MUC16 tumor antigen presented in the context of an HLA-A2 molecule. [00130] In some embodiments, extracellular antigen-binding domain of the expressed CAR binds to a mesothelin tumor antigen. In some embodiments, the extracellular antigen- binding domain of the expressed CAR binds to a mesothelin tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain binds to a mesothelin tumor antigen presented in the context of an HLA-A2 molecule. [00131] In some embodiments, extracellular antigen-binding domain of the expressed CAR binds to a BCMA (B-cell maturation antigen) tumor antigen. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a BCMA tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain binds to a BCMA tumor antigen presented in the context of an HLA-A2 molecule. [00132] In some embodiments, extracellular antigen-binding domain of the expressed CAR binds to a PSCA (prostate stem cell antigen) tumor antigen. In some embodiments, the extracellular antigen-binding domain of the expressed CAR binds to a PSCA tumor antigen presented in the context of an MHC molecule. In some embodiments, the extracellular antigen-binding domain binds to a PSCA tumor antigen presented in the context of an HLA- A2 molecule. [00133] In certain embodiments, the extracellular antigen-binding domain (e.g., human scFv) comprises a heavy chain variable region and a light chain variable region, optionally linked with a linker sequence, for example a linker peptide (e.g., SEQ ID NO: 1), between the heavy chain variable region and the light chain variable region. In certain embodiments, the extracellular antigen-binding domain is a human scFv-Fc fusion protein or full length human IgG with V H and V L regions. [00134] In certain embodiments, the extracellular antigen-binding domain comprises a human scFv that binds to a CD19 antigen. In some embodiments, the scFv comprises a polypeptide having an amino acid sequence of SEQ ID NO: 3. [00135] In some embodiments, the scFv comprises a polypeptide having an amino acid sequence of SEQ ID NO: 4. [00136] In some embodiments, the scFv comprises a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 3 or SEQ ID NO: 4. For example, the scFv comprises a polypeptide having an amino acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3 or SEQ ID NO: 4. [00137] In some embodiments, the scFv is encoded by a nucleic acid having a nucleic acid sequence of SEQ ID NO: 5.
[00138] In some embodiments, the scFv is encoded by a nucleic acid having a nucleic acid sequence of SEQ ID NO: 6. [00139] In some embodiments, the scFv is encoded by a nucleic acid having a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, the scFv is encoded by a nucleic acid having a nucleic acid sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, the scFv is encoded by a nucleic acid having a nucleic acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5 or SEQ ID NO: 6. [00140] In certain non-limiting embodiments, an extracellular antigen-binding domain of the presently disclosed CAR can comprise a linker connecting the heavy chain variable region and light chain variable region of the extracellular antigen-binding domain. As used herein, the term “linker” refers to a functional group (e.g., chemical or polypeptide) that covalently attaches two or more polypeptides or nucleic acids so that they are connected to one another. As used herein, a “peptide linker” refers to one or more amino acids used to couple two proteins together (e.g., to couple V H and V L domains). In certain embodiments, the linker comprises amino acids having the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 33, or SEQ ID NO: 34. In certain embodiments, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 is set forth in SEQ ID NO: 2. [00141] In addition, the extracellular antigen-binding domain can comprise a leader or a signal peptide that directs the nascent protein into the endoplasmic reticulum. Signal peptide or leader can be essential if the CAR is to be glycosylated and anchored in the cell membrane. The signal sequence or leader can be a peptide sequence (about 5, about 10, about 15, about 20, about 25, or about 30 amino acids long) present at the N-terminus of newly synthesized proteins that directs their entry to the secretory pathway. [00142] In certain embodiments, the signal peptide is covalently joined to the N-terminus of the extracellular antigen-binding domain. In certain embodiments, the signal peptide comprises a CD8 signal polypeptide comprising amino acids having the sequence set forth in SEQ ID NO: 7 as provided below: MALPVTALLLPLALLLHAARP (SEQ ID NO: 7). [00143] The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 7 is set forth in SEQ ID NO: 8, which is provided below: atggccctgccagtaacggctctgctgctgccacttgctctgctcctccatgcagccagg cct (SEQ ID NO: 8). [00144] In certain embodiments, the signal peptide comprises a CD8 signal polypeptide comprising amino acids having the sequence set forth in SEQ ID NO: 9 as provided below: MALPVTALLLPLALLLHA (SEQ ID NO: 9). [00145] The nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 9 is set forth in SEQ ID NO: 10, which is provided below: ATGGCTCTCCCAGTGACTGCCCTACTGCTTCCCCTAGCGCTTCTCCTGCATGCA (SEQ ID NO: 10). [00146] Transmembrane Domain of a CAR. In certain non-limiting embodiments, the transmembrane domain of the CAR comprises a hydrophobic alpha helix that spans at least a portion of the membrane. Different transmembrane domains result in different receptor stability. After antigen recognition, receptors cluster and a signal is transmitted to the cell. In accordance with the presently disclosed subject matter, the transmembrane domain of the CAR can comprise a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, a synthetic peptide (e.g., a transmembrane peptide not based on a protein associated with the immune response), or a combination thereof. [00147] In certain embodiments, the transmembrane domain of a presently disclosed CAR comprises a CD28 polypeptide. The CD28 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous to the sequence having a NCBI Reference No: PI0747 or NP006130 (SEQ ID NO: 11), or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide can have an amino acid sequence that is a consecutive portion of SEQ ID NO: 11 which is at least 20, or at least 30, or at least 40, or at least 50, and up to 220 amino acids in length. Alternatively or additionally, in non- limiting various embodiments, the CD28 polypeptide has an amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, or 200 to 220 of SEQ ID NO: 11. In certain embodiments, the CAR of the presently disclosed comprises a transmembrane domain comprising a CD28 polypeptide, and an intracellular domain comprising a co-stimulatory signaling region that comprises a CD28 polypeptide. In certain embodiments, the CD28 polypeptide comprised in the transmembrane domain and the intracellular domain has an amino acid sequence of amino acids 114 to 220 of SEQ ID NO: 11. [00148] SEQ ID NO: 11 is provided below: [00149] In accordance with the presently disclosed subject matter, a “CD28 nucleic acid molecule” refers to a polynucleotide encoding a CD28 polypeptide. In certain embodiments, the CD28 nucleic acid molecule encoding the CD28 polypeptide comprised in the transmembrane domain and the intracellular domain (e.g., the co-stimulatory signaling region) of the presently disclosed CAR (amino acids 114 to 220 of SEQ ID NO: 11) comprises nucleic acids having the sequence set forth in SEQ ID NO: 12 as provided below. attgaagttatgtatcctcctccttacctagacaatgagaagagcaatggaaccattatc catgtgaaagggaaacacctttgtccaagtc ccctatttcccggaccttctaagcccttttgggtgctggtggtggttggtggagtcctgg cttgctatagcttgctagtaacagtggccttta ttattttctgggtgaggagtaagaggagcaggctcctgcacagtgactacatgaacatga ctccccgccgccccgggcccacccgca agcattaccagccctatgccccaccacgcgacttcgcagcctatcgctcc (SEQ ID NO: 12) [00150] In certain embodiments, the transmembrane domain comprises a CD8 polypeptide. The CD8 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%) homologous to SEQ ID NO: 13 (homology herein may be determined using standard software such as BLAST or FASTA) as provided below, or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. In certain embodiments, the CD8 polypeptide can have an amino acid sequence that is a consecutive portion of SEQ ID NO: 13 which is at least 20, or at least 30, or at least 40, or at least 50, and up to 235 amino acids in length. Alternatively or additionally, in various embodiments, the CD8 polypeptide has an amino acid sequence of amino acids 1 to 235, 1 to 50, 50 to 100, 100 to 150, 150 to 200, or 200 to 235 of SEQ ID NO: 13. [00152] In certain embodiments, the transmembrane domain comprises a CD8 polypeptide comprising amino acids having the sequence set forth in SEQ ID NO: 14 as provided below: ( Q ) [00154] In accordance with the presently disclosed subject matter, a “CD8 nucleic acid molecule” refers to a polynucleotide encoding a CD8 polypeptide. In certain embodiments, the CD8 nucleic acid molecule encoding the CD8 polypeptide comprised in the transmembrane domain of the presently disclosed CAR (SEQ ID NO: 14) comprises nucleic acids having the sequence set forth in SEQ ID NO: 15 as provided below. [00156] In certain non-limiting embodiments, a CAR can also comprise a spacer region that links the extracellular antigen-binding domain to the transmembrane domain. The spacer region can be flexible enough to allow the antigen-binding domain to orient in different directions to facilitate antigen recognition while preserving the activating activity of the CAR. In certain non-limiting embodiments, the spacer region can be the hinge region from IgGl, the CH 2 CH 3 region of immunoglobulin and portions of CD3, a portion of a CD28 polypeptide (e.g., SEQ ID NO: 11), a portion of a CD8 polypeptide (e.g., SEQ ID NO: 13), a variation of any of the foregoing which is at least about 80%, at least about 85%>, at least about 90%, or at least about 95% homologous thereto, or a synthetic spacer sequence. In certain non-limiting embodiments, the spacer region may have a length between about 1-50 (e.g., 5-25, 10-30, or 30-50) amino acids. [00157] Intracellular Domain of a CAR. In certain non-limiting embodiments, an intracellular domain of the CAR can comprise a CD3ζ polypeptide, which can activate or stimulate a cell (e.g., a cell of the lymphoid lineage, e.g., a T cell). CD3ζ comprises 3 ITAMs, and transmits an activation signal to the cell (e.g., a cell of the lymphoid lineage, e.g., a T cell) after antigen is bound. The CD3ζ polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to the sequence having a NCBI Reference No: NP_932170 (SEQ ID NO: 16), or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. In certain embodiments, the CD3ζ polypeptide can have an amino acid sequence that is a consecutive portion of SEQ ID NO: 17 which is at least 20, or at least 30, or at least 40, or at least 50, and up to 164 amino acids in length. Alternatively or additionally, in various embodiments, the CD3ζ polypeptide has an amino acid sequence of amino acids 1 to 164, 1 to 50, 50 to 100, 100 to 150, or 150 to 164 of SEQ ID NO: 17. In certain embodiments, the CD3ζ polypeptide has an amino acid sequence of amino acids 52 to 164 of SEQ ID NO: 17. [00158] SEQ ID NO: 17 is provided below: [00159] In certain embodiments, the CD3ζ polypeptide has the amino acid sequence set forth in SEQ ID NO: 18, which is provided below: [00160] In certain embodiments, the CD3ζ polypeptide has the amino acid sequence set forth in SEQ ID NO: 19, which is provided below: [00161] In accordance with the presently disclosed subject matter, a “CD3ζ nucleic acid molecule” refers to a polynucleotide encoding a CD3ζ polypeptide. In certain embodiments, the CD3ζ nucleic acid molecule encoding the CD3ζ polypeptide (SEQ ID NO: 18) comprised in the intracellular domain of the presently disclosed CAR comprises a nucleotide sequence as set forth in SEQ ID NO: 20 as provided below. ( Q ) [00162] In certain embodiments, the CD3ζ nucleic acid molecule encoding the CD3ζ polypeptide (SEQ ID NO: 19) comprised in the intracellular domain of the presently disclosed CAR comprises a nucleotide sequence as set forth in SEQ ID NO: 21 as provided below. [00163] In certain non-limiting embodiments, an intracellular domain of the CAR further comprises at least one signaling region. The at least one signaling region can include a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP- 10 polypeptide, a PD-1 polypeptide, a CTLA-4 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, a synthetic peptide (not based on a protein associated with the immune response), or a combination thereof. [00164] In certain embodiments, the signaling region is a co-stimulatory signaling region. [00165] In certain embodiments, the co-stimulatory signaling region comprises at least one co-stimulatory molecule, which can provide optimal lymphocyte activation. As used herein, “co-stimulatory molecules” refer to cell surface molecules other than antigen receptors or their ligands that are required for an efficient response of lymphocytes to antigen. The at least one co-stimulatory signaling region can include a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof. The co-stimulatory molecule can bind to a co-stimulatory ligand, which is a protein expressed on cell surface that upon binding to its receptor produces a co- stimulatory response, i.e., an intracellular response that effects the stimulation provided when an antigen binds to its CAR molecule. Co-stimulatory ligands, include, but are not limited to CD80, CD86, CD70, OX40L, 4-1BBL, CD48, TNFRSF14, and PD- Ll. As one example, a 4-1BB ligand (i.e., 4-1BBL) may bind to 4-1BB (also known as “CD 137”) for providing an intracellular signal that in combination with a CAR signal induces an effector cell function of the CAR + T cell. CARs comprising an intracellular domain that comprises a co-stimulatory signaling region comprising 4-1BB, ICOS or DAP-10 are disclosed in U.S.7,446,190, which is herein incorporated by reference in its entirety. In certain embodiments, the intracellular domain of the CAR comprises a co-stimulatory signaling region that comprises a CD28 polypeptide. In certain embodiments, the intracellular domain of the CAR comprises a co- stimulatory signaling region that comprises two co-stimulatory molecules: CD28 and 4-1BB or CD28 and OX40. [00166] The 4-1BB polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous to the sequence having a NCBI Reference No: P41273 or NP_001552 (SEQ ID NO: 22) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00167] SEQ ID NO: 22 is provided below: [00168] In certain embodiments, the 4-1BB co-stimulatory domain has the amino acid sequence set forth in SEQ ID NO: 23, which is provided below: [00169] In accordance with the presently disclosed subject matter, a “4-1BB nucleic acid molecule” refers to a polynucleotide encoding a 4-1BB polypeptide. In certain embodiments, the 4-1BB nucleic acid molecule encoding the 4-1BB polypeptide (SEQ ID NO: 23) comprised in the intracellular domain of the presently disclosed CAR comprises a nucleotide sequence as set forth in SEQ ID NO: 24 as provided below. [00170] An OX40 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous to the sequence having a NCBI Reference No: P43489 or NP 003318 (SEQ ID NO: 25), or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00171] SEQ ID NO: 25 is provided below: [00172] In accordance with the presently disclosed subject matter, an “OX40 nucleic acid molecule” refers to a polynucleotide encoding an OX40 polypeptide. [00173] An ICOS polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous to the sequence having a NCBI Reference No: NP_036224 (SEQ ID NO: 26) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00174] SEQ ID NO: 26 is provided below: [00175] In accordance with the presently disclosed subject matter, an “ICOS nucleic acid molecule” refers to a polynucleotide encoding an ICOS polypeptide. [00176] In accordance with the presently disclosed subject matter, a CTLA-4 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to UniProtKB/Swiss- Prot Ref. No.: P16410.3 (SEQ ID NO: 27) (homology herein may be determined using standard software such as BLAST or FASTA) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00177] SEQ ID NO: 27 is provided below: [00178] In accordance with the presently disclosed subject matter, a “CTLA-4 nucleic acid molecule” refers to a polynucleotide encoding a CTLA-4 polypeptide. [00179] In accordance with the presently disclosed subject matter, a PD-1 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to NCBI Reference No: NP_005009.2 (SEQ ID NO: 28) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00180] SEQ ID NO: 28 is provided below: [00181] In accordance with the presently disclosed subject matter, a “PD-1 nucleic acid molecule” refers to a polynucleotide encoding a PD-1 polypeptide. [00182] In accordance with the presently disclosed subject matter, a LAG-3 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to UniProtKB/Swiss- Prot Ref. No. : P18627.5 (SEQ ID NO: 29) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00183] SEQ ID NO: 29 is provided below: [00184] In accordance with the presently disclosed subject matter, a “LAG-3 nucleic acid molecule” refers to a polynucleotide encoding a LAG-3 polypeptide. [00185] In accordance with the presently disclosed subject matter, a 2B4 polypeptide can have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to UniProtKB/Swiss-Prot Ref. No.: Q9BZW8.2 (SEQ ID NO: 30) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00186] SEQ ID NO: 30 is provided below: [00187] In accordance with the presently disclosed subject matter, a “2B4 nucleic acid molecule” refers to a polynucleotide encoding a 2B4 polypeptide. [00188] In accordance with the presently disclosed subject matter, a BTLA polypeptide can have an amino acid sequence that is at least about 85%>, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to UniProtKB/Swiss- Prot Ref. No. : Q7Z6A9.3 (SEQ ID NO: 31) or fragments thereof, and/or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. [00189] SEQ ID NO: 31 is provided below: [00190] In accordance with the presently disclosed subject matter, a “BTLA nucleic acid molecule” refers to a polynucleotide encoding a BTLA polypeptide. Exemplary CAR and C825 Antigen-Binding Fragment Constructs [00191] In certain embodiments, the CAR and the anti-DOTA C825 antigen binding fragment are expressed as single polypeptide linked by a self-cleaving linker, such as a P2A linker. In certain embodiments, the CAR and the anti-DOTA C825 antigen binding fragment are expressed as two separate polypeptides. [00192] In certain embodiments, the CAR comprises an extracellular antigen-binding region that comprises a human scFv that specifically binds to a human tumor antigen, a transmembrane domain comprising a CD28 polypeptide and/or a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co-stimulatory signaling region that comprises a 4-1BB polypeptide. The CAR also comprises a signal peptide or a leader covalently joined to the N-terminus of the extracellular antigen-binding domain. The signal peptide comprises amino acids having the sequence set forth in SEQ ID NO: 7 or SEQ ID NO: 9. In certain embodiments, the human scFv is selected from the group consisting of an anti-BCMA scFv, an anti-CD19 scFv, an anti-mesothelin scFv, an anti-MUC16 scFv, an anti- PSCA scFv, an anti-WT1 scFv, and an anti-PRAME scFv. [00193] In some embodiments, the nucleic acid encoding the CAR and the anti-DOTA C825 antigen binding fragment is operably linked an inducible promoter. In some embodiments, the nucleic acid encoding the CAR and the anti-DOTA C825 antigen binding fragment is operably linked a constitutive promoter. In some embodiments, the nucleic acid encoding the CAR and the nucleic acid encoding and the anti-DOTA C825 antigen binding fragment are operably linked to two separate promoters. In some embodiments, the nucleic acid encoding the CAR is operably linked a constitutive promoter and the anti-DOTA C825 antigen binding fragment is operably linked a constitutive promoter. In some embodiments, the nucleic acid encoding the CAR is operably linked a constitutive promoter and the anti- DOTA C825 antigen binding fragment is operably linked an inducible promoter. [00194] In some embodiments, the inducible promoter is a synthetic Notch promoter that is activatable in a CAR T cell, where the intracellular domain of the CAR contains a transcriptional regulator that is released from the membrane when engagement of the CAR with the tumor antigen induces intramembrane proteolysis (see, e.g., Morsut et al., Cell 164(4): 780–791 (2016). Accordingly, transcription of the anti-DOTA C825 antigen binding fragment is induced upon binding of the engineered immune cell with the tumor antigen. [00195] The presently disclosed subject matter also provides isolated nucleic acid molecules encoding the CAR/anti-DOTA C825 antigen binding fragment constructs described herein or a functional portion thereof. In certain embodiments, the isolated nucleic acid molecule encodes an anti-CD19-targeted CAR comprising a human scFv that specifically binds to a human CD19 polypeptide, a transmembrane domain comprising a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co- stimulatory signaling region comprising a 4-1BB polypeptide, a P2A self-cleaving peptide, and an anti-DOTA C825 antigen binding fragment provided herein. [00196] In certain embodiments, the isolated nucleic acid molecule encodes an anti-CD19- targeted CAR comprising a human scFv that specifically binds to a human CD19 polypeptide fused to a synthetic Notch transmembrane domain and an intracellular cleavable transcription factor. In certain embodiments, the isolated nucleic acid molecule encodes an anti-DOTA C825 antigen binding fragment inducible by release of the transcription factor of a synthetic Notch system. [00197] In certain embodiments, the isolated nucleic acid molecule encodes an anti- MUC16-targeted CAR comprising a human scFv that specifically binds to a human MUC16 polypeptide, a transmembrane domain comprising a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co-stimulatory signaling region comprising a 4-1BB polypeptide, a P2A self-cleaving peptide, and an anti-DOTA C825 antigen binding fragment provided herein. [00198] In certain embodiments, the isolated nucleic acid molecule encodes an anti- mesothelin-targeted CAR comprising a human scFv that specifically binds to a human mesothelin polypeptide, a transmembrane domain comprising a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co-stimulatory signaling region comprising a 4-1BB polypeptide, a P2A self-cleaving peptide, and an anti-DOTA C825 antigen binding fragment provided herein. [00199] In certain embodiments, the isolated nucleic acid molecule encodes an anti-WT1- targeted CAR comprising a human scFv that specifically binds to a human WT1 polypeptide, a transmembrane domain comprising a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co-stimulatory signaling region comprising a 4-1BB polypeptide, a P2A self-cleaving peptide, and an anti-DOTA C825 antigen binding fragment provided herein. [00200] In certain embodiments, the isolated nucleic acid molecule encodes an anti-PSCA- targeted CAR comprising a human scFv that specifically binds to a human PSCA polypeptide, a transmembrane domain comprising a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co-stimulatory signaling region comprising a 4-1BB polypeptide, a P2A self-cleaving peptide, and an anti-DOTA C825 antigen binding fragment provided herein. [00201] In certain embodiments, the isolated nucleic acid molecule encodes an anti- BCMA-targeted CAR comprising a human scFv that specifically binds to a human BCMA polypeptide, a transmembrane domain comprising a CD8 polypeptide, and an intracellular domain comprising a CD3ζ polypeptide and a co-stimulatory signaling region comprising a 4-1BB polypeptide, a P2A self-cleaving peptide, and an anti-DOTA C825 antigen binding fragment provided herein. [00202] In certain embodiments, the isolated nucleic acid molecule encodes a functional portion of a presently disclosed CAR constructs. As used herein, the term “functional portion” refers to any portion, part or fragment of a CAR, which portion, part or fragment retains the biological activity of the targeted CAR (the parent CAR). In certain embodiments, an isolated nucleic acid molecule encoding a functional portion of a tumor antigen-targeted CAR can encode a protein comprising, e.g., about 10%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, and about 95%, or more of the parent CAR. Immune Cells [00203] The presently disclosed subject matter provides engineered immune cells expressing an anti-DOTA C825 antigen binding fragment and a T-cell receptor (e.g., a CAR) or other ligand that comprises an extracellular antigen-binding domain, a transmembrane domain and an intracellular domain, where the extracellular antigen-binding domain specifically binds tumor antigen, including a tumor receptor or ligand, as described above. In certain embodiments immune cells can be transduced with a presently disclosed CAR/anti- DOTA C825 antigen binding fragment constructs such that the cells express the CAR and the anti-DOTA C825 antigen binding fragment. [00204] The engineered immune cells of the presently disclosed subject matter can be cells of the lymphoid lineage or myeloid lineage. The lymphoid lineage, comprising B, T, and natural killer (NK) cells, provides for the production of antibodies, regulation of the cellular immune system, detection of foreign agents in the blood, detection of cells foreign to the host, and the like. Non-limiting examples of immune cells of the lymphoid lineage include T cells, Natural Killer (NK) cells, embryonic stem cells, and pluripotent stem cells (e.g., those from which lymphoid cells may be differentiated). T cells can be lymphocytes that mature in the thymus and are chiefly responsible for cell-mediated immunity. T cells are involved in the adaptive immune system. The T cells of the presently disclosed subject matter can be any type of T cells, including, but not limited to, T helper cells, cytotoxic T cells, memory T cells (including central memory T cells, stem-cell-like memory T cells (or stem-like memory T cells), and two types of effector memory T cells: e.g., T EM cells and TEMRA cells, Regulatory T cells (also known as suppressor T cells), Natural killer T cells, Mucosal associated invariant T cells, and γδ T cells. Cytotoxic T cells (CTL or killer T cells) are a subset of T lymphocytes capable of inducing the death of infected somatic or tumor cells. In certain embodiments, the CAR-expressing T cells express Foxp3 to achieve and maintain a T regulatory phenotype. [00205] Natural killer (NK) cells can be lymphocytes that are part of cell-mediated immunity and act during the innate immune response. NK cells do not require prior activation in order to perform their cytotoxic effect on target cells. [00206] The engineered immune cells of the presently disclosed subject matter can express an extracellular antigen-binding domain (e.g., a human scFv, a Fab that is optionally crosslinked, or a F(ab) 2 ) that specifically binds to a tumor antigen. In some embodiments, the immune cell is a lymphocyte, such as a T cell, a B cell or a natural killer (NK) cell. In certain embodiments, the engineered immune cell is a T cell. The T cell can be a CD4 + T cell or a CD8 + T cell. In certain embodiments, the T cell is a CD4 + T cell. In certain embodiments, the T cell is a CD8 + T cell. [00207] A presently disclosed engineered immune cells can further include at least one recombinant or exogenous co-stimulatory ligand. For example, a presently disclosed engineered immune cells can be further transduced with at least one co-stimulatory ligand, such that the engineered immune cells co-expresses or is induced to co-express the tumor antigen-targeted CAR and the at least one co-stimulatory ligand. The interaction between the tumor antigen-targeted CAR and at least one co-stimulatory ligand provides a non-antigen- specific signal important for full activation of an immune cell (e.g., T cell). Co-stimulatory ligands include, but are not limited to, members of the tumor necrosis factor (TNF) superfamily, and immunoglobulin (Ig) superfamily ligands. TNF is a cytokine involved in systemic inflammation and stimulates the acute phase reaction. Its primary role is in the regulation of immune cells. Members of TNF superfamily share a number of common features. The majority of TNF superfamily members are synthesized as type II transmembrane proteins (extracellular C-terminus) containing a short cytoplasmic segment and a relatively long extracellular region. TNF superfamily members include, without limitation, nerve growth factor (NGF), CD40L (CD40L)/CD 154, CD137L/4-1BBL, TNF-α, CD134L/OX40L/CD252, CD27L/CD70, Fas ligand (FasL), CD30L/CD153, tumor necrosis factor beta (TNFP)/lymphotoxin-alpha (LT-α), lymphotoxin-beta (LΤ-β), CD257/B cell- activating factor (BAFF)/BLYS/THANK/TALL-1, glucocorticoid-induced TNF Receptor ligand (GITRL), TNF-related apoptosis-inducing ligand (TRAIL), and LIGHT (TNFSF14). The immunoglobulin (Ig) superfamily is a large group of cell surface and soluble proteins that are involved in the recognition, binding, or adhesion processes of cells. These proteins share structural features with immunoglobulins — they possess an immunoglobulin domain (fold). Immunoglobulin superfamily ligands include, but are not limited to, CD80 and CD86, both ligands for CD28, or PD-L1/(B7-H1) that are ligands for PD-1. In certain embodiments, the at least one co-stimulatory ligand is selected from the group consisting of 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof. In certain embodiments, the engineered immune cell comprises one recombinant co-stimulatory ligand that is 4-1BBL. In certain embodiments, the engineered immune cell comprises two recombinant co-stimulatory ligands that are 4-1BBL and CD80. CARs comprising at least one co-stimulatory ligand are described in U.S. Patent No.8,389,282, which is incorporated by reference in its entirety. [00208] Furthermore, a presently disclosed engineered immune cells can further comprise at least one exogenous cytokine. For example, a presently disclosed engineered immune cell can be further transduced with at least one cytokine, such that the engineered immune cells secretes the at least one cytokine as well as expresses the tumor antigen-targeted CAR. In certain embodiments, the at least one cytokine is selected from the group consisting of IL-2, IL- 3, IL-6, IL-7, IL-11, IL-12, IL-15, IL-17, and IL-21. In certain embodiments, the cytokine is IL-12. [00209] The engineered immune cells can be generated from peripheral donor lymphocytes. The engineered immune cells (e.g., T cells) can be autologous, non-autologous (e.g., allogeneic), or derived in vitro from engineered progenitor or stem cells. [00210] In certain embodiments, a presently disclosed engineered immune cells (e.g., T cells) expresses from about 1 to about 5, from about 1 to about 4, from about 2 to about 5, from about 2 to about 4, from about 3 to about 5, from about 3 to about 4, from about 4 to about 5, from about 1 to about 2, from about 2 to about 3, from about 3 to about 4, or from about 4 to about 5 vector copy numbers per cell of a presently disclosed tumor antigen- targeted CAR and/or anti-DOTA C825 antigen binding fragment. [00211] For example, the higher the CAR expression level in an engineered immune cell, the greater cytotoxicity and cytokine production the engineered immune cell exhibits. An engineered immune cell (e.g., T cell) having a high tumor antigen-targeted CAR expression level can induce antigen-specific cytokine production or secretion and/or exhibit cytotoxicity to a tissue or a cell having a low expression level of tumor antigen-targeted CAR, e.g., about 2,000 or less, about 1,000 or less, about 900 or less, about 800 or less, about 700 or less, about 600 or less, about 500 or less, about 400 or less, about 300 or less, about 200 or less, about 100 or less of tumor antigen binding sites/cell. Additionally or alternatively, the cytotoxicity and cytokine production of a presently disclosed engineered immune cell (e.g., T cell) are proportional to the expression level of tumor antigen in a target tissue or a target cell. For example, the higher the expression level of human tumor antigen in the target, the greater cytotoxicity and cytokine production the engineered immune cell exhibits. [00212] The unpurified source of immune cells may be any source known in the art, such as the bone marrow, fetal, neonate or adult or other hematopoietic cell source, e.g., fetal liver, peripheral blood or umbilical cord blood. Various techniques can be employed to separate the cells. For instance, negative selection methods can remove non-immune cell initially. Monoclonal antibodies are particularly useful for identifying markers associated with particular cell lineages and/or stages of differentiation for both positive and negative selections. [00213] A large proportion of terminally differentiated cells can be initially removed by a relatively crude separation. For example, magnetic bead separations can be used initially to remove large numbers of irrelevant cells. Suitably, at least about 80%, usually at least 70% of the total hematopoietic cells will be removed prior to cell isolation. [00214] Procedures for separation include, but are not limited to, density gradient centrifugation; resetting; coupling to particles that modify cell density; magnetic separation with antibody-coated magnetic beads; affinity chromatography; cytotoxic agents joined to or used in conjunction with a mAb, including, but not limited to, complement and cytotoxins; and panning with antibody attached to a solid matrix, e.g., plate, chip, elutriation or any other convenient technique. [00215] Techniques for separation and analysis include, but are not limited to, flow cytometry, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, impedance channels. [00216] The cells can be selected against dead cells, by employing dyes associated with dead cells such as propidium iodide (PI). Usually, the cells are collected in a medium comprising 2% fetal calf serum (FCS) or 0.2% bovine serum albumin (BSA) or any other suitable (e.g., sterile), isotonic medium. [00217] In some embodiments, the engineered immune cells comprise one or more additional modifications. For example, in some embodiments, the engineered immune cells comprise and express (is transduced to express) an antigen recognizing receptor that binds to a second antigen that is different than selected tumor antigen. The inclusion of an antigen recognizing receptor in addition to a presently disclosed CAR on the engineered immune cell can increase the avidity of the CAR or the engineered immune cell comprising thereof on a targeted cell, especially, the CAR is one that has a low binding affinity to a particular tumor antigen, e.g., a Kd of about 2 × 10 -8 M or more, about 5 × 10 -8 M or more, about 8 × 10 -8 M or more, about 9 × 10 -8 M or more, about 1 × 10 -7 M or more, about 2 × 10 -7 M or more, or about 5 × 10 -7 M or more. [00218] In certain embodiments, the antigen recognizing receptor is a chimeric co- stimulatory receptor (CCR). CCR is described in Krause, et al., J. Exp. Med.188(4):619- 626(1998), and US20020018783, the contents of which are incorporated by reference in their entireties. CCRs mimic co-stimulatory signals, but unlike, CARs, do not provide a T-cell activation signal, e.g., CCRs lack a CD3ζ polypeptide. CCRs provide co-stimulation, e.g., a CD28-like signal, in the absence of the natural co-stimulatory ligand on the antigen- presenting cell. A combinatorial antigen recognition, i.e., use of a CCR in combination with a CAR, can augment T-cell reactivity against the dual-antigen expressing T cells, thereby improving selective tumor targeting. Kloss et al., describe a strategy that integrates combinatorial antigen recognition, split signaling, and, critically, balanced strength of T-cell activation and costimulation to generate T cells that eliminate target cells that express a combination of antigens while sparing cells that express each antigen individually (Kloss et al., Nature Biotechnology 31(l):71-75 (2013)). With this approach, T-cell activation requires CAR-mediated recognition of one antigen, whereas costimulation is independently mediated by a CCR specific for a second antigen. To achieve tumor selectivity, the combinatorial antigen recognition approach diminishes the efficiency of T-cell activation to a level where it is ineffective without rescue provided by simultaneous CCR recognition of the second antigen. In certain embodiments, the CCR comprises an extracellular antigen-binding domain that binds to an antigen different than selected tumor antigen, a transmembrane domain, and a co-stimulatory signaling region that comprises at least one co-stimulatory molecule, including, but not limited to, CD28, 4-1BB, OX40, ICOS, PD-1, CTLA-4, LAG-3, 2B4, and BTLA. In certain embodiments, the co-stimulatory signaling region of the CCR comprises one co-stimulatory signaling molecule. In certain embodiments, the one co- stimulatory signaling molecule is CD28. In certain embodiments, the one co-stimulatory signaling molecule is 4-1BB. In certain embodiments, the co-stimulatory signaling region of the CCR comprises two co-stimulatory signaling molecules. In certain embodiments, the two co-stimulatory signaling molecules are CD28 and 4-1BB. A second antigen is selected so that expression of both selected tumor antigen and the second antigen is restricted to the targeted cells (e.g., cancerous tissue or cancerous cells). Similar to a CAR, the extracellular antigen-binding domain can be a scFv, a Fab, a F(ab) 2; or a fusion protein with a heterologous sequence to form the extracellular antigen-binding domain. In certain embodiments, the CCR comprises a scFv that binds to CD138, transmembrane domain comprising a CD28 polypeptide, and a co-stimulatory signaling region comprising two co-stimulatory signaling molecules that are CD28 and 4-1BB. [00219] In certain embodiments, the antigen recognizing receptor is a truncated CAR. A “truncated CAR” is different from a CAR by lacking an intracellular signaling domain. For example, a truncated CAR comprises an extracellular antigen-binding domain and a transmembrane domain, and lacks an intracellular signaling domain. In accordance with the presently disclosed subject matter, the truncated CAR has a high binding affinity to the second antigen expressed on the targeted cells, e.g., myeloma cells. The truncated CAR functions as an adhesion molecule that enhances the avidity of a presently disclosed CAR, especially, one that has a low binding affinity to tumor antigen, thereby improving the efficacy of the presently disclosed CAR or engineered immune cell (e.g., T cell) comprising thereof. In certain embodiments, the truncated CAR comprises an extracellular antigen- binding domain that binds to CD138, a transmembrane domain comprising a CD8 polypeptide. A presently disclosed T cell comprises or is transduced to express a presently disclosed CAR targeting tumor antigen and a truncated CAR targeting CD138. In certain embodiments, the targeted cells are solid tumor cells. In some embodiments, the engineered immune cells are further modified to suppress expression of one or more genes. In some embodiments, the engineered immune cells are further modified via genome editing. Various methods and compositions for targeted cleavage of genomic DNA have been described. Such targeted cleavage events can be used, for example, to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination at a predetermined chromosomal locus. See, for example, U.S. Patent Nos.7,888,121 ; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861 ; 8,586,526; U.S. Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231 ; 201000218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983 and 20130177960, the disclosures of which are incorporated by reference in their entireties. These methods often involve the use of engineered cleavage systems to induce a double strand break (DSB) or a nick in a target DNA sequence such that repair of the break by an error born process such as non-homologous end joining (NHEJ) or repair using a repair template (homology directed repair or HDR) can result in the knock out of a gene or the insertion of a sequence of interest (targeted integration). Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription-activator like effector nucleases (TALENs), or using the CRISPR/Cas system with an engineered crRNA/tracr RNA ('single guide RNA') to guide specific cleavage. In some embodiments, the engineered immune cells are modified to disrupt or reduce expression of an endogenous T-cell receptor gene (see, e.g., WO 2014153470, which is incorporated by reference in its entirety). In some embodiments, the engineered immune cells are modified to result in disruption or inhibition of PD1, PDL-1 or CTLA-4 (see, e.g., U.S. Patent Publication 20140120622), or other immunosuppressive factors known in the art (Wu et al. (2015) Oncoimmunology 4(7): e1016700, Mahoney et al. (2015) Nature Reviews Drug Discovery 14, 561–584). Vectors [00220] Many expression vectors are available and known to those of skill in the art and can be used for expression of polypeptides provided herein. The choice of expression vector will be influenced by the choice of host expression system. Such selection is well within the level of skill of the skilled artisan. In general, expression vectors can include transcriptional promoters and optionally enhancers, translational signals, and transcriptional and translational termination signals. Expression vectors that are used for stable transformation typically have a selectable marker which allows selection and maintenance of the transformed cells. In some cases, an origin of replication can be used to amplify the copy number of the vector in the cells. [00221] Vectors also can contain additional nucleotide sequences operably linked to the ligated nucleic acid molecule, such as, for example, an epitope tag such as for localization, e.g., a hexa-his tag or a myc tag, hemagglutinin tag or a tag for purification, for example, a GST fusion, and a sequence for directing protein secretion and/or membrane association. [00222] Expression of the antibodies or antigen-binding fragments thereof can be controlled by any promoter/enhancer known in the art. Suitable bacterial promoters are well known in the art and described herein below. Other suitable promoters for mammalian cells, yeast cells and insect cells are well known in the art and some are exemplified below. Selection of the promoter used to direct expression of a heterologous nucleic acid depends on the particular application and is within the level of skill of the skilled artisan. Promoters which can be used include but are not limited to eukaryotic expression vectors containing the SV40 early promoter (Bernoist and Chambon, Nature 290:304-310(1981)), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797(1980)), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. USA 75: 1441-1445 (1981)), the regulatory sequences of the metallothionein gene (Brinster et al., Nature 296:39-42 (1982)); prokaryotic expression vectors such as the β- lactamase promoter (Jay et al., Proc. Natl. Acad. Sci. USA 75:5543 (1981)) or the tac promoter (DeBoer et al., Proc. Natl. Acad. Sci. USA 50:21-25(1983)); see also "Useful Proteins from Recombinant Bacteria": in Scientific American 242:79-94 (1980)); plant expression vectors containing the nopaline synthetase promoter (Herrera- Estrella et al., Nature 505:209-213(1984)) or the cauliflower mosaic virus 35S RNA promoter (Gardner et al., Nucleic Acids Res.9:2871(1981)), and the promoter of the photosynthetic enzyme ribulose bisphosphate carboxylase (Herrera-Estrella et al., Nature 510: 115-120(1984)); promoter elements from yeast and other fungi such as the Gal4 promoter, the alcohol dehydrogenase promoter, the phosphoglycerol kinase promoter, the alkaline phosphatase promoter, and the following animal transcriptional control regions that exhibit tissue specificity and have been used in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., Cell 55:639-646 (1984); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol.50:399-409(1986); MacDonald, Hepatology 7:425-515 (1987)); insulin gene control region which is active in pancreatic beta cells (Hanahan et al., Nature 515: 115-122 (1985)), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al., Cell 55:647-658 (1984); Adams et al., Nature 515:533-538 (1985); Alexander et al., Mol. Cell Biol.7: 1436-1444 (1987)), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., Cell 15:485-495 (1986)), albumin gene control region which is active in liver (Pinckert et al., Genes and Devel.1:268-276 (1987)), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., Mol. Cell. Biol.5:1639-403 (1985)); Hammer et al., Science 255:53-58 (1987)), alpha-1 antitrypsin gene control region which is active in liver (Kelsey et al., Genes and Devel.7:161-171 (1987)), beta globin gene control region which is active in myeloid cells (Magram et al., Nature 515:338-340 (1985)); Kollias et al., Cell 5:89-94 (1986)), myelin basic protein gene control region which is active in oligodendrocyte cells of the brain (Readhead et al., Cell 15:703-712 (1987)), myosin light chain-2 gene control region which is active in skeletal muscle (Shani, Nature 514:283-286 (1985)), and gonadotrophic releasing hormone gene control region which is active in gonadotrophs of the hypothalamus (Mason et al., Science 254: 1372- 1378 (1986)). [00223] In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the antibody, or portion thereof, in host cells. A typical expression cassette contains a promoter operably linked to the nucleic acid sequence encoding the antibody chain and signals required for efficient polyadenylation of the transcript, ribosome binding sites and translation termination. Additional elements of the cassette can include enhancers. In addition, the cassette typically contains a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region can be obtained from the same gene as the promoter sequence or can be obtained from different genes. [00224] Some expression systems have markers that provide gene amplification such as thymidine kinase and dihydrofolate reductase. Alternatively, high yield expression systems not involving gene amplification are also suitable, such as using a baculovirus vector in insect cells, with a nucleic acid sequence encoding a germline antibody chain under the direction of the polyhedron promoter or other strong baculovirus promoter. [00225] Any methods known to those of skill in the art for the insertion of DNA fragments into a vector can be used to construct expression vectors containing a nucleic acid encoding any of the polypeptides provided herein. These methods can include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). The insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. If the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. Alternatively, any site desired can be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers can contain specific chemically synthesized nucleic acids encoding restriction endonuclease recognition sequences. [00226] Exemplary plasmid vectors useful to produce the polypeptides provided herein contain a strong promoter, such as the HCMV immediate early enhancer/promoter or the MHC class I promoter, an intron to enhance processing of the transcript, such as the HCMV immediate early gene intron A, and a polyadenylation (poly A) signal, such as the late SV40 polyA signal. [00227] Genetic modification of engineered immune cells (e.g., T cells, NK cells) can be accomplished by transducing a substantially homogeneous cell composition with a recombinant DNA or RNA construct. The vector can be a retroviral vector (e.g., gamma retroviral), which is employed for the introduction of the DNA or RNA construct into the host cell genome. For example, a polynucleotide encoding the tumor antigen-targeted CAR and the anti-DOTA C825 antigen binding fragment can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from an alternative internal promoter. [00228] Non-viral vectors or RNA may be used as well. Random chromosomal integration, or targeted integration (e.g., using a nuclease, transcription activator-like effector nucleases (TALENs), Zinc-finger nucleases (ZFNs), and/or clustered regularly interspaced short palindromic repeats (CRISPRs), or transgene expression (e.g., using a natural or chemically modified RNA) can be used. [00229] For initial genetic modification of the cells to provide tumor antigen-targeted CAR and the anti-DOTA C825 antigen binding fragment expressing cells, a retroviral vector is generally employed for transduction, however any other suitable viral vector or non-viral delivery system can be used. For subsequent genetic modification of the cells to provide cells comprising an antigen presenting complex comprising at least two co-stimulatory ligands, retroviral gene transfer (transduction) likewise proves effective. Combinations of retroviral vector and an appropriate packaging line are also suitable, where the capsid proteins will be functional for infecting human cells. Various amphotropic virus-producing cell lines are known, including, but not limited to, PA12 (Miller, et al., Mol. Cell. Biol.5:431-437 (1985)); PA317 (Miller, et al., Mol. Cell. Biol.6:2895-2902 (1986)); and CRIP (Danos, et al. Proc. Natl. Acad. Sci. USA 85:6460-6464 (1988)). Non -amphotropic particles are suitable too, e.g., particles pseudotyped with VSVG, RD114 or GALV envelope and any other known in the art. [00230] Possible methods of transduction also include direct co-culture of the cells with producer cells, e.g., by the method of Bregni, et al., Blood 80: 1418-1422(1992), or culturing with viral supernatant alone or concentrated vector stocks with or without appropriate growth factors and polycations, e.g., by the method of Xu, et al., Exp. Hemat.22:223-230 (1994); and Hughes, et al., J. Clin. Invest.89: 1817 (1992). [00231] Transducing viral vectors can be used to express a co-stimulatory ligand and/or secretes a cytokine (e.g., 4-1BBL and/or IL-12) in an engineered immune cell. In some embodiments, the chosen vector exhibits high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430 (1997); Kido et al., Current Eye Research 15:833-844 (1996); Bloomer et al., Journal of Virology 71 :6641- 6649, 1997; Naldini et al., Science 272:263267 (1996); and Miyoshi et al., Proc. Natl. Acad. Sci. U.S.A.94: 10319, (1997)). Other viral vectors that can be used include, for example, adenoviral, lentiviral, and adeno-associated viral vectors, vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus (also see, for example, the vectors of Miller, Human Gene Therapy 15-14, (1990); Friedman, Science 244: 1275-1281 (1989); Eglitis et al., BioTechniques 6:608-614, (1988); Tolstoshev et al., Current Opinion in Biotechnology 1:55-61(1990); Sharp, The Lancet 337: 1277-1278 (1991); Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322 (1987); Anderson, Science 226:401-409 (1984); Moen, Blood Cells 17:407-416 (1991); Miller et al., Biotechnology 7:980-990 (1989); Le Gal La Salle et al., Science 259:988-990 (1993); and Johnson, Chest 107:77S-83S (1995)). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370 (1990); Anderson et al., U.S. Pat. No.5,399,346). [00232] In certain non-limiting embodiments, the vector expressing a presently disclosed tumor antigen-targeted CAR is a retroviral vector, e.g., an oncoretroviral vector. [00233] Non-viral approaches can also be employed for the expression of a protein in cell. For example, a nucleic acid molecule can be introduced into a cell by administering the nucleic acid in the presence of lipofection (Feigner et al., Proc. Nat'l. Acad. Sci. U.S.A. 84:7413, (1987); Ono et al., Neuroscience Letters 17:259 (1990); Brigham et al., Am. J. Med. Sci.298:278, (1989); Staubinger et al., Methods in Enzymology 101 :512 (1983)), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263 : 14621 (1988); Wu et al., Journal of Biological Chemistry 264: 16985 (1989)), or by micro- injection under surgical conditions (Wolff et al., Science 247: 1465 (1990)). Other non-viral means for gene transfer include transfection in vitro using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell. Transplantation of normal genes into the affected tissues of a subject can also be accomplished by transferring a normal nucleic acid into a cultivatable cell type ex vivo (e.g., an autologous or heterologous primary cell or progeny thereof), after which the cell (or its descendants) are injected into a targeted tissue or are injected systemically. Recombinant receptors can also be derived or obtained using transposases or targeted nucleases (e.g., Zinc finger nucleases, meganucleases, or TALE nucleases). Transient expression may be obtained by RNA electroporation. [00234] cDNA expression can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element or intron (e.g., the elongation factor la enhancer/promoter/intron structure). For example, if desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers. Alternatively, if a genomic clone is used, regulation can be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above. [00235] The resulting cells can be grown under conditions similar to those for unmodified cells, whereby the modified cells can be expanded and used for a variety of purposes. Polypeptides and Analogs and Polynucleotides [00236] Also included in the presently disclosed subject matter are extracellular antigen- binding domains that specifically binds to a tumor antigen (e.g., human tumor antigen) (e.g., an scFv (e.g., a human scFv), a Fab, or a (Fab) 2 ), CD3ζ, CD8, CD28, etc. polypeptides or fragments thereof, and polynucleotides encoding thereof that are expressed in an engineered immune cell. The presently disclosed subject matter provides methods for optimizing an amino acid sequence or a nucleic acid sequence by producing an alteration in the sequence. Such alterations may comprise certain mutations, deletions, insertions, or post-translational modifications. The presently disclosed subject matter further comprises analogs of any naturally-occurring polypeptide of the presently disclosed subject matter. Analogs can differ from a naturally-occurring polypeptide of the presently disclosed subject matter by amino acid sequence differences, by post-translational modifications, or by both. Analogs of the presently disclosed subject matter can generally exhibit at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity or homology with all or part of a naturally-occurring amino acid sequence of the presently disclosed subject matter. The length of sequence comparison is at least about 5, about 10, about 15, about 20, about 25, about 50, about 75, about 100 or more amino acid residues. Again, in an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e -3 and e -100 indicating a closely related sequence. Modifications comprise in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally-occurring polypeptides of the presently disclosed subject matter by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mutagenesis by irradiation or exposure to ethanemethyl sulfate or by site-specific mutagenesis as described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2nd ed.), CSH Press, 1989, or Ausubel et al., supra). Also included are cyclized peptides, molecules, and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., beta (β) or gamma (γ) amino acids. [00237] In addition to full-length polypeptides, the presently disclosed subject matter also provides fragments of any one of the polypeptides or peptide domains of the presently disclosed subject matter. A fragment can be at least about 5, about 10, about 13, or about 15 amino acids. In some embodiments, a fragment is at least about 20 contiguous amino acids, at least about 30 contiguous amino acids, or at least about 50 contiguous amino acids. In some embodiments, a fragment is at least about 60 to about 80, about 100, about 200, about 300 or more contiguous amino acids. Fragments of the presently disclosed subject matter can be generated by methods known to those of ordinary skill in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events). [00238] Non-protein analogs have a chemical structure designed to mimic the functional activity of a protein of the present technology. Such analogs are administered according to methods of the presently disclosed subject matter. Such analogs may exceed the physiological activity of the original polypeptide. Methods of analog design are well known in the art, and synthesis of analogs can be carried out according to such methods by modifying the chemical structures such that the resultant analogs enhance the function of the original polypeptide when expressed in an engineered immune cell. These chemical modifications include, but are not limited to, substituting alternative R groups and varying the degree of saturation at specific carbon atoms of a reference polypeptide. The protein analogs can be relatively resistant to in vivo degradation, resulting in a more prolonged effect upon administration. Assays for measuring functional activity include, but are not limited to, those described in the Examples below. [00239] In accordance with the presently disclosed subject matter, the polynucleotides encoding an extracellular antigen-binding domain that specifically binds to tumor antigen (e.g., human tumor antigen) (e.g., an scFv (e.g., a human scFv), a Fab, or a (Fab) 2 ), CD3 , CD8, CD28 can be modified by codon optimization. Codon optimization can alter both naturally occurring and recombinant gene sequences to achieve the highest possible levels of productivity in any given expression system. Factors that are involved in different stages of protein expression include codon adaptability, mRNA structure, and various cis- elements in transcription and translation. Any suitable codon optimization methods or technologies that are known to ones skilled in the art can be used to modify the polynucleotides of the presently disclosed subject matter, including, but not limited to, OptimumGene™, Encor optimization, and Blue Heron. Administration [00240] Engineered immune cells expressing the tumor antigen-targeted CAR and an anti- DOTA C825 antigen binding fragment of the presently disclosed subject matter can be provided systemically or directly to a subject for diagnosing or monitoring progression of a neoplasia. In certain embodiments, engineered immune cells are directly injected into an organ of interest (e.g., an organ affected by a neoplasia). Alternatively or additionally, the engineered immune cells are provided indirectly to the organ of interest, for example, by administration into the circulatory system (e.g., the tumor vasculature) or into the solid tumor. Expansion and differentiation agents can be provided prior to, during or after administration of cells and compositions to increase production of T cells in vitro or in vivo. [00241] Engineered immune cells of the presently disclosed subject matter can be administered in any physiologically acceptable vehicle, systemically or regionally, normally intravascularly, intraperitoneally, intrathecally, or intrapleurally, although they may also be introduced into bone or other convenient site where the cells may find an appropriate site for regeneration and differentiation (e.g., thymus). In certain embodiments, at least 1 × 10 5 cells can be administered, eventually reaching 1 × 10 10 or more. In certain embodiments, at least 1 × 10 6 cells can be administered. A cell population comprising engineered immune cells can comprise a purified population of cells. Those skilled in the art can readily determine the percentage of engineered immune cells in a cell population using various well-known methods, such as fluorescence activated cell sorting (FACS). The ranges of purity in cell populations comprising engineered immune cells can be from about 50% to about 55%, from about 55% to about 60%, from about 65% to about 70%, from about 70% to about 75%, from about 75% to about 80%, from about 80% to about 85%; from about 85% to about 90%, from about 90% to about 95%, or from about 95 to about 100%. Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage). The engineered immune cells can be introduced by injection, catheter, or the like. If desired, factors can also be included, including, but not limited to, interleukins, e.g., IL-2, IL-3, IL 6, IL-11, IL-7, IL-12, IL-15, IL-21, as well as the other interleukins, the colony stimulating factors, such as G-, M- and GM-CSF, interferons, e.g., γ- interferon. [00242] In certain embodiments, compositions of the presently disclosed subject matter comprise pharmaceutical compositions comprising engineered immune cells expressing a tumor antigen-targeted CAR and an anti-DOTA C825 antigen binding fragment with a pharmaceutically acceptable carrier. Administration can be autologous or non-autologous. For example, engineered immune cells expressing a tumor antigen-targeted CAR and an anti- DOTA C825 antigen binding fragment and compositions comprising thereof can be obtained from one subject, and administered to the same subject or a different, compatible subject. Peripheral blood derived T cells of the presently disclosed subject matter or their progeny (e.g., in vivo, ex vivo or in vitro derived) can be administered via localized injection, including catheter administration, systemic injection, localized injection, intravenous injection, or parenteral administration. When administering a pharmaceutical composition of the presently disclosed subject matter (e.g., a pharmaceutical composition comprising engineered immune cells expressing a tumor antigen-targeted CAR), it can be formulated in a unit dosage injectable form (solution, suspension, emulsion). Formulations [00243] Engineered immune cells expressing a tumor antigen-targeted CAR and an anti- DOTA C825 antigen binding fragment and compositions comprising thereof can be conveniently provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof. [00244] Sterile injectable solutions can be prepared by incorporating the compositions of the presently disclosed subject matter, e.g., a composition comprising engineered immune cells, in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired. Such compositions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as “REMINGTON' S PHARMACEUTICAL SCIENCE”, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation. [00245] Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the presently disclosed subject matter, however, any vehicle, diluent, or additive used would have to be compatible with the engineered immune cells of the presently disclosed subject matter. [00246] The compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and lacrimal fluid. The desired isotonicity of the compositions of the presently disclosed subject matter may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is suitable particularly for buffers containing sodium ions. [00247] Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose can be used because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The concentration of the thickener can depend upon the agent selected. The important point is to use an amount that will achieve the selected viscosity. Obviously, the choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form). [00248] Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert and will not affect the viability or efficacy of the engineered immune cells as described in the presently disclosed subject matter. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein. [00249] One consideration concerning the use of the engineered immune cells of the presently disclosed subject matter is the quantity of cells necessary to achieve an optimal effect. The quantity of cells to be administered will vary according to the subject. In certain embodiments, from about 10 2 to about 10 12 , from about 10 3 to about 10 11 , from about 10 4 to about 10 10 , from about 10 5 to about 10 9 , or from about 10 6 to about 10 8 engineered immune cells of the presently disclosed subject matter are administered to a subject. More effective cells may be administered in even smaller numbers. In some embodiments, at least about 1 × 10 8 , about 2 × 10 8 , about 3 × 10 8 , about 4 × 10 8 , about 5 × 10 8 , about 1 × 10 9 , about 5 × 10 9 , about 1 × 10 10 , about 5 × 10 10 , about 1 × 10 11 , about 5 × 10 11 , about 1 × 10 12 or more engineered immune cells of the presently disclosed subject matter are administered to a human subject. The precise determination of what would be considered an effective dose may be based on factors individual to each subject, including their size, age, sex, weight, and condition of the particular subject. Dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art. Generally, engineered immune cells are administered at doses that are nontoxic or tolerable to the patient. [00250] The skilled artisan can readily determine the amount of cells and optional additives, vehicles, and/or carrier in compositions to be administered in methods of the presently disclosed subject matter. Typically, any additives (in addition to the active cell(s) and/or agent(s)) are present in an amount of from about 0.001% to about 50% by weight) solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as from about 0.0001 wt % to about 5 wt %, from about 0.0001 wt% to about 1 wt %, from about 0.0001 wt% to about 0.05 wt%, from about 0.001 wt% to about 20 wt %, from about 0.01 wt% to about 10 wt %, or from about 0.05 wt% to about 5 wt %. For any composition to be administered to an animal or human, and for any particular method of administration, toxicity should be determined, such as by determining the lethal dose (LD) and LD50 in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be ascertained without undue experimentation. DOTA Hapten Compositions [00251] DOTA is a macrocyclic chelating agent that forms stable metal complexes that are irreversible under physiological conditions. DOTA has a molecular weight of 405 Daltons, and exhibits rapid diffusion and renal clearance. [00252] Examples of DOTA haptens include, but are not limited to, benzyl-DOTA, NH 2 - benzyl (Bn) DOTA, DOTA-desferrioxamine, DOTA-Phe-Lys(HSG)-D-Tyr-Lys(HSG)-NH 2 , Ac-Lys(HSG)D-Tyr-Lys(HSG)-Lys(Tscg-Cys)-NH 2 , DOTA-D-Asp-D-Lys(HSG)-D-Asp-D- Lys(HSG)-NH 2 ; DOTA-D-Glu-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH 2 , DOTA-D-Tyr-D- Lys(HSG)-D-Glu-D-Lys(HSG)-NH 2 , DOTA-D-Ala-D-Lys(HSG)-D-Glu-D-Lys(HSG)- NH 2 , DOTA-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-NH 2 , Ac-D-Phe-D-Lys(DOTA)-D- Tyr-D-Lys(DOTA)-NH 2 , Ac-D-Phe-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)-NH 2 , Ac-D-Phe- D-Lys(Bz-DTPA)-D-Tyr-D-Lys(Bz-DTPA)-NH 2 , Ac-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D- Lys(Tscg-Cys)-NH 2 , DOTA-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D-Lys(Tscg-Cys)- NH 2 , (Tscg-Cys)-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D-Lys(DOTA)-NH 2 , Tscg-D- Cys-D-Glu-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH 2 , (Tscg-Cys)-D-Glu-D-Lys(HSG)-D-Glu- D-Lys(HSG)-NH 2 , Ac-D-Cys-D-Lys(DOTA)-D-Tyr-D-Ala-D-Lys(DOTA)-D-Cys-NH 2 , Ac- D-Cys-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)-NH 2 , Ac-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)- D-Lys(Tscg-Cys)-NH 2 , Ac-D-Lys(DOTA)-D-Tyr-D-Lys(DOTA)-D-Lys(Tscg-Cys)-NH 2 , DOTA-RGD, DOTA-PEG-E(c(RGDyK)) 2 , DOTA-8-AOC-BBN, DOTA-PESIN, p-NO2- benzyl-DOTA, DOTA-biotin-sarcosine (DOTA-biotin), 1,4,7,10-tetraazacyclododecane- 1,4,7,10-tetraacetic acid mono (N-hydroxysuccinimide ester) (DOTA-NHS), and DOTATyrLysDOTA. See Orcutt et al., Mol Imaging Biol. (2011) Apr; 13(2): 215–221; Cheal SM, et al. (2017) J Nucl Med, 58(11):1735-42 (describing DOTA haptens with β- emitters); Cheal SM, et al. (2018) J Nucl Med, 59:123 (α-emitters). DOTA and its variants chelate a wide range of metals including paramagnetic metals and radionuclides. Exemplary metals include indium, gallium, gadolinium, europium, terbium, copper, bismuth, and the like. [00253] In some embodiments, the DOTA hapten has the structure of Formula I O or a pharmaceutically acceptable salt thereof, wherein M 1 is 175 Lu 3+ , 45 Sc 3+ , 69 Ga 3+ , 71 Ga 3+ , 89 Y 3+ , 113 In 3+ , 115 In 3+ , 139 La 3+ , 136 Ce 3+ , 138 Ce 3+ , 140 Ce 3+ , 142 Ce 3+ , 151 Eu 3+ , 153 Eu 3+ , 159 Tb 3+ , 154 Gd 3+ , 155 Gd 3+ , 156 Gd 3+ , 157 Gd 3+ , 158 Gd 3+ , or 160 Gd 3+ ; X 1 , X 2 , X 3 , and X 4 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; X 5 , X 6 , and X 7 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; and n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22. In certain embodiments, n is 3. [00254] In some embodiments of the DOTA hapten, at least two of X 1 , X 2 , X 3 , and X 4 are each independently a lone pair of electrons. In certain embodiments of the DOTA hapten, three of X 1 , X 2 , X 3 , and X 4 are each independently a lone pair of electrons and the remaining X 1 , X 2 , X 3 , or X 4 is H. [00255] Additionally or alternatively, in some embodiments, the present disclosure provides a bischelate comprising any of the above DOTA haptens of Formula I and a radionuclide cation. In some embodiments, the DOTA hapten of Formula I can bind a radionuclide cation with a K d of about 1 pM-1 nM (e.g., about 1-10 pM; 1-100 pM; 5-50 pM; 100-500 pM; or 500 pM-1 nM). In some embodiments, the K d is in the range of about 1 nM to about 1 pM, for example, no more than about 1 nM, 950 pM, 900 pM, 850 pM, 800 pM, 750 pM, 700 pM, 650 pM, 600 pM, 550 pM, 500 pM, 450 pM, 400 pM, 350 pM, 300 pM, 250 pM, 200 pM, 150 pM, 100 pM, 90 pM, 80 pM, 70 pM, 60 pM, 50 pM, 40 pM, 30 pM, 20 pM, 10 pM, 9 pM, 8 pM, 7 pM, 6 pM, 5 pM, 4 pM, 3 pM, 2.5 pM, 2 pM, or 1 pM. In some embodiments, the bischelate is of Formula II or a pharmaceutically acceptable salt thereof, wherein M 1 is 175 Lu 3+ , 45 Sc 3+ , 69 Ga 3+ , 71 Ga 3+ , 8 9 Y 3+ , 113 In 3+ , 115 In 3+ , 139 La 3+ , 136 Ce 3+ , 138 Ce 3+ , 140 Ce 3+ , 142 Ce 3+ , 151 Eu 3+ , 153 Eu 3+ , 159 Tb 3+ , 1 54 Gd 3+ , 155 Gd 3+ , 156 Gd 3+ , 157 Gd 3+ , 158 Gd 3+ , or 160 Gd 3+ ; M 2 is the radionuclide cation; X 1 , X 2 , X 3 , and X 4 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; X 5 , X 6 , and X 7 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; and n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22. In certain embodiments, n is 3. In some embodiments of the bischelate, at least two of X 5 , X 6 , and X 7 are each independently a lone pair of electrons. Additionally or alternatively, in some embodiments of the bischelate, the radionuclide cation is a divalent cation or a trivalent cation. [00256] In any and all embodiments of the DOTA haptens disclosed herein, M 2 is 111 In, 6 7 Ga, 51 Cr, 58 Co, 99m Tc, 103m Rh, 195m Pt, 119 Sb, 161 Ho, 189m Os, 192 Ir, 201 Tl, 203 Pb, 89 Zr, 68 Ga, or 6 4 Cu. [00257] In another aspect, the present disclosure provides a complex comprising an engineered immune cell provided herein and a DOTA hapten, wherein the engineered immune cell is configured to bind to the DOTA hapten and a tumor antigen. The present disclosure also provides a complex comprising a bischelate (e.g., the bischelate of Formula II) and an engineered immune cell, wherein the engineered immune cell is configured to bind to the DOTA hapten and a tumor antigen. In any of the above embodiments of the complexes disclosed herein, the engineered immune cell expresses an anti-DOTA C825 antigen binding fragment (See Cheal et al., Mol Cancer Ther.13(7):1803-12 (2014)). Additionally or alternatively, in any of the above embodiments of the complexes disclosed herein, the engineered immune cell expresses an anti-DOTA C825 antigen binding fragment with a G54C substitution. [00258] In any of the above embodiments of the complexes disclosed herein, the tumor antigen is selected from the group consisting of 5T4, alpha 5β1-integrin, 707-AP, A33, AFP, ART-4, B7H4, BAGE, Bcl-2, β-catenin, BCMA, Bcr-abl, MN/C IX antibody, CA125, CA19- 9, CAMEL, CAP-1, CASP-8, CD4, CD5, CD19, CD20, CD21 , CD22, CD25, CDC27/m, CD33, CD37, CD45, CD52, CD56, CD80, CD123, CDK4/m, CEA, c-Met, CS-1, CT, Cyp-B, cyclin B1, DAGE, DAM, EBNA, EGFR, ErbB3, ELF2M, EMMPRIN, EpCam, ephrinB2, estrogen receptor, ETV6-AML1, FAP, ferritin, folate-binding protein, GAGE, G250, GD-2, GM2, GnT-V, gp75, gp100 (Pmel 17), HAGE, HER-2/neu, HLA-A*0201-R170I, HPV E6, HPV E7, Ki-67, HSP70-2M, HST-2, hTERT (or hTRT), iCE, IGF-1R, IL-2R, IL-5, KIAA0205, LAGE, LDLR/FUT, LRP, MAGE, MART, MART-1/melan-A, MART-2/Ski, MC1R, mesothelin, MUC, MUC16, MUM-1 -B, myc, MUM-2, MUM-3, NA88-A, NYESO- 1, NY-Eso-B, p53, proteinase-3, p190 minor bcr-abl, Pml/RARα, PRAME, progesterone receptor, PSA, PSCA, PSM, PSMA, ras, RAGE, RU1 or RU2, RORI, SART-1 or SART-3, survivin, TEL/AML1, TGFβ, TPI/m, TRP-1, TRP-2, TRP-2/INT2, tenascin, TSTA tyrosinase, VEGF, and WT1. Additionally or alternatively, in some embodiments of the complex, the anti-DOTA C825 antigen binding fragment of the engineered immune cell binds to the DOTA hapten with a K d that is lower than or equal to 100 nM-95 nM, 95-90 nM, 90-85 nM, 85-80 nM, 80-75 nM, 75-70 nM, 70-65 nM, 65-60 nM, 60-55 nM, 55-50 nM, 50- 45 nM, 45-40 nM, 40-35 nM, 35-30 nM, 30-25 nM, 25-20 nM, 20-15 nM, 15-10 nM, 10-5 nM, 5-1 nM, 1 nM-950 pM, 950 pM-900 pM, 900 pM-850 pM, 850 pM-800 pM, 800 pM- 750 pM, 750 pM-700 pM, 700 pM-650 pM, 650 pM-600 pM, 600 pM-550 pM, 550 pM-500 pM, 500 pM-450 pM, 450 pM-400 pM, 400 pM-350 pM, 350 pM-300 pM, 300 pM-250 pM, 250 pM-200 pM, 200 pM-150 pM, 150 pM-100 pM, 100 pM-50 pM, 50 pM-40 pM, 40 pM- 30 pM, 30 pM-20 pM, 20 pM-10 pM, 9 pM, 8 pM, 7 pM, 6 pM, 5 pM, 4 pM, 3 pM, 2.5 pM, 2 pM, 1.5 pM, or 1 pM. Diagnostic Methods of the Present Technology [00259] In one aspect, the present disclosure provides a method for detecting tumors (e.g., solid or liquid tumors) in a subject in need thereof comprising (a) administering to the subject an effective amount of any complex of the present technology, wherein the complex is configured to localize to a tumor expressing the tumor antigen recognized by the engineered immune cell of the complex; and (b) detecting the presence of tumors in the subject by detecting radioactive levels emitted by the complex that are higher than a reference value. Also disclosed are methods for detecting tumors (e.g., solid or liquid tumors) in a subject in need thereof comprising (a) administering to the subject an effective amount of any engineered immune cell described herein, wherein the engineered immune cell is configured to localize to a tumor expressing the tumor antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; and (c) detecting the presence of tumors in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. [00260] Additionally or alternatively, in some embodiments of the methods disclosed herein, the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected using positron emission tomography or single photon emission computed tomography. [00261] In some embodiments of the methods disclosed herein, the subject is diagnosed with, or is suspected of having cancer. Examples of cancer include, but are not limited to, adrenal cancers, bladder cancers, blood cancers, bone cancers, brain cancers, breast cancers, carcinoma, cervical cancers, colon cancers, colorectal cancers, corpus uterine cancers, ear, nose and throat (ENT) cancers, endometrial cancers, esophageal cancers, gastrointestinal cancers, head and neck cancers, Hodgkin's disease, intestinal cancers, kidney cancers, larynx cancers, leukemias, liver cancers, lymph node cancers, lymphomas, lung cancers, melanomas, mesothelioma, myelomas, nasopharynx cancers, neuroblastomas, non-Hodgkin's lymphoma, oral cancers, ovarian cancers, pancreatic cancers, penile cancers, pharynx cancers, prostate cancers, rectal cancers, sarcoma, seminomas, skin cancers, stomach cancers, teratomas, testicular cancers, thyroid cancers, uterine cancers, vaginal cancers, vascular tumors, and metastases thereof. [00262] In any of the preceding embodiments of the methods disclosed herein, the complex, the engineered immune cell, or the radiolabeled-DOTA hapten is administered intravenously, intratumorally, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously, intracerebroventricularly, orally or intranasally. Additionally or alternatively, in some embodiments, the complex, the engineered immune cell, or the radiolabeled-DOTA hapten is administered into the cerebral spinal fluid or blood of the subject. [00263] Additionally or alternatively, in some embodiments, the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected between 2 to 120 hours after the complex or the radiolabeled-DOTA hapten is administered. In certain embodiments, the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are expressed as the percentage injected dose per gram tissue ( %ID/g). The reference value may be calculated by measuring the radioactive levels present in non-tumor (normal) tissues, and computing the average radioactive levels present in non-tumor (normal) tissues ± standard deviation. In some embodiments, the reference value is the standard uptake value (SUV). See Thie JA, J Nucl Med.45(9):1431-4 (2004). Additionally or alternatively, in some embodiments, the ratio of radioactive levels between a tumor and normal tissue is about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1 or 100:1. In some embodiments, the subject is human. [00264] The radiolabeled-DOTA hapten may be administered at any time between 1 minute to 4 or more days following administration of the engineered immune cells expressing the anti-DOTA C825 antigen binding fragment. For example, in some embodiments, the radiolabeled-DOTA hapten is administered 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 1.25 hours, 1.5 hours, 1.75 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 48 hours, 72 hours, 96 hours, or any range therein, following administration of the engineered immune cells expressing the anti-DOTA C825 antigen binding fragment. Alternatively, the radiolabeled-DOTA hapten may be administered at any time after 4 or more days following administration of the engineered immune cells expressing the anti-DOTA C825 antigen binding fragment. [00265] In one aspect, the present disclosure provides a method for monitoring biodistribution of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of any engineered immune cell disclosed herein, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; and (c) determining the biodistribution of engineered immune cells in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. In another aspect, the present disclosure provides a method for monitoring biodistribution of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of a complex comprising any engineered immune cell of the present technology and a radiolabeled DOTA hapten, wherein the complex is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; and (b) determining the biodistribution of engineered immune cells in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. [00266] In yet another aspect, the present disclosure provides a method for monitoring viability of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of any engineered immune cell disclosed herein, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (d) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (e) determining that the engineered immune cells in the subject are viable when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are comparable to that observed at the first time point. In some embodiments, the method further comprises administering to the subject a second effective amount of the radiolabeled-DOTA hapten prior to step (d). Also disclosed herein is a method for monitoring viability of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of a complex comprising any engineered immune cell described herein and a radiolabeled DOTA hapten, wherein the complex is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (d) determining that the engineered immune cells in the subject are viable when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are comparable to that observed at the first time point. [00267] In yet another aspect, the present disclosure provides a method for monitoring expansion of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of any engineered immune cell described herein, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject a first effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (d) administering to the subject a second effective amount of the radiolabeled-DOTA hapten after step (c); (e) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (f) determining that the engineered immune cells in the subject have expanded when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are higher relative to that observed at the first time point. [00268] In any and all embodiments of the methods disclosed herein, the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected using positron emission tomography or single photon emission computed tomography. Additionally or alternatively, in any of the preceding embodiments of the methods disclosed herein, the engineered immune cell, the radiolabeled-DOTA hapten, or the complex is administered intratumorally, intravenously, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously, intracerebroventricularly, orally or intranasally. In some embodiments of the methods disclosed herein, the engineered immune cell(s), radiolabeled-DOTA haptens, or complexes are administered intravenously, intratumorally, intraperitoneally, subcutaneously, intramuscularly, or intratumorally. [00269] In any and all embodiments of the methods disclosed herein, the subject has a cancer or tumor selected from among carcinoma, sarcoma, a melanoma, or a hematopoietic cancer. In some embodiments, the cancer or tumor is selected from among adrenal cancers, bladder cancers, blood cancers, bone cancers, brain cancers, breast cancers, carcinoma, cervical cancers, colon cancers, colorectal cancers, corpus uterine cancers, ear, nose and throat (ENT) cancers, endometrial cancers, esophageal cancers, gastrointestinal cancers, head and neck cancers, Hodgkin's disease, intestinal cancers, kidney cancers, larynx cancers, leukemias, liver cancers, lymph node cancers, lymphomas, lung cancers, melanomas, mesothelioma, myelomas, nasopharynx cancers, neuroblastomas, non-Hodgkin's lymphoma, oral cancers, ovarian cancers, pancreatic cancers, penile cancers, pharynx cancers, prostate cancers, rectal cancers, sarcoma, seminomas, skin cancers, stomach cancers, teratomas, testicular cancers, thyroid cancers, uterine cancers, vaginal cancers, vascular tumors, and metastases thereof. Kits [00270] The present technology provides kits containing components suitable for diagnosing cancer in a patient. In one aspect, the kit comprises a composition including engineered immune cells comprising a tumor antigen-targeted receptor (e.g., a CAR) and an anti-DOTA C825 antigen binding fragment in unit dosage form. In particular embodiments, the cells further expresses at least one co-stimulatory ligand. In some embodiments, the kit comprises a sterile container; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister- packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments. If desired, the engineered immune cell can be provided together with instructions for administering the engineered immune cell to a subject having or at risk of developing a neoplasia (e.g., solid tumor). In certain embodiments, the instructions include at least one of the following: description of the diagnostic agent; dosage schedule and administration for diagnosing or monitoring progression of a neoplasia (e.g., solid tumor) or symptoms thereof; precautions; warnings; indications; counter-indications; overdose information; adverse reactions; animal pharmacology; clinical studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. [00271] In another aspect, the kits of the present technology comprise a DOTA hapten (e.g., Bn-DOTA, NH 2 -benzyl (Bn) DOTA, a bischelate of Formula II, or any of the DOTA haptens described herein etc.), at least one engineered immune cell of the present technology, and instructions for use. The kits may further comprise one or more radionuclides, such as 111 In, 67 Ga, 51 Cr, 58 Co, 99m Tc, 103m Rh, 195m Pt, 119 Sb, 161 Ho, 189m Os, 192 Ir, 201 Tl, 203 Pb, 89 Zr, 68 Ga, or 64 Cu. [00272] In some embodiments, the at least one engineered immune cell of the present technology binds to a tumor antigen target (e.g., BCMA, CD19, mesothelin, MUC16, PSCA, WT1, and PRAME). The at least one engineered immune cell of the present technology may be provided in the form of a prefilled syringe or autoinjection pen containing a sterile, liquid formulation or lyophilized preparation of the antibody (e.g., Kivitz et al., Clin. Ther. 28:1619-29 (2006)). [00273] A device capable of delivering the kit components through an administrative route may be included. Examples of such devices include syringes (for parenteral administration) or inhalation devices. [00274] The kit components may be packaged together or separated into two or more containers. In some embodiments, the containers may be vials that contain sterile, lyophilized formulations of a DOTA hapten and/or engineered immune cell composition that are suitable for reconstitution. A kit may also contain one or more buffers suitable for reconstitution and/or dilution of other reagents. Other containers that may be used include, but are not limited to, a pouch, tray, box, tube, or the like. Kit components may be packaged and maintained sterilely within the containers. EXAMPLES Example 1: Materials and Methods [00275] CAR T cell transduction. Figs.3A-3C show three different strategies to virally transduce primary human T cells with both C825 and CD19-CAR. Fig.3A show transduction with two single constructs, one encoding C825 with a GFP reporter (top) and one encoding the CD19 CAR (bottom). Fig.3B shows a bicistronic construct encoding C825 with a transmembrane domain and GFP reporter and CD19 CAR, separated by P2A cleavage site. Fig.3C shows a bicistronic construct encoding C825 with a Thy1 GPI linkage and His tag reporter and CD19 CAR, separated by a P2A cleavage site. Representative flow plots of transduction of primary human T cells are shown on the right. Example 2: In vivo Tracking of the Engineered CAR T Cells of the Present Technology in Xenograft Models [00276] CD-19 CAR-T cells were transduced with a specialized ultra-high affinity membrane expressing hapten capture antibody C825. These cells were purified and tested for surface vector expression using [ 111 In]Pr-DOTA radiohapten system prior to in vivo use, by saturation binding assay as shown in Fig.2A. CD19-expressing Raji lymphoma, a human B- cell (Burkitt’s type) lymphoma, were used as a lymphomatous tumor in immunologically deficient mice for CD19 targeting. Fig.2B shows a NSG mouse with a s.c. Raji GFP-fluc tumor in the right shoulder. Ten days after i.v. CAR-T cell injection (2.5 x 10 6 ), the mouse was injected with [ 111 In]Pr-DOTA radiohapten for in vivo tracking of CAR T cells (either: CD19 CAR + C825, or control CD19 CAR only). As shown in Fig.2C, animals treated with CD19 CAR T cells expressing C825 scFv showed effective tumor targeting in xenografts bearing Raji tumors. CAR-T cells efficiently captured radiohapten chelates with optimized pharmacology via renal clearance (data not shown). [00277] Fig.4A shows schematic structures of retroviral vectors SFG-Thor, SFG-19BBz (CAR) and SFG-C825. Fig.4B shows that there is no difference between SFG-Thor T cells and SFG-19BBz (CAR) T cells with respect to killing CD19(+) Raji tumor cells as measured by in vitro 4 h cytotoxicity assays. These results demonstrate that transducing CD19-specific CAR T cells with humanized C825 scFv did not negatively impact their ability to target and lyse CD19(+) tumor target cells. Fig.4C shows in vitro binding of [ 111 In]InPr at 1 h. This representative data set demonstrates the specific binding of the radiolabeled DOTA probe to C825-expressing T cells, whereas no significant uptake was observed in SFG-19BBz (CAR) and NT T cells. (All experiments were performed in triplicate at 37 °C). Data are mean ± SD. Fig.4D shows in vitro binding kinetics of [ 111 In]InPr to SFG-Thor T cells (n = 3 independent assays; representative example shown). Fig.4E shows an exemplary scheme of in vivo study for assessing T cell targeting to tumor cells. 68 Ga-NODAGA-Pr (100mCu, 700 pmol) was used as the radiotracer and administered 10 days after T cell administration (1×10 6 T cells) in NSG mice bearing CD19(+) Raji xenografts. Fig.4F shows exemplary Maximum intensity projection (MIP) images at 1 h post-injection (p.i.) of 68 Ga-NODAGA-Pr depicting homing and accumulation of SFG-Thor T cells at the tumor (right shoulder, red arrow). No uptake above background at the tumor site is noted following SFG-19BBz (CAR) T cell administration (blue arrow). Fig.4G shows mean uptake in tumors and tumor-to-normal- tissue-ratios (TNR) (SFG-Thor: n=4; SFG-19BBz (CAR): n=2) using image-based biodistribution. **, P < 0.01. [00278] Fig.5A shows an exemplary scheme for tracking engineered T cells in vivo in a s.c. Raji-tumor mouse model (3×10 6 cells) with established treatment failure. Seven days post tumor inoculation, mice were injected i.v. with either 3×10 6 huC825-19BBz or 3×10 6 19BBz T cells. On day 17 post T cell administration, mice demonstrating persistent growing tumor burden indicating treatment failure were i.v. injected with 86 Y-DOTA-Bn (3.7 MBq; 40 pmol) to assess persistence and localization of the transplanted T cells. Fig.5B shows Maximum intensity projection (MIP) and axial PET/CT images at 1, 3 and 16 h p.i. depict accumulation of huC825-19BBz -CAR T cells at the tumor (orange circle). Highest intratumoral T cell uptake was seen at 3 h pi of 4.9 %ID/g (vs 0.8% ID/g in control). No uptake above background at the tumor is noted in control mice (19BBz CAR; green circle). Rapid, predominant renal tracer clearance was noted. [00279] These results demonstrate that the engineered immune cells of the present technology are useful in methods for determinining the in vivo biodistribution, viability, and expansion of the engineered immune cells. EXEMPLARY EMBODIMENTS [00280] The present disclosure may be described in terms of the following non-limiting embodiments: [00281] Embodiment 1: The present application in one aspect provides an engineered immune cell comprising: (a) an anti-DOTA C825 antigen binding fragment comprising the amino acid sequence of any one of SEQ ID NOs: 35-39, 41 or 42, and/or a nucleic acid encoding the anti-DOTA C825 antigen binding fragment; and (b) a receptor that binds to a target antigen and/or a nucleic acid encoding the receptor. [00282] Embodiment 2: The engineered immune cell of Embodiment 1, wherein the receptor is a T cell receptor. [00283] Embodiment 3: The engineered immune cell of Embodiment 1 or 2, wherein the receptor is a native cell receptor. [00284] Embodiment 4: The engineered immune cell of Embodiment 1 or 2, wherein the receptor is a non-native cell receptor. [00285] Embodiment 5: The engineered immune cell of any one of Embodiments 1-4, wherein the receptor is a chimeric antigen receptor. [00286] Embodiment 6: The engineered immune cell of Embodiment 5, wherein the nucleic acid encoding the anti-DOTA C825 antigen binding fragment comprises a leader sequence for secretion of the anti-DOTA C825 antigen binding fragment. [00287] Embodiment 7: The engineered immune cell of any one of Embodiments 1-6, wherein the nucleic acid encoding the anti-DOTA C825 antigen binding fragment is operably linked to a promoter. [00288] Embodiment 8: The engineered immune cell of Embodiment 7, wherein the promoter is a constitutive promoter. [00289] Embodiment 9: The engineered immune cell of Embodiment 7, wherein the promoter is a conditional promoter. [00290] Embodiment 10: The engineered immune cell of Embodiment 9, wherein the conditional promoter is induced by binding of the receptor to the target antigen. [00291] Embodiment 11: The engineered immune cell of any one of Embodiments 1-10, wherein the target antigen is a tumor antigen. [00292] Embodiment 12: The engineered immune cell of any one of Embodiments 1-11, wherein the nucleic acid encoding the receptor is operably linked to a constitutive promoter. [00293] Embodiment 13: The engineered immune cell of any one of Embodiments 5-12, wherein the chimeric antigen receptor comprises (i) an extracellular antigen binding domain; (ii) a transmembrane domain; and (iii) an intracellular domain. [00294] Embodiment 14: The engineered immune cell of Embodiment 13, wherein the extracellular antigen binding domain binds to the target antigen. [00295] Embodiment 15: The engineered immune cell of any one of Embodiments 11-14, wherein the tumor antigen is selected from the group consisting of 5T4, alpha 5β1-integrin, 707-AP, A33, AFP, ART-4, B7H4, BAGE, Bcl-2, β-catenin, BCMA, Bcr-abl, MN/C IX antibody, CA125, CA19-9, CAMEL, CAP-1, CASP-8, CD4, CD5, CD19, CD20, CD21 , CD22, CD25, CDC27/m, CD33, CD37, CD45, CD52, CD56, CD80, CD123, CDK4/m, CEA, c-Met, CS-1, CT, Cyp-B, cyclin B1, DAGE, DAM, EBNA, EGFR, ErbB3, ELF2M, EMMPRIN, EpCam, ephrinB2, estrogen receptor, ETV6-AML1, FAP, ferritin, folate-binding protein, GAGE, G250, GD-2, GM2, GnT-V, gp75, gp100 (Pmel 17), HAGE, HER-2/neu, HLA-A*0201-R170I, HPV E6, HPV E7, Ki-67, HSP70-2M, HST-2, hTERT (or hTRT), iCE, IGF-1R, IL-2R, IL-5, KIAA0205, LAGE, LDLR/FUT, LRP, MAGE, MART, MART- 1/melan-A, MART-2/Ski, MC1R, mesothelin, MUC, MUC16, MUM-1 -B, myc, MUM-2, MUM-3, NA88-A, NYESO-1, NY-Eso-B, p53, proteinase-3, p190 minor bcr-abl, Pml/RARα, PRAME, progesterone receptor, PSA, PSCA, PSM, PSMA, ras, RAGE, RU1 or RU2, RORI, SART-1 or SART-3, survivin, TEL/AML1, TGFβ, TPI/m, TRP-1, TRP-2, TRP- 2/INT2, tenascin, TSTA tyrosinase, VEGF, and WT1. [00296] Embodiment 16: The engineered immune cell of any one of Embodiments 13-15, wherein the extracellular antigen binding domain comprises a single chain variable fragment (scFv). [00297] Embodiment 17: The engineered immune cell of any one of Embodiments 13-16, wherein the extracellular antigen binding domain comprises a human scFv. [00298] Embodiment 18: The engineered immune cell of any one of Embodiments 13-17, wherein the extracellular antigen binding domain comprises a CD19 scFv of SEQ ID NO: 3 or SEQ ID NO: 4. [00299] Embodiment 19: The engineered immune cell of any one of Embodiments 13-18, wherein the extracellular antigen binding domain comprises a CD19 scFv having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4. [00300] Embodiment 20: The engineered immune cell of any one of Embodiments 13-19, wherein the extracellular antigen binding domain comprises a signal peptide that is covalently joined to the N-terminus of the extracellular antigen binding domain. [00301] Embodiment 21: The engineered immune cell of any one of Embodiments 13-20, wherein the transmembrane domain comprises a CD8 transmembrane domain. [00302] Embodiment 22: The engineered immune cell of any one of Embodiments 13-21, wherein the intracellular domain comprises one or more costimulatory domains. [00303] Embodiment 23: The engineered immune cell of Embodiment 22, wherein the one or more costimulatory domains are selected from a CD28 costimulatory domain, a CD3ζ- chain, a 4-1BBL costimulatory domain, or any combination thereof. [00304] Embodiment 24: The engineered immune cell of any one of Embodiments 1-23, wherein the engineered immune cell is a lymphocyte. [00305] Embodiment 25: The engineered immune cell of Embodiment 24, wherein the lymphocyte is a T cell, a B cell, or a natural killer (NK) cell. [00306] Embodiment 26: The engineered immune cell of Embodiment 25, wherein the T cell is a CD4+ T cell or a CD8+ T cell. [00307] Embodiment 27: The engineered immune cell of any one of Embodiments 1-26, wherein the engineered immune cell is a tumor infiltrating lymphocyte. [00308] Embodiment 28: The engineered immune cell of any one of Embodiments 1-27, wherein the engineered immune cell is derived from an autologous donor or an allogenic donor. [00309] Embodiment 29: A polypeptide comprising a chimeric antigen receptor and an anti-DOTA C825 antigen binding fragment comprising an amino acid sequence of any one of SEQ ID NOs: 35-39, 41 or 42. [00310] Embodiment 30: The polypeptide of Embodiment 29, further comprising a self- cleaving peptide located between the anti-DOTA C825 antigen binding fragment and the chimeric antigen receptor. [00311] Embodiment 31: The polypeptide of Embodiment 30, wherein the self-cleaving peptide is a P2A self-cleaving peptide. [00312] Embodiment 32: The polypeptide of any one of Embodiments 29-31, wherein the anti-DOTA C825 antigen binding fragment comprises a leader sequence for secretion of the anti-DOTA C825 antigen binding fragment. [00313] Embodiment 33: The polypeptide of any one of Embodiments 29-32, wherein the chimeric antigen receptor comprises (i) an extracellular antigen binding domain; (ii) a transmembrane domain; and (iii) an intracellular domain. [00314] Embodiment 34: The polypeptide of Embodiment 33, wherein the extracellular antigen binding domain binds to a tumor antigen. [00315] Embodiment 35: The polypeptide of Embodiment 34, wherein the tumor antigen is selected from among MUC16, mesothelin, CD19, WT1, PSCA, and BCMA. [00316] Embodiment 36: The polypeptide of any one of Embodiments 33-35, wherein the extracellular antigen binding domain comprises a single chain variable fragment (scFv). [00317] Embodiment 37: The polypeptide of any one of Embodiments 33-36, wherein the extracellular antigen binding domain comprises a CD19 scFv of SEQ ID NO: 3 or SEQ ID NO: 4. [00318] Embodiment 38: The polypeptide of any one of Embodiments 33-37, wherein the extracellular antigen binding domain comprises a CD19 scFv having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4. [00319] Embodiment 39: The polypeptide of any one of Embodiments 33-38, wherein the transmembrane domain comprises a CD8 transmembrane domain. [00320] Embodiment 40: The polypeptide of any one of Embodiments 33-39, wherein the intracellular domain comprises one or more costimulatory domains. [00321] Embodiment 41: The polypeptide of Embodiment 40, wherein the one or more costimulatory domains are selected from a CD28 costimulatory domain, a CD3ζ-chain, a 4- 1BBL costimulatory domain, or any combination thereof. [00322] Embodiment 42: A nucleic acid encoding the polypeptide of any one of Embodiments 29-41. [00323] Embodiment 43: The nucleic acid of Embodiment 42, wherein the nucleic acid encoding the polypeptide is operably linked to a promoter. [00324] Embodiment 44: The nucleic acid of Embodiment 43, wherein the promoter is a constitutive promoter. [00325] Embodiment 45: The nucleic acid of Embodiment 43, wherein the promoter is a conditional promoter. [00326] Embodiment 46: The nucleic acid of Embodiment 45, wherein the conditional promoter is inducible by the chimeric antigen receptor binding to an antigen. [00327] Embodiment 47: A vector comprising the nucleic acid of any one of Embodiments 42-46. [00328] Embodiment 48: The vector of Embodiment 47, wherein the vector is a viral vector or a plasmid. [00329] Embodiment 49: The vector of Embodiment 47, wherein the vector is a retroviral vector. [00330] Embodiment 50: A host cell comprising the nucleic acid of any one of Embodiments 42-46 or the vector of any one of Embodiments 47-49. [00331] Embodiment 51: A complex comprising the engineered immune cell of any one of Embodiments 1-28 and a DOTA hapten, wherein the engineered immune cell is configured to bind to the DOTA hapten and a tumor antigen. [00332] Embodiment 52: The complex of Embodiment 51, wherein the DOTA hapten is benzyl-DOTA, NH2-benzyl (Bn) DOTA, DOTA-desferrioxamine, DOTA-Phe-Lys(HSG)-D- Tyr-Lys(HSG)-NH2, Ac-Lys(HSG)D-Tyr-Lys(HSG)-Lys(Tscg-Cys)-NH2, DOTA-D-Asp- D-Lys(HSG)-D-Asp-D-Lys(HSG)-NH2; DOTA-D-Glu-D-Lys(HSG)-D-Glu-D-Lys(HSG)- NH2, DOTA-D-Tyr-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, DOTA-D-Ala-D-Lys(HSG)-D- Glu-D-Lys(HSG)-NH2, DOTA-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-NH2, Ac-D-Phe- D-Lys(DOTA)-D-Tyr-D-Lys(DOTA)-NH2, Ac-D-Phe-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)- NH2, Ac-D-Phe-D-Lys(Bz-DTPA)-D-Tyr-D-Lys(Bz-DTPA)-NH2, Ac-D-Lys(HSG)-D-Tyr- D-Lys(HSG)-D-Lys(Tscg-Cys)-NH2, DOTA-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D- Lys(Tscg-Cys)-NH2, (Tscg-Cys)-D-Phe-D-Lys(HSG)-D-Tyr-D-Lys(HSG)-D-Lys(DOTA)- NH2, Tscg-D-Cys-D-Glu-D-Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, (Tscg-Cys)-D-Glu-D- Lys(HSG)-D-Glu-D-Lys(HSG)-NH2, Ac-D-Cys-D-Lys(DOTA)-D-Tyr-D-Ala-D- Lys(DOTA)-D-Cys-NH2, Ac-D-Cys-D-Lys(DTPA)-D-Tyr-D-Lys(DTPA)-NH2, Ac-D- Lys(DTPA)-D-Tyr-D-Lys(DTPA)-D-Lys(Tscg-Cys)-NH2, Ac-D-Lys(DOTA)-D-Tyr-D- Lys(DOTA)-D-Lys(Tscg-Cys)-NH2, DOTA-RGD, DOTA-PEG-E(c(RGDyK))2, DOTA-8- AOC-BBN, DOTA-PESIN, p-NO2-benzyl-DOTA, DOTA-biotin-sarcosine (DOTA-biotin), 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid mono (N-hydroxysuccinimide ester) (DOTA-NHS), or DOTATyrLysDOTA. [00333] Embodiment 53: The complex of Embodiment 51, wherein the DOTA hapten has the structure of Formula II
pharmaceutically acceptable salt thereof, wherein M 1 is 175 Lu 3+ , 45 Sc 3+ , 69 Ga 3+ , 71 Ga 3+ , 89 Y 3+ , 1 13 In 3+ , 115 In 3+ , 139 La 3+ , 136 Ce 3+ , 138 Ce 3+ , 140 Ce 3+ , 142 Ce 3+ , 151 Eu 3+ , 153 Eu 3+ , 159 Tb 3+ , 154 Gd 3+ , 1 55 Gd 3+ , 156 Gd 3+ , 157 Gd 3+ , 158 Gd 3+ , or 160 Gd 3+ ; M 2 is a radionuclide cation; X 1 , X 2 , X 3 , and X 4 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; X 5 , X 6 , and X 7 are each independently a lone pair of electrons (i.e., providing an oxygen anion) or H; and n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22. [00334] Embodiment 54: The complex of any one of Embodiments 51-53, wherein M 2 is 1 11 In, 67 Ga, 51 Cr, 58 Co, 99m Tc, 103m Rh, 195m Pt, 119 Sb, 161 Ho, 189m Os, 192 Ir, 201 Tl, 203 Pb, 89 Zr, 68 Ga, or 64 Cu. [00335] Embodiment 55: A method for detecting tumors in a subject in need thereof comprising (a) administering to the subject an effective amount of the complex of Embodiment 54, wherein the complex is configured to localize to a tumor expressing the tumor antigen recognized by the engineered immune cell of the complex; and (b) detecting the presence of tumors in the subject by detecting radioactive levels emitted by the complex that are higher than a reference value. [00336] Embodiment 56: A method for detecting tumors in a subject in need thereof comprising (a) administering to the subject an effective amount of the engineered immune cell of any one of Embodiments 11-28, wherein the engineered immune cell is configured to localize to a tumor expressing the tumor antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; and (c) detecting the presence of tumors in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. [00337] Embodiment 57: The method of Embodiment 55 or 56, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected using positron emission tomography or single photon emission computed tomography. [00338] Embodiment 58: The method of any one of Embodiments 55-57, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected between 4 to 24 hours after the complex or the radiolabeled-DOTA hapten is administered. [00339] Embodiment 59: The method of any one of Embodiments 55-58, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are expressed as the percentage injected dose per gram tissue ( %ID/g). [00340] Embodiment 60: The method of any one of Embodiments 55-59, wherein the ratio of radioactive levels between a tumor and normal tissue is about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1 or 100:1. [00341] Embodiment 61: The method of any one of Embodiments 55-60, wherein the subject is diagnosed with, or is suspected of having cancer. [00342] Embodiment 62: The method of Embodiment 61, wherein the cancer is selected from the group consisting of adrenal cancers, bladder cancers, blood cancers, bone cancers, brain cancers, breast cancers, carcinoma, cervical cancers, colon cancers, colorectal cancers, corpus uterine cancers, ear, nose and throat (ENT) cancers, endometrial cancers, esophageal cancers, gastrointestinal cancers, head and neck cancers, Hodgkin's disease, intestinal cancers, kidney cancers, larynx cancers, leukemias, liver cancers, lymph node cancers, lymphomas, lung cancers, melanomas, mesothelioma, myelomas, nasopharynx cancers, neuroblastomas, non-Hodgkin's lymphoma, oral cancers, ovarian cancers, pancreatic cancers, penile cancers, pharynx cancers, prostate cancers, rectal cancers, sarcoma, seminomas, skin cancers, stomach cancers, teratomas, testicular cancers, thyroid cancers, uterine cancers, vaginal cancers, vascular tumors, and metastases thereof. [00343] Embodiment 63: The method of any one of Embodiments 55-62, wherein the complex, the engineered immune cell, or the radiolabeled-DOTA hapten is administered intravenously, intratumorally, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously, intracerebroventricularly, orally or intranasally. [00344] Embodiment 64: The method of any one of Embodiments 55-63, wherein the complex, the engineered immune cell, or the radiolabeled-DOTA hapten is administered into the cerebral spinal fluid or blood of the subject. [00345] Embodiment 65: A method for monitoring biodistribution of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of the engineered immune cell of any one of Embodiments 1-28, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; and (c) determining the biodistribution of engineered immune cells in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. [00346] Embodiment 66: A method for monitoring biodistribution of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of a complex comprising the engineered immune cell of any one of Embodiments 1-28 and a radiolabeled DOTA hapten, wherein the complex is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; and (b) determining the biodistribution of engineered immune cells in the subject by detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value. [00347] Embodiment 67: A method for monitoring viability of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of the engineered immune cell of any one of Embodiments 1-28, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject an effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (d) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (e) determining that the engineered immune cells in the subject are viable when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are comparable to that observed at the first time point. [00348] Embodiment 68: The method of Embodiment 67, further comprising administering to the subject a second effective amount of the radiolabeled-DOTA hapten prior to step (d). [00349] Embodiment 69: A method for monitoring viability of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of a complex comprising the engineered immune cell of any one of Embodiments 1-28 and a radiolabeled DOTA hapten, wherein the complex is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (d) determining that the engineered immune cells in the subject are viable when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are comparable to that observed at the first time point. [00350] Embodiment 70: A method for monitoring expansion of engineered immune cells in a subject comprising: (a) administering to the subject an effective amount of the engineered immune cell of any one of Embodiments 1-28, wherein the engineered immune cell is configured to localize to a tissue expressing the target antigen recognized by the engineered immune cell; (b) administering to the subject a first effective amount of a radiolabeled-DOTA hapten, wherein the radiolabeled-DOTA hapten is configured to bind to the anti-DOTA C825 antigen binding fragment expressed by the engineered immune cell; (c) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a first time point; (d) administering to the subject a second effective amount of the radiolabeled-DOTA hapten after step (c); (e) detecting radioactive levels emitted by the radiolabeled-DOTA hapten that are higher than a reference value at a second time point; and (f) determining that the engineered immune cells in the subject have expanded when the radioactive levels emitted by the radiolabeled-DOTA hapten at the second time point are higher relative to that observed at the first time point. [00351] Embodiment 71: The method of any one of Embodiments 65-70, wherein the radioactive levels emitted by the complex or the radiolabeled-DOTA hapten are detected using positron emission tomography or single photon emission computed tomography. [00352] Embodiment 72: The method of any one of Embodiments 65-71, wherein the engineered immune cell, the radiolabeled-DOTA hapten, or the complex is administered intravenously, intraperitoneally, subcutaneously, intramuscularly, or intratumorally. [00353] Embodiment 73: The method of any one of Embodiments 65-72, wherein the cancer is a carcinoma, a sarcoma, a melanoma, or a hematopoietic cancer. [00354] Embodiment 74: The method of any one of Embodiments 65-73, wherein the cancer is selected from among adrenal cancers, bladder cancers, blood cancers, bone cancers, brain cancers, breast cancers, carcinoma, cervical cancers, colon cancers, colorectal cancers, corpus uterine cancers, ear, nose and throat (ENT) cancers, endometrial cancers, esophageal cancers, gastrointestinal cancers, head and neck cancers, Hodgkin's disease, intestinal cancers, kidney cancers, larynx cancers, leukemias, liver cancers, lymph node cancers, lymphomas, lung cancers, melanomas, mesothelioma, myelomas, nasopharynx cancers, neuroblastomas, non-Hodgkin's lymphoma, oral cancers, ovarian cancers, pancreatic cancers, penile cancers, pharynx cancers, prostate cancers, rectal cancers, sarcoma, seminomas, skin cancers, stomach cancers, teratomas, testicular cancers, thyroid cancers, uterine cancers, vaginal cancers, vascular tumors, and metastases thereof. [00355] Embodiment 75: A kit comprising the engineered immune cell of any one of Embodiments 1-28, and instructions for diagnosing or monitoring the progression of cancer. EQUIVALENTS [00356] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. [00357] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group. [00358] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth. [00359] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.