Description Technical Field:

The invention relates to a enzymes which catalyze a hydrolytic conversion between soporific fatty acid primary amides and their corresponding fatty acids, to methods for enzymatically catalyzing such conversions, and to methods for inhibiting the enzymatic catalysis of such conversions. More particularly, the invention relates to cis-9,10- octadecenoa idase and to its use and inhibition.

Statement of Government Rights:

This invention was made with government support under a National Institutes of Health Shared Instrumentation grant No. 1 S10 RR07273-01. The government has certain rights in the invention.

Background:

Sleep is a natural, periodic behavioral state during which the body rests itself and its physiological powers are restored. It is characterized by a loss of reactivity to the environment. During sleep, certain physiological processes of both the body and the brain function differently than they do during alert wakefulness.

Normal sleep consists of at least two quite different behavioral states: synchronized sleep, during which the electroencephalogram consists of slow waves of high amplitude, and desynchronized sleep (DS) or activated sleep characterized by rapid eye movements (REM sleep) , in which the electroencephalogram

pattern is characterized by waves of high frequency and low amplitude. Synchronized sleep is further characterized by slow and regular respiration, by relatively constant heart rate and blood pressure, and by a predominance of delta waves. Synchronized sleep usually consists of four stages, followed by a period of activated sleep. Each cycle lasts between 80 and 120 minutes. In contrast, desynchronized sleep is further characterized by irregular heart rate and respiration, periods of involuntary muscular jerks and movements, and a higher threshold for arousal. Periods of desynchronized sleep last from 5-20 minutes and occur at about 90 minute intervals during a normal night's sleep.

Sleep disorders include sleep deprivation and paroxysmal sleep, i.e., narcolepsy. There has been no known pharmacological method for promoting or inhibiting the initiation of sleep or for maintaining the sleeping or waking state.

Cerebrospinal fluid (liquor cerebrosinalis) is a clear, colorless fluid that circulates within the four ventricles of the brain and the subarachnoid spaces surrounding the brain and spinal cord.

Cerebrospinal fluid originates as an ultrafiltrate of the blood secreted by the choroid plexus in the lateral third and fourth ventricles. Cerebrospinal fluid is also sometimes called neurolymph. After passing through the four ventricles and the subarachnoid spaces, cerebrospinal fluid is largely resorbed into the venous system via the arachnoid villi. Cerebrospinal fluid serves as a medium for the removal of catabolites, excretions, and waste materials from the tissues bathed by it. To date, no factor derived from cerebrospinal fluid has been

reported to correlate with sleep deprivation. What is needed is a method for analyzing cerebrospinal fluid for identifying a biochemical factor generated by subject that correlates with sleep deprivation.

Since the seminal discovery of prostaglandins, there has been increasing recognition of the role of fatty acids and their derivatives in important physiological processes, e.g., B. Samuelsson, Les Prix Nobel 1982. pp. 153-174.

Cis-9,10-Octadecenoamide has been isolated from the cerebrospinal fluid of sleep-deprived cats and has been shown to exhibit sleep-inducing properties when injected into rats. Other fatty acid primary amides in addition to cis-9,10-octadecenoamide were identified as natural constituents of the cerebrospinal fluid of cat, rat, and man, indicating that these compounds compose a distinct family of brain lipids. Together, these results teach that fatty acid primary amides represent a new class of biological signalling molecules that can be employed for inducing subjects to sleep. Preferred fatty acid primary amides include _% an alkyl chain having an unsaturation and are represented by the following formula: NH ₂ C(0) (CH ₂ ) _(6ϊnsX1) CH=CH(CH ₂ ) _(82ni5 )CH ₃ . Preferred soporific fatty acid primary amides have an unsaturation with a cis configuration within their alkyl chain. In addition to cis-9,10- octadecenoamide, other soporifically active fatty acid primary amides include cis-8,9-octadecenoamide, cis-11,12-octadecenoamide, and cis-13,14- docosenoamide.

Deutsch et. al (Biochemical Pharmacology, 1993,

46, 791) has identified an amidase activity which

catalyzes both the hydrolysis and synthesis of arachidonylethanolamide (anandamide) from the membrane subcellular fractions taken from neuroblastoma, glioma cells and crude homogenates of rat brain tissues. The study detected the uptake and enzymatic breakdown of arachidonylethanolamide (anandamide) to arachidonic acid (and vice versa) from the homogenates of tissues from brain, liver, kidney and lung but not from rat heart and skeletal muscles.

The active membrane fraction which displayed this amidase activity was prepared by either homogenizing the desired cell line and subsequently subjecting the crude homogenate to density centrifugation or by taking the crude homogenates of rat brains and directly incubating them with anandamide.

The uptake and degradation of arachidonylethanolamide (anandamide) was assayed by incubation of [Η]-anandamide (NEN, NET-1073, 210 Ci/mmol) in the cell culture medium. It was found, by liquid scintillation counting of the aqueous and organic phases, that arachidonic acid and anandamide distributed in the organic phase. Thus, the organic extract of the cell medium was subsequently visualized using thin-layer chromatography, sprayed with a surface autoradiograph enhancer (EN ³ HANCE, Dupont) and exposed to X-ray film (Kodak X-OMAT AR) at -80 °C.

The serine protease inhibitor, phenylmethylsulfonyl fluoride at 1.5 mM concentration completely inhibited the amidase activity. Other inhibitors tested had little or no effect on the

activity and included aprotinin, benzamidine, leupeptin, chymostatin and pepstatin.

In a second manuscript, Deusch et. al. (J. Biol Chem . , 1994, 269 , 22937) reports the synthesis of several types of specific inhibitors of anandamide hydrolysis and their ability to inhibit anandamide breakdown in vitro. Four classes of compounds were synthesized and include fatty acyl ethanolamides, α-keto ethanolamides, α-keto ethyl esters and trifluoromethyl ketones. The most effective class of compounds were the trifluoromethyl ketones and α-keto esters. The least potent inhibitors were the α-keto amides and saturated analogs of anandamide.

As an example, when anandamide is incubated with neuroblastoma cells, it is rapidly hydrolyzed to arachidonate but in the presence of the inhibitor arachidonyl trifluoromethyl ketone, there is a 5 fold increase of anandamide levels. The study infers that polar carbonyls such as those found in trifluoromethyl ketones, may form stabilized hydrates that mimic the tetrahedral intermediates formed during the reaction between the nucleophilic residue and the carbonyl group of anandamide. Deutsch suggests that the nucleophilic residue may be the active site of a serine hydroxyl in the hydrolytic enzyme.

This enzyme is classified as an amidase (EC

#3.5) where the enzyme acts on carbon nitrogen bonds other than peptide bonds. The amidase activity is inhibited by the serine protease inhibitor, PMSF and the action of trifluoromethyl ketone inhibitors (and others) directly affect the hydrolytic activity of the enzyme. Furthermore, Deutsch suggests that

anandamide is cleaved by a mechanism that involves an active site serine hydroxyl group.

What is needed is an identification of enzymes within the brain tissue which catalyze the degradation of soporific compound found in the cerebrospinal, for mediating the soporific activity of these compounds. What is needed is an identification of inhibitors for inhibiting the activity of enzymes which degrade soporific compounds of the type found in cerebrospinal fluid.

Summary:

An enzyme is disclosed herein which degrades soporific fatty acid primary amides, viz. cis-9,10- octadecenoamidase. Cis-9,10-octadecenoamidase is one of the enzymes which mediated the activity of soporific fatty acid primary amides.

SCHEME 1

One aspect of the invention is directed to a purified form of cis-9,10-octadecenoamidase. The cis-9,10-octadecenoamidase is characterized by an enzymic activity for catalyzing a conversion cis- 9,10-octadecenoamide to oleic acid. The cis-9,10- octadecenoamidase is purified by a chromatographic methodology. Preferred chromatographic methodologies include affinity chromatography , electric chromatography, gel filtration chromatography, ion exchange chromatography, and partition chromatography. In affinity chromatography, a solid phase adsorbent contains groups that bind particular proteins because they resemble ligands for which the proteins have a natural affinity. In a preferred mode, the solid phase adsorbent contains one or more cis-9,10-octadecenoamidase inhibitors which bind the

enzyme. In antibody affinity chromatography, a solid phase im unoabsorbent having antibodies with a bind specificity with respect to cis-9,10- octadecenoamidase are employed. In electric chromatography or electrophoresis, the cis-9,10- octadecenoamidase is separated from other molecules according to its molecular weight or isoelectric point. In gel filtration, also known as gel permeation, molecular sieve, and exclusion chromatography, the solid phase creates a stationary phase of gel solvent and a mobile phase of excluded solvent. The cis-9,10-octadecenoamidase is separated according to its molecular size as it partitions between the stationary and mobile phases. The gel particles are selected to have a exclusion size in excess of cis-9,10-octadecenoamidase. In ion exchange chromatography, a solid phase ion exchanger is employed for separating the cis-9,10- octadecenoamidase from other molecules according to its partitioning between ionic and nonionic forces.

In partition chromatography, immiscible fluids having a stationary and mobile phases are employed for separating the cis-9,10-octadecenoamidase according to its partitioning between the two immiscible phases. Preferred chromatographic methodologies include DEAE chromatography, affinity chromatography on a solid phase having attached Hg groups derivatized with an inhibitor of cis-9,10- octadecenoamidase such as a trifluoroketone.

In a preferred mode, a crude source of σis-9,10- octadecenoamidase is purified in four steps. In the first step, a crude source of cis-9,10- octadecenoamidase is purified by exchange chromatography using a DEAE chromatography column to form a first elution product. In the second step,

the elution product from the first step is further purified by partitioning by with affinity chromatography to form a second elution product. In the third step, elution product from the second step is further purified by partitioning with Heparin affinity chromatography to form a third elution product. In the fourth step, the elution product from the third step is further purified by partitioning with an stationary phase derivatized with a trifluoroketone inhibitor of cis- octadecenoamidase. The eluant from the fourth step form the purified form of cis-9, 10-octadecenoamidase.

The cis-9,10-octadecenoamidase is characterized by inclusion of an amino acid sequence selected from a group consisting of: a.) GGSSGGEGALIGSGGSPLGLGTDIGGSIRFP (SEQ ID NO 5: 1-31), b. SPGGSSGGEGALIGS (SEQ ID NO 6: 1-15), c. ALIGSGGSPLGLGTD (SEQ ID NO 7: 11-25), d. GLGTDIGGSIRFPSA (SEQ ID NO 8: 21-35), e. RFPSAFCGICGLKPT (SEQ ID NO 9: 31-45), f. GLKPTGNRLSKSGLK (SEQ ID NO 10 41-55) , g- KSGLKGCVYGQTAVQ (SEQ ID NO 11 51-65) , h. QTAVQLSLGPMARDV (SEQ ID NO 12 61-75) , i. MARDVESLALCLKAL (SEQ ID NO 13 71-85) , j- CLKALLCEHLFTLDP (SEQ ID NO 14 81-95) , k. FTLDPTVPPFPFREE (SEQ ID NO 15 91-105) , 1. PFREEVYRSSRPLRV (SEQ ID NO 16 101-115) , m. RPLRVGYYETDNYTM (SEQ ID NO 17 111-125) , n. DNYTMPSPAMRRALI (SEQ ID NO 18 121-135) , o. RRALIETKQRLEAAG (SEQ ID NO 19 131-145) , P- LEAAGHTLIPFLPNN (SEQ ID NO 20 141-155) , q- FLPNNIPYALEVLSA (SEQ ID NO 21 151-165) , r. EVLSAGGLFSDGGRS (SEQ ID NO 22 161-175) , s. DGGRSFLQNFKGDFV (SEQ ID NO 23 171-185) ,

(SEQ ID NO 24: 181-195) ,

(SEQ ID NO 25: 191-205) ,

(SEQ ID NO 26: 201-215) ,

(SEQ ID NO 27: 211-225) ,

(SEQ ID NO 28: 221-235) ,

(SEQ ID NO 29: 231-245) ,

(SEQ ID NO 30: 241-255) ,

(SEQ ID NO 31: 251-265) ,

(SEQ ID NO 32: 261-274)

Another aspect of the invention is directed to a method for catalyzing the hydrolysis of a fatty acid primary amide. In this hydrolysis method, the fatty acid primary amide is combined or contacted with a catalytic amount of purified form of cis-9,10- octadecenoamidase. In a preferred mode, the fatty acid primary amide is of a type which includes an alkyl chain having an unsaturation or more particularly is represented by the following formula:

NH ₂ C(0) (CH ₂ ) (6-*nill) CH=CH(CH ₂ ) _(8ins5 )CH ₃ .

More particularly, the unsaturation of the alkyl chain may have a cis configuration or may be identically cis-9,10-octadecenoamide, cis-8,9- octadecenoamide, cis-ll,12-octadecenoamide, or cis-13,14- docosenoamide.

Another aspect of the invention is directed to a method for inhibiting an enzymatically catalyzed hydrolysis of cis-9,10-octadecenoamide by cis-9 ,10- octadecenoamidase. In this method, the cis-9,10- octadecenoamidase is combined or contacted with an inhibitor of the cis-9,10-octadecenoamidase.

Preferred inhibitors include phenylmethylsulfonyl fluoride, HgCl ₂ , and a trifluoroketone having the following structure:

Another aspect of the invention is directed to a method for ascertaining the inhibitory activity of a candidate inhibitor of cis-9,10-octadecenoamidase. The method may include the of Claim 1, the method comprising five steps. In the first step, a mixture "A" is formed by combining cis-9,10-octadecenoamidase and cis-9,10-octadecenoamide substrate under reaction conditions. In the second step, a mixture "B" is formed by combining the mixture "A" with the candidate inhibitor. In the third step, the conversion of ciε- 9,10-octadecenoamide substrate to a hydrolysis product within mixture "A" is quantified. In the fourth step, the conversion of cis-9,10- octadecenoamide substrate to hydrolysis product within mixture "B" is quantified. In the fifth step, the inhibitory activity of the candidate inhibitor is ascertained by comparing the quantifications of steps three and four.

Another aspect of the invention is directed to a trifluoroketone inhibitor of σis-9,10- octadecenoamidase represented by following structure:

Another aspect of the invention is directed to a nucleotide sequence partially encoding cis-9,10- octadecenoamidase. The nucleotide sequence is represented as follows:

CCAGGAGGTTCCTCAGGGGGTGAGGGGGC

TCTCATTGGATCTGGAGGTTCCCCTCTGG

GTTTAGGCACTGACATTGGCGGCAGCATC

CGGTTCCCTTCTGCCTTCTGCGGCATCTG TGGCCTCAAGCCTACTGGCAACCGCCTCA

GCAAGAGTGGCCTGAAGGGCTGTGTCTAT

GGACAGACGGCAGTGCAGCTTTCTCTTGG

CCCCATGGCCCGGGATGTGGAGAGCCTGG

CGCTATGCCTGAAAGCTCTACTGTGTGAG CACTTGTTCACCTTGGACCCTACCGTGCC

TCCCTTTCCCTTCAGAGAGGAGGTCTATA

GAAGTTCTAGACCCCTGCGTGTGGGGTAC

TATGAGACTGACAACTATACCATGCCCAG

CCCAGCTATGAGGAGGGCTCTGATAGAGA CCAAGCAGAGACTTGAGGCTGCTGGCCAC

ACGCTGATTCCCTTCTTACCCAACAACAT

ACCCTACGCCCTGGAGGTCCTGTCTGCGG

GCGGCCTGTTCAGTGACGGTGGCCGCAGT

TTTCTCCAAAACTTCAAAGGTGACTTTGT GGATCCCTGCTTGGGAGACCTGATCTTAA

TTCTGAGGCTGCCCAGCTGGTTTAAAAGA

CTGCTGAGCCTCCTGCTGAAGCCTCTGTT

TCCTCGGCTGGCAGCCTTTCTCAACAGTA

TGCGTCCTCGGTCAGCTGAAAAGCTGTGG AAACTGCAGCATGAGATTGAGATGTATCG

CCAGTCTGTGATTGCCCAGTGGAAAGCGA

TGAACTTGGATGTGCTGCTGACCCCNATG

YTNGGNCCNGCNYTNGAYYTNAAYACNCC

NGGNMGN (SEQ ID NO 1: 1-783).

Brief Description of the Drawings:

Figure 1 illustrates the structures of natural agent, cis-9,10-octadecenoamide (1), related analogs (2-6) . Compound 6 is the preferred structure for naturally occurring C ₂₂ fatty acid amide.

Figure 2 illustrates the determined aminoacid sequence of the purified oleic amidase.

Figure 3 illustrates a partial purification strategy involving isolation of a plasma membrane protein fraction from rat liver using 1) a sucrose gradient of the liver membrane followed by 2) a 100 mM sodium carbonate wash and 3) solubilization in trion-based buffer. The isolated liver plasma membrane is then purified by four consecutive chromatographic steps: 1) Ion exchane DEAE column, 2) Mercury inhibition column, 3) detergent exchange Heparin column followed by 4) an affinity column with a trifluoroketone inhibitor. The purified protein was determined to have a 20-30 fold enrichment of amidase activity from crude membrane protein fraction by visual comparison of the purified protein band intensity with the crude protein fraction. Estimated purified yield is 10-15% from crude liver plasma membrane protein.

Figure 4 illustrates the affinity column purification strategy (step 4, figure 3) using a trifluoroketone inhibitor which is linked to a disulfide-derivatized solid support (pyridyl disulfide beads) .

Figure 5 illustrates the synthetic protocal for the synthesis of the trifluoroketone inhibitor and subsequent attachment of the inhibitor to the disulfide-derivatized solid support using pyridyl disulfide beads.

Figure 6 represents an autoradiogram of a thin layer chromatography plate (Si02, 55% ethyl acetate/hexanes) illustrating the cis-9,10- octadecenoamidase activity of a rat brain membrane fraction with respect to the hydrolysis of radio- labelled cis-9, 10- octadecenoamide to oleic acid and its inhibition by phenylmethyl sulfonyl fluoride (PMSF) . Lane number, content: lane 1, Cis-9, 10- octadecenoamide standard; lane 2, Cis-9, 10- octadecenoamide with rat brain soluble fraction; lane 3, Cis-9, 10-octadecenoamide with rat brain membrane fraction; lane 4, Cis-9,10-octadecenoamide with rat brain membrane fraction + 1 mM phenylmethylsulfonyl fluoride (PMSF); lane 5, Cis-9, 10-octadecenoamide with rat brain membrane fraction + 5 mM EDTA; lane 6, Cis-9,10-octadecenoamide with rat pancreatic microsomes; lane 7, Cis-9,10-octadecenoamide with proteinase K (200 mg) ; lane 8, oleic acid standard.

Figure 7 represents an autoradiogram of a thin layer chromatography plate (Si02, 55% ethyl acetate/hexanes) illustrating the cis-9,10- octadecenoamidase activity of a rat brain membrane fraction with respect to the hydrolysis of radio- labelled cis-9,10- octadecenoamide to oleic acid and its inhibition by mercuric chloride (HgCl ₂ ) . The optimal concentrations required for inhibition of

amide hydrolysis activity lies between 50 mM and 5 mM HgCl ₂ . The various lanes of the TLC plate are identified as follows: lane 1, Cis-9,10- octadecenoamide standard; lane 2, Cis-9,10- octadecenoamide with rat brain soluble fraction; lane 3, Cis-9, 10-octadecenoamide with rat brain membrane fraction and 500 mM HgCl ₂ ; lane 4, Cis-9,10- octadecenoamide with rat brain membrane fraction and 50 mM HgCl ₂ ; lane 5, Cis-9, 10-octadecenoamide with rat brain membrane fraction and 5 mM HgCl ₂ ; lane 6, oleic acid standard. A typical HgCl ₂ inhibition study uses a 100 mM HgCl ₂ stock (27 g in l L Tris buffer (50 mM) , pH 7.5) of HgCl ₂ .

Figure 8 represents a northern blot of mRNA obtained from cloning procedures. Ribosomal markers are shown by the arrows, next to lane 1, and indicate 5kb and 2kb bands. The arrow next to lane 6 points to a 3kb band which is representative of the oleic amidase enzyme. Lane 1 is total RNA from rat brain; lane 2 is total RNA from rat lung; lane 3 is total RNA from rat kidney; lane 4 is total RNA from rat heart; lane 5 is total RNA from rat liver; lane 6 is mRNA from rat liver (mRNA loaded in lane 6 is approximately 500 ng) ; total respective RNA loaded in lanes 1-5 was approximately 15 μg.

Detailed Description:

Protocols for the Induction of Sleep:

Synthetic cis-9,10-octadecenoamide was injected (ip) into rats in order to test its effect on spontaneous behavior at different doses: 1 (n=2) , 2 (n=2), 5 (n=7), 10 (n=10) , 20 (n=2), and 50 (n=2) mg,

where n = number of rats tested. Rats were injected during a reversed dark period (12:12) two hours after the lights cycled off and were observed in their home cages. With the lower doses (1 and 2 mg) , no overt effect on spontaneous behavior was witnessed.

However, at a threshold of 5 mg and above there was a marked effect consisting of an induction of long-lasting motor quiescence associated with eyes closed, sedated behavior characteristic of normal sleep. Also as with normal sleep, the rats still responded to auditory stimuli with orienting reflex and sustained attention toward the source of stimulation. In addition, motor behavior was impaired. The latency to behavioral sedation following administration was about 4 minutes and subjects were normally active again after 1 hour (5 mg) , 2 hour (10 mg) , or 2.5 hour (20 mg and 50 mg) .

We have compared cis-9,10-octadecenoamide to vehicle and the synthetic analogs listed in Figure 1 to estimate the structural specificity of its sleep-inducing potential. Neither vehicle (5% ethanol in saline solution) nor oleic acid (5) showed any overt behavioral effect. Trans-9,10- octadecenoamide demonstrated similar pharmacological effects to its cis counterpart, but was much less potent as measured by the comparatively shorter duration time for its sleep-inducing properties (at 10 mg per rat, the biological effect lasted one hour for the trans isomer and two hours for the cis isomer) . When the olefin was moved either direction along the alkyl chain (to the 8,9 (3) or 11,12 (4) positions) or the alkyl chain length was extended to 22 carbons (6) , a substantial reduction in both the degree and duration of the pharmacological effects was observed, and while the mobility of the rats

still decreased, their eyes remained open and their alertness appeared only slightly affected. Finally, polysomnographic studies on rats injected with cis-9,10-octadecenoamide show an increase in the total time of slow wave sleep (SWS) as well as in the mean duration of the SWS individual periods when compared to vehicle controls. More particularly, male Sprague-Dawley rats (300 g at the time of surgery) were implanted under halothane anesthesia (2-3%) with a standard set of electrodes for sleep recordings. This included two screw electrodes placed in the parietal bone over the hippocampus to record the subjects electroencephalogram (EEG) and two wire electrodes inserted in the neck musculature to record postural tone through electromyographic activity (EMG) . Rats were housed individually with at libitum access to food and water. The dark-light cycle was controlled (12:12, lights on a 10:00 p.m.). One week after the surgery, rats were habituated to the recording conditions for at least three days.

Upon the completion of the habituation period, rats received 2 milliliter (ip) of either: vehicle (5% ethanol/saline solution), cis-9,10-octadecenoamide (10 mg) , or oleic acid (10 mg) . Rats were continuously recorded for four hours after the ip injection (12:00 p.m.-4:00 p.m.) Rats were observed for spontaneous changes in behavior through a one-way window. Sleep recordings were visually scored and four stages were determined: wakefulness, slow-wave-sleep 1 (SWS1) , slow-wave-sleep 2 (SWS2) , and rapid eye movement (REM) sleep.

These increases with respect to slow wave sleep (SWS) were at the expense of waking. Distribution of REM sleep does not seem to be altered. Together, these data suggest that cis-9,10-octadecenoamide

could play an important role in slow-wave sleep modulation.

The traditional view of lipid molecules as passive structural elements of cellular architecture is rapidly giving way to an ever increasing awareness of the active roles these agents play in transducing cell signals and modifying cell behavior, e.g., M. Liscovitch and L. C. Cantley, Cell (1994) : vol. 77, page 329. An intriguing feature of the fatty acid amides studied here is that they belong to a family of simple molecules in which a great deal of diversity may be generated by simply varying the length of the alkane chain and the position, stereochemistry, and number of its olefin(s) .

Interestingly, other neuroactive signalling molecules with amide modifications at their carboxy termini have been reported, from carboxamide terminal peptides to arachidonylethanolamide. Neuroactive signalling molecules employing carboxamide terminal peptides are disclosed by B. A. Eipper, D. A. Stoffers, and R. E. Mains in Annu . Rev. Neurosci . (1992): vol. 15, page 57. Neuroactive signalling molecules employing arachidonylethanolamide is disclosed by W. A. Devane, L. Hanus, A. Breuer, R. G. Pertwee, L. A. Stevenson, G. Griffin, D. Gibson, A. Mandelbaum, A. Etinger, and R. Mechoulam in Science (1992): vol. 258, page 1946. It is disclosed herein that cis-9,10-octadecenoamide is a member of a new class of biological effectors in which simple variations of a core chemical structure have unique physiological consequences.

Isolation and assay of integral membrane protein fraction with cis-9,10-octadecenoamidase activity:

Observations on Lipid Amidase Activity

Lipid amidase activity has been observed in brain, liver, lung, kidney and spleen tissues, but not in heart tissue. The activity is inhibited by 1 mM PMSF (phenylmethylsulfonyl fluoride) and 50 mM

HgCl, which is a test for sulfhydryl group dependency of the reaction. Since the fractions are not solubilized by 100 mM sodium carbonate (pH 11.5), the sample is apparently a membrane protein, which has been identified in nuclear, microsomal, and plasma membrane subcellular fractions, but not in the cytosol.

The enzyme catalyzed hydrolysis of cis-9,10-octadecenoamide to oleic acid by purified cis-9,10-octadecenoamide and inhibition of this enzyme by PMSF is disclosed on an autoradiogram of a thin layer chromatographic plate (Si02, 55% ethyl acetate/hexanes), illustrated in Figure 6. In each case the enzymic reaction is performed is a separate reaction vessel and the product is spotted onto a TLC plate. The various reaction conditions for the reaction vessel corresponding to each lane are identified as follows:

lane 1: Cis-9,10-octadecenoamide standard; lane 2: Cis-9 ,10-octadecenoamide with rat brain soluble fraction; lane 3: Cis-9 ,10-octadecenoamide with rat brain membrane fraction; lane 4: Cis-9,10-octadecenoamide with rat

brain membrane fraction + 1 mM PMSF; lane 5: Cis-9,10-octadecenoamide with rat brain membrane fraction + 5 mM EDTA; lane 6: Cis-9,10-octadecenoamide with rat pancreatic microsomes; lane 7: Cis-9,10-octadecenoamide with proteinase K (200 mg) ; and lane 8: oleic acid standard.

Inhibition studies of Cis-9,10-octadecenoamide hydrolysis to oleic acid with HgCl ₂ are illustrated in

Figure 7. Between 50 mM and 5 mM HgCl ₂ lies the optimal concentrations required for inhibition of amide hydrolysis activity. The enzyme catalyzed hydrolysis of cis-9,10-octadecenoamide to oleic acid by purified cis-9,10-octadecenoamide and inhibition of this enzyme by HgCl ₂ is performed in a series of reaction vessels and spotted onto a thin layer chromatographic plate (Si02, 55% ethyl acetate/hexanes) . A typical HgCl ₂ inhibition study uses a 100 mM HgCl ₂ stock (27 mg in lmL Tris buffer (50 mM) , pH 7.5) of HgCl ₂ . The various reaction conditions for the reaction vessels corresponding to each lane are identified as follows:

lane 1: Cis-9,10-octadecenoamide standard; lane 2: Cis-9,10-octadecenoamide with rat brain soluble fraction; lane 3: Cis-9,10-octadecenoamide with rat brain membrane fraction and 500 mM

HgCl ₂ ; lane 4: Cis-9,10-octadecenoamide with rat brain membrane fraction and 50 mM HgCl ₂ ; lane 5: Cis-9 ,10-octadecenoamide with rat

brain membrane fraction and 5 mM

HgCl ₂ ; lane 6: oleic acid standard.

SCHEME 2

A unique enzymatic activity capable of degrading the putative effector molecule, cis-9,10- octadecenoamide has been identified and is disclosed herein. Rapid conversion of "C-cis-9,10- octadecenoamide to oleic acid by rat brain membrane fractions was observed by TLC. The enzymatic activity was unaffected by 5 mM EDTA, but was completely inhibited by 1 mM phenylmethylsulfonyl fluoride (PMSF) . Only trace amide hydrolysis activity was observed with rat brain soluble fractions, while rat pancreatic microsomes and proteinase K showed no significant capacity to hydrolyze cis-9,10-octadecenoamide to oleic acid.

Synthesis of fatty acid primary amides:

Preferred protocols for synthesizing exemplary fatty acid primary amides are provided. The synthetic protocols differ only with respect to the chain length of the starting materials, the product yields, and the separation of the various cis and trans products. Accordingly, exemplary descriptions of synthetic protocols for the synthesis of cis-9,10- octadecenoamide and several other fatty acid primary amides are provided and serve to illustrate the synthetic protocol for the entire class of fatty acid primary amides.

Purification Protocals

Isolation of integral membrane protein fraction with cis-9 _r 10-octadecenoamidase activity:

The protocol described herein is for about 5-10 g of tissue. The rat liver(s) are collected, weighed and then placed in ImM NaHC0 ₃ on ice. Next, the liver is cut up, rinsed (2X) with ImM NaHC0 ₃ and minced with a razor blade on a sheet of wax. It is then placed into 25 ml of ImM sodium bicarbonate and homogenized in a tissuemizer for 2 minutes at setting 6. A dilution to 100 ml with ImM sodium bicarbonate is subsequently performed, which is followed by a filtration through 4 layers of cheesecloth and then through 8 layers. The filtrate is then brought up to 100 ml and split into four JA-20 tubes and topped off with ImM sodium bicarbonate. The tubes are spun at 6,000 rpm (4500 x g) for 12 minutes at 4°C in the JA- 20 rotor. Using a Pasteur pipette, the fat layer is sucked off and the supernatant layer is decanted and saved.

Next, the pellet is resuspended in the remaining supernatant layer with a syringe and needle. 20 iL fractions of the resuspension are then dounced 16 times with a 15 ml dounce homogenizer. The fractions are then combined into a single JA-20 tube and brought up to volume with ImM NaHC0 ₃ . The tubes are next spun again at 6,000 rpm (4500 x g) for 15 minutes at 4°C in a JA-20 rotor and the supernatant is subsequently poured off and saved. The pellet is resuspended and dounced as before and then brought up to 10 ml volume with ImM sodium bicarbonate. Next, 20 mL of 67% sucrose solution is added to a final volume of 30 ml and the mixture is split into 2 tubes. An additional 25 mL of 30% sucrose is added to the top of each tube and spun at 27 K rpm for 1 hour 45 minutes at 4°C in an ultracentrifuge. The fractions are collected from the sucrose gradient and the middle band from the sucrose gradient (plasma membrane band) is placed in a capped plastic tube and filled with ImM sodium bicarbonate. The tube is subsequently spun at 17,000 rpm for 35 minutes at 4°C.

The supernatant is discarded and the pellets are resuspended (with ouncing) in 100 mM of sodium carbonate. This solution is subsequently kept on ice for 1 hour and then spun at 100,000 g for 1 hour. The supernatant (solubilized peripheral membrane proteins) is discarded since no lipid amidase activity is present in this fraction and the pellet is resuspended (with Douncing) in 10% glycerol, 1% Triton, 0.1% phosphatidyl choline, 20mM Hepes buffer and then stirred for two hours at 4°C. Finally the solution is spun at 100,000 g for 1 hour and the supernatant thus obtained is further purified as follows.

Puri ication via 4 step column chromatography process

Step 1 DEAE column/ ion exchange (figure 3) . The above solubilized supernatant batch is further purified. The supernatant batch is mixed with DEAE- Sephadex (Diethylaminoethyl-Sephadex, commercially available from Sigma chemical company) ion exchange resin for 1 hour at 4°C. The fraction which is bound to the DEAE resin, displays the lipid amidase activity (none in flow through) . Solubilized rat liver plasma membrane (in BI: 10% glycerol, 1% Triton X-100, 1 mM EDTA, 20 mM Hepes, pH 7.2) is passed over DEAE Fast Flow column (Pharmacia) and washed with 5 column volumes of BI, 0.2% Triton. Then the amidase activity is eluted with 1 column volume each of 50 mM, 100 mM, and 200 mM NaCl BI, 0.2% Triton.

Step 2 Hg Column (figure 3) . The above eluent from the DEAE exchange, is mixed with p- chloromercuric benzoic acid resin (Commercially available from BioRad chemical company) for 1 hour at 4 ^C C. The fraction which is bound to.the above mercury resin, displays the lipid amidase activity (none in flow through) , is washed with 5 column volumes of BI, 0.2% Triton, 5 column volumes of BI, 0.2% Triton and 150 mM NaCl, and eluted with 1.5 column volumes BI, 0.2% Triton, 150 mM NaCl, and 25 mM b-mercaptoethanol.

Step 3 Heparin column (figure 3) . Hg-eluted amidase activity was passed over Heparin column (BioRad) and washed with 10 column volumes of BI, 0.7% CHAPS and 150 mM NaCl (detergent exchange) . Elution was conducted with 1 column volume each of BI, 0.7% CHAPS and 300 mM, 400 mM, 500 mM, 650 mM, and 750 mM NaCl, with amidase activity eluting in the

final two fractions.

Step 4 Affinity column (figures 3 and 4) . Heparin-eluted amidase activity was mixed with Triton X-100 for a final concentration of 0.2%, and then passed over CF ₃ -inhibitor linked to activated pyridyl disulphide beads (attachment of inhibitor to beads is described infra) and washed with 20 column volumes of BI, 0.2% Triton X-100. Elution was conducted by passing 3 column volumes of BI, with 0.2% Triton and 20 mM DTT, and letting column stand at 4o C for 30 h. Then, washing column with 1.5 column volumes of BI with 0.2% Triton and 20 mM DTT eluted single protein of 60 kD in size. Protein was digested with trypsin and peptides were sequenced as described infra.

The purity of the activity is then assessed after this procedure according to an assay protocol.

Assay of protein fraction with cis-9.10- octadecenoamidase activity ffigure 3 ) :

The following protocol is used for assaying cis- 9 ,10-octadecenoamide hydrolysis activity: To 120 mL of 125 mM TrisHCl, pH 9.0 was added successively 70 mL protein fraction (1 mg/mL protein concentration for brain membrane fraction, 2 mg/mL for brain soluble fraction, 5 mg/mL for pancreatic microsomal preparation), 6 mL of ethanol, and 4 mL of ¹⁴ C-cis- 9 ,10-octadecenoamide (in ethanol, 0.25 mCi/mL) . Each reaction mixture is incubated for 4 hours at 37°C and then partitioned between EtOAc and 0.07 M HC1. The EtOAc layer is evaporated to dryness and the remaining residue is dissolved in 15 mL ethanol. TLC fractions are taken from this ethanol stock. TLC plates are treated with EN ³ HANCE spray and developed

at -78°C for 2 hours.

The purified protein was determined to have a 20-30 fold enrichment of amidase activity from crude membrane protein fraction by visual comparison of the purified protein band intensity with the crude protein fraction. Estimated purified yield is 10-15% (figure 3)

₂ CI ₂ ,

1) KHMDS (1 eq), THF, reflux, 1 hr

2) -78°, decyl aldehyde (1.2 eq), to RT for 2 hr

10 (3:1 :1), 8 hr, RT 11 60% 60-75 %

1) oxalyl chloride (3 eq), CH ₂ CI _2, 4 hr, RT

2) sat NH4OH, 0°, 5 min

3

85-90%

Scheme 3

0

.A —0

H,K' fCHj *ICH,), OH 12

13.70

(.CK,) _f PPr>-.>&'* J4.915-

LiOH (3 eqj.THF:McOH: H _? 0

CH.O-^(CH.)- ^{CH.) _f OTBDPS HO-^ ₍ CH.}, *" 'fCH _I ) _r OTBDPS

0:1:1). Shr.KT

16.895

Suc Λnny (2 eu). EtiN (2 cqϊ.

H-N .Λ (CK-) ₇ 'fCK,),OH 12. SO

DMAPi.l eui. CH-C1-.10 h

Scheme 4

Synthetic protocals

Cis-9 _r 10-octadecenoamide ri! figure 1):

A solution of oleic acid (1.0 g, 3.55 mmol, 1.0 equiv.) in CH ₂ C1 ₂ (8.9 mL, 0.4 M) at 0 °C was treated dropwise with oxalyl chloride (5.32 mL, 2.0 M solution in CH ₂ C1 ₂ , 10.64 mmol, 3.0 equiv.). The reaction mixture was stirred at 25 °C for 4 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous NH ₄ 0H (2.0 mL) . The reaction mixture was then partitioned between ethyl acetate (EtOAc) (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 40-100% EtOAc-hexanes gradient elution) afforded 1 as a white solid (0.810 g, 0.996 g theoretical, 81.3%): ^l K NMR (CDC1 ₃ , 250 MHz) δ 6.06 (bs, 1H, NH ₂ C(0)), 5.58 (bs, 1H, Nff ₂ C(0)), 5.32 (m, 2H, CH=CH) , 2.16 (t, 2H, J = 7.5 Hz, CH ₂ C(O)NH ₂ ) , 2.02 (m, 4H, CH ₂ CH=CHCH ₂ ) , 1.61 (m, 2H, Ctf ₂ CH ₂ C(0)NH ₂ ) , 1.29 (b s, 14H, alkyl protons), 0.87 (t, 3H, CH ₃ ) ; FABHRMS (NBA/Nal m/e 282.2804 (C _ιe H ₃₅ NO + H ⁺ requires 282.2797). The regions of the spectra that distinguish between the cis and trans isomers are the olefinic protons from δ 5.3 to 5.2 and allylic protons from δ 2.0 to 1.8. These regions identify the natural compound as cis-9,10-octadecenoamide.

Trans-9 _r 10-octadecenoamide ffiσure 1) :

A solution of elaidic acid (1.0 g, 3.55 mmol, 1.0 equiv.) in CH ₂ C1 ₂ (8.9 mL, 0.4 M) at 0 °C was treated dropwise with oxalyl chloride (5.32 mL, 2.0 M solution in CH ₂ C1 ₂ , 10.64 mmol, 3.0 equiv.). The reaction mixture was stirred at 25 ^C C for 4 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous NH ₄ 0H (2.0 mL) . The reaction mixture was then partitioned between ethyl acetate (EtOAc) (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 40-100% EtOAc-hexanes gradient elution) afforded 2 as a white solid. The regions of the spectra that distinguish between the cis and trans isomers are the olefinic protons from δ 5.3 to 5.2 and allylic protons from δ 2.0 to 1.8. These regions identify the compound as trans-9,10-octadecenoamide.

Cis-8.9-octadecenoamide (3 : figure li :

A solution of 11, synthesized infra, (0.130 g, 0.461 mmol, 1.0 equiv.) in CH ₂ C1 ₂ (1.5 mL, 0.31 M) at 0 °C was treated dropwise with oxalyl chloride (0.69 mL, 2.0 M solution in CH ₂ C1 ₂ , 1.38 mmol, 3.0 equiv.). The reaction mixture was stirred at 25 °C for 4 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous NH ₄ OH (2.0 mL) . The reaction mixture was then partitioned between ethyl acetate (EtOAc) (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 40-100% EtOAc-hexanes gradient elution) afforded 3 as a white solid. (0.105 g, 0.130 theoretical, 80.8%): ^α H NMR (CDC1 ₃ , 250 MHz) δ 5.70- 5.34 (m, 4H, H ₂ NC(0) and CH=CH) , 2.21 (t, 2H, J = 7.5 Hz, CH ₂ C(0)NH ₂ ), 2.00 (m, 4H, CH ₂ CH=CHCH ₂ ) , 1.63 (m, 2H, CH ₂ CH ₂ C(0)NH ₂ ) , 1.47-1.23 (m, 20H, alkyl protons), 0.87 (t, 3H, RCH ₃ ) ; FABHRMS (NBA/CSI m/e 414.1762 (C ₁₈ H ₃₅ N0 + Cs ⁺ requires 414.1773).

Cis-11.12-octadecenoamide (A : figure 1):

A solution of Δ11,12 octadecenoic acid (1.0 g, 3.55 mmol, 1.0 equiv.) in CH ₂ C1 ₂ (8.9 mL, 0.4 M) at 0 °C was treated dropwise with oxalyl chloride (5.32 mL, 2.0 M solution in CH ₂ C1 ₂ , 10.64 mmol, 3.0 equiv.). The reaction mixture was stirred at 25 °C for 4 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous NH ₄ 0H (2.0 mL) . The reaction mixture was then partitioned between ethyl acetate (EtOAc) (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ 5 cm x 15 cm, 40-100% EtOAc-hexanes gradient elution) afforded 4 as a white solid.

Oleic acid t5 : figure 1 , :

Oleic acid was obtained from Aldrich chemical company, CAS #112-80-1.

Erucamide (6: figure 1)

Erucamide was obtained from Aldrich chemical company, CAS #28,057-7.

Methvl-8-hvdroxv-octanoate (7 : scheme 3): A solution of suberic acid monomethyl ester (1.5 g, 7.97 mmol, 1.0 equiv.) in tetrahydrofuran (THF) (32.0 mL, .25M) at -20 °C was treated dropwise with BH ₃ .THF (IM solution in THF, 7.97 mL, 7.97 mmol, 1.0 equiv.) . The reaction mixture was stirred overnight and was subsequently allowed to reach room temperature. The reaction mixture was then diluted with ethyl acetate (100 mL) and quenched with methanol (10 mL) and 10% HC1 (10 mL) . Extraction with NaHC0 ₃ (IX 20 mL) , water (2X 10 mL) , and brine (IX 10 mL) , afforded methyl-8-hydroxy-octanoate (7) as a crude white solid.

Methγl-8-bromo-octanoate (8: scheme 3):

A solution of crude methyl-8-hydroxy-octanoate (7, 1.24 g, 7.13 mmol, 1.0 equiv.) in CH ₂ C1 ₂ (15 mL,

0.48 M) at 0 °C was treated successively with CBr ₄ (3.07 g, 9.27 mmol, 1.3 equiv.) and PPh ₃ (2.61 g, 9.98 mmol, 1.4 equiv.) and the reaction mixture was stirred at 4 °C for 10 h. The reaction mixture was then concentrated under reduced pressure and washed repeatedly with Et ₂ 0 (8 x 10 mL washes) . The Et ₂ 0 washes were combined and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, hexanes) afforded 8 as a clear, colorless oil (1.25 g, 1.69 g theoretical, 74.0%): ^: H NMR (CDC1 ₃ , 250 MHZ) δ 3.64 (S, 3H, C(0)0CH ₃ ), 3.38 (t, 2H, J = 6.8 HZ, CH ₂ Br) , 2.29 (t, 2H, J=7.4 Hz CH ₂ C(0)0CH ₃ ) , 1.83 (p, 2H, CH ₂ CH ₂ Br) , 1.63 (m, 2H, CH ₂ CH ₂ C(0)OCH ₃ ) 1.47- 1.28 (m, 6H, alkyl protons).

Methvl-8-triphenγlphosphoranγl-octanoate-bromide f9: scheme 3) :

A solution of 8 (1.25 g, 5.23 mmol, 1.0 equiv.) in CH ₃ CN (4.0 mL, 1.31 M) was treated with triphenylphosphine (1.52 g, 5.75 mmol, 1.1 equiv.) and stirred at reflux for 10 h. Additional triphenylphosphine (0.685 g, 2.61 mmol, 0.5 equiv.) was added to the reaction mixture and stirring was continued at reflux for 5 h. The reaction mixture was concentrated under reduced pressure and washed repeatedly with Et ₂ 0 (5 x 10 mL washes) . The remaining residue was then solubilized in the minimum volume of CH ₂ C1 ₂ and concentrated under reduced pressure to afford 9 as a colorless foam (2.20 g, 2.61 g theoretical, 84.3%): IH NMR (CDC1 ₃ , 250 MHz) δ 7.82-7.51 (m, 15H, ArH) , 3.70-3.46 (m, 5H, CH ₃ 0C(0)R and CH ₂ PPh ₃ ) , 2.13 (t, 2H, J = 7.4 Hz, CH2C(0)OCH3) , 1.62-1.43 (m, 6H, alkyl protons), 1.30-1.02 (m, 4H, alkyl protons); FABHRMS (NBA) m/e 419.2154 (C ₂₇ H ₃₂ Br0 ₂ P-Br ^" requires 419.2140).

Methyl-cis-8.9-octadecenoate (10: scheme 3 )

A solution of 9 (0.71 g, 1.42 mmol, 1.0 equiv.) in THF (7.0 mL, 0.2 M) at 25 °C was treated with KHMDS (3.0 mL, 0.5 M solution in THF, 1.5 mmol, 1.06 equiv.) and the reaction mixture was stirred at reflux for 1 h. The reaction mixture was then cooled to -78 °C, treated with decyl aldehyde (0.321 mL, 1.71 mmol, 1.2 equiv.) warmed to 25 ^C C, and stirred for an additional 30 min. The reaction mixture was then treated with saturated aqueous NH ₄ C1 and partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 0-2% EtOAc-hexanes gradient elution) afforded 10 as a colorless oil (0.290 g, 0.422 g theoretical, 68.7 %) : ^: H NMR (CDC1 ₃ , 250 MHz) δ 5.34 (m, 2H, CH=CH) , 3.65 (s, 3H, CH ₃ OC(0)), 2.29 (t, 2H, J = 7.4 HZ, CH ₂ C(0)OCH ₃ ) , 2.00 (m, 4H, CH ₂ CH=CHCH ₂ ) , 1.61 (m, 2H, CH ₂ CH ₂ C(0)OCH ₃ ) , 1.29 (bs, 20 H, alkyl protons), 0.86 (t, 3H, RCH ₃ ) .

Cis-8.9 octadecenoic acid t il : scheme 3):

A solution of 10 (0.245 g, 0.825 mmol, 1.0 equiv.) in THF-MeOH-H ₂ 0 (3-1-1 ratio, 4.1 mL, 0.2 M) at 0 °C was treated with LiOHH ₂ 0 (0.104 g, 2.48 mmol, 3.0 equiv.). The reaction mixture was warmed to 25 °C, stirred for 8 h, and then partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was washed successively with 10% aqueous HCl (100 mL) and saturated aqueous NaCl (100 mL) , dried, and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5cm x 15 cm, 10-30% EtOAc-hexanes gradient elution) afforded 11 as a colorless oil (0.156 g, 0.233 g theoretical, 67.0%): ^X H NMR (CDC1 ₃ , 250 MHz) δ 5.34 (m, 2H, CH=CH) , 2.34 (t, 2H, J = 7.4 Hz,

CH ₂ COOH) , 2 . 01 (m, 4H, CH ₂ CH=CHCH ₂ ) , 1. 61 (m, 2H,

CH ₂ CH ₂ COOH) , 1. 47-1. 23 (m, 20 H, alkyl protons) , 0. 87 (t , 3H, RCH ₃ ) .

18-Hemisuccinate-cis-9 . 10-octadecenoamide t l2 : scheme IX:

A solution of 18 (0.047 g, 0.160 M, 1.0 equiv) in CH ₂ C1 ₂ -CHC1 ₃ (3-1, 1.60 mL, 0.1M) was treated successively with Et ₃ N (0.045 mL, 0.320 mmol, 2.0 equiv), succinic anhydride (0.033 g, 0.320 mmol, 2.0 equiv) and DMAP (0.002 g, 0.016 mmol, 0.1 equiv), and the reaction mixture was stirred at 25 °C for 10 h. The reaction mixture was then partitioned between CH ₂ C1 ₂ (50 mL) and H ₂ 0 (50 mL) , and the organic layer was washed successively with 10% aqueous HCl (50 mL) and saturated aqueous NaCl (50 mL) , dried (Na ₂ S0 ₄ ) , and concentrated under reduced pressure. Chromatography (Si0 ₂ , 3 cm x 15 cm, 0-10% MeOH-EtOAc) afforded 12 as a white solid (0.051 g, 0.063 theoretical, 80.3%): H NMR (CDC1 ₃ , 250 MHz) δ 6.95 (b ε, IH, ff ₂ NC(0)), 5.72 (b s, IH, ff ₂ NC(0)), 5.34 (m, 2H, CH=CH) , 4.08 (t, 3H, J = 6.6 Hz, Ctf ₂ 0C(0)R), 2.61 (m, 4H, R0C(0)CH ₂ Ciϊ ₂ C00H) , 2.21 (t, 2H, J = 7.5 Hz, Ctf ₂ C(0)NH ₂ ) , 2.00 (m, 4H, Cff ₂ CH=CHCJ_' ₂ ) , 1.70-1.52 (m, 4H, CH ₂ CH ₂ C(0)NH ₂ and Cff ₂ CH ₂ OH) , 1.29 (b s, 18H, alkyl protons); FABHRMS (NBA) m/e 398.2893 (C ₂₂ H ₃₉ N0 ₅ + H ⁺ requires 398.2906).

Methyl-9-bromo-nonanoate (13: scheme 4):

A solution of methyl-9-hydroxy-nonanoate (1.1 g, 5.85 mmol, 1.0 equiv) in CH ₂ C1 ₂ (30 mL, 0.2 M) at 0 °C was treated successively with CBr ₄ (2.5 g, 7.54 mmol, 1.3 equiv) and PPh ₃ (2.15 g, 8.19 mmol, 1.4 equiv) and the reaction mixture was stirred at 4 °C for 10 h. The reaction mixture was then concenctrated under reduced pressure and washed repeatedly with Et ₂ 0 (8 x 10 L washes) . The Et ₂ 0 washes were combined and

concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, hexanes) afforded 13 as a clear, colorless oil (1.02 g, 1.47 g theorectical, 69.5 %) : ^α H NMR (CDC1 ₃ , 250 MHz) d 3.64 (s, 3H, C(0)0CH ₃ ), 3.38 (t, 2H, J = 6.8 HZ, CH ₂ Br) , 2.29 (t, 2H, J = 7.4 Hz CJΪ ₂ C(0)OCH ₃ ) , 1.83 (p, 2H, Cff ₂ CH ₂ Br) , 1.63 (m, 2H, CJϊ ₂ CH ₂ C(0)OCH ₃ ) 1.47-1.28 (m, 8H, alkyl protons) .

Methγl-9-triphenylphosphoranvl-nonanoate-bromide (14 scheme 4) :

A solution of 13 (1.02 g, 4.06 mmol, 1.0 equiv) in CH ₃ CN (3.5 mL, 1.16 M) was treated with triphenylphosphine (1.17 g, 4.47 mmol, 1.1 equiv) and stirred at reflux for 10 h. Additional triphenylphosphine (0.532 g, 2.03 mmol, 0.5 equiv) was added to the reaction mixture and stirring was continued at reflux for 5 h. The reaction mixture was concentrated under reduced pressure and washed repeatedly with Et ₂ 0 (5 x 10 mL washes) . The remaining residue was then solubilized in the minimum volume of CH ₂ C1 ₂ and concentrated under reduced pressure to afford 14 as a colorless foam (1.90 g, 2.08 g theoretical, 91.3%): ^: H NMR (CDC1 ₃ , 250 MHz) δ 7.82-7.51 (m, 15H, ArH) , 3.70-3.46 (m, 5H, CH ₃ 0C(0)R and CH ₂ PPh ₃ ) , 2.13 (t, 2H, J = 7.4 Hz, CH ₂ C(0)0CH ₃ ) ,

1.62-1.02 (m, 12H, alkyl protons); FABHRMS (NBA) m/e 433.2312 (C ₂₈ H ₃₄ Br0 ₂ P - Br ^" requires 433.2296).

Methyl-18-t-butvldiphenvsilvloxγ-cis-9.10 octadecenoate (15 scheme 41:

A solution of 14 (1.0 g, 1.95 mmol, 1.0 equiv) in THF (6.5 mL, 0.3 M) at 25 °C was treated with KHMDS (3.9 L, 0.5 M solution in THF, 1.95 mmol, 1.0 equiv) and the reaction mixture was stirred at reflux for 1 h. The reaction mixture was then cooled to -78 °C, treated with 3 (0.93 g, 2.35 mmol, 1.2 equiv),

warmed to 25 °C, and stirred for an additional 30 min. The reaction mixture was then treated with saturated aqueous NH ₄ C1 and partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 0-2% EtOAc-hexanes gradient elution) afforded 15 as a colorless oil (0.82 g, 1.07 g theoretical, 76.3%): ^α H NMR (CDC1 ₃ , 250 MHz) δ 7.67 (m, 4H, ArH), 7.41 (m, 6H, ArH), 5.34 (m, 2H, CH=CH) , 3.65 (m, 5H, CH ₃ OC(0) and CJϊ ₂ 0TBDPS) , 2.29 (t, 2H, J = 7.4 Hz, CH ₂ C(O)0CH3) , 2.00 (m, 4H, Cff ₂ CH=CHCff ₂ ) , 1.55 (m, 4H, CH ₂ CH ₂ C(0)OCH ₃ and CH ₂ CH ₂ OTBDPS) , 1.29 (b s, 18H, alkyl protons), 1.04 (S, 9H, (CH ₃ ) ₃ C).

18-T-butyldiphenvlsilvloxγ-cis-9 _r 10-octadecenoic acid

(16 scheme 4) •

A solution of 5 (0.81 g, 1.47 mmol, 1.0 equiv) in THF-MeOH-H ₂ 0 (3-1-1 ratio, 7.3 mL, 0.2 M) at 0 °C was treated with LiOH"H0 (0.188 g, 4.48 mmol, 3.0 equiv) . The reaction mixture was warmed to 25 °C, stirred for 8 h, and then partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was washed successively with 10% aqueous HCl (100 mL) and saturated aqueous NaCl (100 mL) , dried, and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 10-30% EtOAc-hexanes gradient elution) afforded 16 as a colorless oil (0.700 g, 0.790 g theoretical, 88.7%): ^: H NMR (CDC1 ₃ , 250 MHz) δ 7.67 (m, 4H, ArH), 7.41 (m, 6H, ArH), 5.34 (m, 2H, CH=CH) , 3.65 (t, 3H, J = 6.5 Hz, Cff ₂ 0TBDPS) , 2.34 (t, 2H, J = 7.4 HZ, Cff ₂ COOH) , 2.00 (m, 4H, CH ₂ CH=CHOf ₂ ) , 1.65-1.50 (m, 4H, CH ₂ CH ₂ COOH and CH ₂ CH ₂ OTBDPS) , 1.47- 1.23 (m, 18H, alkyl protons), 1.05 (s, 9H, (Ctf ₃ ) ₃ C); FABHRMS (NBA/CsI) m/e 669.2772 (C ₃₄ H ₅₂ 0 ₃ Si + Cs ⁺ requires 669.2740).

18-T-butγldiphenγlsilyloxγ-cis-9.10-octadecenoamide

(17 scheme 4) :

A solution of 16 (0.685 g, 1.28 mmol, 1.0 equiv) in CH ₂ C1 ₂ (4.3 mL, 0.3 M) at 0 °C was treated dropwise with oxalyl chloride (1.92 mL, 2 M solution in CH ₂ C1 ₂ , 3.84 mmol, 3.0 equiv). The reaction mixture was stirred at 25 °C for 4 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous NH ₄ OH (2.0 mL) . The reaction mixture was then partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 40-100% EtOAc-hexanes gradient elution) afforded 17 as a colorless oil (0.520 g, 0.684 g, 76.0%): ^α H NMR (CDC1 ₃ , 250 MHz) δ 7.67 (m,

4H, ArH), 7.41 (m, 6H, ArH), 5.70-5.34 (m, 4H, ff ₂ NC(0) and CH=CH) , 3.65 (t, 3H, J = 6.5 Hz, Ctf ₂ 0TBDPS) , 2.21 (t, 2H, J = 7.5 Hz, CJf ₂ C(0)NH ₂ ) , 2.00 (m, 4H, Cff ₂ CH=CHCH ₂ ) , 1.65-1.50 (m, 4H, CH ₂ CH ₂ C(0)NH ₂ and Cff ₂ CH ₂ 0TBDPS) , 1.47-1.23 (m, 18H, alkyl protons), 1.05 (s, 9H, (CH ₃ ) ₃ C) ; FABHRMS (NBA/CsI m/e 668.2929 (C ₃₄ H ₅₃ 0 ₂ NSi + Cs ^* requires 668.2900).

18-Hydroxy-cis-9 _f 10-octadecenoamide (18 scheme 4): A solution of 17 (0.185 g, 0.345 mmol, 1.0 equiv) in THF (1.1 mL, 0.31 M) was treated with tetrabutylammoniumfluoride (0.69 mL, 1.0 M solution in THF, 0.69 mmol, 2.0 equiv) and the reaction mixture was stirred at 25 °C for 2 h. The reaction mixture was then partitioned between EtOAc (50 mL) and H ₂ 0 (50 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure . Chromatography (Si0 ₂ , 3 cm x 15 cm, 0-5% MeOH-EtOAc gradient elution) afforded 18 as a white solid (0.097 g, 0.103 g theoretical, 94.6%): ^α H NMR (CDC1 ₃ , 250

MHz) δ 5.65-5.34 (m, 4H, H ₂ NC(0) and CH=CH) , 3.62 (t,

3H, J * 6 . 5 Hz , CH ₂ OH) , 2 . 21 (t, 2H, J = 7 . 5 Hz , Ctf ₂ C (0) NH ₂ ) , 2 . 00 (m, 4H , Cff ₂ CH=CHCH ₂ ) , 1. 65-1. 50 (m, 4H, CJf ₂ CH ₂ C (0) NH ₂ and CH ₂ CH ₂ OH) , 1. 29 (b s , 18H, alkyl protons) ; FABHRMS (NBA) 298 . 2732 (C ₁₈ H ₃₅ N0 ₂ + H ⁺ requires 298 .2746) .

Synthesis of Compound 100 (figure 5) :

Methyl-9-t-butyldiphenylsilyloxy-nonanoate (intermediate for compound 100: figure 5) . A solution of methyl-9-hydroxy-nonanoate (0.838 g, 4.46 mmol, 1.0 equiv: Aldrich) in CH ₂ C1 ₂ (15 mL, 0.3 M) was treated successively with Et ₃ N (0.75 mL, 5.38 mmol, 1.2 equiv), t-butylchlorodiphenylsilane (1.28 mL, 4.93 mmol, 1.1 equiv), and DMAP (0.180 g, 1.48 mmol, 0.33 equiv), and the reaction mixture was stirred at 25 °C for 12 h. Saturated aqueous NH ₄ C1 was added to the reaction mixture and the mixture was partitioned between CH ₂ C1 ₂ (100 mL) and H ₂ 0 (100 mL) . The organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 0-5% EtOAc-hexanes gradient elution ) afforded the intermeidate as a clear, colorless oil (1.22g, 1.831 theoretical, 64.1%): ^l H NMR (CDC1 ₃ , 250 MHz) δ 7.66 (m, 4H, ArH), 7.38 (m, 6H, ArH), 3.67-3.62 (m, 5H, C(0)OCH ₃ and Cff ₂ OTBDPS) , 2.30 (t, 2H, J = 7.4 Hz, CH ₂ C(0)OCH ₃ ) , 1.58 (m, 4H, Cff ₂ CH ₂ OTBDPS and CH ₂ CH ₂ C(0)OCH ₃ ) , 1.28 (b s, 8H, alkyl protons), 1.05 (s, 9H, C(CH ₃ ) ₃ )

Methyl-9-bromo-nonanoate (intermediate for compound

100: figure 5) i

A solution of methyl-9-hydroxy-nonanoate (1.1 g,

5.85 mmol, 1.0 equiv) in CH ₂ C1 ₂ (30 mL, 0.2 M) at 0 °C was treated successively with CBr ₄ (2.5 g, 7.54 mmol, 1.3 equiv) and PPh ₃ (2.15 g, 8.19 mmol, 1.4 equiv) and the reaction mixture was stirred at 4 °C for 10 h.

The reaction mixture was then concenctrated under reduced pressure and washed repeatedly with Et ₂ 0 (8 x 10 mL washes) . The Et ₂ 0 washes were combined and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, hexanes) afforded the intermediate as a clear, colorless oil (1.02 g, 1.47 g theorectical, 69.5 %) : ^α H NMR (CDC1 ₃ , 250 MHz) d 3.64 (s, 3H, C(0)OCff ₃ ), 3.38 (t, 2H, J = 6.8 Hz, CH ₂ Br) , 2.29 (t, 2H, J = 7.4 Hz CH ₂ C(0)OCH ₃₎ , _{lmi3 (p} , _2H , _c H ₂ CR ₂ r) , 1.63 (m, 2H, CH ₂ CH ₂ C(0)OCH ₃ ) 1.47-1.28 (m, 8H, alkyl protons) .

9-T-butvldiphenγlsilγloxγ-nonanal (intermediate for compound 100: figure 5) : A solution of 1 (1.25 g, 2.93 mmol, 1.0 equiv) in toluene (9.80 mL, 3.0 M) at -78 ^C C was treated dropwise with DIBAL-H (4.40 mL, 1.0 M solution in hexanes, 4.40 mmol, 1.5 equiv). The reaction mixture was stirred at -78 °C for 30 min. The reaction mixture was then treated dropwise with MeOH (2 mL) and partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was washed with 10 % aqueous HCl (100 mL) , dried (Na ₂ S0 ₄ ) , and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 0-5 % EtOAc-hexanes gradient elution) afforded 3 as a colorless oil (1.1 g, 94.9 %) : H NMR (CDC1 ₃ , 250 MHz) δ 9.76 (t, IH, J = 1.8 Hz, IfC(O)R), 7.67 (m, 4H, ArH), 7.40 (m, 6H, ArH), 3.65 (t, 2H, J = 6.4 Hz, CH ₂ OTBDPS) , 2.41 (t of d, 2H J = 1.8 and 7.3 Hz, CH ₂ C(0)H), 1.58 (m, 4H, CH ₂ CH ₂ OTBDPS and CF ₂ CH ₂ C(0)H) , 1.29 (b s, 8H, alkyl protons), 1.05 (s, 9H, (Cfl ₃ ) ₃ C); FABHRMS (NBA/CsI) m/e 529.1560 (C25H3602Si + Cs ⁺ requires 529.1539).

Methyl-9-triphenγlphosphoranγl-nonanoate Bromide (intermediate for compound 100: figure 5):

A solution of 9-T-butyldiphenylsilyloxy-nonanal (1.02 g, 4.06 mmol, 1.0 equiv) in CH ₃ CN (3.5 mL, 1.16 M) was treated with triphenylphosphine (1.17 g, 4.47 mmol, 1.1 equiv) and stirred at reflux for 10 h. Additional triphenylphosphine (0.532 g, 2.03 mmol, 0.5 equiv) was added to the reaction mixture and stirring was continued at reflux for 5 h. The reaction mixture was concentrated under reduced pressure and washed repeatedly with Et ₂ 0 (5 x 10 mL washes) . The remaining residue was then solubilized in the minimum volume of CH ₂ C1 ₂ and concentrated under reduced pressure to afford the intermediate as a colorless foam (1.90 g, 2.08 g theoretical, 91.3%): H NMR (CDC1 ₃ , 250 MHz) δ 7.82-7.51 (m, 15H, ArH), 3.70-3.46 (m, 5H, CJJ ₃ OC(0)R and Ctf ₂ PPh ₃ ) , 2.13 (t, 2H, J = 7.4 Hz, CH ₂ C(0)OCH ₃ ) , 1.62-1.02 (m, 12H, alkyl protons); FABHRMS (NBA) m/e 433.2312 (C ₂₈ H ₃₄ Br0 ₂ P - Br ^" requires 433.2296).

Methyl-18-t-butyldiphenysilyloxy-cig-9,ιo- octadecenoate (intermediate for compound 100: figure

5J_:

A solution of (1.0 g, 1.95 mmol, 1.0 equiv) in THF (6.5 mL, 0.3 M) at 25 °C was treated with KHMDS (3.9 mL, 0.5 M solution in THF, 1.95 mmol, 1.0 equiv) and the reaction mixture was stirred at reflux for 1 h. The reaction mixture was then cooled to -78 °C, treated with 3 (0.93 g, 2.35 mmol, 1.2 equiv), warmed to 25 °C, and stirred for an additional 30 min. The reaction mixture was then treated with saturated aqueous NH ₄ C1 and partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 0-2% EtOAc-hexanes gradient elution) afforded the intermediate as a colorless oil (0.82 g, 1.07 g theoretical, 76.3%): H

NMR (CDC1 ₃ , 250 MHz) δ 7.67 (m, 4H, ArH), 7.41 (m, 6H, ArH), 5.34 (m, 2H, Ctf=CH) , 3.65 (m, 5H, Cff ₃ OC(0) and CH ₂ OTBDPS) , 2.29 (t, 2H, J = 7.4 Hz, Cff ₂ C(0)0CH3) , 2.00 (m, 4H, C2f ₂ CH=CHCH ₂ ) , 1.55 (m, 4H, CH ₂ CH ₂ C(0)OCH ₃ and Ctf ₂ CH ₂ OTBDPS) , 1.29 (b s, 18H, alkyl protons), 1.04 (S, 9H, (CH ₃ ) ₃ C).

1B-T-butyldiphenylsilyloxy-σis-9 _r 10-octadecenoic acid (compound 100: figure 5i ; A solution of Methyl-18-t-butyldiphenysilyloxy- cis-9,10-octadecenoate (0.81 g, 1.47 mmol, 1.0 equiv) in THF-MeOH-H ₂ 0 (3-1-1 ratio, 7.3 mL, 0.2 M) at 0 °C was treated with LiOH'H ₂ 0 (0.188 g, 4.48 mmol, 3.0 equiv) . The reaction mixture was warmed to 25 °C, stirred for 8 h, and then partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) . The organic layer was washed successively with 10% aqueous HCl (100 mL) and saturated aqueous NaCl (100 mL) , dried, and concentrated under reduced pressure. Chromatography (Si0 ₂ , 5 cm x 15 cm, 10-30% EtOAc-hexanes gradient elution) afforded 100 as a colorless oil (0.700 g, 0.790 g theoretical, 88.7%): H NMR (CDC1 ₃ , 250 MHz) δ 7.67 (m, 4H, ArH), 7.41 (m, 6H, ArH), 5.34 (m, 2H, CH-CH) , 3.65 (t, 3H, J = 6.5 Hz, CH ₂ OTBDPS) , 2.34 (t, 2H, J = 7.4 Hz, CH ₂ C00H) , 2.00 (m, 4H, CH ₂ CH=CHCH ₂ ) , 1.65-1.50 (m, 4H, Cff ₂ CH ₂ COOH and CH ₂ CH ₂ OTBDPS) , 1.47- 1.23 (m, 18H, alkyl protons), 1.05 (s, 9H, (CH ₃ ) ₃ C); FABHRMS (NBA/Csl) m/e 669.2772 (C ₃₄ H ₅₂ 0 ₃ Si + Cs ⁺ requires 669.2740).

Synthesis of Compound 101 (figure 5) : Step 1. A solution of 100 (1.0 equiv) in CH ₂ C1 ₂ (0.3 M) at 0 °C was treated dropwise with oxalyl chloride (4.0 equiv). The reaction mixture was stirred at 25 °C for 4 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous

NH ₄ OH (2.0 mL) . The reaction mixture was then partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure.

Step 2. A solution of the above step 1 intermediate compound (1.0 equiv) in ether (0.3 M) at 0 °C was treated dropwise with pyridine (8.0 equiv.) followed by trifluoroaceticanhydride (6.0 equiv; Aldrich). The reaction mixture was stirred at 25 °C for 3 h, concentrated under reduced pressure, cooled to 0 °C, and treated with saturated aqueous NH ₄ OH (2.0 mL) . The reaction mixture was then partitioned between EtOAc (100 mL) and H ₂ 0 (100 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure.

Step 3. A solution of the above step 2 intermediate compound (1.0 equiv) in THF (0.31 M) was treated with tetrabutylammoniumfluoride (1.0 M solution in THF,

3.0 equiv) and the reaction mixture was stirred at 25 °C for 3 h. The reaction mixture was then partitioned between EtOAc (50 mL) and H ₂ 0 (50 mL) , and the organic layer was dried (Na ₂ S0 ₄ ) and concentrated under reduced pressure. Product was purified by standard chromatographic conditions and yielded compound 101 in 66% overall yield for the 3 steps.

Synthesis of Compound 102 (figure 5) : Step 1. A solution of 101 (1.0 equiv.) in THF (0.1 M) was treated with triphenylphosphine (2.0 equiv.), followed by diethylazodicarboxylate solution (1.0 THF solution, DEAD, 2.0 equiv., Aldrich) and at 0 °C for 30 minutes. The reaction mixture was concentrated under reduced pressure and washed repeatedly with Et ₂ 0 (5 x 10 mL washes) . The remaining residue was then

solubilized in the minimum volume of CH ₂ C1 ₂ and concentrated under reduced pressure.

Step 2. A solution of the above step 1 compound (1.0 equiv.) in THF (0.10 M) was treated with thiolacetic acid (2.0 equiv.; Aldrich) at 0 °C for 30 minutes. The reaction mixture was concentrated under reduced pressure and washed repeatedly with Et ₂ 0 (5 x 10 mL washes) . The remaining residue was then solubilized in the minimum volume of CH ₂ C1 ₂ and concentrated under reduced pressure. Product was purified by standard chromatographic conditions and yielded compound 102 in 71% overall yield for the 2 steps.

Synthesis of Compound 103 (figures 4 and 5\ : Step 1. A solution of 102 (1.0 equiv) in MeOH/ ater (2:1 mixture, total concentration 0.20 M) at 0 °C was treated with NaOH (3.0 equiv) and stirred for 10 minutes, and then partitioned between EtOAc (100 L) and water (100 mL) . The organic layer was washed successively with 10% aqueous HCl (100 mL) and saturated aqueous NaCl (100 mL) , dried, and concentrated under reduced pressure.

Step 2. A solution of the above step 1 compound (1.0 equiv) in aqueous IN HCl at 0 °C was stirred until the reaction mixuture achieved a pH of 7.0, and then the mixture was partitioned between EtOAc (100 mL) and water (100 mL) . The organic layer was washed successively with saturated aqueous NaCl (100 mL) , dried, and concentrated under reduced pressure.

Step 3. A solution of the above step 2 compound (1.0 equiv.) in aqueos ImM NaHC0 ₃ at 25 °C was treated with Pyridyl disulfide beads (l.l equiv. Aldrich) and

stirred for 2 hours. The beads were subsequently washed with excess saturated NaHC0 ₃ (3X) , water (3X) and brine (IX) . Standard filtration obtained the activated beads (compound 103) which were then packed into the column for affinity chromatography of the enzyme as discussed supra.

Cloning of Rat Liver Cis-9.10-Octadecenoamidase cDNA:

To obtain a cDNA clone for cis-9,10- octadecenoamidase from cDNA library generated from rat liver mRNA, degenerate oligonucleotide primers were designed based on the amino acid residue sequence of cis-9,10-octadecenoamidase polypeptide fragment obtained from a trypsin digest. Briefly, the cis-9,10-octadecenoamidase, purified as described above, was subjected to a trypsin digest to form internal polypeptide fragments as performed by

Worchester Foundation, orchester, PA. The resultant polypeptide fragments were purified by HPLC. Five polypeptide fragments were then selected for sequencing having lengths ranging from 12 to 25 amino acid residues.

The degenerate oligonucleotide primers were designed to incorporate a unique restriction site into the 5' ends of the primers that functioned as either forward and the backward primers. The forward primers are also referred to as upstream, sense or 5' primers. The backward primers are also referred to as downstream, anti-sense or 3' primers. The restriction sites were incorporated into the polymerase chain reaction (PCR) products to allow for insertion into the multiple cloning site of a sequencing vector as described below.

To amplify regions of cDNA encoding cis-9,10- octadecenoamidase, rat liver mRNA was reversed transcribed into cDNA for use a template in PCR with selected pairs of degenerate oligonucleotide primers described above. With the exception of an annealing temperature of 60°C, PCR was performed under conditions well known to one of ordinary skill in the art.

For successful amplifications from proper pairs of degenerate primers, the resultant PCR fragments contained regions of cDNA between and including a pair of degenerate primers. The amplified fragments were then digested with the specific restriction enzymes corresponding to the restriction sites incorporated by the selected primers. The digested PCR fragments were then separately cloned into pBluescript (Stratagene, La Jolla, CA) .

Of the cloned PCR fragments, three were selected for sequencing. The three PCR fragments were 350 base pair (bp) , 400 bp and 750 bp. Sequencing of these σis-9,10-octadecenoamidase-encoding cDNA fragments showed that the 750 bp fragment contained the sequences of both the 350 and 400 bp fragments.

From the 350 bp cDNA fragment obtained by PCR was then labeled internally and used as a probe for Northern analysis on electrophoresed rat liver mRNA. The probe hybridized to a fragment approximately 2.5 to 3.0 kilobases (kb) in length, which is the expected size of the cis-9 ,10-octadecenoamidase mRNA that encodes a 60 kDa protein.

To isolate a cDNA clone encoding the complete cis-9,10-octadecenoamidase protein, the 350 bp probe was then use to screen a cDNA library from rat liver mRNA obtained from Clontech (Palo Alto, CA) . The methods for cloning the cis-9,10-octadecenoamidase cDNA of this invention are techniques well known to one of ordinary skill in the art and are described, for example, in "Current Protocols in Molecular Biology", eds. Ausebel et al., Wiley & Sons, Inc., New York (1989) , the disclosures of which are hereby incorporated by reference.

From the screen 3 clones, 2 of 2.7 kb in length and 1 of 2.0 kb in length, were obtained. The partial sequence of one of the 2.7 kb clones, designated p60, indicates that the clone does contain cis-9 ,10-octadecenoamidase-specific sequences.

A cDNA clone for the human homolog of cis-9,10- octadecenoamidase is similarly obtained by screening a cDNA library from human liver mRNA. The rat liver- derived degenerate primers are useful in amplifying human homologs under lower stringency.

The rat liver cDNA clone designated p60 obtained above has been deposited with American Type Culture Collection (ATCC) on or before June 12, 1996 and has been assigned the ATCC accession number . This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty) . This assures maintenance of a viable plasmid for 30 years from the date of each deposit. The plasmid will be made available by ATCC under the terms of the Budapest Treaty which assures permanent and unrestricted availability of the progeny of the plasmid to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 U.S.C. §122 and the Commissioner's rules pursuant thereto (including 37 CFR §1.14 with particular reference to 886 OG 638) . The assignee of the present application has agreed that if the plasmid deposit should die or be lost or destroyed when

cultivated under suitable conditions, it will be promptly replaced on notification with a viable specimen of the same plasmid. Availability of the deposit is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.

A partial nucleotide sequence, of the top strand of the p60 cDNA clone containing 780 nucleotides described above is listed in SEQ ID NO 1 along with the deduced amino acid residue sequence. The encoded amino acid residue sequence is listed separately in SEQ ID NO 2. In order to show the amino acid residue encoded by each triplet codon in the Sequence Listing, a stop codon, TAA, was added at positions 781 to 783 to allow for the coding sequence (CDS) function in the Patentin program used to prepare the Sequence Listing. In other words, the stop codon is artificially inserted into the nucleotide sequence shown in SEQ ID NO 1 to facilitate the translation of the cDNA coding sequence into an amino acid sequence.

The actual position of the cis-9,10- octadecenoamidase nucleotide position within a complete cDNA clone is not yet known. The 3' end, however, is not the end of the cDNA as a degenerate oligonucleotide primer of 42 nucleotides in length encoding 14 amino acid residues is located contiguous to the 3• end of the sequence in SEQ ID NO 1. In other words, the 42-mer degenerat oligonucleotide would have been at nucleotide position 781 to 822 if they had been included in SEQ ID NO 1, lacking the stop codon. The 42-mer degenerate oligonucleotide encodes the polypeptide fragment having the amino

acid residue sequence PMLGPALDLNTPGR (SEQ ID NO 32) . The actual nondegenerate nucleotide sequence of a cis-9,10-octadecenoamidase cDNA clone encoding the polypeptide sequence in SEQ ID NO 32 has not yet been confirmed. Nevertheless, since the 42-mer degenerate oligonucleotide was designed from the polypeptide fragment in SEQ ID NO 3 that resulted from the trypsin digest of the purified cis-9,10- octadecenoamidase protein, the correct amino acid sequence of the cis-9,10-octadecenoamidase cDNA encoded by the nucleotide sequence in SEQ ID NO 1 including the 42-mer degenerate oligonucleotide is confirmed and is shown in SEQ ID NO 3. The amino acid residue sequence in SEQ ID NO 2 is the same as the one shown in SEQ ID NO 1.

At the 5' end of the partial cDNA sequence of cis-9,10-octadecenoamidase, the nucleotide sequence beginning at position 7 and ending at position 102 encodes a region of amino acid that contains residues that are found in a consensus sequence of amidases. The consensus amidase amino acid residue sequence is fiG£≤£SXXΔXVAXXXXXXXX£XDX£G£IEIE (SEQ ID NO 4). The corresponding region in the cis-9,10- octadecenoamidase protein of this invention has the amino acid residue sequence

GGSSGGEGALIGSGGSPLGLGTDIGGSIRFP (SEQ ID NO 5) also shown in SEQ ID NO 2 beginning at amino acid residue position 3 and ending at position 34. The consensus sequence is presented in single letter code where X is Xaa representing a different amino acid residue in different amidases. The residues that correspond to the partial cis-9,10-octadecenoamidase sequence are indicated with an underline.

Preparation of Recombinant Cis-9 _r 10- Octadecenoamidase:

The partial nucleotide sequence encoding the partial amino acid residue sequence of cis-9,10- octadecenoamidase shown in SEQ ID NO 3, where the nucleotide sequence comprises the sequence in SEQ ID NO 1 along with a 42-mer oligonucleotide sequence derived from the degenerate oligonucleotide primer for encoding the polypeptide listed in SEQ ID NO 32, is used for expression of cis-9,10-octadecenoamidase recombinant protein. To accomplish this, the 822 bp sequence is inserted into the multiple cloning site or polylinker region of a selectable mammalian expression vector, such as pZeoSV, pcDNA3 or pRc/CMV (Invitrogen, San Diego, CA) that provide for high- level constitutive transcription from mammalian enhancer-promoter sequences including transcription termination and polyadenlyation sequences. Alternatively, the cis-9,10-octadecenoamidase- encoding nucleotide sequence is cloned into an IPTG inducible mammalian expression system, such as LacSwitch™ (Stratagene, La Jolla, CA) .

Comparable mammalian expression vectors can also be used and are well known to one of ordinary skill in the art and are described in "Current Protocols in Molecular Biology", eds. Ausebel et al., Wiley & Sons, Inc., New York (1989), the disclosures of which are hereby incorporated by reference.

For insertion of the cis-9,10-octadecenoamidase- encoding nucleotide sequence shown in SEQ ID NO 1, the 3' end of which is annealed to a 42-mer sequence encoding the polypeptide fragment in SEQ ID NO 32, into a selected expression vector, the nucleotide sequence is synthesized by chemical techniques, for

example, the phosphotriester method of Matteucci, et al., (J. Am. Chem. Soc.. 103:3185-3191, 1981) or using automated synthesis methods. In addition, larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define the DNA segment, followed by hybridization and ligation of oligonucleotides to build the complete segment.

To facilitate cloning of the synthesized nucleotide sequence encoding cis-9,10- octadecenoamidase into an expression vector, nucleotide sequences specific for a preselected restriction enzyme is also inserted into both the 5' and 3* ends of the synthesized nucleotide fragment. Different restriction enzymes can also be used to allow for direction ligation of the insert DNA into the multiple cloning site of the recipient vector. Insertion of the synthetic DNA is then achieved following similar digestion of the expression vector.

Alternatively, the cis-9 ,10-octadecenoamidase- encoding nucleotide sequence is isolated from the clone p60 on deposit with ATCC having ATCC accession number as described above. The partial cis-

9,10-octadecenoamidase nucleotide sequence is amplified from the clone by PCR with primers pairs that correspond to the 5' and 3' ends of the cis- 9,10-octadecenoamidase nucleotide sequence that further incorporate restriction cloning sites as described above. The resultant PCR products are such that, when subcloned into the one of the above expression vectors, a σis-9,10-octadecenoamidase recombinant protein is expressed following transformation into a appropriate host mammalian cell, the selection of which is dependent upon the

expression vector and which is familiar to one of ordinary skill in the art.

In addition, smaller regions of cis-9,10- octadecenoamidase cDNA are similarly clones to produce the corresponding encoded cis-9,10- octadecenoamidase polypeptides. Moreover, the methods described herein are useful for cloning and expressing the complete recombinant cis-9,10- octadecenoamidase protein.

Recombinant cis-9,10-octadecenoamidase proteins for use in this invention are also produced in bacteria and purified, the cloning of which is performed by subcloning either a synthetic or PCR amplified cis-9,10-octadecenoamidase nucleotide sequence into the multiple cloning site in the pRSET B vector (Invitrogen, San Diego, CA) , which contains the nucleotide sequence encoding 6 histidines before the insertion of the cis-9,10-octadecenoamidase sequence. The vector contains the T7 promoter which drives the expression of 6x His-tagged proteins in E. coli. Once expressed, the expressed 6x histidine- tagged procortistatin sequence is then purified by affinity chromatography on a TALON (Clontech) metal affinity resin.

In alternative approaches, a cis-9,10- octadecenoamidase-glutathione-S-transferase fusion protein is produced in E. coli by subcloning the synthetic or PCR amplified cis-9,10-octadecenoamidase nucleotide sequence into the appropriate sites of the pGEX2 vector (Pharmacia, Piscataway, NJ) , as described above.

Thus, the methods described herein are useful

for the generation of both recombinant cis-9,10- octadecenoamidase proteins and recombinant cis-9,10- octadecenoamidase fusion proteins of varying lengths of the mature 60 kDa protein including the complete protein itself.

Once expressed, the recombinant cis-9,10- octadecenoamidase proteins are useful in the methods of this invention without further purification or preferably, are purified according to affinity purification methods previously described.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: The Scrippβ Research Institute

(ii) TITLE OF INVENTION: CIS-9, 10-OCTADECENOAMIDASE

(iϋ) NUMBER OF SEQUENCES: 32

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(v) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT/US96/ (B) FILING DATE: 12-JUN-1996

(C) CLASSIFICATION:

(vi) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/489,535 (B) FILING DATE: 12-JUN-1995

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 783 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: CDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(i ) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..780

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AGC CCA GGA GGT TCC TCA GGG GGT GAG GGG GCT CTC ATT GGA TCT GGA 48 Ser Pro Gly Gly Ser Ser Gly Gly Glu Gly Ala Leu lie Gly Ser Gly 1 5 10 15

GGT TCC CCT CTG GGT TTA GGC ACT GAC ATT GGC GGC AGC ATC CGG TTC 96 Gly Ser Pro Leu Gly Leu Gly Thr Asp lie Gly Gly Ser lie Arg Phe

20 25 30

CCT TCT GCC TTC TGC GGC ATC TGT GGC CTC AAG CCT ACT GGC AAC CGC 144 Pro Ser Ala Phe Cyβ Gly lie Cys Gly Leu Lys Pro Thr Gly Asn Arg

35 40 45

CTC AGC AAG AGT GGC CTG AAG GGC TGT GTC TAT GGA CAG ACG GCA GTG 192 Leu Ser Lys Ser Gly Leu Lys Gly Cys Val Tyr Gly Gin Thr Ala Val 50 55 60

CAG CTT TCT CTT GGC CCC ATG GCC CGG GAT GTG GAG AGC CTG GCG CTA 240 Gin Leu Ser Leu Gly Pro Met Ala Arg Asp Val Glu Ser Leu Ala Leu 65 70 75 80

TGC CTG AAA GCT CTA CTG TGT GAG CAC TTG TTC ACC TTG GAC CCT ACC

288 Cys Leu Lys Ala Leu Leu Cys Glu His Leu Phe Thr Leu Asp Pro Thr 85 90 95

GTG CCT CCC TTT CCC TTC AGA GAG GAG GTC TAT AGA AGT TCT AGA CCC

336

Val Pro Pro Phe Pro Phe Arg Glu Glu Val Tyr Arg Ser Ser Arg Pro 100 105 110

CTG CGT GTG GGG TAC TAT GAG ACT GAC AAC TAT ACC ATG CCC AGC CCA

384

Leu Arg Val Gly Tyr Tyr Glu Thr Asp Asn Tyr Thr Met Pro Ser Pro 115 120 125

GCT ATG AGG AGG GCT CTG ATA GAG ACC AAG CAG AGA CTT GAG GCT GCT

432 Ala Met Arg Arg Ala Leu lie Glu Thr Lys Gin Arg Leu Glu Ala Ala

130 135 140

GGC CAC ACG CTG ATT CCC TTC TTA CCC AAC AAC ATA CCC TAC GCC CTG

480

Gly His Thr Leu lie Pro Phe Leu Pro Asn Asn lie Pro Tyr Ala Leu

145 150 155 160

GAG GTC CTG TCT GCG GGC GGC CTG TTC AGT GAC GGT GGC CGC AGT TTT

528

Glu Val Leu Ser Ala Gly Gly Leu Phe Ser Asp Gly Gly Arg Ser Phe 165 170 175

CTC CAA AAC TTC AAA GGT GAC TTT GTG GAT CCC TGC TTG GGA GAC CTG

576 Leu Gin Asn Phe Lys Gly Asp Phe Val Asp Pro Cys Leu Gly Asp Leu 180 185 190

ATC TTA ATT CTG AGG CTG CCC AGC TGG TTT AAA AGA CTG CTG AGC CTC 624

lie Leu lie Leu Arg Leu Pro Ser Trp Phe Lys Arg Leu Leu Ser Leu 195 200 205

CTG CTG AAG CCT CTG TTT CCT CGG CTG GCA GCC TTT CTC AAC AGT ATG 672

Leu Leu Lys Pro Leu Phe Pro Arg Leu Ala Ala Phe Leu Asn Ser Met 210 215 220

CGT CCT CGG TCA GCT GAA AAG CTG TGG AAA CTG CAG CAT GAG ATT GAG 720

Arg Pro Arg Ser Ala Glu Lys Leu Trp Lys Leu Gin His Glu lie Glu 225 230 235 240

ATG TAT CGC CAG TCT GTG ATT GCC CAG TGG AAA GCG ATG AAC TTG GAT 768

Met Tyr Arg Gin Ser Val lie Ala Gin Trp Lys Ala Met Asn Leu Asp 245 250 255

GTG CTG CTG ACC TAA 783

Val Leu Leu Thr 260

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 260 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Ser Pro Gly Gly Ser Ser Gly Gly Glu Gly Ala Leu lie Gly Ser Gly 1 5 10 15

Gly Ser Pro Leu Gly Leu Gly Thr Asp lie Gly Gly Ser lie Arg Phe 20 25 30

Pro Ser Ala Phe Cys Gly lie Cys Gly Leu Lys Pro Thr Gly Asn Arg 35 40 45

Leu Ser Lys Ser Gly Leu Lys Gly Cys Val Tyr Gly Gin Thr Ala Val 50 55 60

Gin Leu Ser Leu Gly Pro Met Ala Arg Asp Val Glu Ser Leu Ala Leu 65 70 75 80

Cys Leu Lys Ala Leu Leu Cys Glu His Leu Phe Thr Leu Asp Pro Thr 85 90 95

Val Pro Pro Phe Pro Phe Arg Glu Glu Val Tyr Arg Ser Ser Arg Pro 100 105 110

Leu Arg Val Gly Tyr Tyr Glu Thr Asp Asn Tyr Thr Met Pro Ser Pro 115 120 125

Ala Met Arg Arg Ala Leu lie Glu Thr Lys Gin Arg Leu Glu Ala Ala 130 135 140

Gly His Thr Leu lie Pro Phe Leu Pro Asn Asn lie Pro Tyr Ala Leu 145 150 155 160

Glu Val Leu Ser Ala Gly Gly Leu Phe Ser Asp Gly Gly Arg Ser Phe 165 170 175

Leu Gin Asn Phe Lys Gly Asp Phe Val Asp Pro Cys Leu Gly Asp Leu 180 185 190

lie Leu lie Leu Arg Leu Pro Ser Trp Phe Lys Arg Leu Leu Ser Leu 195 200 205

Leu Leu Lys Pro Leu Phe Pro Arg Leu Ala Ala Phe Leu Asn Ser Met

210 215 220

Arg Pro Arg Ser Ala Glu Lys Leu Trp Lys Leu Gin His Glu lie Glu 225 230 235 240

Met Tyr Arg Gin Ser Val lie Ala Gin Trp Lys Ala Met Asn Leu Asp 245 250 255

Val Leu Leu Thr 260

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 274 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Ser Pro Gly Gly Ser Ser Gly Gly Glu Gly Ala Leu lie Gly Ser Gly 1 5 10 15

Gly Ser Pro Leu Gly Leu Gly Thr Asp lie Gly Gly Ser lie Arg Phe

20 25 30

Pro Ser Ala Phe Cys Gly lie Cys Gly Leu Lys Pro Thr Gly Asn Arg 35 40 45

Leu Ser Lys Ser Gly Leu Lys Gly Cys Val Tyr Gly Gin Thr Ala Val 50 55 60

Gin Leu Ser Leu Gly Pro Met Ala Arg Asp Val Glu Ser Leu Ala Leu 65 70 75 80

Cys Leu Lys Ala Leu Leu Cys Glu His Leu Phe Thr Leu Asp Pro Thr 85 90 95

Val Pro Pro Phe Pro Phe Arg Glu Glu Val Tyr Arg Ser Ser Arg Pro 100 105 110

Leu Arg Val Gly Tyr Tyr Glu Thr Asp Asn Tyr Thr Met Pro Ser Pro 115 120 125

Ala Met Arg Arg Ala Leu lie Glu Thr Lys Gin Arg Leu Glu Ala Ala 130 135 140

Gly His Thr Leu lie Pro Phe Leu Pro Asn Asn lie Pro Tyr Ala Leu 145 150 155 160

Glu Val Leu Ser Ala Gly Gly Leu Phe Ser Asp Gly Gly Arg Ser Phe 165 170 175

Leu Gin Asn Phe Lys Gly Asp Phe Val Asp Pro Cys Leu Gly Asp Leu 180 185 190

lie Leu lie Leu Arg Leu Pro Ser Trp Phe Lys Arg Leu Leu Ser Leu 195 200 205

Leu Leu Lys Pro Leu Phe Pro Arg Leu Ala Ala Phe Leu Asn Ser Met 210 215 220

Arg Pro Arg Ser Ala Glu Lys Leu Trp Lys Leu Gin His Glu lie Glu 225 230 235 240

Met Tyr Arg Gin Ser Val lie Ala Gin Trp Lys Ala Met Asn Leu Asp 245 250 255

Val Leu Leu Thr Pro Met Leu Gly Pro Ala Leu Asp Leu Asn Thr Pro 260 265 270

Gly Arg

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: :

Gly Gly Ser Ser Gly Gly Xaa Xaa Ala Xaa Val Ala Xaa Xaa Xaa Xaa 1 5 10 15

Xaa Xaa Xaa Xaa Gly Xaa Asp Xaa Gly Gly Ser lie Arg lie Pro

20 25 30

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Gly Gly Ser Ser Gly Gly Glu Gly Ala Leu lie Gly Ser Gly Gly Ser 1 5 10 15

Pro Leu Gly Leu Gly Thr Asp lie Gly Gly Ser lie Arg Phe Pro 20 25 30

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids (B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Ser Pro Gly Gly Ser Ser Gly Gly Glu Gly Ala Leu lie Gly Ser 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Ala Leu lie Gly Ser Gly Gly Ser Pro Leu Gly Leu Gly Thr Asp 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Gly Leu Gly Thr Asp lie Gly Gly Ser lie Arg Phe Pro Ser Ala

1 5 10 15

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Arg Phe Pro Ser Ala Phe Cys Gly lie Cys Gly Leu Lys Pro Thr

1 5 10 15

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Gly Leu Lye Pro Thr Gly Asn Arg Leu Ser Lys Ser Gly Leu Lys 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids (B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

Lys Ser Gly Leu Lys Gly Cys Val Tyr Gly Gin Thr Ala Val Gin 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids (B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Gin Thr Ala Val Gin Leu Ser Leu Gly Pro Met Ala Arg Asp Val 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

Met Ala Arg Asp Val Glu Ser Leu Ala Leu Cys Leu Lys Ala Leu 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

Cys Leu Lys Ala Leu Leu Cys Glu His Leu Phe Thr Leu Asp Pro 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

Phe Thr Leu Asp Pro Thr Val Pro Pro Phe Pro Phe Arg Glu Glu

1 5 10 15

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Pro Phe Arg Glu Glu Val Tyr Arg Ser Ser Arg Pro Leu Arg Val 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids (B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

Arg Pro Leu Arg Val Gly Tyr Tyr Glu Thr Asp Asn Tyr Thr Met 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids (B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

Asp Asn Tyr Thr Met Pro Ser Pro Ala Met Arg Arg Ala Leu lie 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

Arg Arg Ala Leu lie Glu Thr Lys Gin Arg Leu Glu Ala Ala Gly 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

Leu Glu Ala Ala Gly His Thr Leu lie Pro Phe Leu Pro Asn Asn 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

Phe Leu Pro Asn Asn lie Pro Tyr Ala Leu Glu Val Leu Ser Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

Glu Val Leu Ser Ala Gly Gly Leu Phe Ser Asp Gly Gly Arg Ser 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids (B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

Asp Gly Gly Arg Ser Phe Leu Gin Asn Phe Lys Gly Asp Phe Val 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

Lys Gly Asp Phe Val Asp Pro Cys Leu Gly Asp Leu lie Leu lie 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

Asp Leu lie Leu lie Leu Arg Leu Pro Ser Trp Phe Lys Arg Leu

1 5 10 15

(2) INFORMATION FOR SEQ ID NO:26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

Trp Phe Lys Arg Leu Leu Ser Leu Leu Leu Lys Pro Leu Phe Pro 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

Lys Pro Leu Phe Pro Arg Leu Ala Ala Phe Leu Asn Ser Met Arg 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:28:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

Leu Asn Ser Met Arg Pro Arg Ser Ala Glu Lys Leu Trp Lys Leu 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:29:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

Lys Leu Trp Lys Leu Gin His Glu lie Glu Met Tyr Arg Gin Ser 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:30:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

Met Tyr Arg Gin Ser Val lie Ala Gin Trp Lys Ala Met Aβn Leu 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:31:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:

Lys Ala Met Asn Leu Asp Val Leu Leu Thr Pro Met Leu Gly Pro

1 5 10 15

(2) INFORMATION FOR SEQ ID NO:32:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(v) FRAGMENT TYPE: internal

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

Pro Met Leu Gly Pro Ala Leu Asp Leu Asn Thr Pro Gly Arg 1 5 10