CEREBROVASCULAR EVENTS IN COVID-19

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 63/400,446, filed on August 24, 2022, the entire contents of which are incorporated herein in their entirety by this reference.

BACKGROUND OF THE INVENTION

Cerebrovascular (CBV) events are a major complication of COVID-19. Between 0.5% and 5% of COVID- 19-positive subjects suffer a cerebrovascular (CBV) event (e.g., acute ischemic stroke, intracerebral hemorrhage, and cerebral venous sinus thrombosis). In a retrospective observational study, COVID-19 subjects had more severe strokes than those subjects who did not have COVID-19 (World Wide Web at acc.org/latest-in-cardiology/journal- scans/2020/12/18/19/24/acute-cerebrovascular-events-with-cov id; last visited July 18, 2022). COVID- 19-positive stroke subjects, relative to COVID- 19-negative stroke subjects, have higher mortality rates, worse functional outcomes at discharge, and longer hospital stays (Tsivgoulis et al. (2020) Ther. Adv. Neurol Disord., 13:1756286420978004).

Despite the prevalence and severity of CBV events in COVID-19 patients, there are no established biomarkers that can be used to determine the risk of a CBV event in a subject that has or has had COVID-19. Furthermore, while the levels of microRNAs (miRNAs) within extracellular vesicles (EVs) have been shown to be useful diagnostic and prognostic biomarkers in a number of disease states, EVs miRNAs have never been investigated in COVID-19. There is a huge gap between the demand and the supply of reliable biomarkers that can predict COVID-19 complications, especially considering the unpredictable impact of "long COVID-19" (chronic sequelae of COVID-19).

SUMMARY OF THE INVENTION

The present invention is based, at least in part, on the discovery that plasma levels of miRNA-24 (miR-24) are particularly useful in identifying COVID-19 patients who are at risk for a CBV event. Provided herein are methods of detecting miR-24; methods of identifying COVID-19 patients who are at risk for a CBV event; and methods of preventing or treating a CBV event in said patients.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows miR-24 levels measured within endothelial extracellular vesicles (EC- EV), identified by the endothelial marker CD31. Cerebrovascular (CB V) events were divided in events with no findings at imaging evaluation, which included transient ischemic attacks (TIA) and migraine (blue bars), and ischemic or hemorrhagic stroke confirmed by imaging (red bars). Data are represented as mean ± SE; * P < 0.05 vs NO CBV; # P < 0.05 vs COVID-19 Negative.

DETAILED DESCRIPTION OF THE INVENTION

Emerging evidence indicates that microRNAs (miRNAs) are involved in a number of physiologic and pathologic processes. However, miRNAs have not yet been investigated in COVID-19 patients. MiR-24 is expressed in human brain endothelial cells (ECs) and targets neuropilin- 1, a co-factor needed for SARS-CoV-2 internalization. The present disclosure demonstrates an association between the plasma level of endothelial extracellular vesicle (EV) miR-24 and the onset of CBV events in COVID-19 patients. Thus, miR-24 level provides an important diagnostic tool in identifying COVID-19 patients who are at risk for a CBV event. The identified patients can be treated with various therapies of the present disclosure or those known in the art to prevent and/or treat a CBV event.

Definitions

The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

The term “complementary” refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds (“base pairing”) with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.

The term “extracellular vesicle” or “EV” refers to a lipid-based microparticle or nanoparticle present in a sample (e.g., a biological fluid, body fluid) obtained from a subject. EVs can be referred to as exosomes, microvesicles, and nanovesicles. An EV is generally between about 20 nm to about 90 nm in diameter. EVs are derived from a variety of different mammalian cell types, and can be secreted or shed from such cells.

A “kit” is any manufacture (e.g. a package or container) comprising at least one reagent, e.g. a probe for miR-24 or miR-24, for collecting, isolating, processing, and/or detecting EVs and/or the level of miR-24 therein. In certain embodiments, the kit may further comprise a reference standard, e.g., miR-24 in an amount known to identify COVID-19 patients at risk for a CBV event (e.g., positive control for a diagnostic assay) or miR-24 in an amount known to identify COVID-19 patients who are not at risk for a CBV event (e.g., a negative control for a diagnostic assay). The kit may be promoted, distributed, or sold as a unit for performing the methods encompassed by the present invention. Reagents in the kit may be provided in individual containers or as mixtures of two or more reagents in a single container. In addition, instructional materials which describe the use of the compositions within the kit can be included.

As used herein, “subject” refers to any animal, e.g., a mammal or a human, e.g., healthy or diseased. In preferred embodiments, the subject is a COVID- 19-positive subject and/or a subject with long COVID. In some embodiments, a subject has a family history of developing a CBV event. In some embodiments, a subject has not experienced a CBV event. The term “subject” is interchangeable with “patient”. The term “non-human animal” includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dog, cat, cow, chickens, amphibians, reptiles, etc.

The term “predictive” includes the use of a biomarker nucleic acid status, e.g., over- or under- activity, expression before, during or after therapy, for determining the likelihood of a CBV event. Such predictive use of the biomarker may be confirmed by, e.g., (1) its absolute or relatively modulated presence or absence in a biological sample, e.g., a sample comprising whole blood, serum, or plasma from a subject, e.g. a human afflicted with COVID-19; (2) its absolute or relatively modulated presence or absence in clinical subset of subjects with COVID-19.

Extracellular Vesicles (EVs)

EVs are cell-derived vesicles with a closed double-layer membrane structure. According to their size and density, EVs mainly include exosomes (30-150 nm), micro vesicles (MVs) (100-1000 nm), and apoptotic bodies or cancer related oncosomes (1-10 pm). EVs exist in virtually all human body fluids included, but not limited to, whole blood, serum, plasma, urine, saliva, etc. EVs are able to carry various molecules, such as proteins, lipids and RNAs on their surface as well as within their lumen. The EV and exosomal surface proteins can mediate organ-specific homing of circulating EVs and exosomes. EVs can comprise biomarkers that can indicate the source from which the EVs are derived. For example, CD31 is a marker often seen on the surface of endothelial cells, and CD31+ EVs can be derived from such cells. As used herein, the term “extracellular vesicles” or “EVs” includes all cell-derived vesicles with a closed double-layer membrane structure derived from multivescular bodies or from the plasma membrane, including exosomes, microvesicles, and apoptotic bodies.

As demonstrated herein, the contents of EVs (e.g., miR-24) are able to serve as novel biomarkers for use in the diagnosis, prognosis, and prediction of conditions (i.e., cerebrovascular (CBV) events) in COVID-19 subjects.

In some embodiments, miRNA in a sample is analyzed without partitioning the EVs. In other embodiments, a sample is processed to partition EVs present therein prior to analysis for the level of miRNAs.

ISOLATION AND QUANTIFICATION OF EXTRACELLULAR VESICLES

EVs circulate in blood and many other body fluids, with typical concentrations of between 10 ⁹ - 10 ¹² vesicles/ml blood. EVs are generally stable and can tolerate multiple cycles of freezing and thawing while preserving structure and molecular contents. Thus, EVs offer a robust source to discover blood-based biomarkers for clinical use. EVs may be directly assayed from the biological samples, such that the level of EVs is determined or the one or more biomarkers in the EV lumen are determined without prior isolation, purification, or concentration of the EVs.

In some embodiments, a sample is processed to partition EVs present therein prior to analysis for the presence and/or level of miRNAs, which may increase sensitivity of the detection, especially if the miRNA copy number is less than 20 copies.

Alternatively, in some embodiments, EVs may be purified or concentrated prior to analysis. Analysis of EVs can include quantifying the amount of one or more EV populations in a biological sample. For example, a heterogeneous population of EVs can be quantified, or a homogeneous population of EVs, such as a population of EVs with a particular biomarker profile (i.e., CD31+), or derived from a particular cell type (cell-of- origin specific EVs) can be isolated from a heterogeneous population of EVs and quantified. Analysis of an EV can also include detecting, quantitatively or qualitatively, a particular biomarker profile or a bio-signature, of an EV. An enriched population of EVs can be obtained from a biological sample derived from any cell or cells capable of producing and releasing EVs into the bodily fluid.

Any methods known in the art can be used to partition EVs. For example, kits that allow EV partitioning are available commercially from vendors, e.g., CD31 MicroBeads (130-091-935; Miltenyi Biotec), Mojosort Magnetic beads from Biolegends (Cat#480016); MagCapture Tim 4 Exosome isolation kit from Fujifilm (Cat#293-77601); Dynabeads MyOne T1 Carboxylic Acid beads from Thermofisher (Cat#65011); Dynabeads Streptavidin MyOne T1 beads from ThermoFisher (Cat#10606D); ExoEasy exosome purification kit from Qiagen (Cat#76064); Plasma/serum exosome purification kit from Nbrgen Biotek (Cat#57400); ExoQuick purification reagent from SBI (Cat#EXOQ5TM-l). Also known in the art are traditional methods involving sedimentation of small extracellular vesicles (small EVs) using ultracentrifugation (see e.g., Lane et al. (2017) Methods Mol Biol, 1660:111-130), which is incorporated herein by reference. Alternatively, a method comprising Extracellular Vesicle Capture by AnTibody of Choice and Enzymatic Release may be used (see, e.g., Mitchell et al. (2021) J Extracell Vesicles, 10:el2110), which is incorporated herein by reference. In some embodiments, physical properties of extracellular vesicles may be employed to separate them from a medium or other source material, including separation on the basis of electrical charge (e.g., electrophoretic separation, ion-exchange chromatography), size (e.g., filtration, size-exclusion chromatography, molecular sieving, etc.), density (e.g., regular or gradient centrifugation), Svedberg constant (e.g., sedimentation with or without external force, etc.).

In some embodiments of the present disclosure, EVs can be isolated or captured by using a lipophilic capture agent. In other embodiments of the present disclosure, EVs can be isolated or captured using an antibody having an affinity for the particular molecule on the surface of the extracellular vesicle to bind to the molecule. Antibodies that specifically bind CD31 can be used as marker to capture EVs derived from endothelial cells. In some embodiments the capture antibody is a monoclonal antibody. In some embodiments, the antibody is a polyclonal antibody. In some embodiments, other proteins serve as the markers used to isolate EVs. For example, tetraspanins have been widely used as markers to capture EVs, as they are found in a significant amount of EVs from many different origins. In some embodiments, the capture antibody having an affinity for the proteins associated with an EV may be tethered to a substrate or bound to a second molecule (e.g., magnetic beads) that allows for isolation of the capture antibody-EV complex. For example, in some embodiments of the present disclosure, the capture antibody is tethered to a surface of an array.

In some embodiments, EVs are isolated based on one or more biological properties, and include methods that can employ surface markers (e.g., precipitation, reversible binding to solid phase, fluorescence assisted cell sorting (FACS), separation using magnetic beads or other surfaces, immunoprecipitation or other antibody-mediated separation techniques, etc.). In some embodiments, an antibody or aptamer that specifically binds to CD31 comprises a label such that upon binding to CD31+ EVs, the vesicles are detectable.

Methods for Detecting miRNA

The present application encompasses the correlation of miR-24 and cerebrovascular (CBV) events. miR-24 is a 68-nucleotide long RNA molecule that are processed into a 22- nucleotide mature RNA. The mature miR-24 is incorporated into a RNA-induced silencing complex (RISC) that targets mRNAs through imperfect base pairing with the miRNA. The 68-nucleotide long miR-24 precursor or any portion thereof may be used to determine the level of miR-24 in a sample. In some embodiments, the 22-nucleotide mature miR-24 is used to determine the level of miR-24 in a sample.

SEQ ID NO: 1 provides an exemplary nucleic acid sequence of miR-24 (68 nucleotide). >NR_029496.1 Homo sapiens microRNA 24-1 (MIR24-1), microRNA CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAGTTCA GCAGGAACAGGAG (SEQ ID NO: 1)

*The above sequence includes RNA nucleic acid molecules (e.g., thymidine replaced with uridine), nucleic acid molecules encoding orthologs of the encoded proteins, as well as DNA, cDNA, or RNA nucleic acid sequences comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of SEQ ID NO: 1, or a portion thereof (e.g., fragments thereof, e.g., fragments comprising the mature 22-nucleotide-long miR-24). Also included are complementary sequences. Such nucleic acid molecules can be useful in detecting the presence and/or level of miRNA-24 for the methods described herein.

Oligonucleotide or modified oligonucleotide (e.g. locked nucleic acid) probes that hybridize to a target RNA are contemplated in the present invention. Oligonucleotides can be generated using the target sequence provided herein or known in the art. Methods for designing and producing oligonucleotide probes are well known in the art (see, e.g., Wernersson et al. (2007) Nat Protoc. 2(11):2677-91). In some embodiments, the oligonucleotide probes are used as primers for an amplification assay (e.g., RT-PCR, isothermal amplification, etc.). In some embodiments, the oligonucleotides are detectably labeled (e.g., with a fluorescent peptide or molecule).

Numerous methods for analyzing RNA levels in a sample are known in the art. Examples of assays include but are not limited to multiplex bead-based assays, RNA-seq, next generation sequencing, sequencing, mass spectrometry (e.g., RNA sequencing by LC- MS, cDNA sequencing by LC-MS), microarray, Southern blotting of the cDNA of miRNA, Northern blotting, PCR, RT-PCR, realtime PCR (e.g., TaqMan®), any variation thereof, or any combination of two or more thereof. Accordingly, any methods described herein or those known in the art can be used to collect, analyze, and detect miRNAs from EVs. SEQUENCING Any of a variety of sequencing reactions known in the art can be used to directly sequence the miRNAs or their complementary DNA (cDNA) counterpart. Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert (1977) Proc. Natl. Acad. Sci. USA 74:560 or Sanger (1977) Proc. Natl. Acad Set. USA 74:5463. It is also contemplated that any of a variety of automated sequencing procedures can be utilized (Naeve (1995) Biotechniques 19:448-53), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36: 127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38: 147-159). Notably, mass spectrometry (e.g., LC-MS, LC-MS/MS) may be used to sequence DNA (see Chowdhury and Guengerich (2013) Curr Protoc Nucleic Acid Chem 7:Unit-7.1611) or RNA (Zhang et al. (2019) Nucleic Acids Research 47:el25).

In certain embodiments, detection of miRNA can be accomplished using methods including, but not limited to, sequencing by hybridization (SBH), sequencing by ligation (SBL), quantitative incremental fluorescent nucleotide addition sequencing (QIFNAS), pyrosequencing, fluorescent in situ sequencing (FISSEQ), FISSEQ beads (U.S. Pat. No. 7,425,431), wobble sequencing (PCT/US05/27695), multiplex sequencing (U.S. Ser. No. 12/027,039, filed Feb. 6, 2008; Porreca et al. (2007) Nat. Methods 4:931), polymerized colony (POLONY) sequencing (U.S. Pat. Nos. 6,432,360, 6,485,944 and 6,511,803, and PCT/US05/06425); nanogrid rolling circle sequencing (ROLONY) (U.S. Ser. No. 12/120,541, filed May 14, 2008), and the like. High-throughput sequencing methods, e.g., on cyclic array sequencing using platforms such as Roche 454, Illumina Solexa or MiSeq or HiSeq, AB-SOLiD, Helicos, Polonator platforms and the like, can also be utilized. High- throughput sequencing methods are described in U.S. Ser. No. 61/162,913, filed Mar. 24, 2009. A variety of light-based sequencing technologies are known in the art (Landegren et al. (1998) Genome Res. 8:769-76; Kwok (2000) Pharmocogenom. 1 :95-100; and Shi (2001) Clin. Chem. 47:164-172) (see, for example, U.S. Pat. Publ. Nos. 2013/0274117, 2013/0137587, and 2011/0039304).

Next-generation sequencing (NGS) is a technology for determining the sequence of DNA or RNA to study genetic variation associated with diseases or other biological phenomena. Introduced for commercial use in 2005, this method was initially called “massively-parallel sequencing”, because it enabled the sequencing of many DNA strands at the same time, instead of one at a time as with traditional Sanger sequencing by capillary electrophoresis (CE). Because of the speed, throughput, and accuracy of NGS, NGS enables the interrogation of hundreds to thousands of miRNAs or their cDNA counterparts at one time in multiple samples, as well as discovery and analysis of different types of genomic features in a single sequencing run, from single nucleotide variants (SNVs), to copy number and structural variants, and even RNA fusions. NGS provides the ideal throughput per run, and studies can be performed quickly and cost-effectively. Additional advantages of NGS include lower sample input requirements, higher accuracy, and ability to detect variants at lower allele frequencies than with Sanger sequencing.

Analyzing the whole genome using next-generation sequencing (NGS) delivers a base-by-base view of all genomic alterations, including single nucleotide variants (SNV), insertions and deletions, copy number changes, and structural variations. Paired-end wholegenome sequencing involves sequencing both ends of a DNA fragment, which increases the likelihood of alignment to the reference and facilitates detection of genomic rearrangements, repetitive sequences, and gene fusions.

In some embodiments, the Illumina “Phased Sequencing” platform, which employs a combination of long and short pair-ends, can be used. In other embodiments, the third- generation single-molecule sequencing technologies (e.g., ONT and PacBio) can produce much longer reads of DNA sequences.

In some embodiments, the “Deep Sequencing” or high-coverage version of Illumina NGS can be used. Deep Sequencing refers to sequencing a sample multiple times, sometimes hundreds or even thousands of times. The Deep Sequencing allows detection of miRNA, rare clonal types, cells, or microbes comprising as little as 1% of the original sample. Illumina’s NovaSeq performs such whole-genome sequencing efficiently and cost- effectively, and its scalable output generates up to 6 Tb and 20 billion reads in dual flow cell mode with simple streamlined automated workflows.

RNA-SEQ

RNA-seq allows for high throughput next generation sequencing (NGS), providing both qualitative and quantitative information about the different RNA species present in a given sample. There are many different types of RNA-seq. Direct RNA-seq sequences the RNA in a sample directly. This method avoids the bias introduced by complementary DNA (cDNA) synthesis, polymerase chain reaction (PCR), or adaptor ligation. However, RNA is an unstable molecule, so often RNA-seq workflows begin with conversion of RNA into cDNA. MICROARRAY

In certain embodiments, detection of miRNA can be accomplished using microarrays.

High-throughput microarrays have been developed to identify and detect miRNAs in a variety of samples, e.g., tissue and cell types (see, e.g., Babak et al., RNA 10: 1813 (2004); Calin et al., Proc. Natl. Acad. Sci. USA 101 : 11755 (2004); Liu et al., Proc. Natl. Acad. Sci. USA 101 :9740 (2004); Miska et al., Genome Biol. 5:R68 (2004); Sioud and Rosok, BioTechniques 37:574

(2004); Krichevsky et al., RNA 9:1274 (2003)). The use of microarrays has several advantages for detection of miRNA expression, including the ability to determine the presence and/or level of multiple miRNAs in the same sample at a single time point, a need for only small amounts of RNA, and the potential to simultaneously identify the expression of both precursor and mature miRNA molecules.

In some embodiments, covalent attachment of fluorophores can be used to directly label miRNA molecules for use in microarray analyses (see, e.g., Babak et al., RNA 10: 1813 (2004); MICROMAX ASAP miRNA Chemical Labeling Kit, Perkin Elmer, Shelton, CT; Label IT® pArray Labeling Kit, Minis Bio Corp., Madison, WI). In other embodiments, random primed-reverse transcription of miRNA molecules can be used to produce labeled cDNA molecules for use in microarray analyses (see, e.g., Sioud and Rosok, BioTechniques 37:574 (2004); Liu et al. , Proc. Natl. Acad. Sci. USA 101 :9740 (2004)).

Significant Level

The “level” or “amount” of a biomarker (e.g., miRNAs) in a subject is “significantly” higher or lower than the level of a biomarker in a control (e.g., normal sample), if the amount of the biomarker is greater or less, respectively, than the level in a control by an amount greater than the standard error of the assay employed to assess amount.

In some embodiments, the amount or level of a biomarker in a subject can be considered “significantly” higher or lower than the normal and/or control amount if the amount is at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000%, 1500%, 2000%, 2500%, 3000%, or more, or any range in between, such as 1%- 100%, higher or lower, respectively, than the normal and/or control amount of the biomarker. Such significant modulation values can be applied to any metric described herein, such as the level of miRNA.

Control

A control refers to any reference standard suitable to provide a comparison to the level of products in the test sample. In certain embodiments, the control comprises obtaining a control sample from which the level of miRNA is detected and compared to the same from the test sample. Such a control sample may comprise any suitable sample, including but not limited to a sample from a control healthy patient (can be stored sample or previous sample measurement) with a known outcome. In some embodiments, the control may comprise a reference standard expression product (e.g., miRNA) level from any suitable source, including but not limited to an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, a healthy subject, a COVID- 19-negative subject, a subject without a CBV event, a COVID- 19-positive subject without a CBV event, etc.) or receiving a certain treatment (for example, COVID-19 therapy). In some embodiments, the control comprises samples drawn or collected longitudinally at different times, to evaluate a change in the level of miRNA over time. It will be understood by those of skill in the art that such control samples and reference standard expression product levels can be used in combination as controls in the methods of the present disclosure.

In some embodiments, the amount of miRNA may be determined within a sample relative to, or as a ratio of, the amount of another housekpeeing miRNA in the same sample. In some embodiments, the control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of product levels of two miRNAs in the test sample and comparing it to any suitable ratio of the same in a reference standard; determining product levels of the two or more miRNAs in the test sample and determining a difference in product levels in any suitable control; and determining product levels of the two or more miRNAs in the test sample, normalizing their level to the level of housekeeping gene products in the test sample, and comparing to any suitable control. In preferred embodiments, the control comprises a control sample which is of the same lineage and/or type as the test sample. In other embodiments, instead of normalizing relative to the level of a housekeeping miRNA, the miRNA level may be normalized relative to any protein level (e.g., CD31), nucleic acid level, lipid level, or others within the sample.

In other embodiments, the control may comprise product levels grouped as percentiles within or based on a set of patient samples, such as all CO VID-19 patients. In some embodiments, a control product level is established wherein higher or lower levels of product relative to, for instance, a particular percentile, are used as the basis for predicting outcome. In other preferred embodiments, a control product level is established using product levels from COVID-19 control patients with a known outcome, and the product levels from the test sample are compared to the control product level as the basis for predicting outcome. As demonstrated by the data provided herein, the methods of the present disclosure are not limited to use of a specific cut-point in comparing the level of product in the test sample to the control.

In some embodiments, a pre-determined marker amount (e.g., pre-determined level of miR-24) can be any suitable standard. For example, the pre-determined marker amount can be obtained from the same or a different human for whom a patient selection is being assessed. In some embodiments, the pre-determined marker amount can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time. In addition, the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human. In such a manner, the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.

Accordingly, in some embodiments, a control comprises a sample (e.g., a biological sample or a derivative thereof, a body fluid or a derivative thereof, e.g., plasma or a derivative thereof) from (a) a normal healthy person, a COVID- 19-negative subject, a subject without a CBV event, or a COVID- 19-positive subject without a CBV event; or (b) a portion or all of pooled samples from one or more subjects of (a).

In other embodiments, a control comprises a sample (e.g., a biological sample or a derivative thereof, e.g., body fluid or a derivative thereof, e.g., plasma or a derivative thereof) from a patient who is being evaluated (e.g., diagnosis or prognosis). For example, the control sample may comprise (i) a historical sample of the patient, or (ii) the sample obtained from the patient in longitudinal studies, e.g., pre-therapy or post-therapy (e.g., COVID-19 therapy or CBV therapy). The use of such control allows comparison of a biomarker present in the same patient over time (e.g., during the progression of a CBV event).

Cerebrovascular (CBV)

The term “CBV event” refers to any neurological symptoms that impair cerebral circulation (e.g., blood flow in the brain). Restrictions in blood flow may occur from vessel narrowing (stenosis), clot formation (thrombosis), blockage (embolism) or blood vessel rupture (hemorrhage). Lack of sufficient blood flow (ischemia) affects brain tissue and may cause a stroke.

Central nervous system (CNS) manifestations may comprise headache, migraine, dizziness, seizures, confusion, delirium, and coma. Peripheral nervous system (PNS) involvement may be presented as hypogeusia, hyposmia, other cranial neuropathies or generalized weakness due to Guillain-Barre and intensive-care-unit-acquired polyneuropathy or myopathy. COVID-19-associated CBV events are known in the art (see e.g., Tsivgoulis (2020) Therapeutic Advances in Neurological Disorders, 13: 1-18), which is incorporated by reference.

In some embodiments, the CBV event comprises coagulopathy. The hypercoagulability may further add to the risk of developing cerebral venous thrombosis or ischemic stroke.

In some embodiments, the CBV event comprises cerebral aneurysms, carotid stenosis, intracranial stenosis, atherosclerotic disease, subarachnoid hemorrhage, subdural hematoma, intraparenchymal cerebral hemorrahage, ischemic stroke, intracerebral hemorrhage, cerebral venous thrombosis, transient ischemic attacks, migraine, hemorrhagic stroke, cryptogenic stroke, or any combination thereof.

In some embodiments, the CBV event comprises ischemic stroke, intracerebral hemorrhage, cerebral venous thrombosis, transient ischemic attacks and migraine; ischemic stroke; hemorrhagic stroke; or any combination thereof.

Additional examples of CBV events include: cerebral aneurysms, Exemplary CBV events are further described in details below.

TRANSIENT ISCHEMIC ATTACK (TIA) A TIA is a temporary cerebrovascular event that leaves no permanent damage. Most likely an artery to the brain is temporarily blocked, causing stroke-like symptoms, but the blockage dislodges before any permanent damage occurs.

Symptoms of a TIA may be similar to stroke, but they resolve quickly. In fact, symptoms may be so vague and fleeting that people just "brush" them off, especially when they last just a few minutes. TIA symptoms include:

• Sudden numbness or weakness of the face, arm or leg, especially on one side of the body

• Sudden confusion, trouble speaking or understanding

• Sudden trouble seeing in one or both eyes

• Sudden trouble walking, dizziness, loss of balance or coordination

• Sudden, severe headache with no known cause ISCHEMIC STROKE (IS)

A recently published, prospective, multinational study reported 123 patients who presented with acute IS out of a total of 17,799 SARS-CoV-2-infected patients. This result corresponds to a non-weighted risk of 0.7% for IS among patients hospitalized for COVID- 19. Other cohort studies reporting IS risk among hospital admissions for COVID-19 also presented similar results. These data underscore that COVID-19 may be associated with a small but non-negligible risk for IS. Another important fact is that IS is reported as the initial manifestation and reason for hospitalization in 26% of COVID-19-confirmed patients.

Regarding the IS subtype according to Trial of ORG 10172 in Acute Stroke Treatment classification, COVID-19 was reported to be associated with a higher incidence of cryptogenic stroke. According to a retrospective cohort study performed in a major health system in New York, cryptogenic stroke was twice more prevalent in COVID-19 positive patients compared with both a contemporary control group consisting of COVID- 19 negative patients and a historical control group derived from patients treated in the same period in 2019. The presented high rates of cryptogenic stroke could further alarm clinicians regarding hypercoagulability state, in situ arterial thrombosis from endothelitis and occult cardioembolism or paradoxical embolism, both of which require deeper investigation and consideration of therapeutic anticoagulation. Other studies, which also included hospitalized CO VID-19 patients, reported an incidence of up to 35% for cryptogenic stroke among IS patients. Finally, it should be noted that different case series of stroke complicating COVID-19 patients have reported a decreased prevalence of lacunar infarction (<10%) among IS patients. This observation indicates the potential lack of association between COVID-19 and intrinsic small-vessel disease. However, since lacunar strokes are generally associated with less severe symptoms compared with large-vessel occlusion

(LVO) strokes, the patients may have not undergone neuroimaging evaluation with brain MRI and ascertainment of acute cerebral ischemia mechanism leading to the underrepresentation of lacunar strokes in patient cohorts.

Another important observation regarding IS incidence in patients with COVID-19 is the report of younger patients without known risk factors presenting with stroke due to LVO. Also, COVID-19 patients with LVO were younger compared with both contemporary controls of COVID- 19-negative patients and historical controls, as investigated in different studies. In another case series, it was shown that among patients hospitalized for stroke due to LVO, more than half tested positive for SARS-CoV-2. Almost a quarter of COVID-19 patients admitted for acute IS is reported to be due to LVO. Multifocal LVOs is another matter of concern in those patients, since multivessel obstruction is presented significantly more frequently in SARSCoV-2 positive patients.

In patients admitted with acute IS during the period of CO VID-19 restrictions, significant concern has been raised regarding the delivery of acute reperfusion treatments. This gains even more importance, especially in the aforementioned patients with LVO, who may need mechanical thrombectomy. Initially, patients were thought to be reluctant to seek medical help for stroke symptoms due to their fear of contracting COVID-19, and subsequently presented with substantial delay to the emergency department, outside the time window for available acute reperfusion therapies. Different cohort studies evaluated the management in the acute phase of stroke patients during COVID-19 restrictions compared with historical controls treated in the same periods before the pandemic. Several of them have underscored the negative effect of lockdown on the management of IS, depicting reductions of stroke admissions, the total number of thrombolysis and/or thrombectomy and significant increases in treatment times.

CEREBRAL HEMORRHAGE

Several case reports and cohort studies have recently been published presenting COVID-19 patients with parenchymal hemorrhage, subarachnoid hemorrhage, and subdural hematoma. A retrospective case series of five patients showed that CO VID-19 patients with intracerebral hemorrhage (ICH) were younger than expected and mostly suffered from lobar ICH. One of the patients described in this report had multifocal ICH without any underlying vascular abnormality. Similar results were presented in a retrospective cohort study, that showed 0.5% of hospitalized COVID-19 patients to be diagnosed with hemorrhagic stroke, with coagulopathy being the most common etiology. A large, deep intracerebral hematoma with an irregular, multi-lobular shape identified in a COVID-19 patient is common.

The atypical multifocal nature of many of the reported ICH cases to date would suggest some form of underlying vasculopathy which likely acts synergistically with the a number of factors, such as ACE2 inactivation, endothelial dysfunction/degeneration, coagulopathy or hypocoagulability, or secondary effects of COVID-19 such as renal failure/cirrhosis with concomitant therapeutic anti coagulation in a critically ill older population, in causing ICH. One pathological report to date has confirmed underlying endothelial reactivity, as well as endothelial and neuropil degeneration in a COVID-19 patient with ICH.

Cerebral microbleeds have also been demonstrated in critically ill COVID-19 patients and can present with or without leukoencephalopathy. The atypical location of cerebral microbleeds in the corpus callosum and juxtacortical region may raise the suspicion of SARS-CoV-2 infection in critically ill patients. However, a very similar pattern has previously been presented in critically ill non-COVID-19 patients with respiratory failure. These neuroimaging findings are associated with worse neurological status and longer hospitalization in COVID-19, and likely reflect a more advanced stage of critical illness.

CEREBRAL VENOUS THROMBOSIS (CVT)

Venous thromboembolic events, such as pulmonary embolism and deep venous thrombosis, are detected with high frequency in COVID-19 patients hospitalized in intensive care units, even despite anti coagulation treatment. The risk of thrombosis associated with COVID-19 may also be responsible for CVT. Numerous case reports have been published about COVID-19 patients presenting with CVT. In addition, cases with more atypical presentations, such as cortical or deep cerebral venous thrombosis, have been described. Six patients were diagnosed with CVT among 17,799 hospitalized SARS-CoV-2 patients. Headache and impaired consciousness may complicate or even be the presenting symptoms of both COVID-19 and CVT. For that reason, clinicians should be quite vigilant in order to timely diagnose CVT complicating COVID-19. Clinicians should also be able to differentiate COVID-19 patients with primary ICH and hemorrhagic infarction due to CVT, since the latter requires anticoagulant treatment in therapeutic dosage. Finally, CVT involving the internal cerebral veins may be challenging to differentiate from acute hemorrhagic necrotizing encephalitis (Weston-Hurst syndrome), which is another COVID- 19 CNS complication that may symmetrically affect basal ganglia and thalami with hemorrhagic lesions.

Diagnostic Methods

The present disclosure provides, in part, methods, systems, and compositions for accurately classifying whether a biological sample comprises miRNA and/or whether the levels of miRNA are modulated (e.g., upregulated or downregulated), thereby indicative of the state of a disorder of interest, such as a CBV event in COVID-19 patients. In some embodiments, the present invention is useful for classifying a sample (e.g., from a subject) as associated with or at risk for a CBV event or a symptom thereof, using a statistical algorithm and/or empirical data (e.g., the presence, absence, or level miRNA).

An exemplary method for detecting the level of miRNA involves obtaining a biological sample (e.g., a biological sample or a derivative thereof, a body fluid or a derivative thereof, e.g., plasma or a derivative thereof) from a test subject and detecting miRNA in the sample using methods described herein or those known in the art.

In certain instances, the statistical algorithm is a single learning statistical classifier system. For example, a single learning statistical classifier system can be used to classify a sample as a at-risk CBV sample or a CBV sample based upon a prediction or probability value and the presence or level of miRNA. The use of a single learning statistical classifier system typically classifies the sample as a at-risk CBV sample or a CBV sample with a sensitivity, specificity, positive predictive value, negative predictive value, and/or overall accuracy of at least or about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

Other suitable statistical algorithms are well-known to those of skill in the art. For example, learning statistical classifier systems include a machine learning algorithmic technique capable of adapting to complex data sets (e.g, panel of markers of interest) and making decisions based upon such data sets. In some embodiments, a single learning statistical classifier system such as a classification tree (e.g., random forest) is used. In other embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more learning statistical classifier systems are used, preferably in tandem. Examples of learning statistical classifier systems include, but are not limited to, those using inductive learning (e.g., decision/classification trees such as random forests, classification and regression trees (C&RT), boosted trees, etc.), Probably Approximately Correct (PAC) learning, connectionist learning (e.g., neural networks (NN), artificial neural networks (ANN), neuro fuzzy networks (NFN), network structures, perceptrons such as multi-layer perceptrons, multi-layer feed-forward networks, applications of neural networks, Bayesian learning in belief networks, etc.), reinforcement learning (e.g., passive learning in a known environment such as naive learning, adaptive dynamic learning, and temporal difference learning, passive learning in an unknown environment, active learning in an unknown environment, learning action-value functions, applications of reinforcement learning, etc.), and genetic algorithms and evolutionary programming. Other learning statistical classifier systems include support vector machines (e.g., Kernel methods), multivariate adaptive regression splines (MARS), Levenberg-Marquardt algorithms, Gauss-Newton algorithms, mixtures of Gaussians, gradient descent algorithms, and learning vector quantization (LVQ). In certain embodiments, the method of the present disclosure further comprises sending the sample classification results to a clinician (a non-specialist, e.g., primary care physician; and/or a specialist).

In some embodiments, the method of the present disclosure further provides a diagnosis in the form of a probability that the individual has a CBV event or at risk of having a CBV event. For example, the individual can have about a 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater probability of having a CBV event or at risk of having a CBV event. In yet another embodiment, the method of the present invention further provides a prognosis of the CBV event in the individual (e.g., COVID-19 patient). In some instances, the method of classifying a sample as a at-risk CBV sample or a CBV sample may be further based on the symptoms (e.g, clinical factors) of the individual from which the sample is obtained. In some instances, the method of classifying a sample as a CBV sample or at-risk CBV sample may be further based on a family history of having a CBV event or being at risk of a CBV event, irrespective of the symptoms. In some embodiments, the diagnosis of an individual as having a CBV event or being at risk of a CBV event is followed by administering to the individual a therapeutically effective amount of a therapy (e.g, a CBV therapy, a COVID- 19 therapy). In some embodiments, the diagnosis of an individual as having a CBV event is followed by treating the individual with a CBV therapy to prevent the CBV event.

In some embodiments, the methods further comprise analyzing the control sample to detect miRNA, such that the presence and/or the level of said miRNA is detected in the control biological sample, and comparing the presence or the level of miRNA in the control sample with the presence or the level of miRNA in the test sample.

Samples

A sample used for the methods and compositions of the present disclosure may comprise any biological sample or a derivative thereof. In some embodiments, a sample comprises a tissue or a cell. In some embodiments, a sample comprises a body fluid or a derivative thereof. The term “body fluid” refers to fluids that are excreted or secreted from the body as well as fluid that are normally not (e.g., blood and blood plasma saliva, serum, tears, urine, sweat). In some embodiments, a sample comprises plasma or a derivative thereof. In preferred embodiments, a sample comprises EVs. In some embodiments, the EVs comprise CD31 protein. In some embodiments, the EVs are endothelial cell EVs.

In certain instances, the method encompassed by the present invention further comprises obtaining the sample from the individual prior to detecting or determining the presence or level of at least one marker in the sample.

A sample can be analyzed as a crude unpartitioned sample, or partitioned to EVs and supernatant. For miRNA that is particularly low in abundance, partitioning a sample to an EV fraction may enhance sensitivity.

The sample or the partitioned EVs may be then extracted for nucleic acids, optionally followed by size separation for focus on microRNA level evaluations. The microRNA fraction (exosomal or non-exosomal) can be analyzed by next generation sequencing, PCR, or analogous strategies described herein or known in the art.

Sample preparation and separation can involve any of the procedures, depending on the type of sample collected and/or analysis of biomarker measurement(s). Such procedures include, by way of example only, concentration, dilution, adjustment of pH, removal of high abundance polypeptides e.g., albumin, gamma globulin, and transferrin, etc.), addition of preservatives and calibrants, addition of protease inhibitors, addition of RNase inhibitor, addition of denaturants, desalting of samples, concentration of sample RNA, extraction and purification of miRNA. In some embodiments, the level of miRNA measurement(s) in a sample from a subject is compared to a control biological sample. In other embodiments, the level of miRNA measurement(s) in a sample from a subject is compared to a predetermined control (standard) sample. The sample from the subject may be a COVID- 19-positive subject. The control sample can be from the same subject or from a different subject. The control sample can be from a normal, non-diseased subject. The control sample can be a combination of samples from several different subjects. In some embodiments, the leve of miRNA from a subject is compared to a pre-determined level. This pre-determined level may be obtained from normal samples.

As described herein, a “pre-determined” biomarker amount measurement(s) may be a biomarker amount measurement(s) used to, by way of example only, evaluate a subject that may be selected for treatment, evaluate a response to a CB V therapy, and/or evaluate a response to a a CBV therapy. A pre-determined biomarker amount measurement(s) may be determined in populations of patients with or without COVID-19. The pre-determined biomarker amount measurement s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount measurement(s) can vary according to specific subpopulations of patients. Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount measurement s) of the individual. Furthermore, the pre-determined biomarker amount can be determined for each subject individually. In some embodiments, the amounts determined and/or compared in a method described herein are based on absolute measurements.

In some embodiments, the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., biomarker (e.g., miRNA) level before a treatment vs. after a treatment, such biomarker measurements relative to a spiked or man-made control, such biomarker measurements relative to the expression of a housekeeping gene/miRNA, and the like). For example, the relative analysis can be based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement. Pre-treatment biomarker measurement can be made at any time prior to initiation of a CBV therapy and/or a COVID-19 therapy. Posttreatment biomarker measurement can be made at any time after initiation of a CBV therapy and/or a COVID-19 therapy. In some embodiments, post-treatment biomarker measurements are made 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 weeks or more after initiation of a CBV therapy and/or a COVID-19 therapy, and even longer toward indefinitely for continued monitoring. Treatment can comprise one or more CBV therapies and/or COVID-19 therapy therapies.

The pre-determined biomarker amount measurement(s) can be any suitable standard. For example, the pre-determined biomarker amount measurement s) can be obtained from the same or a different human for whom a patient selection is being assessed. In some embodiments, the pre-determined biomarker amount measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time. In addition, the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human. In such a manner, the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.

In some embodiments of the present disclosure, the change of biomarker (e.g., miRNA) amount measurement(s) from the pre-determined level is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 fold or greater, or any range in between, inclusive. In some embodiments, the change of biomarker amount measurement(s) from the pre-determined level is a significant level (see above). Such cutoff values apply equally when the measurement is based on relative changes, such as based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.

Method of Prevention and/or Treatment

The methods of the present disclosure (e.g., detecting miR-24 level, identifying or diagnosing a subject at risk for a CBV event) may further comprise recommending, prescribing, and/or administering a therapy to prevent or treat a CBV event to the COVID- 19-positive subject determined to be at risk for a CBV event.

The term “preventing” is art-recognized, and when used in relation to a condition or a disease, e.g., a CBV event, is well understood in the art, and includes administration of a treatment, e.g., a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject relative to a subject which does not receive the treatment. Thus, prevention of a CBV event includes, for example, reducing one or more symptoms of a CBV event in a population of patients receiving a prophylactic treatment relative to an untreated control population, and/or delaying the appearance of one or more symptoms of a CBV event in a treated population versus an untreated control population, e.g., by a statistically and/or clinically significant amount.

A “therapeutically effective amount” of a compound is an amount capable of producing a medically desirable result in a treated patient, e.g., prevent a CBV event, reduce or alleviate any symptom associated with a CBV event, with an acceptable benefit: risk ratio, preferably in a human and/or non-human mammal.

The term “treating” includes prophylactic and/or therapeutic treatments. The term “prophylactic or therapeutic” treatment is art-recognized and includes administration to the subject of one or more of a therapy described herein or those known in the art (e.g., a therapy that prevents or treats a CBV event, a therapy that prevents or treats COVID-19, etc.). If it is administered prior to clinical manifestation of the unwanted condition (e.g., disease or other unwanted state of the subject), then the treatment is prophylactic (i.e., it protects the subject against developing the unwanted condition); whereas, if it is administered after manifestation of the unwanted condition, the treatment is therapeutic (i.e., it is intended to diminish, ameliorate, or stabilize the existing unwanted condition or side effects thereof).

In some aspects, provided herein are methods for preventing and/or treating COVID-19 (i.e., a SARS-CoV-2 infection).

The methods described herein may be used to treat any subject in need thereof. As used herein, a “subject in need thereof’ includes any subject who has COVID-19, who has had COVID-19 and/or who is predisposed to COVID-19. For example, in some embodiments, the subject has a COVID-19. In some embodiments, the subject has undergone treatments for COVID-19. In some embodiments, the subject is predisposed to COVID-19 due to age, or having a compromised immune system or other serious underlying medical conditions that predisposes the subject to COVID-19. In preferred embodiments, the subject has been tested positive for COVID-19.

The therapies (e.g., CBV therapy, COVID-19 therapy) described herein or those known in the art, or pharmaceutical compositions comprising same may be delivered by any suitable route of administration, including orally and parenterally. In certain embodiments the pharmaceutical compositions are delivered generally (e.g., via oral or parenteral administration). In certain embodiments, the pharmaceutical compositions is administered by subcutaneous injection. The dosage of the subject agent (e.g., CBV therapy, COVID-19 therapy, or pharmaceutical composition comprising same) may be determined by reference to the plasma concentrations of the agent. For example, the maximum plasma concentration (Cmax) and the area under the plasma concentration-time curve from time 0 to infinity (AUC (0-4)) may be used. Dosages include those that produce the above values for Cmax and AUC (0-4) and other dosages resulting in larger or smaller values for those parameters.

Actual dosage levels of the active ingredients in the pharmaceutical compositions may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

The selected dosage level will depend upon a variety of factors including the activity of the particular agent employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could prescribe and/or administer doses of the agents employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

In general, a suitable daily dose of an agent described herein will be that amount of the agent which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.

A pharmaceutical dosage unit may be applied to a subject in a single volume, e.g., a single shot, or may be applied in 2, 3, 4, 5 or more separate volumes or shots that are applied at different locations of the body, for instance in the right and the left limb. Reasons for applying a single pharmaceutical dosage unit in separate volumes may be multiples, such as avoid negative side effects. It is to be understood herein that the separate volumes of a pharmaceutical dosage may differ in composition, i.e., may comprise different kinds or composition of active ingredients and/or adjuvants. A pharmaceutical dosage unit may be an effective amount or part of an effective amount. An “effective amount” is to be understood herein as an amount or dose of active ingredients required to prevent and/or reduce the symptoms of a disease (e.g., COVID-19, a CB V event) relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for preventive and/or therapeutic treatment of COVID-19 or a CBV event varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an “effective” amount.

EXEMPLARY CBV THERAPIES

Therapies that prevent or treat a CBV event are art-recognized.

For example, upon diagnosis, a CBV event may be monitored. A doctor may use:

• a cerebral angiography: A doctor uses this to identify a vascular abnormality, such as a blood clot or a blood vessel defect. It involves injecting dye into the arteries to reveal any clots and display their size and shape on a computed axial tomography (CAT), CT, or magnetic resonance imager (MRI) scan.

• an MRI scan: This can detect even early stage strokes.

• a magnetic resonance angiogram (MRA): This procedure takes place in an MRI.

The MRA shows the blood vessels in the neck and brain. It may help to detect aneurysms and blockages.

• a CAT scan: This can help a doctor diagnose and detect hemorrhagic strokes as it can distinguish between blood, bone, and brain tissue. However, it does not always reveal damage from an ischemic stroke, especially in the early stages.

• a CT angiography (CTA): This scan allows healthcare professionals to see blood vessels in a person’s head and neck.

• an electrocardiogram (EKG or ECG): This can detect cardiac arrhythmia, which is a risk factor for embolic strokes.

• a lumbar puncture (spinal tap): This may help detect bleeding caused by a cerebral hemorrhage. This procedure involves removing cerebrospinal fluid with a needle. In some embodiments, cerebral angiography may be performed to treat a CBV event. Depending on the location of the aneurysm or narrowing caused by stenosis, minimally invasive treatment options, also known as neurointerventional or neuroradiological procedures, may be available. First, a catheter is threaded into the artery, and the aneurysm, malformation, or stenosis is located by injecting a special dye that helps create a clear picture of the cerebrovascular system on an X-ray. For cases of cerebrovascular stenosis, a balloon may be used to widen a narrowed artery, followed by the placement of a stent to keep the artery open and prevent clotting. For aneurysms and malformations, tiny platinum coils or beads are used to fill the problem area, preventing blood from circulating or pooling in that area, and reducing the risk of clots, leaks, or hemorrhages.

Medications that can help reduce the risk of serious complications from cerebrovascular disease include:

• Blood thinners (anti-coagulants and anti -platelets): a blood thinner reduces the risk of blood clots. Non-limiting examples of blood thinners include vitamin K antagonist, aspirin, warfarin (Coumadin), heparin, rivaroxaban (Xarelto), dabigatran (Pradaxa), apixaban (Eliquis), edoxaban (Lixiana, Savaysa), betrixaban (Bevyxxa), dalteparin (Fragmin), endoxaparin (Lovenox), fondaparinux (Arixtra), ticlopidine (Ticlid), clopidogrel (Plavix), ticagrelor (Brilinta), prasugrel (Effient), dipyridamole, dipyridamole/aspirin (Aggrenox), and eptifibatide (Integrilin).

• Antihypertensive drugs: Diuretics, Angiotensin-converting enzyme (ACE) inhibitors, Adrenergic receptor antagonists (e.g., beta blockers, alpha blockers), thiazide diuretics, angiotensin II receptor antagonists (ARBs), calcium channel blockers (e.g., dihydropyridines and nondihydropyri dines), vasodilators (e.g., hydralazine), renin inhibitors (e.g., Aliskiren), aldosterone receptor antagonist (e.g., eplerenon, spironolactone), alpha-2 adrenergic receptor agonists (e.g., clonidine, guanabenz, guanfacine, methyldopa, moxonidine), endothelium receptor blocker (e.g., bosentan), or other medications that are used to lower blood pressure reduces the risk of hemorrhaging. o Non-limiting examples of ACE inhibitors include Benazepril (Lotensin), Captopril, Enalapril (Vasotec), Fosinopril, Lisinopril (Prinivil, Zestril), Moexipril, Perindopril, Quinapril (Accupril), Ramipril (Altace), and Trandolapril. o Non-limiting examples of diuretics include bumetanide, ethacrynic acid, furosemide, torsemide, epitizide, hydrochlorothiazide, chlorothiazide, bendroflumethiazide, methyclothiazide, polythiazide, indapamide, chlorthalidone, metalozone, xipamide, clopamide, amiloride, triamterene, spironolactone, and eplerenone. o Non-limiting examples of calcium channel blockers include dihydropyridines (amlodipine, barnidipine, cilnidipine, clevidipine, felodipine, isradipine, lercanidipine, levamlodipine, nicardipine, nifedipine, nimodipine, nisoldipine, nitrendipine) and non-dihydropyridines (diltiazem, verapamil). o Non-limiting examples of angiotensin II receptor antagonists (ARBs) include azilsartan, candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, valsartan, and Fimasartan. o Non-limiting examples of adrenergic receptor antagonists include beta blockers (e.g., acebutolol, atenolol, bisoprolol, betaxolol, carteolol, carvedilol, labetalol, metoprolol, nadolol, nebivolol, oxprenolol, penbutolol, pindolol, propranolol, timolol), alpha blockers (doxazosin, chlorpromazine, phentolamine, indoramin, phenoxybenzamine, prazosin, terazosin, tolazoline, urapidil), and mixed alpha and beta blockers (e.g., bucindolol, carvedilol, labetalol, clonidine).

• Cholesterol- lowering medications: Statins, or cholesterol-lowering medications, can help prevent further buildup of arterial plaque that causes stenosis and clotting. Non-limiting examples of statin include include atorvastatin (Lipitor), fluvastatin (Lescol XL), lovastatin (Altoprev or Mevacor), pitavastatin (Livalo or Zypitamag), pravastatin (Pravachol), rosuvastatin (Crestor, Ezallor), and simvastatin (Zocor, FloLipid).

Accordingly, in some embodiments, a therapy that prevents or treats a CBV event comprises an a blood thinner (e.g., anti-coagulant, anti-platelets), statin, ACE inhibitor, an antihypertensive therapy, or any combination thereof.

EXEMPLARY CO VID-19 THERAPIES

In certain aspects, the methods of the present disclosure further comprises recommending, prescribing, and/or administering to a subject (e.g., COVID-19 subject) determined to be at risk of a CBV event, a COVID-19 therapy. In some embodiments, a COVID-19 therapy (e.g., antiviral therapy) comprises remdesivir, PF-07321332, molnupiravir (Lagevrio), MitoQ, a cell-derived therapeutic exosome, berzosertib, Favipiravir, lopinavir/ritonavir with or without IFN-beta-la, ASC-09 and ritonavir, CD24Fc, Bamlanivimab and/oretesevimab, Bebtelovimab, Casirivimab/imdevimab (REGEN-COV, Ronapreve), Regdanvimab (Regkirona), Sotrovimab, Tixagevimab AZD8895) and/or cilgavimab (AZD1061) (collectively called Evusheld), Nirmatrelvir/ritonavir (Paxlovid), baricitinib, ensovibep, convalescent plasma, tocilizumab (Actemra), lenzilumab, Dapagliflozin, Apabetalone, Sarilumab, Sabizabulin, or any combination thereof.

Pharmaceutical composition

The compositions and methods of the present invention may be utilized to treat an individual in need thereof. In preferred embodiments, the composition or the compound of a therapy (e.g., COVID-19 therapy, CBV therapy) is preferably administered as a pharmaceutical composition comprising, for example, a compound and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions such as water or physiologically buffered saline or other solvents or vehicles such as glycols, glycerol, oils such as olive oil, or injectable organic esters. In preferred embodiments, when such pharmaceutical compositions are for human administration, particularly for invasive routes of administration (i.e., routes, such as injection or implantation, that circumvent transport or diffusion through an epithelial barrier), the aqueous solution is pyrogen-free, or substantially pyrogen-free. The excipients can be chosen, for example, to effect delayed release of an agent or to selectively target one or more cells, tissues or organs. The pharmaceutical composition can be in dosage unit form such as tablet, capsule (including sprinkle capsule and gelatin capsule), granule, lyophile for reconstitution, powder, solution, syrup, suppository, injection or the like. The composition can also be present in a transdermal delivery system, e.g., a skin patch. The composition can also be present in a solution suitable for topical administration, such as a lotion, cream, or ointment.

A pharmaceutically acceptable carrier can contain physiologically acceptable agents that act, for example, to stabilize, increase solubility or to increase the absorption of a compound such as a compound of the invention. Such physiologically acceptable agents include, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers or excipients. The choice of a pharmaceutically acceptable carrier, including a physiologically acceptable agent, depends, for example, on the route of administration of the composition. The preparation or pharmaceutical composition can be a selfemulsifying drug delivery system or a selfmicroemulsifying drug delivery system. The pharmaceutical composition (preparation) also can be a liposome or other polymer matrix, which can have incorporated therein, for example, a compound of the invention.

Liposomes, for example, which comprise phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.

The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

A pharmaceutical composition (preparation) can be administered to a subject by any of a number of routes of administration including, for example, orally (for example, drenches as in aqueous or non-aqueous solutions or suspensions, tablets, capsules (including sprinkle capsules and gelatin capsules), boluses, powders, granules, pastes for application to the tongue); absorption through the oral mucosa (e.g., sublingually); subcutaneously; transdermally (for example as a patch applied to the skin); and topically (for example, as a cream, ointment or spray applied to the skin). The compound may also be formulated for inhalation. In certain embodiments, a compound may be simply dissolved or suspended in sterile water. Details of appropriate routes of administration and compositions suitable for same can be found in, for example, U.S. Pat. Nos. 6,110,973, 5,763,493, 5,731,000, 5,541,231, 5,427,798, 5,358,970 and 4,172,896, as well as in patents cited therein.

The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 1 percent to about ninety-nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

Methods of preparing these formulations or compositions include the step of bringing into association an active compound, such as a compound of the invention, with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound of the present invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

Formulations of the invention suitable for oral administration may be in the form of capsules (including sprinkle capsules and gelatin capsules), cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), lyophile, powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil- in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound of the present invention as an active ingredient. Compositions or compounds may also be administered as a bolus, electuary or paste. To prepare solid dosage forms for oral administration (capsules (including sprinkle capsules and gelatin capsules), tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; (10) complexing agents, such as, modified and unmodified cyclodextrins; and (11) coloring agents. In the case of capsules (including sprinkle capsules and gelatin capsules), tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

The tablets, and other solid dosage forms of the pharmaceutical compositions, such as dragees, capsules (including sprinkle capsules and gelatin capsules), pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.

Liquid dosage forms useful for oral administration include pharmaceutically acceptable emulsions, lyophiles for reconstitution, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, cyclodextrins and derivatives thereof, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants that may be required.

The ointments, pastes, creams and gels may contain, in addition to an active compound, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof. Powders and sprays can contain, in addition to an active compound, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

Transdermal patches have the added advantage of providing controlled delivery of a compound of the present invention to the body. Such dosage forms can be made by dissolving or dispersing the active compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel.

The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion. Pharmaceutical compositions suitable for parenteral administration comprise one or more active compounds in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

Examples of suitable aqueous and nonaqueous carriers that may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents that delay absorption such as aluminum monostearate and gelatin.

In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution, which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

Injectable depot forms are made by forming microencapsulated matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissue.

For use in the methods of this invention, active compounds can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.

Methods of introduction may also be provided by rechargeable or biodegradable devices. Various slow release polymeric devices have been developed and tested in vivo in recent years for the controlled delivery of drugs, including proteinaceous biopharmaceuticals. A variety of biocompatible polymers (including hydrogels), including both biodegradable and non-degradable polymers, can be used to form an implant for the sustained release of a compound at a particular target site.

Actual dosage levels of the active ingredients in the pharmaceutical compositions may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of factors including the activity of the particular compound or combination of compounds employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound(s) being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound(s) employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the therapeutically effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the pharmaceutical composition or compound at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. By “therapeutically effective amount” is meant the concentration of a compound that is sufficient to elicit the desired therapeutic effect. It is generally understood that the effective amount of the compound will vary according to the weight, sex, age, and medical history of the subject. Other factors which influence the effective amount may include, but are not limited to, the severity of the patient's condition, the disorder being treated, the stability of the compound, and, if desired, another type of therapeutic agent being administered with the compound of the invention. A larger total dose can be delivered by multiple administrations of the agent. Methods to determine efficacy and dosage are known to those skilled in the art (Isselbacher et al. (1996) Harrison’s Principles of Internal Medicine 13 ed., 1814-1882, herein incorporated by reference).

In general, a suitable daily dose of an active compound used in the compositions and methods of the invention will be that amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.

If desired, the effective daily dose of the active compound may be administered as one, two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. In certain embodiments of the present invention, the active compound may be administered two or three times daily. In preferred embodiments, the active compound will be administered once daily. The patient receiving this treatment is any animal in need, including primates, in particular humans; and other mammals such as equines, cattle, swine, sheep, cats, and dogs; poultry; and pets in general.

In certain embodiments, compounds of the invention may be used alone or conjointly administered with another type of therapeutic agent.

The present disclosure includes the use of pharmaceutically acceptable salts of compounds of the invention in the compositions and methods of the present invention. In certain embodiments, contemplated salts of the invention include, but are not limited to, alkyl, dialkyl, trialkyl or tetra-alkyl ammonium salts. In certain embodiments, contemplated salts of the invention include, but are not limited to, L-arginine, benenthamine, benzathine, betaine, calcium hydroxide, choline, deanol, diethanolamine, diethylamine, 2-(diethylamino)ethanol, ethanolamine, ethylenediamine, N- methylglucamine, hydrabamine, IH-imidazole, lithium, L-lysine, magnesium, 4-(2- hydroxyethyljmorpholine, piperazine, potassium, l-(2-hydroxyethyl)pyrrolidine, sodium, triethanolamine, tromethamine, and zinc salts. In certain embodiments, contemplated salts of the invention include, but are not limited to, Na, Ca, K, Mg, Zn or other metal salts. In certain embodiments, contemplated salts of the invention include, but are not limited to, 1- hydroxy-2-naphthoic acid, 2,2-dichloroacetic acid, 2-hydroxy ethanesulfonic acid, 2- oxoglutaric acid, 4-acetamidobenzoic acid, 4-aminosalicylic acid, acetic acid, adipic acid, 1- ascorbic acid, 1-aspartic acid, benzenesulfonic acid, benzoic acid, (+)-camphoric acid, (+)- camphor- 10-sulfonic acid, capric acid (decanoic acid), caproic acid (hexanoic acid), caprylic acid (octanoic acid), carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane- 1,2-disulfonic acid, ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, d-glucoheptonic acid, d-gluconic acid, d-glucuronic acid, glutamic acid, glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, 1-malic acid, malonic acid, mandelic acid, methanesulfonic acid , naphthalene-l,5-disulfonic acid, naphthalene-2-sulfonic acid, nicotinic acid, nitric acid, oleic acid, oxalic acid, palmitic acid, pamoic acid, phosphoric acid, proprionic acid, 1- pyroglutamic acid, salicylic acid, sebacic acid, stearic acid, succinic acid, sulfuric acid, 1-tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, and undecylenic acid acid salts. The pharmaceutically acceptable acid addition salts can also exist as various solvates, such as with water, methanol, ethanol, dimethylformamide, and the like. Mixtures of such solvates can also be prepared. The source of such solvate can be from the solvent of crystallization, inherent in the solvent of preparation or crystallization, or adventitious to such solvent.

Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BEIT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal-chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Exemplary Embodiments

1. A method of identifying a COVID- 19-positive subject at risk for a cerebrovascular (CBV) event, the method comprising:

(a) determining the level of miR-24 in a sample from the COVID- 19-positive subject; and

(b) comparing the level of the miR-24 to a control, wherein a significantly lower level of miR-24 relative to the control indicates that the COVID- 19-positive subject is at risk for a CBV event.

2. The method of 1, wherein said significantly lower level of miR-24 comprises an at least 20% decrease in the level of miR-24

3. The method of 1 or 2, wherein said significantly lower level of miR-24 comprises at least 50% decrease in the level of the miR-24.

4. The method of any one of 1-3, further comprising recommending, prescribing, and/or administering a therapy to prevent or treat a CBV event to the COVID- 19-positive subject determined to be at risk for a CBV event. 5. A method of preventing or treating a cerebrovascular (CBV) event in a CO VID- 19- positive subject, the method comprising

(a) identifying a COVID- 19-positive subject at risk for a CBV event according to the method of any one of 1-3; and

(b) administering to the subject a therapy to prevent or treat a CBV event.

6. The method of 4 or 5, wherein the therapy to prevent or treat a CBV event comprises a blood thinner (e.g., anti-coagulant, anti -platelets), statin, ACE inhibitor, an antihypertensive therapy, or any combination thereof.

7. The method of any one of 1-6, further comprising administering a COVID-19 therapy to the subject.

8. The method of 7, wherein the COVID-19 therapy comprises remdesivir, PF- 07321332, molnupiravir (Lagevrio), MitoQ, a cell-derived therapeutic exosome, berzosertib, Favipiravir, lopinavir/ritonavir with or without IFN-b eta- la, ASC-09 and ritonavir, CD24Fc, Bamlanivimab and/oretesevimab, Bebtelovimab, Casirivimab/imdevimab (REGEN-COV, Ronapreve), Regdanvimab (Regkirona), Sotrovimab, Tixagevimab AZD8895) and/or cilgavimab (AZD1061) (collectively called Evusheld), Nirmatrelvir/ritonavir (Paxlovid), baricitinib, ensovibep, convalescent plasma, tocilizumab (Actemra), lenzilumab, Dapagliflozin, Apabetalone, Sarilumab, Sabizabulin, or any combination thereof.

9. The method of any one of 1-8, wherein the control comprises a miR-24 level in

(a) a sample from a healthy subject, a COVID- 19-negative subject, a subject without a CBV event, or a COVID- 19-positive subject without a CBV event; or

(b) a portion or all of pooled samples from one or more subjects of (a).

10. The method of any one of 1-8, wherein the control is a pre-determined level of miRNA.

11. The method of any one of 1-10, wherein the sample comprises body fluid of the subject, optionally plasma of the subject.

12. The method of any one of 1-11, wherein the sample comprises an endothelilal cell extracellular vesicle and/or a CD31 -positive extracellular vesicle.

13. The method of any one of 1-12, further comprising fractionating EVs from the sample before detecting the level of miR-24. 14. The method of any one of 1-13, further comprising isolating an endothelilal cell extracellular vesicle (EC-EVs) and/or a CD31-positive extracellular vesicle from the sample before detecting the level of miR-24.

15. The method of any one of 1-14, further comprising reverse transcribing miR-24 into a cDNA before detecting the level of miR-24.

16. The method of any one of 1-15, wherein the level of miR-24 is detected by a method comprising: multiplex bead-based assays, RNA-seq, next generation sequencing, sequencing, mass spectrometry (e.g., RNA sequencing by LC-MS, cDNA sequencing by LC-MS), microarray, Southern blotting of the cDNA of miRNA, Northern blotting, PCR, RT-PCR, realtime PCR (e.g., TaqMan®), any variation thereof, or any combination of two or more thereof.

17. The method of any one of 1-16, wherein the COVID-19 subject has long COVID.

18. The method of any one of 1-17, wherein the CBV event comprises ischemic stroke, intracerebral hemorrhage, cerebral venous thrombosis, transient ischemic attacks, migraine, hemorrhagic stroke, cryptogenic stroke, or any combination thereof.

19. The method of any one of 1-18, wherein the CBV event comprises transient ischemic attacks and migraine; ischemic stroke; hemorrhagic stroke; or any combination thereof.

20. The method of any one of 1-19, wherein the subject is a mammal.

21. The method of any one of 1-20, wherein the subject is a dog, a cat, or a human, optionally a human.

EXAMPLES

Example 1: Isolation of CD31+ EVs

Subject blood samples are obtained and centrifuged at 753g at 4°C to obtain plateletpoor EDTA plasma and stored at -80°C within 3 h from blood collection.

Plasma EDTA samples are allowed to thaw at room temperature. Appropriate volume (100 pL when used for singular miRNA dosage) is diluted with an equal amount of PBS. For removal of apoptotic bodies and residual cellularity, sample are precleared by two subsequent centrifugations at 4°C: one at 2,000g for 30 min and the following at 10,000g for 45 min. Supernatant is diluted with PBS to reach 500 pL volume and then mixed with FcR Blocking Reagent (20 pL) provided in the commercially available kit for endothelial cells isolation (130-091-935; Miltenyi Biotec). After vortexing, 20 pL CD31 MicroBeads (130-091-935; Miltenyi Biotec) are added to the suspension and incubated at 4° C in the dark for 30 min. Appropriate (according to reaction volume) columns are mounted on the magnetic field and activated with PBS. After incubation, the mixture is loaded onto the column to allow separation. After three washes with 500 pL PBS, the column is removed from the magnetic support and CD31+ EVs are eluted in 500 pL PBS with the help of a plunger (Fig. 1 A). As a negative control, isotype control beads (DynaBeads M-280) and no beads (equal amount of PBS) are used for parallel isolation of EVs for testing for eventual nonspecific bindings of EVs and subjected to MACSPlex comparison.

Example 2: Isolation of EVs through Ultracentrifugation

An aliquot of 1 mL plasma is precleared as indicated above and then the supernatant is diluted with PBS and subjected to ultracentrifugation (UC) at 120,000g (4°C) in a Thermo Scientific SI 10AT rotor in a Sorvall MX 150 ultracentrifuge for 1.5 h. Pellets are resuspended in PBS and ultracentrifuged again at 120,000g for an additional 1.5 h. The final pellets are resuspended in 500 pL PBS.

Example 3: Cytofluorimetric Detection of EV Markers

A commercially available (cat. no. 130-108-813, MACSPlex Exosome Kit; Miltenyi Biotec) kit is used for cytofluorimetric detection of a large range of markers in isolated EVs. Briefly, EVs isolated starting from the same amount of plasma are prepared as described in the manufacturer protocol. The multiplex bead-based platform is analyzed by flow cytometry with use of a BD FACSCanto II flow cytometer with the corresponding software (Becton, Dickinson and Company, Franklin Lakes, NJ) equipped with a 488-nm and a 640-nm laser. Fluorescence emission is collected by 530/30 nm, 585/42 nm, and 660/20 nm bandpass filters. At least 1,000 beads per sample are examined, and mean fluorescence intensity is determined with use of BD FACSDiva 6.1 software. Background signals are determined by analysis of beads incubated only with the respective staining antibodies and subtracted from the signals obtained for beads incubated with EVs and stained with the corresponding antibody. The multiplex bead-based platform includes setup beads for flow cytometer setup. Example 4: RNA Extraction and miRNA Profiling

Plasma samples from the subjects are pooled to reach 1 mL. CD31+ EVs are isolated from control preparations and COVID-19 patient preparations. RNA is extracted with a commercial kit known to enrich small RNA species (Norgen Biotek Corporation). The same amount of RNA is converted to cDNA by priming with a mixture of looped primers according to the manufacturer’s instructions (Megaplex kit; Applied Biosystems). cDNA (9 pL) is used for mature miRNA profiling by a real-time PCR instrument equipped with a 384-well reaction plate and human miRNA array pool A containing 367 different human miRNA assays in addition to selected small nucleolar RNAs and negative controls (non-human miRNAs). Only miRNAs expressed in more than one sample are included in the analysis. 2 ^-Ct of the average values of each miRNA are used to build the heat map comparing control and COVID-19 patients with the ClustVis web tool (World Wide Web at biit.cs.ut.ee/clustvis/).

Example 5: Single miRNA Quantitation

For single miRNA quantification, CD31+ EVs are isolated from 100 pL plasma. After mixing with lysis buffer and before loading to the RNA separation column (Norgen Biotek Corporation), the synthetic non-human miRNA is spiked into plasma before RNA extraction. Only samples with the synthetic non-human miRNA recovery >95% are used in subsequent analyses. Reverse transcription and miR-24 amplification are performed as previously described and as known in the art. Relative expression correspond to the 2 ^-ACt value. The miRNA expression levels are normalized by the spiked synthetic non- human miRNA.

Example 6: Clinical Observations

Plasma was obtained from 369 subjects hospitalized for COVID-19, consecutively enrolled from November 2020 to April 2021 at the “Ospedali dei Colli” . 48 subjects were excluded due to having a history of CBV disease, cancer, atrial fibrillation, deep vein thrombosis, or unavailability of admission blood samples; thus, the study was conducted in 321 subjects. As a control age and sex matched COVID- 19 negative population, plasma was obtained from 57 healthy donors and 37 subjects with CBV disorders. A SARS-CoV-2 test (RT-qPCR) was performed in all subjects to confirm or rule out the COVID-19 diagnosis. Endothelial-derived extracellular vesicles (EC -EVs) were extracted from the plasma collected from these subjects via serial centrifugation and CD31 ⁺ magnetic isolation and EC-EVs miR-24 levels were quantified as previously described (see e.g., Prattichizzo et al. (2021) Diabetes, 70(l):240-254; Khalyfa et al. (2016) Am J Respir Crit Care Med, 194(9): 1116-1126; Mone et al. (2021) Noncoding RNA, 7(1); and Santulli et al. (2014) J Clin Invest, 124(9): 4102-4114, each of which is incorporated by reference).

Clinical parameters of the population are provided in Table 1. CBV events were diagnosed in 56 COVID-19 subjects (17.4%). No significant differences in comorbidities and in therapeutic management were observed. Levels of EC -EV miR-24 were significantly reduced in COVID-19 subjects that have a CBV disorder relative to those who do not, but not when examining subjects without COVID-19 (Table 1). These results were confirmed when subdividing our population according to the presence of ischemic or hemorrhagic findings at imaging evaluation (Figure 1). Strikingly, using a stepwise multiple regression analysis, adjusting for age, hypertension, dyslipidemia, diabetes, and D-dimer, the association between EC-EV miR-24 and CBV disease in COVID-19 subjects was confirmed [Wald: 17.723; Exp(B): 0.955, C.I. 95%: 0.935-0.976, P < 0.001],

This is the first study showing an association between EC-EV non-coding RNA and clinical outcome in COVID-19 subjects.

A significant association was identified linking EC-EV miR-24 and CBV disorders, which could be valuable to understand the mechanisms underlying the pathophysiology of CBV complications in COVID-19.

Table 1. Main characteristics of our population. Data on quantitative parameters are expressed as mean ± standard deviation; data on qualitative characteristics are expressed as percentage values or absolute numbers. BMI: Body mass index; CBV: cerebrovascular (events); DBP: Diastolic blood pressure; EC-EV miR-24: level of miR-24 shuttled by endothelial (CD31+) extracellular vesicles; hs-CRP: high-sensitivity C Reactive Protein; IL-6: Interleukin-6; SBP: Systolic blood pressure; TNFa: Tumor Necrosis Factor a. Following verification of normality (Shapiro-Wilks test) and equal variance (Bartlett’s test), continuous variables were compared using ANOVA followed by Tukey -Kramer test for independent samples, whereas variables not normally distributed were compared via the Kruskall-Wallis test; categorical data were compared using the % ² test; *P < 0.05 vs NO CBV; # P < 0.05 vs COVID-19 Negative.

References

1. Prattichizzo F, De Nigris V, Sabbatinelli J, Giuliani A, Castano C, Parrizas M, Crespo I, Grimaldi A, Baranzini N, Spiga R et al: CD31(+) Extracellular Vesicles From Patients With Type 2 Diabetes Shuttle a miRNA Signature Associated With Cardiovascular Complications. Diabetes 2021, 70(l):240-254.

2. Mori MA, Ludwig RG, Garcia-Martin R, Brandao BB, Kahn CR: Extracellular miRNAs: From Biomarkers to Mediators of Physiology and Disease. Cell Metab 2019, 30(4):656-673.

3. Khalyfa A, Kheirandish-Gozal L, Khalyfa AA, Philby MF, Alonso- Alvarez ML, Mohammadi M, Bhattacharjee R, Teran-Santos J, Huang L, Andrade J et al: Circulating Plasma Extracellular Microvesicle MicroRNA Cargo and Endothelial Dysfunction in Children with Obstructive Sleep Apnea. Am J Respir Crit Care Med 2016, 194(9): 1116- 1126.

4. Mone P, Gambardella J, Wang X, Jankauskas SS, Matarese A, Santulli G: miR-24 Targets the Transmembrane Glycoprotein Neuropilin- 1 in Human Brain Microvascular Endothelial Cells. Noncoding RNA 2021, 7(1).

5. Mayi BS, Leibowitz JA, Woods AT, Ammon KA, Liu AE, Raja A: The role of Neuropilin-1 in COVID-19. PLoS Pathog 2021, 17(l):el009153.

6. Santulli G, Wronska A, Uryu K, Diacovo TG, Gao M, Marx SO, Kitaj ewski J, Chilton JM, Akat KM, Tuschl T et al: A selective microRNA-based strategy inhibits restenosis while preserving endothelial function. J Clin Invest 2014, 124(9):4102-4114.

INCORPORATION BY REFERENCE

The contents of all references, patent applications, patents, and published patent applications, as well as the Figures and the Sequence Listing, cited throughout this application are hereby incorporated by reference.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the present invention described herein. Such equivalents are intended to be encompassed by the following claims.