COMPOSITIONS AND METHODS FOR DELIVERY OF NUCLEIC ACIDS TO HEPATOCYTES

BACKGROUND OF THE INVENTION

The government owns rights in the present invention pursuant to grant number GM49734 from the National Institutes of Health.

1. Field of the Invention

The present invention relates generally to the field of recombinant DNA vectors, and particularly concerns vectors useful for delivering, expressing or producing a desired protein of interest in a hepatocyte. More particularly, it concerns recombinant baculoviruses that are used to deliver hepatocyte expressable nucleic acid constructs specifically to hepatocytes. The invention also provides methods of using the expression systems and recombinant baculoviruses, particularly in the treatment of liver diseases and/or infections.

2. Description of Related Art Baculoviruses are DNA-containing viruses that infect insects or other invertebrates

(Adams and McClintock 1991). Baculovirus vectors usually provide high levels of foreign gene expression, and the insect cell hosts have some eucaryotic protein processing capabilities. Also, while insect cells remain more expensive to cultivate than bacteria, recent developments have significantly reduced the cost of producing foreign gene products in this system. Based on these properties, the baculovirus-insect cell system is a widely used tool for the production of foreign gene products, particularly eucaryotic proteins that must be co- and post-translationally processed (Summers and Smith, 1987, Luckow and Summers, 1988; Miller, 1988; O'Reilly et al, 1992).

Recent studies suggest that baculoviruses can infect some types of mammalian cells and, therefore, that these viruses might be useful as vectors for human gene therapy

(Hofmann, ei al, 1995; Boyce and Bucher, 1996; Yap et al, 1997). Baculoviruses infect

human hepatocytes more efficiently than other cell lines tested in vitro, suggesting that these viruses might be most useful for liver-directed gene therapy. Moreover, baculoviruses fail to replicate in mammalian cells, including hepatocytes, and cause no apparent cytopathology in these cells. Boyce and Bucher (1996) found that the efficiency of hepatocyte infection by baculoviruses was as high as 50-70% in HepG2 cells and primary hepatocytes, respectively, which equalled the gene transfer efficiencies obtained with retroviral and herpesvirus vectors. But, in order to obtain these results, it was necessary to use excessively high multiplicities of infection (100-200 plaque-forming units per cell). This is a severe limitation for in vivo applications of this technology due to the increased likelihood that a patient will mount an immune response against these large doses of virus.

In addition, equally high efficiencies of gene transfer were not observed with different types of hepatocyte cultures.

Thus, a method of delivering nucleic acid constructs to hepatocytes efficiently and at low multiplicity of infection would represent a significant advance in the field.

SUMMARY OF THE INVENTION The present invention overcomes the limitations present in the art by providing compositions and methods for specific delivery of nucleic acids to hepatocytes. Provided are baculovirus expression systems and baculoviruses comprising these expression systems. The recombinant baculoviruses of the present invention, by virtue of having one or more galactosyl residues on one or more of the virion glycoproteins, interact with hepatocytes. As a result of this interaction, the nucleic acids comprised within the recombinant baculoviruses are delivered into the hepatocyte at a low multiplicity of infection, thus reducing the possibility of immune reaction against the baculoviral proteins. The present invention increases the specificity and efficiency of baculovirus- mediated gene transfer to hepatocytes. This is accomplished by using baculovirus particles that have been produced in the presence of βl ,4-galactosyltransferase activity, which results in terminal galactosylation of virion glycoproteins. The presence of these galactose moieties on the virion particles provides a means for their enhanced uptake by the asialoglycoprotein receptor, which is found in large quantities on the surface of hepatocytes.

This receptor specifically recognizes and binds baculovirus particles decorated with

terminal galactose. Binding is followed by intemalization of those particles by receptor- mediated endocytosis, which is the normal route by which baculoviruses enter their hosts. Subsequently, the virus is uncoated in the lysosomal compartment and nucleocapsids are released into the cytoplasm where they are available for import into the nucleus. Gene expression occurs in that compartment because, like previously described examples, the viral genome includes a gene or genes consisting of a promoter that can be expressed in hepatocytes, such as the cytomegalovirus IE promoter or the Rous sarcoma virus LTR, and a coding region designed to produce a therapeutic moiety, such as a protein, ribozyme or antisense product. The invention first provides a baculovirus expression system comprising a first nucleic acid segment encoding a galactosyltransferase enzyme, the first nucleic acid segment operatively positioned under the control of a first promoter operative in an insect cell, and a second nucleic acid segment comprising at least a first hepatocyte expressible nucleic acid segment, the second nucleic acid segment operatively positioned under the control of a second promoter operative in a hepatocyte.

In certain embodiments of the invention, the first promoter and the second promoter are of distinct types. In particular embodiments, the first promoter is a baculovirus promoter. Baculovirus promoters contemplated for use include, but are not limited to, the IE1, IEN (IE2), IEO, 39K, gp64, DA26, ETL, 35K, capsid (p39), plO, polyhedrin and p6.9 baculovirus promoters. In preferred aspects, the first promoter is an IE 1, IEN (IE2) or IEO baculovirus promoter. In particularly preferred embodiments, the first promoter is an IE 1 baculovirus promoter. The first promoter may be obtained from, for example, the viral DNA of Autographa californica NPV, Trichoplusia ni NPV, Rachipulsia ou NPV, Orgyia pseudosugata NPV, Bombyx mori NPV, Heliothis zea NPV, Spodoptera exigua NPV or Galleria mellonella NPV.

In other preferred embodiments, the first promoter is an insect cell promoter, such as the β-actin promoter from Bombyx mori. Insect cells contemplated for use in obtaining promoters are exemplified by, but not limited to, Spodoptera frugiperda, Bombyx mori, Heliothis virescens, Heliothis zea, Mamestra brassicas, Estigmene acrea and Trichoplusia ni insect cells.

In further embodiments of the invention, the second promoter is a viral promoter, exemplified by, but not limited to, a cytomegalovirus IE promoter, SV40 early gene promoter and a Rous sarcoma virus LTR promoter, or a cellular promoter, such as β-actin promoter and the fatty acid binding protein promoter. In another aspect of the invention, the second promoter is a hepatocyte specific promoter, exemplified by, but not limited to, an albumin, α-1 antitrypsin or apolipoprotein AI promoter. However, while certain of these promoters may be preferred in certain aspects of the invention, any promoter that is operative in a hepatocyte is contemplated for use in the present invention.

In additional preferred aspects of the invention, the expression systems disclosed herein further comprise an enhancer operatively positioned to enhance expression of the first or second nucleic acid segment. In other aspects of the invention, the enhancer is operatively positioned to enhance expression of the first and second nucleic acid segment. In certain embodiments, the enhancer is a viral enhancer, and in preferred embodiments, the enhancer is a baculovirus enhancer, exemplified by, but not limited to, a baculovirus hrl, hr2, hr3, hr4 or hr5 enhancer. Preferred sources for the enhancer include the viral DNA of

Autographa californica NPV, Trichoplusia ni NPV, Rachipulsia ou NPV, Orgyia pseudosugata NPV, Bombyx mori NPV, Heliothis zea NPV, Spodoptera exigua NPV or Galleria mellonella NPV. In addition to viral enhancers, cellular enhancer elements have also been described and are also contemplated for use in the instant invention. An exemplary, but by no means limiting, list of enhancer elements is provided in Tables 2 and 3 herein below.

In another embodiment of the invention, the second nucleic acid segment comprises at least a first structural gene encoding a selected protein. In particular aspects, the second promoter is a promoter naturally associated with the structural gene. Structural genes encoding any selected protein are contemplated for use in the present invention, including, but not limited to, a first structural gene encoding an LDL receptor, phenylalanine hydroxylase, αl -antitrypsin, lipoprotein lipase, an apolipoprotein, for example apolipoprotein C-II or apolipoprotein B-100, a tyrosine kinase, a cytochrome P-450 or a marker protein. Preferred for use is the LDL receptor. In other preferred aspects, the second nucleic acid segment comprises a first structural gene encoding a selected protein and a second structural gene encoding marker protein.

In a further aspect of the invention, the second nucleic acid segment comprises at least a first coding region encoding a ribozyme. Ribozymes are discussed in greater detail herein below. In preferred aspects of the present invention, the second nucleic acid segment comprises at least a first coding region encoding a ribozyme that binds to and cleaves the RNA genome or an RNA transcript of a hepatitis A, hepatitis C, hepatitis D, hepatitis E or hepatitis G virus. In other aspects of the present invention, the second nucleic acid segment comprises at least a first coding region encoding a ribozyme that binds to and cleaves an RNA transcript of a hepatitis B or hepatitis F virus. In additional embodiments, the second nucleic acid segment comprises at least a first coding region encoding a ribozyme that binds to and cleaves an RNA transcript of an oncogene expressed in liver cancer. Ribozymes that bind to and cleave other cellular mRNAs, particularly those transcripts that when reduced or eliminated are involved with reduction of a particular disease state, are also contemplated for use in the present invention.

In another embodiment of the invention, the second nucleic acid segment comprises at least a first coding region encoding an antisense nucleic acid. Antisense nucleic acids are discussed in greater detail herein below. In preferred aspects, the second nucleic acid segment comprises at least a first coding region encoding an antisense nucleic acid that binds to a hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis F or hepatitis G virus gene or RNA transcript. In other aspects, the second nucleic acid segment comprises at least a first coding region encoding an antisense nucleic acid that binds to a liver cancer gene or RNA transcript. Antisense nucleic acids that bind to other cellular transcripts, particularly those transcripts that when reduced or eliminated are involved with reduction of a particular disease state, are also contemplated for use in the present invention.

In certain embodiments of the present invention, the first nucleic acid segment and the second nucleic acid segment are comprised within a single nucleic acid vector. In other aspects, the first nucleic acid segment and the second nucleic acid segment are comprised within distinct first and second nucleic acid vectors.

In particularly preferred embodiments of the present invention, the expression systems disclosed herein are encapsulated within a baculovirus. The present invention provides a variety of expression systems for use in providing a hepatocyte expressible nucleic acid segment to a hepatocyte. Thus, the present invention provides for the use of the

instant expression systems in providing a hepatocyte expressible nucleic acid segment to a hepatocyte. The present invention also provides expression systems for use in expressing a hepatocyte expressible nucleic acid segment in a hepatocyte. Therefore, the present invention also provides for the use of the disclosed expression systems in expressing a hepatocyte expressible nucleic acid segment in a hepatocyte.

Additionally, the expression systems of the present invention may be used in preparing a recombinant baculovirus. Thus, the use of the instant expression systems in preparing a recombinant baculovirus is also provided. Further expression systems disclosed herein may be used in preparing a baculovirus for providing a hepatocyte expressible nucleic acid segment to a hepatocyte, or alternatively in preparing a baculovirus for expressing a hepatocyte expressible nucleic acid segment in a hepatocyte. Therefore the present invention also provides for the use of the present expression systems in preparing a baculovirus for providing a hepatocyte expressible nucleic acid segment to a hepatocyte and in preparing a baculovirus for expressing a hepatocyte expressible nucleic acid segment in a hepatocyte.

The invention also provides a baculovirus comprising any of the baculovirus expression systems disclosed herein for use in providing a hepatocyte expressible nucleic acid segment to a hepatocyte and in expressing a hepatocyte expressible nucleic acid segment in a hepatocyte. Thus the use of a baculovirus comprising any of the instant expression systems in providing a hepatocyte expressible nucleic acid segment to a hepatocyte, as well as in expressing a hepatocyte expressible nucleic acid segment in a hepatocyte is provided. The invention also provides a baculovirus comprising at least a first galactosylated virion glycoprotein.

The invention further provides a method of expressing a hepatocyte expressible nucleic acid segment in a hepatocyte, comprising contacting the hepatocyte with a baculovirus containing a nucleic acid segment comprising the gene, the baculovirus comprising at least a first galactosylated virion glycoprotein, the hepatocyte expressing the gene. In other embodiments, the invention provides a method of expressing a hepatocyte expressible nucleic acid segment in a hepatocyte, comprising contacting the hepatocyte with a baculovirus comprising any of the expression systems disclosed herein. In further aspects, the invention provides a method of providing a nucleic acid segment to a hepatocyte,

comprising contacting the hepatocyte with a baculovirus comprising the nucleic acid segment, the baculovirus comprising at least a first galactosylated virion glycoprotein.

In certain aspects of the invention, the baculovirus is obtained by a process comprising transfecting an insect cell with a baculoviral DNA comprising a gene encoding a galactosyltransferase and the nucleic acid segment, and recovering a baculovirus comprising at least a first galactosylated virion glycoprotein from the insect cell. In other aspects, the baculovirus is obtained by a process comprising cotransfecting an insect cell with a baculoviral DNA comprising the nucleic acid segment and a nucleic acid vector comprising a gene encoding a galactosyltransferase, and recovering a baculovirus comprising at least a first galactosylated virion glycoprotein from the insect cell. In yet other aspects, the baculovirus is obtained by a process comprising cotransfecting an insect cell with a baculoviral DNA and a nucleic acid vector comprising a gene encoding a galactosyltransferase and the nucleic acid segment, and recovering a baculovirus comprising at least a first galactosylated virion glycoprotein from the insect cell. In further embodiments, the baculovirus is obtained by a process comprising infecting an insect cell with a recombinant baculovirus comprising the nucleic acid segment and a gene that encodes a galactosyltransferase, and recovering a baculovirus comprising at least a first galactosylated virion glycoprotein from the insect cell. And in still other embodiments, the baculovirus is obtained by a process comprising infecting an insect cell that expresses a gene encoding a galactosyltransferase with a recombinant baculovirus comprising the nucleic acid segment, and recovering a baculovirus comprising at least a first galactosylated virion glycoprotein from the insect cell. In other particular aspects, the baculovirus is obtained by a process comprising coinfecting an insect cell with a first recombinant baculovirus comprising a gene encoding a galactosyltransferase and a second recombinant baculovirus comprising the nucleic acid segment, and recovering a baculovirus comprising at least a first galactosylated virion glycoprotein from the insect cell.

In preferred aspects of the present invention, the nucleic acid segment is operatively positioned under the control of a promoter, exemplified by, but not limited to, a cytomegalovirus IE promoter, SV40 early gene promoter, β-actin promoter, fatty acid binding protein promoter and a Rous sarcoma virus LTR promoter. In other preferred embodiments, the promoter is a hepatocyte specific promoter. Examples of hepatocyte

specific promoters include, but are not limited to, an albumin, α-1 antitrypsin or apolipoprotein AI promoter.

In certain aspects of the invention, the nucleic acid segment comprises a structural gene encoding a selected protein. In particular embodiments, the promoter is a promoter naturally associated with the structural gene. In particularly preferred aspects of the present invention, the selected protein is secreted from the hepatocyte. In other preferred aspects, the selected protein is a therapeutic protein, exemplified by, but not limited to, αl- antitrypsin, lipoprotein lipase, an apolipoprotein, a tyrosine kinase, a cytochrome P-450, an LDL receptor or phenylalanine hydroxylase. Particularly preferred therapeutic proteins are an LDL receptor or phenylalanine hydroxylase.

In alternate aspects of the invention, the nucleic acid segment comprises a ribozyme. In preferred aspects, the ribozyme binds to and cleaves the RNA genome or an RNA transcript of a hepatitis A, hepatitis C, hepatitis D, hepatitis E or hepatitis G virus. In other embodiments, the nucleic acid segment comprises an antisense nucleic acid. In preferred embodiments, the antisense nucleic acid binds to a hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis F or a hepatitis G virus gene or RNA transcript. In certain aspects of the present invention, the hepatocyte is comprised within an animal. In preferred embodiments, the animal is a human subject.

Also provided in the present invention is a method of treating a liver disease or infection, comprising providing to a hepatocyte comprising a liver disease or infection a therapeutically effective amount of a baculovirus comprising a hepato-therapeutic nucleic acid segment, the baculovirus comprising at least a first galactosylated virion glycoprotein. In certain aspects of the invention, the liver disease or infection is viral hepatitis, such as may be caused by a hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis F or a hepatitis G virus. In other aspects, the liver disease or infection is a disease characterized by a genetic defect in at least a first hepatocyte, including, but not limited to: drug induced hepatitis; autoimmune hepatitis type 1, 2a, 2b or 3 (autoimmune chromic active hepatitis): chronic hepatitis; Wilson's disease; αl -antitrypsin deficiency; chronic cholesteratic diseases, such as primary biliary cirrhosis or primary sclerosis cholangitis; cirrhosis disorders, such as primary biliary cirrhosis, primary hemochromatosis, alcohol liver disease, post-necrotic cirrhosis, non-alcohol steathohepatitis and cq -antitrypsin globulin deficiency,

hypoglycemia; non-insulin dependent diabetes mellitus; liver infections, such as Whipple's disease, meningitis, mild hepatomegaly/hepatitis, leptospirosis, lyme disease, focal necrosis of hepatocytes (caused by C. pittaci), yellow fever (caused by B. arbovirus) and Hydatid Disease (caused by the liver parasite E. chinococcosis); inherited diseases, such as familial lipoprotein lipase (LPL) deficiency, which can be caused by a defect in LPL gene or a lack of LPL, familial apolipoprotein C-II deficiency, caused by a lack of apo C-II, familial hypertriglyceridemia, caused by an increase in triglyceride synthesis and an increase in VLDLs, familial combined hyperlipidemia, causing an increase in apo B and VLDL levels, familial hypercholestolemia, caused by LDL receptor mutations (fewer or less effective LDL-R), familial defective apolipoprotein B-100, caused by an altered apo B-100 that binds

LDL-R poorly, familial hypobetahpoproteinemia, characterized by an altered apoB-protein length, abetalipoproteinemia, wherein apo B lipoprotein secretion is defective, dysbetalipoproteinemia (hyperlipoproteinemia), wherein apo Ε is defective so uptake is slow, (characterized by a homozygous Ε2 allele), primary low HDL syndrome, decreased decithin-cholesterol acyltransferase, Tangier disease, apoA-1 defects, such as the apo A-

_Malano mutant, apo A-l deficiency plus Apo CIII absence, polygenic hypercholesterolemia, \ -antitrypsin deficiency, liver gene defect in Pi (protease inhibitor) gene locus, phenylketouria, cahracterized by a defect in phenylalanine hydroxylase in all tissues, and certain forms of cancer, including heptocellular carcinoma and heptobiliary carcinoma.

Additionally, treatment of diseases not restricted to the liver are contemplated, through the secretion of therapeutic proteins from hepatocytes into the bloodstream. This is accomplished by linking a nucleic acid segment encoding a therapeutic protein to a nucleic acid sequence that encodes a secretion signal peptide, and providing the hybrid nucleic acid segment to a hepatocyte as described in detail herein. Upon expression of the hybrid nucleic acid segment in hepatocytes, the therapeutic protein is secreted into the bloodstream, and since the liver is such a large organ, the plasma levels of the therapeutic protein can rise to effective levels very quickly, in some cases only minutes after expression.

As used herein, the term "hepato-therapeutic" will be understood to mean a therapeutic agent that has a therapeutic effect on a hepatocyte. In particular aspects of the invention, the hepato-therapeutic nucleic acid segment comprises a structural gene encoding

a therapeutic protein. In further aspects, the hepato-therapeutic nucleic acid segment comprises a ribozyme. In still other aspects, the hepato-therapeutic nucleic acid segment comprises an antisense nucleic acid.

The present invention provides a variety of expression systems for use in the preparation of a recombinant baculovirus for use in preparing a medicament for treating a liver disease or infection. Additionally provided is a baculovirus comprising any of the instant expression systems for use in preparing a medicament for treating a liver disease or infection. Further, the invention also provides a baculovirus comprising a galactosyltransferase-therapeutic gene expression system for use in preparing a medicament for treating a liver disease or infection. Also, the invention provides a baculovirus comprising a galactosyltransferase-anti-viral gene expression system for use in preparing a medicament for treating viral hepatitis.

The invention also provides a baculovirus expression vector characterized as either: (a) comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene operatively positioned under the control of and in frame with a promoter; or (b) comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural gene encoding an oligosaccharide processing enzyme, the gene operatively positioned under the control of a baculoviral immediate early, delayed early, early or late promoter.

Recombinant vectors form important aspects of the present invention. The term "expression vector or construct" means any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. Thus, in certain embodiments, expression includes both transcription of a gene and translation of a RNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid, for example, to generate antisense or ribozyme constructs. It will naturally be understood that the transcriptional units each comprise the appropriate transcription and translation initiation and termination signals, such as ATG start signals. and are positioned in the proper orientation to allow transcription of the gene.

Where the present invention comprises the vector of part (a) above, it will be understood that the vector may advantageously further include a third, fourth, fifth, sixth, seventh, eighth and/or a ninth glycosylation enzyme transcriptional unit, the third, fourth, fifth, sixth, seventh, eighth and/or a ninth transcriptional unit comprising a structural gene for a third, fourth, fifth, sixth, seventh, eighth and/or a ninth oligosaccharide processing enzyme, operatively positioned under the control of a promoter.

Equally, where the present invention comprises the vector of part (b) above, the vector may also further include a second, third, fourth, fifth, sixth, seventh, eighth and/or a ninth glycosylation enzyme transcriptional unit, the second, third, fourth, fifth, sixth, seventh, eighth and/or a ninth transcriptional unit comprising a structural gene for a second, third, fourth, fifth, sixth, seventh, eighth and/or a ninth oligosaccharide processing enzyme, operatively positioned under the control of a promoter.

Exemplary oligosaccharide processing enzymes for use in the invention include, but are not limited to α-glucosidases, including α-glucosidase I and α-glucosidase II, α- mannosidases, such as α-mannosidase I and α-mannosidase II, N- acetylglucosaminyltransferases, including, but not limited to N- acetylglucosaminyltransferase I and N-acetylglucosaminyltransferase II, fucosyltransferases, galactosyltransferases and sialyltransferases. The oligosaccharide processing enzymes contemplated for use in the present invention include, but are not limited to, the extensive list provided herein below in Table 1.

The oligosaccharide processing enzymes may be used individually, or in any combination. In certain preferred embodiments, the oligosaccharide processing enzyme will be a galactosyltransferase. In other preferred embodiments, a galactosyltransferase will be used in combination with a sialyltransferase. In further preferred embodiments, a galactosyltransferase will and a sialyltransferase will be used in conjunction with

N-acetylglucosaminyltransferase I and N-acetylglucosaminyltransferase II.

Particularly useful vectors are contemplated to be those vectors in which the coding portion of a DNA segment, whether encoding a full length protein or smaller peptide, is positioned under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases "operatively

positioned", "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. Promoters for use in the present invention include insect cell promoters, viral promoters, and preferably baculovirus promoters, such as IE1, IEN (IE2), IEO, 39K, gp64, DA26, ETL, 35K, capsid (p39) plO and the polyhedrin promoter.

The viral promoters for use in the present invention may be obtained from the viral DNA of Autographa californica NPV, Trichoplusia ni NPV, Rachipulsia ou NPV, Orgyia pseudosugata NPV, Bombyx mori NPV, Heliothis zea NPV, Spodoptera exigua NPV or Galleria mellonella NPV .

Additionally, the current invention provides for the use of enhancer elements operatively positioned to enhance expression of the transcriptional units. All eukaryotic enhancers are contemplated for use in the present invention, with preferred enhancers being the baculovirus enhancers hrl, hr2, hr3, hr4 and/or hr5, with the viral DNA of Autographa californica NPV, Trichoplusia ni NPV, Rachipulsia ou NPV, Orgyia pseudosugata NPV,

Bombyx mori NPV, Heliothis zea NPV, Spodoptera exigua NPV or Galleria mellonella NPV being the preferred sources for the baculoviral enhancer elements.

Additional proteins that modify or stabilize proteins are contemplated for use in the present invention, either alone, or in conjunction with the oligosaccharide processing enzymes. Certain embodiments of the present invention provide a structural gene encoding a modification protein, including, but not limited to, a protein kinase, a protein methylase, and proteins involved in acylation, acetylation and/or amidation of proteins, operatively positioned under the control of a promoter. Other embodiments of the present invention provide a structural gene encoding a protein involved in the stabilization or proper folding of proteins, including, but not limited to, protein disulphide isomerase, peptidyl prolyl cis- trans isomerase and/or a chaperone protein, operatively positioned under the control of a promoter. Preferred from this class of proteins is a structural gene for BiP/GRP78, and particularly preferred is BiP/GRP78 from an insect cell.

Further embodiments of the present invention include a structural gene encoding a screenable or selectable marker protein, operatively positioned under the control of a promoter. Exemplary of these screenable marker proteins are β-galactosidase,

chloramphenicol acetyltransferase, β-glucuronidase, luciferase and green fluorescent protein. Preferred for use in the present invention are selectable marker proteins, including, but not limited to, antibiotic or toxin resistance genes such as neomycin resistance, hygromycin resistance and dihydrofolate reductase, which confers resistance to methotrexate.

In particular aspects of the present invention, the vectors further comprise a baculovirus structural gene, with gp64, plO and/or polyhedrin being preferred examples. Further embodiments of the present invention include a cloning restriction site, optionally, and preferably, for insertion of one or more heterologous coding regions or genes that encode one or more proteins or polypeptides to be expressed. In particularly preferred embodiments, the cloning restriction site comprises a DNA insert including a multiple cloning cassette.

Certain embodiments of the present invention include at least one heterologous structural gene encoding a selected protein, the gene operatively positioned under the control of and in frame with a promoter. Preferred are baculoviral promoters, more preferred are very late baculoviral promoters, and particularly preferred are the polyhedrin and/or plO promoter. Alternatively, the promoter is a promoter naturally associated with the heterologous structural gene.

In additional embodiments of the present invention, the vectors comprise a structural gene encoding an insecticidal protein. Insecticidal proteins preferred for use include, but are not limited to, Bacillus thuringiensis crystal toxins, protease inhibitors, lectins, chitinases, proteases, insect-specific neurotoxins and trypsin inhibitors. Particularly preferred are juvenile hormone esterase and the insect-specific toxins Androctonus australis toxin (AalT) and Leiurus quinquestriatus hebraeus toxin (LqhIT2). The present invention additionally provides a 5' end flanking baculovirus viral DNA and a 3' end flanking baculovirus viral DNA, allowing recombination of the transcriptional units into the baculovirus genome, thereby replacing a portion of the baculovirus genome. Preferred portions of the baculovirus genome for replacement are the gp64, plO and/or polyhedrin loci. In certain preferred embodiments of the present invention, the first oligosaccharide processing enzyme structural gene encodes a galactosyltransferase and tne second

oligosaccharide processing enzyme structural gene encodes a sialyltransferase. In preferred embodiments, at least one of the first or second oligosaccharide processing enzyme structural genes is operatively positioned under the control of a baculovirus promoter. Preferred baculovirus promoters are baculovirus immediate early, delayed early and/or early promoters. Further preferred uses of the current invention provide the structural gene encoding N-acetylglucosaminyltransferase I and N-acetylglucosaminyltransferase II, operatively positioned under the control of the above promoters. Particularly preferred embodiments further include a baculoviral enhancer. Preferred embodiments provide these components irrespective of the particular vector construct used. In certain embodiments of the present invention, the vectors are encapsulated within a baculovirus.

Thus in particular aspects the present invention provides a baculovirus expression vector comprising a gene encoding an oligosaccharide processing enzyme, a chaperone protein, a protein stabilization protein and/or another type of protein modification enzyme operatively positioned under the control of a promoter, a baculoviral structural gene, a 5' end flanking baculovirus viral DNA, a 3' end flanking baculovirus viral DNA, and a structural gene encoding a chaperone protein operatively positioned under the control of a promoter.

In further embodiments, the gene encoding the oligosaccharide processing enzyme is operatively positioned under the control of a promoter and a baculoviral enhancer. Additional embodiments include a structural gene encoding a screenable or selectable marker protein operatively positioned under the control of a promoter. In preferred embodiments, the gene encoding the selectable marker protein encodes an antibiotic or toxin resistance gene. Particularly preferred embodiments include a DNA insert including a multiple cloning site. Exemplary embodiments further include a heterologous structural gene inserted into the multiple cloning site.

The present invention also provides a baculovirus particle comprising a baculovirus expression vector characterized as: (a) comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene operatively positioned under the control of a promoter; or (b) comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural

gene encoding an oligosaccharide processing enzyme, the gene operatively positioned under the control of a baculoviral immediate early, delayed early, early or late promoter.

An embodiment of the present invention is an insecticidal composition comprising a population of baculovirus particles, the baculovirus particles comprising a baculovirus expression vector characterized as: (a) comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene operatively positioned under the control of a promoter; or (b) comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural gene encoding an oligosaccharide processing enzyme, the gene operatively positioned under the control of a baculoviral immediate early, delayed early, early or late promoter.

An additional embodiment of the present invention is an insect cell comprising a baculovirus expression vector characterized as: (a) comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene operatively positioned under the control of a promoter; or (b) comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural gene encoding an oligosaccharide processing enzyme, the gene operatively positioned under the control of a baculoviral immediate early, delayed early, early or late promoter.

The insect cell may have integrated into its genome one or more functional units from the baculovirus expression vector. Thus, in further embodiments of the current invention, the insect cell is a stably transformed insect cell line or clone that expresses or continually expresses at least a first glycosylation enzyme not normally expressed, or not normally expressed at sufficiently functional levels, in the natural insect cell. Preferred insect cells are Lepidopteran insect cells, and particularly preferred are Spodoptera frugiperda, Bombyx mori, Heliothis virescens, Heliothis zea, Mamestra brassicas, Estigmene acrea or Trichoplusia ni insect cells.

In certain aspects, the vectors of the present invention are contemplated for use in the preparation of a recombinant baculovirus. Thus, the present invention provides a baculovirus containing any of the baculovirus expression vectors disclosed herein. The

present invention also provides for the use of the vectors of the instant invention in the preparation of a recombinant baculovirus. In further aspects, the invention provides a population of baculovirus particles containing any of the instant baculovirus expression vectors. In other preferred embodiments, a baculovirus containing any of the baculovirus expression vectors disclosed herein are contemplated for use in the preparation of an insecticidal formulation. Thus, the present invention also provides for the use of a baculovirus containing any of the baculovirus expression vectors of the present invention in the preparation of an insecticidal formulation.

Also provided by the present invention is a method for metabolically engineering an insect cell, comprising providing to the cell at least a first baculovirus expression vector characterized as: (a) comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene positioned under the control of a promoter operative in the insect cell; or (b) comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural gene encoding an oligosaccharide processing enzyme, the gene positioned under the control of a baculoviral immediate early, delayed early, early or late promoter operative in the insect cell.

The invention further provides a method for metabolically engineering an insect cell, comprising providing to an insect any of the baculovirus expression vectors disclosed herein. Also provided are baculovirus expression vectors for use in metabolically engineering an insect cell. Thus, the present invention provides for the use of any of the disclosed baculovirus expression vectors in the metabolic engineering an insect cell.

In further embodiments, the insect cell line is provided with the first baculovirus expression vector by infection. Alternatively, the insect cell line is provided with the first baculovirus expression vector by transfection. In an additional method of practicing the present invention, the first baculovirus expression vector is maintained extrachromosomally in the insect cell to provide an insect cell that transiently expresses the oligosaccharide processing enzyme or enzymes. In an alternate method of the current invention, the first baculovirus expression vector stably integrates into the genome of the insect cell line to

provide a stably transformed insect cell that continuously expresses the oligosaccharide processing enzyme or enzymes.

The present invention thus further provides an insect cell containing any of the baculovirus expression vectors disclosed herein. In further aspects, a baculovirus containing any of the disclosed baculovirus expression vectors are provided for use in the preparation of an engineered insect cell. Thus, the present invention provides for the use of a baculovirus containing any of the disclosed baculovirus expression vectors in the preparation of an engineered insect cell. The invention also provides an engineered insect cell that expresses at least a first heterologous oligosaccharide processing enzyme. A further embodiment of the instant invention is an engineered insect cell that expresses at least a first heterologous oligosaccharide processing enzyme and at least a first heterologous gene that encodes a selected protein.

In a preferred method, the first baculovirus expression vector expresses a galactosyltransferase and a sialyltransferase oligosaccharide processing enzyme. Particularly preferred is where the first baculovirus expression vector further expresses

N-acetylglucosaminyltransferase II and N-acetylglucosaminyltransferase II. In certain methods of the present invention, the insect cell is a Lepidopteran insect cell. In preferred methods, the insect cell is a cultured insect cell, or in the alternative is housed within a living insect. In additional methods of the present invention, the insect cell is further provided with a heterologous structural gene that expresses a selected protein in the insect cell. In particular methods, the heterologous structural gene is provided to the insect cell by means of a baculovirus expression vector. In certain methods of the present invention, the heterologous structural gene is comprised within the first baculovirus expression vector. In additional methods, the heterologous structural gene is comprised within a second baculovirus expression vector that is provided to the insect cell.

The present invention provides a method for producing a selected protein in an insect cell, comprising preparing an engineered insect cell that expresses at least a first heterologous oligosaccharide processing enzyme and expressing in the engineered insect cell a heterologous gene that encodes the selected protein. Additional methods comprise collecting the selected protein expressed by the cell.

The present invention also provides a method for producing a selected protein in an insect cell, comprising providing to an insect any of the baculovirus expression vectors of the instant invention and an expressible nucleic acid segment encoding said selected protein. Additionally, baculovirus expression vectors for use in producing an oligosaccharide- containing selected protein in an insect cell are provided. Thus, the present invention provides for the use of any of the disclosed baculovirus expression vectors in the production of an oligosaccharide-containing selected protein in an insect cell. In other embodiments, baculovirus expression vectors are provided for use in preparing a formulation for use in producing an oligosaccharide-containing selected protein in an insect cell. Therefore, the present invention additionally provides for the use of any of the instant baculovirus expression vectors in the preparation of a formulation for use in producing an oligosaccharide-containing selected protein in an insect cell.

The present invention also provides a method for producing a selected protein in an insect cell, comprising providing to the insect cell at least a first baculovirus expression vector that expresses at least a first oligosaccharide processing enzyme in the insect cell, and further providing to the cell a heterologous gene that expresses the selected protein in the insect cell. The method may be characterized as comprising the steps of preparing a first baculovirus expression vector in which an oligosaccharide processing enzyme gene is positioned under the control of a promoter operative in the insect cell, introducing the baculovirus expression vector into an insect cell, and maintaining the insect cell under conditions effective to allow expression of the encoded selected protein. Preferred methods of the present invention include collecting the expressed selected protein and purifying the expressed protein away from total cell components.

In additional methods, the heterologous structural gene is provided to the insect cell by means of a baculovirus expression vector. In alternate methods of the present invention, the heterologous structural gene is comprised within the first baculovirus expression vector, or within a second baculovirus expression vector that is provided to the insect cell.

In a preferred method of the present invention, the first baculovirus expression vector expresses galactosyltransferase and sialyltransferase oligosaccharide processing enzymes. In additional methods, the first baculovirus expression vector further expresses

N-acetylglucosaminyltransferase I and N-acetylglucosaminyltransferase II enzymes.

The present invention provides a selected recombinant protein polypeptide prepared by expressing a heterologous gene encoding the protein or polypeptide in a recombinant insect cell, as disclosed herein, and purifying the expressed protein or polypeptide away from total recombinant host cell components. The present invention further provides a method for producing a selected protein in an insect cell, comprising the steps of creating an engineered insect cell by providing to an insect cell at least a first baculovirus expression vector characterized as comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene positioned under the control of a promoter operative in the insect cell, or comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural gene encoding an oligosaccharide processing enzyme, the gene positioned under the control of a baculoviral immediate early, delayed early, early or late promoter operative in the insect cell, and expressing in the engineered insect cell a heterologous gene that expresses the selected protein.

The present invention also provides a method for producing a selected protein in an insect cell, comprising preparing a stably transformed insect cell that expresses at least a first oligosaccharide processing enzyme and infecting the stably transformed cell with a baculovirus comprising an expression vector that comprises a heterologous gene that expresses the selected protein in the insect cell.

Additionally, the present invention provides a method for killing an insect cell, comprising contacting the insect cell with at least a first baculovirus expression vector that expresses at least a first oligosaccharide processing enzyme in the insect cell. In a preferred method, the baculovirus expression vector is encapsulated within a baculovirus. Thus in certain embodiments, the invention provides an insect containing one or more of the baculovirus expression vectors disclosed herein.

These methods are generally based upon the classical use of baculovirus alone to kill insects. As the virus life cycle requires the virus to infect an insect cell, to reproduce and ultimately to kill the host insect cell and release new viruses, baculovirus alone is insecticidal. The narrow host cell specificity means that the use of baculovirus in the environment is not generally deleterious to cells, plants and animals other than insect cells.

However, the insect target cells can adapt to be less-sensitive to baculovirus infection. This process is believed to include, at least in part, recognition and activity of glycosylated proteins. Therefore, the new baculovirus expression vectors of the present invention that express at least one oligosaccharide processing enzyme, the enzyme not normally present or significantly present in insect cells, will function to change the glycosylation pattern of the proteins in the cells, which should hamper the ability of the cells to become resistant to baculovirus.

In further methods, the insect cell is housed within a living insect. That is, the methods are applicable to insect cells in culture, and to whole, live insects. In additional methods of the present invention, the baculovirus expression vector is characterized as comprising at least a first and a second glycosylation enzyme transcriptional unit, the transcriptional units comprising a first and a second structural gene encoding a first and a second oligosaccharide processing enzyme, each gene positioned under the control of a promoter operative in the insect cell, or comprising at least a first glycosylation enzyme transcriptional unit, the transcriptional unit comprising a structural gene encoding an oligosaccharide processing enzyme, the gene positioned under the control of a baculoviral immediate early, delayed early, early or late promoter operative in the insect cell.

In preferred methods of the present invention, the baculovirus expression vector further expresses an insecticidal protein in the insect cell. In particularly preferred methods, the insecticidal protein is Bacillus thuringiensis crystal toxin, a protease inhibitor, a protease, an insect-specific neurotoxin or other toxins, a lectin, a chitinase, juvenile hormone esterase or a trypsin inhibitor insecticidal protein. In exemplary examples of the present invention, the insecticidal proteins are lectins such as wheat germ agglutinin, rice lectin or stinging nettle lectin, Bacillus thuringiensis crystal toxin genes such as CrylA (b) or CrylA(c), or insect-specific toxins such as AalT or LqhIT2.

In additional methods of the present invention, the vector expresses a glycosylatable insecticidal protein and the oligosaccharide processing enzyme functions to modify the glycosylation pattern of the insecticidal protein, wherein the vector expresses a glycosylatable insecticidal protein that requires a defined glycosylation pattern to achieve significant insecticidal activity and wherein the co-expressed oligosaccharide processing enzyme functions to modify the glycosylation pattern of the insecticidal protein expressed in

the insect cell sufficiently to increase its insecticidal activity, i.e., wherein the oligosaccharide processing enzyme modifies the glycosylation pattern of the insecticidal protein by adding one or more terminal glycosyl residues that are not normally added to the protein when the protein alone is expressed in the insect cell. In preferred methods of the present invention, the vector expresses the insecticidal protein juvenile hormone esterase, AalT and/or LqhIT2 and the oligosaccharide processing enzyme galactosyltransferase and/or sialyltransferase. In other aspects, the vector expresses a chaperone protein, such as BiP/GRP78, in conjunction with an insecticidal protein, such as the insect-specific toxins AalT and/or LqhIT2. The present invention further provides DNA segments that comprise an isolated insect α-mannosidase I and/or α-mannosidase II gene or cDNA, as may be isolated from lepidopteran insect cells, such as Sf9, High Five or Ea cells. The α-mannosidase II or α- mannosidase I genes or cDNAs are DNA segments that comprise gene sequences, or coding regions, that encode α-mannosidase II or α-mannosidase I proteins, polypeptides or peptides.

In certain embodiments, the α-mannosidase II genes and cDNAs will include a contiguous nucleic acid sequence that encodes an α-mannosidase II protein, polypeptide or peptide that comprises a contiguous amino acid sequence from the amino acid sequence of SEQ ID NO:4. In further embodiments, the α-mannosidase II genes and cDNAs will include a contiguous nucleic acid sequence that corresponds to a contiguous nucleic acid sequence from the nucleic acid sequence of SEQ ID NO:3, and preferably, from the open reading frame thereof. Nucleic acid sequences comprising the complement of SEQ ID NO: 3 are also provided.

In certain other embodiments, the α-mannosidase I genes and cDNAs will include a contiguous nucleic acid sequence that encodes an α-mannosidase I protein, polypeptide or peptide that comprises a contiguous amino acid sequence from the amino acid sequence of SEQ ID NO:2. In further other embodiments, the α-mannosidase I genes and cDNAs will include a contiguous nucleic acid sequence that corresponds to a contiguous nucleic acid sequence from the nucleic acid sequence of SEQ ID NO:l, and preferably, from the open reading frame thereof. Nucleic acid sequences comprising the complement of SEQ ID NO: 1 are also provided.

It will be understood that nucleic acid segments of from 14 to about 10,000 nucleotides in length that hybridize to the nucleic acid segment of SEQ ID NO:3 or SEQ ID NO: l , or the complement thereof, under standard or high stringency hybridization conditions are also included within the present invention. Where the insect α- mannosidase II and I gene constructs encode α-mannosidase II and I polypeptides or peptides, contiguous amino acid sequences of from about 15 to about 50, or from about 15 to about 30 amino acids in length are contemplated. These may be used in, e.g., immunization to generate antibodies to α-mannosidase II and I.

Insect α-mannosidase II and I gene constructs encoding full length proteins will generally be preferred in embodiments concerning the production of active proteins. The insect α-mannosidase II and I genes and cDNAs of the present invention may be positioned under the control of a promoter, preferably a promoter that directs the expression of the α- mannosidase II or I proteins in an insect cell. As such, the present invention also provides recombinant vectors comprising insect α-mannosidase II and I genes and/or cDNAs that express α-mannosidase II and/or I proteins. The present invention also provides recombinant host cells, preferably insect cells, comprising or incorporating DNA segments that comprise isolated α-mannosidase II and/or I genes or cDNAs that encode insect α-mannosidase II and/or I proteins. The genes or cDNAs are preferably introduced by means of a recombinant vector and the cell preferably expresses the vector. The invention thus further provides methods of using a DNA segment that includes an isolated insect α-mannosidase II and/or I gene or cDNA that encodes an α-mannosidase II and/or I protein, comprising the steps of preparing a recombinant vector in which an insect α-mannosidase II and/or I -encoding DNA segment is positioned under the control of a promoter, introducing the recombinant vector into a recombinant host cell, preferably an insect cell, culturing the recombinant host cell under conditions effective to allow expression of an insect encoded α-mannosidase II and/or I protein or peptide, and collecting the expressed α-mannosidase II and/or I protein or peptide.

Recombinant insect α-mannosidase II and/or I protein, polypeptide or peptide compositions prepared by expressing α-mannosidase II and/or I in a recombinant host cell are also provided, with preferred compositions comprising α~mannosidase II and/or I polypeptide or peptide composition purified, or substantially, purified away from total

recombinant host cell components. Antibodies that specifically bind to, i.e., have immunospecificty for insect α-mannosidase II and/or I proteins, polypeptides or peptides are also provided.

Methods for detecting insect α-mannosidase II and/or I sequences in a sample are also provided, which comprise obtaining sample nucleic acids from a sample suspected of containing insect α-mannosidase II and/or I, contacting the sample nucleic acids with a nucleic acid segment that encodes an insect α-mannosidase II and/or I protein or peptide under conditions effective to allow hybridization of substantially complementary nucleic acids, and detecting the hybridized complementary nucleic acids thus formed. In situ hybridization, Northern and Southern blotting are contemplated. Also, pairs of nucleic acid primers that hybridize to distant sequences from insect α-mannosidase II and/or I nucleic acid sequences may be used, wherein the primers are capable of amplifying an insect α-mannosidase II and/or I nucleic acid segment when used in conjunction with a polymerase chain reaction. In such a polymerase chain reaction, amplification products are created and the amplification products thus formed are then detected. Thus, nucleic acid detection kits are provided which comprise, in suitable container means, one or more isolated insect α-mannosidase II and/or I nucleic acid segments and, optionally, detection reagents.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. FIG. 1A, FIG. IB and FIG. lC. Immediate early expression plasmids. FIG. 1A: pIElHRl-4. FIG. IB: pAcP(-)IElTV5 and 6. FIG. 1C: pAcP(+)IElTVl-4. The key features of the immediate early expression plasmids described herein below are shown in FIG. 1A through FIG. lC. In each case, the thin lines indicate pUC8 sequences, the open boxes represent the hr5 enhancer, the lightly-shaded boxes represent the iel promoter and downstream sequences, and the darkly shaded boxes represent polyhedrin coding and/or flanking sequences. The early transcription unit in each plasmid is indicated by the arrow

spanning the iel transcriptional initiation (CAGT) and polyadenylation sites. The very late transcription unit in the plasmids shown in FIG. 1C is indicated by the arrow spanning the polyhedrin initiation (ATAAG) and polyadenylation sites. All plasmids within a set (FIG. 1A, FIG. IB, or FIG. 1C) are identical except for their mcs sequences. Multiple cloning site 1 (mcsl : GTGACTATGGATCTAGATCTGCGGCCGCAGGCCTCGCGACTAGTTTAA

ACCC; SEQ ID NO:7) has Xbal, Bglll, Notl, Stul, Nrul, Spel and Pmel sites. Multiple cloning site 2 (mcs2: GTGACTATGGATCCCCGGGTTTAAACTAGTCGCGAGG CCTGCG GCCGCAGATC; SEQ ID NO:8) has Pmel, Spel, Nrul, Stul and Notl sites. Multiple cloning site 3 (mcs3: GTGACCGCGGATCTAGATCTGCGGCCGCAGGCCT CGCGACTAGTTTAAACCC; SEQ ID ΝO:9) has SαcII, Xbal, Bglll, Notl, Stul, Nrul, Spel and Pmel sites. Multiple cloning site 4 (mcs4: GTGACCGCGGATCCCCGGGTTT AAACTAGTCGCGAGGCCTGCGGCCGCAGATC; SEQ ID NO: 10) has Sacll, Pmel. Spel, Nrul, Stul and Notl sites. Multiple cloning site 5 (mcs5: GTGACTATGGAT CCCGGGTACCTTCTAGAATTCCGGAGCGGCCGCTGCAGATCTGATCC; SEQ ID ΝO:l l) has BamHI, Smal, Kpnl, Xbal, Notl, Bglll and Pstl sites. Multiple cloning site 6

(mcs6: GTGACCGCGGATCCCGGGTACCTTCTAGAATTCCGGAGCGGCCGCTGCA GATCTGATCC; SEQ ID NO: 12) has SαcII, BamHI, Smal, Kpnl, Xbal, Notl, Bglll and Pstl sites. The number designating each individual plasmid (#1-6) specifies which mcs sequence it contains. pIElHRl-4 (FIG. 1A) are designed for optimal z -mediated expression of fused (pIElHRl and 2) or nonfused (pIElHR3 and 4) proteins in uninfected insect cells.

Except for Stul and Spel, all of the restriction sites in the mcs are unique, but the Xbal site in mcs 1 and 3 has an overlapping dam methylation site and can be cut only if the DNA is produced in a da ^' strain of E. coli. A foreign gene can be inserted at Stul or Spel, but the insert must have its own polyadenylation site because there are additional Stul and Spel sites downstream that result in deletion of a plasmid fragment including the iel polyadenylation site. The mcs also includes a Smal site, but it is only useful for insertions if partial digests are done because there is another Smal site upstream of the hr5 enhancer element pAcP(-)IElTV5 and 6 (FIG. IB) are designed for the isolation of occlusion-negative recombinant baculoviruses capable of expressing fused (pAcP-IElTV5) or nonfused (pAcP-IElTV6) proteins under iel control. pAcP(+)IElTVl-4 (FIG. 1C) are designed for the isolation of occlusion-positive recombinant baculoviruses capable of expressing fusee

(pAcP+IElTVl and 2) or nonfused (pAcP+IElTV3 and 4) proteins under iel control. Each of the restriction sites in the mcs's of the various pAcP-IElTV and pAcP+IElTV plasmids are unique and the Xbal site in the AcP-IElTV plasmids is not blocked by an overlapping dam methylase site. The mcs in pAcP+IElTV2 and 4 also include BamHI sites, but these are not unique and are not useful for insertions.

FIG. 2. Production of β-gal activity by immediate early and conventional baculovirus vectors. This log-scale plot shows the relative levels of β-gal activity in cytoplasmic extracts from Sf9 cells infected for various times with AcP(-)IElβgal (open bars), AcP(+)IElβgal (stippled bars), 941βgal (cross-hatched bars), or wild-type AcMNPV (closed bars), β-gal activity is expressed as nmol of o-nitrophenol produced per minute per million infected cells.

FIG. 3. Production of E. coli CAT activity by immediate early and conventional baculovirus vectors. This log scale plot shows the relative levels of CAT activity in cytoplasmic extracts from Sf9 cells infected for various times with AcP(-)IElCAT (open bars), AcP(+)IElCAT (light stippled bars), or Ac360CAT (dark stippled bars). CAT activity is expressed as pmol of acetylated chloramphenicol produced per 30 min per million infected cells.

FIG. 4. Production of α-mannosidase II activity by immediate early and conventional baculovirus vectors. This plot shows the relative levels of α-mannosidase II activity in total extracts of Sf9 cells infected for various times with wild-type AcMNPV

(closed bars), AcS Manll (open bars), or AcP(+)SfManII (cross-hatched bars). Activity is expressed as nmol of p-nitrophenol produced per min per ml of cell extract.

FIG. 5A and FIG. 5B. Isolation of the Sf9 α-mannosidase II cDNA. FIG. 5A: A diagram of the partial Sf9 α-mannosidase II cDNA clone is shown (top) and a diagram showing the ligation-anchored PCR™ strategy used to isolate the 5' end of the cDNA

(bottom). FIG. 5B: Assembly of the full-length Sf9 α-mannosidase II cDNA.

FIG. 6. A dendogram of the α-mannosidase polypeptide sequences generated with the Pileup subroutine as described in Example 6. The numbers in parentheses represent the percent identity of the indicated sequence to the Sf9 α-mannosidase II polypeptide. FIG. 7A and FIG. 7B. Enzymatic activity of the Sf9 α-mannosidase II protein in baculovirus-infected Sf9 cells. FIG. 7A: α-Mannosidase II activity assays were performed

on cell extracts with the p-nitrophenyl α-mannoside substrate (open bars, wild type; cross- hatched bars, recombinant). FIG. 7B: Activity assays also were performed in the presence of various concentrations of swainsonine (dotted lines, wild-type; solid lines; recombinant; open squares, 24 h postinfection; crosses, 36 h postinfection; closed circles, 48 h postinfection).

FIG. 8A and FIG. 8B. Genetic structures of the plasmids used to produce immediate early recombinant baculoviruses. FIG. 8A is the genetic structure of pAcP(-)IElGalT. FIG. 8B is the genetic structure of pAcP(+)IElGalT. The key genetic features of both plasmids are shown in the context of the linear AcMNPV map, in which the polyhedrin open reading frame extends from left to right (Summers and Smith, 1987;

O'Reilly et al, 1992). The viral DNA sequences upstream and downstream of the polyhedrin open reading frame are labeled polh-up and polh-dn, respectively. The hr5 enhancer is labeled hr5, the iel promoter is labeled IE1 , and the polyhedrin promoter is labeled PH. The polyhedrin and βl ,4-galactosyltransferase open reading frames are labeled Polh and Gal-T, respectively.

FIG. 9. Expression of βl,4-galactosyltransferase activity by immediate early recombinant baculoviruses. Sf9 cells were mock-infected (open circles) or infected with wild type AcMNPV (closed circles), AcP(-)IElGalT (open squares), or AcP(+)IElGalT (closed squares), and cell extracts were prepared at various times after infection. Triplicate samples of each extract were assayed for βl,4-galactosyltransferase activity as described in

Example 2. The results were plotted as average H-galactose counts per minute (cpm) incorporated versus time of infection with standard errors indicated by the bars. The absence of error bars for some time points indicates that the margin of error is too small to be indicated on the present scale. FIG. 10A and FIG. 10B. Modification of the insect cell N-glycosylation pathwa> by an immediate early recombinant baculovirus. FIG. 10A: Progeny budded virions were; partially purified from Sf9 cells infected with wild type AcMNPV and gp64 was extracted and immunoprecipitated as described in Example 3. FIG. 10B: Progeny budded virions were partially purified from Sf9 cells infected with AcP(+)IElGalT and gp64 was extracted and immunoprecipitated as described in Example 3. The disrupted immunoprecipitates were resolved by SDS-PAGE, transferred to Immobilon, and the blots were cut into strips

and probed with various lectins or rabbit anti-gp64 (Ab), as described in Example 3. The lectins were concanavalin A (Con A; binds α-linked mannose or glucose), Aleuria aurantia agglutinin (AAA; binds α-linked fucose), Datura stramonium agglutinin (DSA; binds terminal O-linked N-acetylglucosamine or Gal-βl,4-GalNAc), RCA (binds β-linked Gal), or Sambucus nigra agglutinin (SNA; binds terminal α-2-6-linked sialic acid). Lectins were preincubated in buffer alone (-) or buffer containing excess competing sugar (+) prior to being used to probe the filters as described previously (Jarvis and Finn, 1995). For the DSA lanes marked (+), excess N-acetylglucosamine was used for reaction on the left and excess galactose for the reaction on the right. Lectin or antibody binding was detected with alkaline phosphatase-conjugated secondary antibodies and a standard color reaction, as described in Example 3. The arrows on the right mark the positions of gp64 and the IgG heavy chain, which served as an internal standard for the lectin blots.

FIG. 11. Linkage of galactose-containing oligosaccharides on gp64 from recombinant virions. gp64 was isolated from either wild type AcMNPV (WT) or AcP(+)IElGalT (GT) virions and treated with buffer (Control) or peptide:N-glycosidase F

(PNGase) as described in Example 3. The reaction products were resolved by SDS-PAGE and analyzed by either immunoblotting with rabbit anti-gp64 (Ab) or RCA lectin blotting (RCA) in the absence (-) or presence (+) of competing galactose as described in the description of FIG. 10A and FIG. 10B. The arrows on the right indicate the positions of glycosylated gp64 (gp64), deglycosylated gp64 (p64), and IgG heavy chain (IgG).

FIG. 12. Influence of galactosylation on glycoprotein function. One-step growth curves were done by infecting triplicate Sf9 cell cultures with wild-type AcMNPV (circles), AcP(+)IElGalT (squares), or AcP(+)IElβgal (triangles) at a multiplicity of infection of 5 plaque-forming units per cell. After a 1 hr adsorption period, the inocula were removed and the cells were washed and fed with fresh growth medium. At various times postinfection, the media from triplicate cultures were harvested, pooled, and clarified by low speed centrifugation. The supernatants were titered by TCID ₅₀ assays on Sf9 cells and the data were converted to average plaque forming units (pfu) per ml and plotted against time of infection, as described in Example 4. FIG. 13. N-linked oligosaccharide processing. The oligosaccharide processing steps in insect cells (left branch) or higher eukaryotes (right branch) is shown. N-

acetylglucosamine residues are depicted as open squares, mannose residues are depicted as open circles, glucose residues are depicted as stippled triangles, fucose residues are depicted as open triangles, galactose residues are depicted as stippled circles and sialic acid residues are depicted as stippled diamonds. The enzymes catalyzing each step are listed. FIG. 14. Modified 5 '-RACE procedure used to screen the Sf9 cDNA library for a full-length αl,2-mannosidase clone. T7-adapter primer (SEQ ID NO:23) is complementary to the T7 promoter sequence in the λ-ZAP II vector and also includes a 17-base adapter sequence at its 5' end. Sf9 Manl primer (SEQ ID NO:30) is complementary to an internal sequence near the 5' end of the partial Sf9 α 1 ,2-mannosidase cDNA clone. Adapter primer (SEQ ID NO:24) consists of just the adapter sequence at the 5 ^' end of the T7-adapter primer. In the first step, the T7-adapter primer anneals to the T7 promoter in the λ-ZAP II vector portion of every cDNA clone and is extended by Taq DNA polymerase. Next, the Sf9 Manl primer anneals only to those single-stranded DNAs derived from cDNA clones containing Sf9 αl,2-mannosidase sequences and is extended in the antisense direction. This generates a product that can be amplified with the adapter primer and Sf9 Manl primer, as shown in the last step. The size of the amplification product is determined by how far the cDNA sequence extends upstream of the position of the Sf9 Man I primer in the clone being amplified.

FIG. 15A and FIG. 15B. Enzymatic activity of the protein encoded by the Sf9 α 1 ,2-mannosidase cD A. Sf9 cells were infected with wild-type baculovirus (WT) or a recombinant (Rec) encoding the Sf9 αl,2-mannosidase cDNA under the control of the polyhedrin promoter. Lysates were prepared at the indicated times postinfection and used for α-mannosidase activity assays, as described in Example 19. A portion of the lysates from cells infected with the recombinant virus was boiled and used as a negative control. α-mannosidase activity was measured in counts per minute (cpm) of [ Hjmannose released from [ ³ H]Man ₉ GlcNAc, as described in Example 19. FIG. 15A shows the activity levels in cell lysates at various times postinfection. These reaction mixtures included 10 mM CaCl ₂ , and 5 mM MgCl ₂ . FIG. 15B shows assays done under various conditions with cell lysates at 48 hours postinfection. As indicated on the abscissa, the various reaction mixtures included 500 μM dMNJ, 10 mM EDTA.10 mM CaCl ₂ , and/or 10 mM MgCl ₂ . The arrow (-

>) indicates cell lysates that were treated with EDTA, then supplemented with CaCl ₂ and/or MgCl ₂ .

FIG. 16A and FIG. 16B. Extended N-glycosylation pathway of SfGalT cells. Progeny budded virions were partially purified from Sf9 or SfGalT cells infected with wild type baculovirus (wt) or AcP(+)IElGalT (rec) and gp64 was extracted and immunoprecipitated. The disrupted immunoprecipitates were resolved by SDS-PAGE, transferred to immobilon, and the blots were cut into strips and probed with rabbit anti-gp64 (Ab) or the lectins Con A (binds α-linked mannose or glucose) or RCA (binds β-linked Gal). Each lectin was preincubated in buffer alone (FIG. 16A) or buffer containing excess competing sugar (FIG. 16B) prior to being used to probe the filters. Lectin or antibody binding was detected with alkaline phosphatase-conjugated secondary antibodies and a standard color reaction. The arrows on the right mark the positions of gp64 and the IgG heavy chain, which served as an internal standard for the lectin blots. The results show clearly that only the gp64 produced in SfGalT cells bound to RCA, indicating that only these cells were able to produce a galactosylated end-product.

FIG. 17A, FIG. 17B, FIG. 17C and FIG. 17D. Galactosylation of a human glycoprotein expressed by a recombinant baculovirus in SfGalT cells. Sf9 or SfGalT cells were mock-infected (mock), infected with wild type baculovirus (wt), or infected with Ac941t-PA (rec), which is a conventional recombinant baculovirus that encodes human tissue plasminogen activator under the transcriptional control of the polyhedrin promoter.

The cells were radiolabeled from 24-48 hr postinfection and the extracellular fraction was collected and immunoprecipitated with a goat antibody against t-PA (α-tPA) or normal goat serum (NGS). The disrupted immunoprecipitates were resolved by SDS-PAGE, transferred to immobilon, and the blots were probed with the lectin RCA, which is specific for β-linked galactose. The lectin was preincubated in buffer alone (FIG. 17A) or buffer containing excess competing galactose (FIG. 17B) prior to being used to probe the filters. Lectin binding was detected with alkaline phosphatase-conjugated secondary antibodies and a standard color reaction. Autoradiographs of the lectin blot of FIG. 17A is shown in FIG. 17C. and of the lectin blot of FIG. 17B is shown in FIG. 17D. The arrows on the right mark the positions of t-PA and the IgG heavy chain, which served as an internal standard for the lectin blots. The results clearly show that t-PA was produced, secreted, and specifically

immunoprecipitated from either Sf9 or SfGalT cells infected with the recombinant virus. However, only the t-PA from the recombinant virus-infected SfGalT cells bound to RCA, indicating that only these cells produced a galactosylated end-product.

FIG. 18A and FIG. 18B. Further extension of the N-glycosylation pathway in SfGalT cells. Progeny budded virions were partially purified from Sf9 (FIG. 18A) or

SfGalT (FIG. 18B) cells infected with wild type baculovirus (E2) or AcP(+)IElST, which is an immediate early recombinant baculovirus that encodes rat α2,6-sialyltransferase cDNA under the transcriptional control of the IE1 promoter (ST). gp64 was extracted and immunoprecipitated and the disrupted immunoprecipitates were resolved by SDS-PAGE and transferred to immobilon. The blots were cut into strips and probed with rabbit anti- gp64 (Ab) or the lectins RCA (binds β-linked Gal) or SNA (binds to α2,6-linked sialic acid). Each lectin was preincubated in buffer alone (-) or buffer containing excess competing sugars (+) prior to being used to probe the filters. Lectin or antibody binding was detected with alkaline phosphatase-conjugated secondary antibodies and a standard color reaction. The arrows on the right mark the positions of gp64 and the IgG heavy chain, which served as an internal standard for the lectin blots. The results show clearly that only the gp64 produced in SfGalT cells by the ST recombinant virus bound to SNA, indicating that only this virus-cell combination was able to produce a galactosylated and sialylated end-product. FIG. 19. Linkage analysis of sialylated oligosaccharides on gp64. gp64 was extracted and immunoprecipitated from the progeny virions produced by SfGalT cells infected with AcP(+)IElST. The immunoprecipitates were stored frozen without any treatment (Ab) or treated with buffer alone (C), peptide :N-glycosidase F (F), or neuraminidase (N). The reaction products were resolved by SDS-PAGE, transferred to immobilon filters, and analyzed by either immunoblotting with rabbit anti-gp64 (Ab) or lectin blotting with RCA (to detect galactose) or SNA (to detect sialic acid). The arrows on the right indicate the positions of gp64 and IgG heavy chain. The results showed clearly that SNA binding was precluded by either neuraminidase or peptide :N-glycosidase F treatment, whereas RCA binding was precluded only by peptide :N-glycosidase F treatment. Furthermore, there was a slight increase in the relative electrophoretic mobility of gp64 after neuraminidase treatment and a major increase after peptide:N-glycosidase F treatment.

These results strongly support the conclusion that at least one N-linked oligosaccharide side-chain on gp64 was galactosylated and sialylated when SfGalT cells were infected with the AcP(+)IElST recombinant baculovirus.

FIG. 20A, FIG. 20B, FIG. 20C and FIG. 20D. Recombinant baculoviruses and transfer plasmids. FIG. 20A. Recombinant baculovirus AcP(+)DIE-GTST. FIG. 20B.

Transfer plasmid AcP(-)DIE-GTST. FIG. 20C. Recombinant baculovirus AcSWT-1. FIG. 20D. Recombinant baculovirus AcSWT-2.

FIG. 21A, FIG. 21B, FIG. 21C and FIG. 21D. Expression plasmids for creation of stable insect cell lines expressing glycosylation enzymes, and selected stable insect cell lines. FIG. 21A. Expression plasmid pDIE-GTST. FIG. 21B. Expression plasmid pDIE-

GlcNAc-TI-II. FIG. 21C. Expression plasmid pIElGT, used to create stable cell line SfGalT, plus recombinant baculovirus AcP(+)IEl ST, used to infect SfGalT to incorporate ST activity. FIG. 21D. Expression plasmid pIElGT, used to create stable cell line SfGalT, plus recombinant baculovirus AcP(-)IElST, used to infect SfGalT to incorporate ST activity and a desired gene of interest.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

The baculovirus-insect cell expression system is well-suited for recombinant glycoprotein production because baculovirus vectors can provide high levels of expression and insect cells can modify newly-synthesized proteins in eucaryotic fashion. However, the

N-glycosylation pathway in baculovirus-infected insect cells differs from the pathway found in higher eukaryotes, as indicated by the fact that glycoproteins produced in the baculovirus system typically lack complex biantennary N-linked oligosaccharide side chains containing penultimate galactose and terminal sialic acid residues. Previous work has shown that the N-glycosylation capabilities of other eucaryotic expression systems can be modified by transfecting cells with genes encoding new processing enzymes and isolating stably-transformed clones that express those genes constitutively. For example, clones of stably-transformed CHO or BHK-21 cells have been isolated that express newly-introduced genes encoding α-2,6-sialyltransferase (Lee et al, 1989; Minch et al, 1995; Grabenhorst et al, 1995) or α-l,3-galactosyltransferase (Smith et al, 1990) and produce differentially modified glycoproteins. Similarly, it has been

shown that Aspergillus nidulans can be transformed to express a heterologous β-l ,2-N- acetylglucosaminyltransferase I gene (Kalsner et al, 1995).

Similar efforts to modify the N-glycosylation pathway in lepidopteran insect cells have been extremely limited. The only published report known to the inventor describes elongation of N-linked oligosaccharides by the addition of an N-acetylglucosamine residue, which was absent on a fowl plague virus glycoprotein expressed in insect cells infected with a conventional baculovirus vector (Wagner et al, 1996b). Addition of the extra monosaccharide was accomplished by coinfecting insect cells with two recombinant baculoviruses, one encoding the fowl plague virus glycoprotein and the other encoding the human processing enzyme, β- 1 ,2-N-acetylglucosaminyltransferase I. Expression of both foreign genes was controlled by the polyhedrin promoter.

There are at least three limitations associated with the Wagner (1996b) approach. First, it can sometimes be difficult to obtain homogeneous populations of cells coinfected with more than one baculovirus. Second, expression of the processing enzyme will not precede expression of the protein to be processed, so only a subpopulation of the protein of interest will be exposed to the new processing activity. Third, expression of this single enzyme would not be sufficient to convert an expressed heterologous protein to a processed state similar to a mammalian protein. It also should be noted that insect cells contain N- acetylglucosaminyltransferase I activity (Altmann et al, 1993; Velardo et al, 1993), so the study by Wagner et al (1996b) actually does not describe the introduction of a new processing activity, merely the upregulation of a preexisting processing activity.

The present inventor realized that modification of the insect cell N-linked oligosaccharide processing pathway to the point where these cells will be able to produce glycoproteins with higher eukaryotic-type N-linked side-chains will require the addition of two processing enzymes that are thought to be completely missing in these cells (a galactosyltransferase and a sialyltransferase) and possibly two more that are expressed at very low levels by these cells (N-acetylglucosaminyltransferases I and II). This complexity may explain why there have been so few attempts to modify the insect N-glycosylation pathway given that many genes would need to be introduced into an insect cell, while simultaneously preserving the ability to express a foreign protein of interest. Moreover, th inventor considered the polyhearin promoter to have limitations in the context of

expressing modification enzymes, but promoters capable of providing temporal expression before polyhedrin are not widely used and are relatively unrecognized. Similarly, the use of vectors and methods needed for insect cell transformation, available for more than five years, have generally been limited. The inventor contemplated that a vector comprising one or more eukaryotic protein processing genes could be used to modify the insect cell N-glycosylation pathway by directing the expression of heterologous processing enzyme(s). The one or more encoded enzyme(s) will then function as part of the insect cell machinery and contribute to the processing of a protein of interest. As shown herein, this approach was demonstrated to have practical utility. The use of a novel baculovirus vector to introduce and express active bovine β 1 ,4-galactosyltransferase (Harduin-Lepers et al, 1993; Russo et al, 1992) in insect cells is shown herein to modify the N-linked oligosaccharide(s) on gp64, the major baculovirus virion glycoprotein (Examples 11-14).

Furthermore, another novel baculovirus vector was used to create a stably transformed insect cell subclone capable of modifying the N-linked oligosaccharides of the gp64 protein or of human tissue plasminogen activator, when genes encoding these proteins comprised within conventional baculovirus vectors were introduced into the transformed cells by infection (Example 20). Finally, these same cells produced galactosylated and sialylated N-linked oligosaccharides on the gp64 protein when infected with a novel baculovirus vector encoding a sialyltransferase and the gp64 protein (Example 21).

The current invention takes advantage of the present discovery of altered protein processing in insect cells through the introduction of heterologous processing enzymes, thus providing various novel improvements to the baculovirus expression system.

I. Baculovirus Expression Vehicles

A baculovirus expression vehicle (BEV) is a recombinant baculovirus with a double- stranded circular DNA genome that has been genetically modified to include a foreign gene of interest. BEVs are viable and can infect susceptible hosts, usually cultured lepidopteran insect cells or larvae, in a helper-independent fashion. Therefore, BEVs can efficiently transfer foreign genes into these eukaryotic host cells. The foreign gene is usually a chimeric construct with the sequence encoding a protein of interest placed under the

transcriptional control of a viral promoter. This arrangement enables viral functions to transcribe the gene during infection. The resulting mRNA is translated and the newly- synthesized protein modified by host-encoded biosynthetic machinery. In essence, then, BEVs and their insect cell hosts are two separate components of a binary eukaryotic expression system, which will be referred to as "the BEV system" herein below.

The BEV system is among the best tools currently available for the expression of recombinant genes in a eukaryotic host. The BEV system has contributed immensely to basic research, as it has been used to produce hundreds of different recombinant proteins for further studies. This system also holds great promise for the industrial production of proteins with direct applications as vaccines, therapeutic agents, and/or diagnostic reagents.

Finally, BEVs are being developed as improved biological pest control agents.

The most significant advantage of the BEV system over other expression systems is that it can be used to produce exceptionally large amounts of functional foreign proteins. The production levels provided by the BEV system are often comparable to those provided by prokaryotic systems and, at late times after infection, the recombinant protein usually constitutes a significant proportion of the total protein in the host cell. Unlike prokaryotic expression systems, however, the BEV system has eukaryotic protein processing capabilities, which enables it to produce more authentic foreign proteins. Thus, it is the potential of this system to provide prokaryotic levels of foreign gene expression in a eukaryotic background that makes it so powerful and attractive. Finally, the actual process of isolating BEVs has become increasingly fast, simple, and efficient as more sophisticated molecular tools have been developed. Additional background information on baculoviruses and the BEV system are available (Montreuil et al, 1995; Richardson, 1995; King and Possee, 1992; O'Reilly et al, 1992; Adams and McClintock, 1991 ; Blissard and Rohrmann, 1990; Luckow and Summers, 1988; Miller, 1988; Summers and Smith, 1987).

A. Baculoviruses

The family Baculoviridae consists of a large group of double-stranded DNA- containing viruses that infect arthropods (Volkman et al, 1995). The majority of these viruses infect insects and the type species is Autographa californica nuclear polyhedrosis virus (AcMNPV). There are two phenotypically distinct forms of AcMNPV, occluded virus

(OV) and budded virus (BV). OV consists of rod-shaped nucleocapsids enclosed by an envelope and embedded within a polyhedral-shaped crystalline matrix, or polyhedron. The "M" in AcMNPV indicates that one enveloped OV particle can contain multiple nucleocapsids. BV also consists of rod-shaped nucleocapsids enclosed by an envelope, but BV particles contain only one nucleocapsid and are released as free, nonoccluded virions by budding from the surface of the infected cell. OV and BV have different relative infectivities for insect larvae or cultured insect cells, which reflects their distinct roles in baculovirus infections, as discussed further below.

AcMNPV was originally isolated (Vail et al, 1971) as a mixture of genotypic variants with different restriction patterns (Lee and Miller, 1978) and different variants were used by investigators who went on to study this baculovirus and develop the first BEVs. Other nucleopolyhedroviruses also have been used to develop BEVs. Among these, BEVs derived from Bombyx mori nuclear polyhedrosis virus (BmNPV) are notable for their frequent use for foreign gene expression in insect larvae (Maeda, 1989). The discussion in this section will focus on generic "baculoviruses" and "BEVs" except where it is important to be more specific.

Natural baculovirus infections begin when a susceptible insect ingests OV in the form of polyhedra-contaminated food. The crystalline polyhedral matrix dissociates in the insect midgut and the liberated virus particles infect columnar epithelial and regenerative cells (Keddie et al, 1989). The infected midgut cells produce BV progeny that invade the insect circulatory and respiratory systems (Engelhard et al, 1994; Keddie, et al, 1989), where they initiate secondary infections and produce both BV and OV. BV progeny are produced when newly-assembled viral nucleocapsids migrate from the nucleus and bud from the infected cell surface. These virions acquire a lipid envelope and plasma membrane-bound glycoproteins during the process of budding. OV progeny are produced when nucleocapsids are enveloped within the nucleus (Stoltz et al, 1973) and the resulting virions are surrounded by the polyhedral matrix.

Polyhedra remain in the nuclei of infected cells until being released when the cell dies. Baculovirus-infected insect larvae are ultimately liquefied by virus-encoded digestive enzymes (Hawtin et al, 1995; Ohkawa et al, 1994) and when the cuticle ruptures, BV and polyhedra are released into the environment. Occluded virions are protected by the

crystalline polyhedral matrix and, as a result, are relatively resistant to inactivation by adverse environmental conditions. Moreover, this form of the virus is significantly more infectious than BV for orally-inoculated insect larvae (Volkman and Summers, 1977). Accordingly, OV is responsible for horizontal transmission of baculovirus infection in nature and is used to experimentally infect larvae via the oral route. Conversely, BV is significantly more infectious than OV for cultured insect cells (Volkman and Summers, 1977; Volkman et al, 1976) and is used to experimentally infect these cells in the laboratory.

The complete nucleotide sequences of AcMNPV (C6 isolate; Ayres et al, 1994; GenBank Accession No. L22858) and BmNPV (GenBank Accession No. L33180) have been determined. The AcMNPV genome is a double-stranded circular DNA molecule consisting of 133,894 nucleotides that probably encode about 150 proteins. Viral genes are distributed evenly throughout the genome on both strands of the DNA and are expressed in a temporally regulated fashion after infection. The immediate early genes, such as iel (Guarino and Summers, 1987), are expressed immediately after infection in the absence of other viral functions. At least some of the immediate early genes encode transcription factors that function to stimulate the expression of other early genes like 39K (Guarino and Smith, 1990). The early phase of baculovirus infection is followed by viral DNA replication and the onset of late viral gene expression. Many baculovirus late genes encode proteins needed for the assembly of progeny virions. For example, vp39 is a late gene which encodes the major nucleocapsid structural protein (Thiem and Miller, 1989) and p6.9 is a late gene which encodes a basic, protamine-like protein found in association with viral DNA (Wilson et al, 1987). Late gene expression is followed by expression of the very late genes, including polh (Hooft van Iddekinge et al, 1983) and/, /0 (Kuzio et al, 1984), which are needed for the assembly and envelopment of polyhedra, respectively.

There have been significant advances in the understanding of baculovirus gene expression during the past decade. The immediate early genes are transcribed by host cell factors and transcription of later classes of viral genes is increasingly influenced by virus- encoded factors. In particular, studies have identified nearly twenty virus-encoded proteins that are required for late and very late gene expression (Lu and Miller, 1995; Todd et l,

1995; McLachlin and Miller, 1994) and at least some of these must assemble into a virus-

modified or -encoded transcriptional complex (Beniya et al, 1996; Passarelli et al, 1994; Fuchs et al, 1983). This is an important concept because it is the nature of the transcriptional complex that is assembled during the very late phase of baculovirus infection, together with the structure of the promoters in baculovirus very late genes (Qin et al, 1989; Weyer and Possee, 1989; Rankin et al, 1988; Possee and Howard, 1987), that determines one of the most attractive properties of BEVs-their ability to express foreign genes at extremely high levels.

By the end of the baculovirus replication cycle, the nucleus occupies most of the volume of the infected host cell and it is literally stuffed with polyhedra. The major component of polyhedra is a protein called polyhedrin (Rohrmann, 1986), which forms the crystalline matrix. Thus, baculoviruses must be able to produce copious amounts of polyhedrin protein. In fact, polyhedrin comprises at least 25% of the total protein in baculovirus-infected insect cells during the very late phase of infection (Smith et al, 1983c). The ability to produce such large amounts of polyhedrin reflects the availability of a huge pool of polyhedrin mRNA, which represents about 25% of the total polyadenylated

RNA in the cell during the very late phase of infection (Adang and Miller, 1982).

The polh promoter contains a critical core sequence, TAAG, which also serves as the transcriptional initiation site and is conserved in baculovirus very late and late promoters (Rohrmann, 1986). However, very late promoters are transcribed later in infection and produce more mRNA than late promoters (Thiem and Miller, 1990). Therefore, the very late promoters and/or the very late transcriptional complex must have additional features, in addition to the TAAG sequence, which account for these differences. Indeed, studies have identified a region in the polh promoter (Ooi et al, 1989) and a virus-encoded factor (McLachlin and Miller, 1994) that specifically enhance very late transcription and transcriptional complexes have been isolated that exhibit preferential activity towards late or very late promoters in vitro (Xu et al, 1995). Furthermore, various differences in the behavior of the polh and pi 0 promoters have been reported (Tomita et al, 1995; McLachlin and Miller, 1994; Roelvink et al, 1992; Min and Bishop, 1991 ) indicating that even individual very late promoters are not functionally homologous. The ability to produce large amounts of polyhedrin during infection was the fundamental property of baculoviruses that led to their development as expression vehicles.

The AcMNPV polh gene was mapped, cloned, and sequenced (Hooft van Iddekinge, et al. , 1983; Adang and Miller, 1982; Vlak et al, 1981) and, together with the establishment of marker rescue in the baculovirus system (Miller, 1981), these studies provided some of the molecular tools that were needed to develop BEVs. In addition, the polh gene was shown to be nonessential for virus replication in cultured insect cells (Smith et al, 1983a). This indicated that one could create a BEV simply by replacing the polh open reading frame in the wild-type viral genome with a nucleotide sequence encoding a foreign protein of interest. The resulting BEV could be phenotypically distinguished from wild-type by its inability to produce polyhedra. Moreover, the BEV would be viable and could be used to infect cultured insect cells, in which the foreign coding sequences would be expressed under the transcriptional control of the polh promoter and large quantities of the foreign protein would be produced. The feasibility of this concept was demonstrated when it was shown that BEVs could be isolated and used to express human β-interferon (Smith et al, 1983b) or E. coli β-galactosidase (Pennock et al, 1984) in cultured insect cells.

B. Producing BEVs

The first step in the original procedure used to produce a BEV is to clone the sequences encoding a protein of interest into a suitable "transfer plasmid". A classic transfer plasmid contains the polh promoter and long upstream and downstream flanking sequences, but lacks some or all of the polh open reading frame, which is usually replaced by a convenient cloning site. Once the DNA sequence encoding a protein of interest has been inserted into this site, the recombinant transfer plasmid is purified, mixed with genomic DNA from wild-type baculovirus, and the mixture is cotransfected into cultured insect cells. Upon entering the cell, the viral DNA will be replicated and wild-type progeny will be produced.

In addition, homologous recombination can occur between the polh flanking sequences in the transfer plasmid and the same sequences in the viral DNA. This process, called "allelic replacement", produces recombinant viral DNAs in which the polh open reading frame in the parental virus has been replaced by sequences from the recombinant transfer plasmid encoding the protein of interest. These viral DNAs are replicated and packaged to produce recombinant viral progeny. Allelic replacement of polh occurs at a

maximum frequency of only about 1% (Smith, et al, 1983a), but this is no problem because it is relatively easy to distinguish wild-type and recombinant progeny by their plaque phenotypes. The mixture of viruses is simply harvested from the cotransfected cells and resolved in a plaque assay. The wild-type progeny, which retain the polyhedrin gene, produce polyhedron-positive plaques, whereas the recombinant progeny, which lack the polyhedrin gene, produce polyhedron-negative plaques. Once identified, recombinant viral clones can be further plaque-purified, amplified, and characterized, then large BV stocks can be produced and used to infect cultured insect cells for foreign gene expression and foreign protein production.

1. Transfer Plasmids

There are many different transfer plasmids that can be used to construct a chimeric gene and insert it into the baculovirus genome by allelic replacement. This section describes the general features of some of these plasmids. Maps and more detailed descriptions are available in several other places, including the primary literature (cited below), technical manuals (Richardson, 1995; King and Possee, 1992; O'Reilly, et al, 1992; Summers and Smith, 1987), and commercial literature and catalogs from various scientific supply houses, including Clontech (Palo Alto), InVitroGen (San Diego), Novagen (Madison), Pharmingen (San Diego), and Stratagene (La Jolla). Many different transfer plasmids can be purchased from these companies.

The first transfer plasmids were designed to produce BEVs in which the polh gene had been replaced by a new, chimeric gene consisting of the very late polh promoter and the sequence encoding the protein of interest positioned downstream, as described above (Pennock, et al, 1984; Smith, et al, 1983b). These transfer plasmids were constructed before it was clearly determined precisely which sequences from the 5' untranslated region

(UTR) of the polh gene were needed for optimal levels of polh promoter-mediated transcription (Rankin, et al, 1988; Matsuura et al, 1987; Possee and Howard, 1987). Once this information became available, it was easier to ensure that the transfer plasmid included all of the critical promoter sequences and to decide exactly where to place multiple cloning sites to facilitate subcloning of the foreign coding sequence. The polh promoter and multiple cloning site in the transfer plasmid must be flanked by sequences which normally

flank the polh gene in the viral genome, as these sequences are needed for homologous recombination between the transfer plasmid and the viral DNA. This process mediates allelic replacement of the polh gene, as described above. Transfer plasmids containing the polh promoter are still the most widely used tools for the production of BEVs. However, the increased popularity of the BEV system has led to the design and construction of many variations on this basic theme.

For example, there are transfer plasmids that can be used to produce BEVs which will express a foreign gene under the control of the very late /.70 promoter. Some of these transfer plasmids contain both the plO promoter and plO flanking sequences and, after the sequence encoding the protein of interest has been inserted, the resulting plasmid is used to replace the nonessential baculovirus plO gene (Vlak et al, 1990). This approach requires special screening procedures to identify recombinant viruses, as loss of the viral plO gene is not accompanied by an easily distinguishable change in plaque phenotype. Usually, this type of transfer plasmid includes a marker gene, such as E. coli lacZ, which is incorporated together with the chimeric gene of interest into the recombinant virus genome during allelic replacement.

Another approach is to use a hybrid transfer plasmid, in which the plO promoter is embedded within polh flanking sequences, to construct the chimeric gene and insert it into the polh region of the baculovirus genome (Weyer et al, 1990). This latter approach takes advantage of the simple visual screen that can be used to distinguish between parental

(occlusion-positive plaques) and recombinant (occlusion-negative plaques) viruses whenever polh is used as the target for allelic replacement. The p 10 promoter has been used to produce BEVs for foreign protein production (Bozon e al, 1995; Tomita, et al, 1995; van Lier et al, 1994; Roelvink, et al, 1992; Vlak, et al, 1990), but it provides lower levels of foreign gene expression and is used much less frequently than the polh promoter for this purpose. The plO promoter is more commonly used to construct BEVs for biopesticide applications because allelic replacement of pi 0 is one way to produce recombinants that can express a foreign gene without deleting the polh gene (McCutchen et al, 1991; Stewart et al, 1991; Merry weather et al, 1990). This is important because BEVs intended for use as pesticides must be able to produce polyhedra to infect insect larvae naturally in the field.

Other transfer plasmids can be used to construct BEVs that will express foreign genes under the transcriptional control of alternative promoters, including both viral and cellular promoters. These plasmids typically contain the promoter of choice embedded within polh flanking sequences and are used for allelic replacement of the polh gene as described above. Baculoviral promoters that have been used most commonly for this purpose include the late p6.9 (Hill-Perkins and Possee, 1990) and vp39 (Thiem and Miller, 1990) promoters and the early etl (Morris and Miller, 1992) and iel (Examples 1-5 below) promoters. Cellular promoters include Drosophilα hsplO (Vlak, et αl, 1990) and B. mori αctin (Johnson et αl , 1992). Transfer plasmids with a hybrid vp39-polh promoter (Thiem and Miller, 1990) or tandem polh-etl promoters (Xia et αl., 1993) also have been described.

Except for the last two, none of these promoters are as strong as the polh promoter (Examples 1-5 below; Morris and Miller, 1992; Thiem and Miller, 1990).

Considering that high-level expression is one of the most attractive features of the BEV system, it might seem foolish to use any promoter besides polh for baculovirus- mediated foreign gene expression. But, there are some good reasons to do this. BEVs canno- produce all classes of foreign proteins in equal abundance or quality under polh control. Generally, secretory pathway proteins are produced at much lower levels than other types of proteins and some are biologically inactive and/or insoluble when expressed under polh control (Pajot-Augy et αl., 1995; Rankl et αl., 1994; Arp et αl., 1993; Xie et αl., 1992; Tsao et αl., 1990). This might reflect the adverse effects of baculovirus infection on host cell secretory pathway functions, which have already begun to decay by the start of the very late phase of infection (Murphy et αl, 1990; Jarvis and Summers, 1989). Alternatively, it might reflect saturation of the protein folding and secretory capacity of the host cell due to high-level foreign gene expression, as has been documented in a yeast system (Parekh et αl. , 1995).

Either way, it has been shown that the p6.9 (Chazenbalk and Rapoport, 1995; Lawrie et αl., 1995; Bonning et αl., 1994; Rankl, et αl., 1994; Sridhar et αl., 1993) and iel (Examples 1-5 below; Jarvis et αl., 1990) promoters, which are expressed earlier and produce less mRNA, and even the /.10 promoter (Bozon, et αl., 1995), which is expressed only slightly earlier and produces only slightly less mRNA, can sometimes be used to produce larger amounts of biologically active and/or soluble foreign protein than the polh

promoter. The use of these alternative promoters to produce BEVs that can express foreign genes earlier in infection also represents a good approach for biopesticide applications, as the main idea is to produce a virus with a new gene that will help it to kill insects or stop their feeding more quickly (Jarvis, et al, 1996; Examples 1-5 below). Sometimes, it is important to be able to express more than one foreign protein simultaneously to study protein-protein interactions, assemble functional protein complexes, or reconstruct biochemical pathways. The BEV system is especially useful for this purpose. One approach is to use a mixture of two or more BEVs, each containing one foreign gene of interest, to coinfect host cells (St. Angelo et al, 1987). Theoretically, this approach can be used to vary the ratios of the different proteins being produced. However, a problem with this approach is that it is difficult to obtain a reasonably uniform population of cells coinfected with each virus. Another approach is to use transfer plasmids containing multiple promoters to produce a single BEV that can express multiple foreign genes. The first transfer plasmids of this type contained two copies of the polh promoter and were used to produce "dual" BEVs that could express two different foreign genes in a single cell

(Emery and Bishop, 1987). Later, transfer plasmids were constructed that contained various combinations of different viral promoters, including the polh, pi 0, and vp39 promoters, and these could be used to produce BEVs capable of expressing up to five different foreign proteins in the same infected cell (Belyaev et al, 1995; Wang et al, 1991 ; Weyer and Possee, 1991).

One of the first specialized functions to be built into transfer plasmids was a marker gene that could be used to identify BEVs. The marker was designed to be incorporated along with the gene of interest during allelic replacement. The resulting BEV would express this marker and produce a protein that could be detected with a chromogenic substrate and identify recombinant viral plaques. This was mandatory for the identification of BEVs with allelic replacements in plO (Vlak, et al, 1990), but it also facilitated the identification of BEVs with allelic replacements in polh (Vialard et al, 1990), because many investigators had trouble seeing the occlusion-negative plaques produced by those recombinants. The first marker used for this purpose was E. coli lacZ and its expression was controlled variously by baculovirus plO, iel, etl, or Drosophila hsplO promoters.

Other markers that have been used for this purpose include luciferase (Oker-Blom et al. , 1993) and β-glucuronidase (Bishop et al, 1995).

The sheer diversity of transfer plasmids that have become available, with their diverse array of multiple cloning sites, has greatly simplified the process of subcloning a foreign coding sequence for insertion into the baculovirus genome. Some transfer plasmids include translational initiation signals and can be used to construct chimeric genes encoding fusion proteins. Others lack these signals and are used to construct genes encoding nonfused proteins. Still others can be used either way, depending on where the foreign coding sequence is inserted. Some transfer plasmids also have been streamlined by shortening the flanking sequences to the minimum lengths needed for efficient homologous recombination. This approach has been used to reduce the size of a transfer plasmid by nearly half, which facilitates the subcloning process by leaving more room for the insertion of larger foreign protein coding sequences (Pharmingen and InVitrogen catalogs).

Some of the newest transfer plasmids are designed for ligation-independent cloning of a foreign protein coding sequence to be incorporated into a BEV (Bishop, et al, 1995,

Pharmingen catalog). This approach circumvents the need to subclone the sequence of interest into the transfer plasmid and amplify it in E. coli prior to cotransfection with viral DNA. Transfer plasmids designed for ligation-independent cloning have long single- stranded overhangs that can anneal to complementary single-stranded overhangs on a PCR™ amplification product encoding the foreign protein of interest. The annealed products are mixed with viral DNA and the mixture is used to cotransfect insect cells for production of BEVs by allelic replacement. This ligation-independent cloning approach is also called "direct" cloning. However, a transfer plasmid serves as an intermediate, which differentiates this approach from truly direct cloning by Hgation of a DNA fragment encoding a protein of interest with restriction-digested viral DNA (Lu and Miller, 1996;

Ernst et al, 1994; and below).

One of the biggest challenges faced in using any expression system is purification of the overexpressed heterologous protein. This has led to the development of various generic protein purification methods (Ford et al, 1991). The usual approach is to design the expression vector to include a short nucleotide sequence which encodes a short amino acid sequence that can be used as an affinity "tag" to purify any protein. The sequence encoding

the protein of interest is inserted into the vector in such a way that it will be expressed as a fusion protein with the affinity tag on its N- or C-terminus. Then, the fusion protein can be solubilized and affinity-purified with a reagent that specifically recognizes and binds to the tag. A problem with this approach is that the affinity tag sometimes interferes with the biological activities of the protein of interest. Hence, some vectors also include sequences which encode a short amino acid sequence between the affinity tag and the protein of interest that can be specifically cleaved by treating the purified fusion protein with a protease.

A variety of different transfer plasmids have been constructed and used to isolate BEVs that produce affinity-tagged proteins. Many different affinity tags have been used in the BEV system. Various affinity tags can be used effectively in this system to purify recombinant proteins to varying degrees, ranging from about 80% to homogeneity. Also, antibodies against some affinity tags can be used to monitor the expression and localization of foreign proteins in BEV-infected insect cells by immunocytochemical techniques. This idea has been taken one step further with the development of transfer plasmids that can be used to produce BEVs which encode fusion proteins containing a naturally fluorescent protein, such as green fluorescent protein (Pharmingen catalog). Fluorescent protein tags permit direct visualization of the fusion protein in unfixed BEV-infected cells with a fluorescence microscope. Some transfer plasmids include sequences that encode signal peptides which can mediate secretion of a foreign protein from BEV-infected insect cells. The coding sequence of interest is inserted downstream and in-frame and the resulting construct encodes the protein of interest with a cleavable N-terminal signal peptide. The signal peptides used to direct secretion are sometimes derived from insect glycoproteins, including honeybee prepromellitin (Tessier et al, 1991) and baculovirus gp64 and egt (Murphy et al, 1993) and it has been found that insect-derived signal peptides can increase the efficiency of secretion of some recombinant proteins from BEV-infected insect cells. However, mammalian signal peptides also can be used, sometimes with better success, to direct secretion of recombinant proteins in this system (Mroczkowski et al, 1994; Jarvis et al, 1993; Andersons et al, 1991). Some transfer plasmids provide both an N-terminal signal peptide and a C-terminal

affinity tag to facilitate purification of recombinant proteins from the growth medium (Kuhn and Zipfel, 1995).

Additionally, some transfer plasmids can be used to produce BEVs that will express a foreign protein which can be incorporated into the envelope of recombinant BV particles (Boublik et al, 1995). These BEVs are eukaryotic versions of bacteriophage "display" vectors, which have been used to select rare recombinants from mixed virus populations by using ligands that bind to the protein of interest (Winter et al, 1994). The transfer vectors contain the sequence encoding gp64, the major BV envelope glycoprotein embedded within polh flanking sequences. The sequence encoding the protein of interest is inserted between the sequences encoding the signal peptide and mature portions of gp64. The resulting plasmid is used for allelic replacement of polh to produce a BEV that will express the protein of interest as a fusion protein which can be incorporated into the BV envelope and "displayed" for interactions with specific ligands or antibodies.

2. Sequences Encoding Foreign Proteins

The promoter in the transfer plasmid is only one component of the chimeric gene that must be assembled and inserted into the baculovirus genome in order to produce a BEV by allelic replacement. Another requirement is the sequence encoding the protein of interest, which could be either a cDNA or genomic DNA sequence. The vast majority of BEVs contain cDNA inserts, but there are a few reports of BEVs that contain and can express foreign DNA sequences containing introns (Davrinche et al, 1993; Iatrou et al, 1989; Jeang et al, 1987) and at least one baculovirus gene has introns that are removed by splicing in infected insect cells (Kovacs et al, 1991; Chisholm and Henner, 1988). However, there is evidence that RNA splicing is very inefficient at late times of baculovirus infection (Kovacs, et al, 1991) and it has been reported that a human papillomavirus gene failed to be spliced when expressed in the BEV system (Park et al, 1993). Thus, it is probably prudent to use cDNAs to construct BEVs.

Publication of the entire AcMNPV nucleotide sequence was accompanied by the identification of 337 open reading frames of at least 150 bp in length (Ayres, et al, 1994). Among these, 154 were included in a selected set deemed most likely to be expressed during oaculovirus infection. Analysis of the predicted translational initiation sites in this

selected set of open reading frames revealed that 41% did not conform to Kozak's rules (1986). This might indicate that biosynthesis of some viral proteins is down-regulated by the absence of an optimal translational initiation site. Or, it might indicate that Kozak's rules do not accurately define the signals required for optimal translational initiation in baculovirus-infected insect cells. The latter interpretation is supported by experimental evidence which showed that Kozak's rules could be broken with no reduction in the levels of foreign protein produced by a BEV (Hills and Crane-Robinson, 1995).

Furthermore, three different proteins were expressed at higher levels by BEVs when fused to a bacterial leader sequence that had a pyrimidine instead of a purine at position -3 relative to the initiation codon (Peakman et al, 1992a). A putative baculovirus translational initiation consensus sequence has been elucidated by computer analysis of 23 viral genes and this sequence includes a purine at position -3 (Ranjan and Hasnain, 1995). However, considering the experimental observations cited above, it is difficult to know how accurately this consensus sequence defines a translational initiation site in the BEV system. Overall, it seems that the rules governing translational initiation in this system remain unclear.

Similarly, analysis of codon usage in the selected set of AcMNPV open reading frames revealed some bias, but it is not clear whether this influences the levels of foreign protein production in the BEV system (Ayres, et al, 1994).

One clear finding is that AUU can sometimes serve as an inefficient translational initiation codon in baculovirus-infected insect cells (Beames et al, 1991). This was discovered when a BEV was used to express hepatitis B virus core protein and about one- fifth of the end-product had a polh amino acid sequence fused to its N-terminus. The BEV had been produced with a transfer plasmid in which the polyhedrin ATG was changed to ATT and the sequence encoding the core protein, which had its own ATG, was inserted downstream and in-frame. It was discovered that the fusion protein was produced as a result of translational initiation at the upstream ATT (AUU in the transcript). This problem might be related to the fact that the AUU was located in precisely the same position formerly occupied by the polh AUG and, in any case, it can be avoided simply by cloning coding sequences out-of-frame with respect to this upstream ATT or by using a transfer plasmid that does not have the ATT in this position.

The chimeric gene in a BEV also must have appropriate signals for transcriptional termination and RNA processing. These signals might be included in the 3' untranslated region of the foreign sequence inserted into the transfer plasmid. Or, they can be provided by the transfer plasmid itself, which includes the 3' untranslated region of the polh gene. mRNA processing signals have not been extensively analyzed in the baculovirus system, but several baculovirus genes, including polh, contain the 3' motif (AAUAAA) that serves as a polyadenylation signal in higher eukaryotes (Westwood et al, 1993). As in higher eukaryotes, this motif alone is insufficient for mRNA processing in baculovirus-infected insect cells. Also, heterologous mRNA processing signals from the SV40 early region or a rabbit β-globin gene have been included in some transfer plasmids and are functional in the

BEV system (Westwood, et al, 1993). These findings suggest that baculovirus-infected insect cells and higher eukaryotes have the same or similar mechanisms for transcriptional termination and mRNA processing.

3. Viral DNAs for Allelic Replacement

Besides the transfer plasmid, the other critical component in an allelic replacement reaction is baculoviral DNA. Baculoviral DNA is usually isolated from BV particles partially purified from the extracellular medium of wild-type baculovirus-infected insect cells, as described elsewhere (Richardson, 1995; O'Reilly, et al, 1992; Summers and Smith, 1987). Historically, a major problem with using wild-type viral DNA to isolate BEVs was that the frequency of allelic replacement is low and many investigators had trouble finding recombinant virus plaques among the high background of parental virus plaques. This problem was addressed by incorporating marker genes into transfer plasmids, as described above. However, this approach did not reduce parental virus background. This problem was solved by the development of linearizable viral DNAs that could be used as the targets for allelic replacement. The first linearizable viral DNA was created by constructing an occlusion-negative recombinant virus with a unique Bsu36I site in the polh region (Kitts et al, 1990). The circular genomic DNA from this recombinant could be linearized by digestion with Bsu36I, which significantly reduced its infectivity. Thus, when linearized viral DNA is mixed with a transfer plasmid and used to cotransfect insect cells, the recircularized recombinant viral DNAs produced by allelic replacement have a strong

replicative advantage over the linear parental DNA molecules. The net result is an increase in the maximum efficiency of BEV production from about 1% to about 30%. An occlusion- positive linearizable viral DNA has been described that provides the same high efficiency of BEV production while preserving the ability to identify recombinants by using the classic visual screen (Hartig et al, 1992). There also is a viral DNA that can be linearized at a unique Bsu36I site in the pi 0 region and used for high efficiency production of BEVs with allelic replacements in that region (Martens et al, 1995).

The development of linearizable viral DNAs was followed by the development of a viral DNA that can provide even higher efficiencies of BEV production (Kitts and Possee, 1993). This viral DNA has an E. coli lacZ insert in the polh region and Bsu36I sites in the two flanking genes on each side. Therefore, Bsu36I digestion actually deletes a fragment of the viral DNA, including part of the ORF 1629 gene located downstream of polh, which encodes an essential nucleocapsid-associated phosphoprotein (Vialard and Richardson, 1993). This effectively inactivates the viral DNA, but it can be rescued by homologous recombination with the transfer plasmid, which simultaneously introduces the coding sequence of interest, restores ORF 1629, and recircularizes the viral genome. The efficiency of BEV production with these Bsu36I-gapped viral DNAs is routinely over 90%.

Another type of baculovirus DNA that is currently being developed as a target for allelic replacement is one in which various "auxiliary" genes have been deleted (Bishop, et al, 1995). These genes encode proteins that are needed for baculoviruses to infect insect larvae, but are nonessential for the replication of these viruses in cultured insect cells. The idea behind the development of these viral DNAs is that expression of the auxiliary genes might interfere with the production of a protein of interest by a BEV. For example, it would be a good idea to delete the baculoviral cathepsin-like protease gene, as this protease could degrade some BEV -expressed recombinant proteins. Similarly, deletion of the viral protein phosphatase gene (Kim and Weaver, 1993) might improve the quality of phosphoproteins produced in the BEV system.

4. Producing BEVs by Allelic Replacement After being subcloned into an appropriate transfer plasmid or annealed to a ligation- independent transfer plasmid, a sequence encoding a protein of interest is incorporated into the baculovirus genome by mixing it with viral DNA and transferring the mixture into

cultured insect cells, where allelic replacement can occur by homologous recombination, as discussed above. The production of BEVs by the allelic replacement method relies upon the homology between sequences flanking the polh (or pi 0) genes in the viral DNA and the same sequences flanking the gene of interest in the transfer plasmid. The frequency with which BEVs are produced by this method is determined by the choice of target viral DNA, as described above, and selectable markers are not usually used. However, some selectable markers have been used to increase the frequency of BEV production, including negative selection of parental viruses containing the herpes simplex virus thymidine kinase gene (Godeau et al, 1992) and positive selection of recombinant viruses containing neomycin resistance or p35 genes (Lerch and Friesen, 1993).

5. Isolating, Identifying, and Characterizing BEVs

The most common way to resolve the mixture of parental and recombinant baculovirus progeny obtained from cotransfected cells is by using a conventional viral plaque assay (Summers and Smith, 1987). However, limiting dilution (Reed and Muench,

1938) and fluorescence-activated cell sorting (Peng et al, 1993) also have been used for this purpose. The classic approach used to identify BEVs in viral plaque assays is direct visualization of occlusion-negative plaques, as described above. This screen can be used only if the parental virus had an intact polh gene and the transfer plasmid was designed to replace that gene. Other ways to identify BEVs in plaque assays are to do plaque-lifts with nucleic acid or antibody probes (Capone, 1989; Summers and Smith, 1987) or to rely on visualization of marker gene that was introduced during allelic replacement, as described above.

Conversely, BEVs produced using Bsu36I-gapped viral DNA can be tentatively identified by the loss of the lacZ marker in the parental viral DNA (Kitts and Possee, 1993).

When limiting dilution is used as the isolation method, BEVs are usually identified by using nucleic acid or antibody probes in dot-blot formats (Manns and Grosse, 1991; Pen et al, 1989; Summers and Smith, 1987). Finally, BEVs can be identified by direct sequencing (Slightom and Sieu, 1992; Wang and Fraser, 1991) or PCR™ analysis (Sisk et l, 1992; Malitschek and Schartl, 1991 ; Webb et al, 1991) of viral DNAs.

After a BEV has been isolated and identified by one of the above methods, it can be amplified in insect cells, titered, and used to produce the foreign protein of interest by infecting a fresh cell culture. However, it is important to carefully characterize BEVs before proceeding with foreign gene expression, as there are some traps in the isolation and screening process. The most serious trap is that recombinants are produced far more frequently by single crossovers than by allelic replacement, which requires a double crossover between the viral DNA and transfer vector (O'Reilly, et al, 1992). Single- crossover recombinants contain the entire transfer plasmid at a random site in the viral genome and are genetically unstable. Depending on which screening method was used, single crossover recombinants can be mistakenly identified as BEVs in which the target gene in the parental viral DNA has been properly replaced by the gene of interest. True allelic replacement must be confirmed by verifying the location of the inserted gene in the BEV genome and/or the absence of the gene it was intended to replace. This can be done by using any of several different methods to analyze the viral DNA, including restriction mapping, Southern blotting, or PCR™. Using linearized or gapped viral DNAs for BEV production minimizes the problem of single crossover recombination because double crossover recombination at the appropriate site is necessary to regenerate a circular viral DNA molecule that can efficiently replicate. However, single crossover recombinants can be obtained if digestion of the viral DNA is incomplete. Standard methods of protein analysis can be used to assess foreign protein production by BEV-infected insect cells. If expression levels are high, as expected, foreign proteins can be identified in electrophoretic profiles of total lysates prepared at late times after infection. In the best cases, this can be done simply by staining protein gels with Coomassie Brilliant Blue. More sensitive methods can be used to detect proteins produced at lower levels, including electrophoretic analysis of total protein lysates from radiolabeled cells, western blotting, radiolabeling and immunoprecipitation, or specific activity assays.

6. Alternative Ways to Produce BEVs

The development of new transfer plasmids and linearizable and gappable viral DNAs for the production of BEVs by allelic replacement significantly increased the rate and

efficiency and simplified the process of BEV production. Alternatives to the allelic replacement approach also have been developed to facilitate BEV production.

The first alternative method described for producing BEVs involved homologous recombination and selection of recombinant viral DNAs in yeast (Patel et al, 1992). A recombinant baculovirus was constructed with a yeast autonomous replication sequence, centromere, and selectable marker in the polh region. This viral DNA was introduced into yeast, where it replicates as a stable, low copy number episome. A second marker, SUP4-o, which can be selected either for or against, was then added to produce the viral DNA molecule that serves as the target for homologous recombination. Recombination occurs when yeast cells containing this viral DNA are transfected with a transfer plasmid designed to replace the SUP4-0 marker with a sequence encoding the foreign protein of interest. Yeast transformants are counterselected for the absence of SUP4-0 and used as a source of the recombinant viral DNA, which can be isolated and transfected onto insect cells to produce BEVs. Another alternative method that can be used to produce BEVs is enzymatic recombination with the Cre-lox system (Peakman et al, 1992b). These investigators constructed a recombinant baculovirus and transfer plasmid with LoxP sites that can mediate site-specific in vitro recombination by purified Cre recombinase. This method produces recombinant viral DNAs at a frequency of up to 50% and BEVs can be isolated by cotransfecting insect cells and resolving the recombinant and parental progeny by plaque assay. BEVs can be identified by the presence of a lacZ marker donated by the transfer plasmid. This approach provided a way to produce BEVs with high frequency before gapped viral DNAs became available. It also circumvents the single crossover problem associated with conventional allelic replacements in vivo. Site-specific transposition of a foreign coding sequence into the baculovirus genome is another method that can be used for highly efficient and rapid production of BEVs (Luckow et al, 1993). This approach requires the use of a "bacmid", which is a recombinant baculoviral DNA containing a mini-F replicon, selectable marker, and Tn7 transposition site. Thus, a bacmid can replicate autonomously in E. coli and strains harboring the bacmid and a helper plasmid that encodes the Tn7 transposase functions can be used to produce BEVs. This is done by introducing a donor plasmid containing the

desired cDNA sequence and a second selectable marker positioned between the left and right arms of Tn7. The transposition functions provided by the helper plasmid will move the cDNA and selectable marker from the donor plasmid to the bacmid. This produces a recombinant bacmid that can be selected, isolated, and transfected onto cultured insect cells to produce BEVs. The bacmid system is available commercially from Life Technologies

(Gaithersburg, MD). In addition, a modified bacmid system that uses an E. coli host strain with an occupied Tn7 attachment site and a temperature-sensitive selection step has been described (Leusch et al, 1995).

Finally, baculovirus DNAs designed for the direct insertion of a foreign gene into unique cloning sites have been described (Lu and Miller, 1996; Ernst, et al, 1994). Due to their large size (-130 Kb), it is difficult to construct viral DNAs with unique restriction sites and to efficiently ligate linearized viral DNA with a foreign DNA fragment in vitro. However, due to the replicative advantage enjoyed by the recircularized viral DNA, direct cloning can be used successfully for highly efficient production of BEVs. Direct cloning of cDNAs into baculovirus vectors containing an appropriate promoter upstream of the insertion site has been proposed as a way to produce baculovirus-based cDNA expression libraries (Lu and Miller, 1996).

C. Using BEVs 1. Expression Levels

The ability to produce foreign proteins at exceptionally high levels is one of the hallmark features of the BEV system. These high production levels mainly reflect the ability of the transcriptional complex and polh promoter to produce large pools of mRNA during the very late phase of infection. Thus, BEVs that express a foreign coding sequence under the control of a different promoter will usually provide lower production levels. The production levels provided by polh-based BEVs are usually measured in the hundreds of mgs of recombinant protein per liter of infected cells (about 1 x 10 cells). However, this, crude generalization must be immediately qualified with a reminder that production levels vary widely from protein to protein. Secretory pathway proteins are produced at lower levels, often only 1 to 5 mg/liter of infected cells. The block to high-level production of secretory pathway proteins is probably post-transcriptional, as BEVs encoding these

proteins can produce large amounts of the foreign mRNA (Jarvis, et al, 1993). However, the nature of this block is unknown. Possibilities include saturation of secretory pathway functions, malfolding of newly-synthesized proteins, and adverse effects of baculovirus infection (Jarvis, et al, 1993; Jarvis and Summers, 1989). It is unlikely that high-level production of all secretory pathway proteins is blocked at one key step, however, because this system can produce some secretory pathway proteins at high levels. Finally, even though they produce less mRNA than the polh promoter, alternative promoters can sometimes produce larger amounts of biologically active secretory pathway proteins, as discussed above.

2. Hosts

Besides the protein to protein variation, production levels in the BEV system depend on the host being used (Hink et al, 1991). Historically, the most widely used hosts were the established insect cell lines IPLB-Sf21-AE ("Sf21 "), originally derived from Spodoptera frugiperda ovaries (Vaughn et al, 1977), and its clonal derivative, Sf9 (Summers and

Smith, 1987). However, in 1992 it was reported that BTI-TN-5B1-4, an insect cell line derived from Trichoplusia i eggs, provided higher levels of foreign protein production (Wickham et al, 1992). Subsequent studies on a larger sample of recombinant proteins generally supported this claim. As a result, BTI-TN-5B1 -4 cells, more commonly known as "High Five " cells (a tradename of InVitroGen), have become another widely-used host for

BEVs. Recent data suggest that subclones of yet another established insect cell line, BTI- EaA, derived from Estigmene acrea (Granados and Naughton, 1975), can provide more extensive N-glycosylation of foreign glycoproteins expressed by BEVs (Ogonah et al. , 1996). Thus, in addition to providing different levels of foreign protein production, different cell lines also can provide different levels of processing in the BEV system.

Insect cells must be perfectly healthy to provide optimal levels of BEV-mediated foreign protein production. This requires high quality growth media, routine subculturing, and careful monitoring of cell doubling times and viability's. Insect cell growth media are available from several different companies and serum-free media have been developed (Maiorella et al, 1988). Insect cell lines may be grown as monolayer cultures in T-flasks, as suspension cultures in shake flasks or spinner flasks, or as large-scaie cultures in stirred

tank or airlift bioreactors (Shuler et al, 1995; Weiss et al, 1995a; Weiss et al, 1995b). The development of scaleup methods was challenging because insect cells have an unusually high oxygen demand and large cultures must be aerated, but aeration can damage the cells because they are extremely sensitive to shear stress. This problem was solved when it was found that a nonionic surfactant, Pluronic F68, could protect insect cells from shear stress

(Maiorella, et al, 1988; Murhammer and Goochee, 1988). The physical and nutritive conditions needed for optimal foreign protein production by large-scale insect cell cultures have been studied extensively (Shuler et al, 1995; Taticek et al, 1994; Tramper et al, 1993). Among many other interesting results, it has been found that perfusion techniques can be used to obtain extremely high-density cultures (>5 x 10 cells/ml) that can produce larger amounts of recombinant protein (Deutschmann and Jager, 1994) and that oxygen demand rises even higher after baculovirus infection (Wong et al, 1994).

Two disadvantages associated with the use of established insect cell lines as hosts for foreign protein production by BEVs are that animal cell culture media are expensive and individual insect cell lines might not have all the protein processing capabilities found in higher eukaryotes (see below). Sometimes, these problems can be circumvented by using insect larvae as an alternative host. BmNPV has been extensively developed for this purpose and is commonly used as a BEV to express foreign proteins in silkworm larvae (Maeda, 1989; Maeda et al, 1985). Methods for rearing and infecting larvae have been described (Choudary et al, 1995; O'Reilly, et al , 1992). However, most investigators use established cell lines this method is more familiar and it is easier to purify recombinant proteins from cultured cells than from insect larvae. Moreover, although larvae are usually cheaper to cultivate than established insect cell lines, their use does not always solve protein processing problems (Pajot-Augy, et al, 1995).

3. Protein Processing

The other hallmark feature of the BEV system is its ability to process proteins. Biosynthesis of many eukaryotic proteins includes co- and/or post-translational processing, which can be critical for protein solubility and function, and insect cells have most of the protein processing pathways associated with higher eukaryotes. In fact, development of the

BEV system has contributed immensely to the knowledge of protein processing in insect

cells. Most reports of foreign protein production in the BEV system include structural analyses of the end-product and its covalent chemical modifications. These are often simple qualitative analyses designed to determine if a specific modification took place and whether there are gross differences in the structures of the recombinant and native proteins (e.g. differences in electrophoretic mobility). However, some studies include more detailed structural analyses, which have provided extremely valuable information on protein processing pathways in insect cells.

This information comes with a caveat, though, which is that it must be applied specifically to the protein processing pathway of a specific baculovirus-infected host. This is important because baculovirus infection probably alters cellular protein processing pathways in various ways (Velardo et al, 1993; Davidson et al, 1991 ; Murphy, et al, 1990;

Jarvis and Summers, 1989) and the specific protein processing capabilities of different hosts, including different insect cell lines, can be quite different (Ogonah, et al, 1996;

Kuroda et l, 1989). The chemical modifications found on many different recombinant proteins have been catalogued elsewhere (Luckow, 1991; Luckow and Summers, 1988). A few selected results that have provided the most definitive information are summarized below.

a. Proteolytic Cleavages Many secretory pathway proteins have short, N-terminal signal peptides that are proteolytically cleaved during biosynthesis. Signal peptide cleavage has been carefully evaluated by directly sequencing the N-termini of many different foreign proteins produced in the BEV system. The results indicate that insect cells can accurately remove native signal peptides of plant or animal secretory pathway proteins. Insect cells also can accurately cleave heterologous signal peptides that are encoded by some transfer plasmids and used to direct secretion, as discussed above. Thus, insect cells clearly have secretory signal peptide recognition and cleavage machinery. However, the relationship between this machinery and that of other eukaryotes remains unclear because some foreign signal peptides are nonfunctional in insect cells (Pajot-Augy, et al, 1995) and insect cell-derived signal peptides sometimes, but not always provide better secretion, as discussed above.

Many eukaryotic proteins also have prosequences, which are usua short amino acids sequences that need to be removed to convert a protein to its biologica: . active form. Prosequences may or may not be accurately and efficiently cleaved from foreign proteins produced in the BEV system. For example, the N-terminal prosequence of human tissue plasminogen activator was efficiently cleaved (Furlong et al, 1988), but the N-term..; prosequences of other proteins, including a frog alpha-amidating enzyme (Suzuki et a 1990), were not. The C-terminal prosequence of the gastrin-releasing peptide precursor was cleaved at the proper site, but also at several other sites (Lebacq-Verheyden et al, 1988). These problems probably reflect limiting levels of the appropriate proteases in baculovirus- infected insect cells, as well as differences in their substrate specificities.

Proteolytic cleavages at internal dibasic amino acid sites occur inefficiently in cultured insect cells. For example, influenza virus hemagglutinin (Kuroda et al, 1986) and HIV gpl60 (Hu et al, 1987) were cleaved slowly and/or inefficiently in the BEV system. This suggests that insect cell lines have limiting amounts of the kex-2 family of processing proteases needed for these internal cleavages. This conclusion is supported by the findings that hemagglutinin was cleaved more efficiently in insect larvae (Kuroda, et al , 1989) and gpl60 was cleaved more efficiently when furin is coexpressed in this system (Yamshchikov et α/ , 1995).

b. Glycosylation

Many eukaryotic proteins are modified by the covalent addition of carbohydrate side-chains. There are three well-defined protein glycosylation pathways in eukaryotic cells: N-glycosylation, O-glycosylation, and addition of O-linked N-acetylglucosamine (O-

GlcNAc; Montreuil, et al, 1995; Hart, 1992). Insect cells have all of these pathways, but they are not necessarily the same as those found in higher eukaryotes (Marz et al, 1995).

N-glycosylation begins with cotranslational addition of a preassembled oligosaccharide precursor, Glc ₃ Man ₉ GlcNAc ₂ , to a nascent polypeptide chain (Kornfeld and Kornfeld, 1985). The glucose residues are removed by glucosidases I and II to produce a "high mannose" side chain, which can be the finished end-product. In mammalian cells, however, high mannose side chains can be converted to "complex" structures. This requires class I α-mannosidases, which remove the α-l,2-linkeα mannose residues to produce

Man ₅ GlcNAc ₂ , GlcNAc transferase I, which adds a GlcNAc residue to produce GlcNAcMan ₅ GlcNAc ₂ , and α-mannosidase II, which removes two mannose residues to produce GlcNAcMan ₃ GlcNAc ₂ . This key intermediate is then elongated by glycosyltransferases that add GlcNAc, galactose, fucose, and sialic acid residues to complete the complex side chain.

The overall conclusion from most structural data on N-linked oligosaccharides from glycoproteins produced in insect cells, together with biochemical data on the processing activities of these cells, is that the insect cell N-glycosylation pathway is a truncated version of the mammalian pathway (Jarvis and Finn, 1995; Marz, et al, 1995; and references therein). Insect cells clearly can add N-linked precursors to newly-synthesized proteins and convert them to trimmed and fucosylated structures. But, these cells usually do not elongate the side-chains further to produce complex structures. Interestingly, insect cells have GlcNAc transferase I and II activities (Altmann et al, 1993; Velardo, et al, 1993), indicating that they should be able to add GlcNAc residues to the trimmed structures. This idea is supported by the finding that some glycoproteins produced in insect cells have N- linked side chains consisting of GlcNAcMan ₃ GlcNAc ₂ .

It has been proposed that GlcNAcMan ₃ GlcNAc ₂ is a transient intermediate needed for fucosylation and that the terminal GlcNAc is subsequently removed to produce the fucosylated Man ₃ GlcNAc ₂ structure seen on many insect cell-derived glycoproteins. This possibility is supported by the discovery that some insect cells contain a membrane-bound

N-acetylglucosaminidase activity (Altmann et al, 1995). Alternatively, if they have the requisite glycosyltransferases, insect cells could convert GlcNAcMan ₃ GlcNAc ₂ to complex structures with penultimate galactose and terminal sialic acids, like those produced by mammalian cells. This possibility is supported by structural data on two foreign glycoproteins produced in BEV-infected insect cells which showed that they had N-linked side-chains with terminal galactose (Ogonah, et al, 1996) or sialic acid (Davidson et al, 1990).

It has been proposed that the synthesis of complex N-linked oligosaccharide side chains by insect cells requires induction of cellular processing enzymes resulting from baculovirus infection (Velardo, et al, 1993; Davidson, et al, 1991 ). However, the total glycopeptide profiles of uninfected and infected Sf9 cells are similar (Kretzschmar et al. ,

1994) and it is generally thought that baculoviruses turn cellular gene expression off (Ooi and Miller, 1988). Another proposal is that only a select few recombinant glycoproteins can acquire complex N-linked side-chains due to special structural properties which make them excellent substrates for extremely low levels of glycosyltransferase activities or poor substrates for the processing N-acetylglucosaminidase in baculovirus-infected insect cells

(Jarvis and Finn, 1995).

Although they might have different N-linked oligosaccharide side-chains, most foreign glycoproteins produced in the BEV system are biologically active and antigenically authentic (Luckow and Summers, 1988). However, it has been shown that a recombinant human glycoprotein with insect cell-derived N-linked glycans is cleared more rapidly from the mammalian circulatory system (Sareneva et al, 1993). Another problem with N- glycosylation in the BEV system is that it can be inefficient, particularly at later times of infection, and the nonprocessed subpopulation of the protein of interest is often insoluble and/or inactive (Jarvis, et al, 1996; Murphy, et al, 1990). O-glycosylation occurs in the Golgi apparatus and results in the post-translational addition of relatively small glycans O-linked through N-acetylgalactosamine (GalNAc) to serine or threonine (Montreuil, et al, 1995). Structural analyses of recombinant O- glycosylated proteins produced in the BEV system reveal that the major O-linked side-chain consists of just the monosaccharide, GalNAc (Marz, et al, 1995). A subpopulation of these proteins have O-linked Gal-GalNAc, but the sialylated Gal-GalNAc trisaccharides produced by mammalian cells have not been detected. Further analysis showed that various insect cell lines have comparable levels of UDP-GalNAc:polypeptide GalNAc transferase activity, but different levels of UDP-Gal: GalNAc β-1,3 galactosyltransferase activity (Thompsen et al. , 1990). Sf9 cells have the lowest levels of the latter activity, which probably explains why GalNac is the major O-linked side-chain produced by these cells. Overall, the O- glycosylation pathway in baculovirus-infected insect cells appears to be incomplete, due to the absence of sialyltransferases, and inefficient, due to limiting levels of transferase activities.

Many proteins are post-translationally glycosylated by a cytoplasmic enzyme which adds a single GlcNAc via O-linkage to serine or threonine residues (Hart, 1992). This process is reversible and probably regulates the functions of many nuclear and cytosoiic

proteins. The BEV system clearly can add O-GlcNAc to foreign proteins, as demonstrated for mammalian keratins (Ku and Omary, 1994), nucleoporins (Bailer et al, 1995). and c- myc (Chou et al, 1995), among others. However, the addition of O-GlcNAc to one keratin was less efficient in this system than in mammalian cells.

c. Phosphorylation Phosphorylation is another reversible covalent chemical modification that can regulate protein function. Phosphorylation of many different foreign proteins has been documented in the BEV system. The more detailed studies have led to the general conclusion that foreign phosphoproteins can be accurately phosphorylated in this system, but phosphorylation of specific sites is sometimes inefficient. For example, the same sites were phosphorylated on SV40 large T-antigen produced in SV40-infected monkey or BEV- infected insect cells, but certain serine residues recognized by nuclear kinases were relatively underphosphorylated in insect cells (Hoss et al, 1990). Considering that T- antigen is localized in the nucleus of BEV-infected insect cells, it appeared that the levels of these kinases might be too low to process all of the T-antigen being produced by these cells. However, another factor to consider is that baculoviruses encode a protein phosphatase and kinase (Ayres, et al, 1994), which could alter the structures of recombinant phosphoproteins in unexpected ways. In fact, one recent study concluded that underphosphorylation of recombinant proteins in the BEV system may result from unusually high phosphatase activities rather than saturation of kinases with recombinant substrate (Fuchs et al, 1995). Another study showed that recombinant kinases involved in cellular signaling were activated by site-specific phosphorylation in the absence of kinases which lie upstream in the signaling pathway, probably by baculovirus-encoded or -induced kinase activity (Kozma et al, 1993). Finally, it is worth mentioning that various growth factor receptors expressed in the BEV system are accurately tyrosine phosphorylated, as this has led people to use this system to express multiple proteins that functionally reconstitute cellular signaling pathways (Agarwal et al, 1995).

d. Other Covalent Chemical Modifications

Acylation. Many eukaryotic proteins are modified by the addition of lipid side- chains, including myristate, palmitate, isoprenoids, and glycosylphosphatidylinositols (GPIs). Studies of various foreign proteins have shown that each of these lipid modifications can occur in BEV-infected insect cells. Myristylation is dependent on protein synthesis, occurs at the expected sites, and can produce side-chains with the expected structures, as shown by site-directed mutagenesis, hydroxylamine resistance, and direct structural analyses (Risinger et al, 1992; Delchambre et al, 1989). Palmitylation is independent of protein synthesis and can produce structurally authentic, hydroxylamine- sensitive side-chains, but it can be quite inefficient in BEV-infected insect cells (Veit et al,

1994; Page et al, 1989). One study showed that palmitylation is sensitive to pharmacological regulation, suggesting that the insect and mammalian cell pathways are similar (Mouillac et al, 1992). This conclusion is supported by the finding that palmitylation of some recombinant proteins produced in the BEV system is dependent upon prior isoprenylation, as in higher eukaryotes (Lowe et al, 1992). Isoprenylation is inefficient in BEV-infected insect cells, but occurs at the same recognition sites and produces the same side-chains, suggesting that prenyltransferase functions are conserved in insect cells and higher eukaryotes (Kalman et al, 1995; Buss et al, 1991). Finally, studies on several recombinant proteins, including human CD59 antigen (Davies and Morgan, 1993), have shown that BEV-infected insect cells can produce GPI anchors. Like many other types of protein processing provided by this system, GPI addition was inefficient, and large subpopulations of these products were unanchored and secreted into the extracellular growth medium.

N-terminal acetylation. N-terminal protein modifications are often a nuisance in protein sequencing projects, but N-acetylation is sometimes required for protein function.

The BEV system can produce N-acetylated proteins and this system was used to show that N-acetylation is required for the function of alpha tropomyosin (Urbancikova and Hitchcock-DeGregori, 1994). Another N-terminal modification that can occur in the BEV system is removal of an N-terminal methionine, followed by acetylation of the formerly penultimate alanine (Han et al. , 1995) or serine (Becker et al. , 1994).

C-terminal methylation. About half of the Kirsten-ras p21 protein produced in the BEV system was modified by C-terminal methylation, as well as isoprenylation (Lowe et al, 1991).

Alpha-amidation. Alpha-amidation is one of the few covalent chemical modifications that does not occur in BEV-infected Sf9 (Lebacq-Verheyden, et al, 1988) or other insect cell lines, including High Five (Vakharia et al, 1995). This covalent chemical modification results from a complex, multistep pathway which begins with proteolytic cleavage of a C-terminal prosequence, followed by the removal of additional amino acids to produce a C-terminal glycine. The glycine residue is then hydroxylated and amidated by two distinct activities. The C-terminal prosequence can be removed in BEV-infected insect cells, but alpha-amidation does not occur, suggesting that these cells lack a subsequent step(s) in this processing pathway. By contrast, alpha-amidation can occur in BEV-infected insect larvae (Hellers et al, 1991).

e. Supramolecular Assembly

Supramolecular protein assembly is one of the best-documented capabilities of the BEV system. Individual proteins can assemble into higher order structures via disulfide bond formation, which is virtually complete in some cases (Giese et al, 1989), but not in others (Domingo and Trowbridge, 1988). This indicates that BEV-infected insect cells have protein disulfide isomerase activity, but perhaps too little to completely process highly- expressed foreign proteins. Proteins also can assemble by noncovalent interactions in BEV- infected insect cells at rates similar to (Lanford, 1988) or lower than (Kuroda et al, 1991) native rates.

Hetero-oligomeric protein complexes can be assembled by infecting insect cells with multiple BEVs (St. Angelo, et al, 1987) or with a single BEV encoding multiple foreign genes (Emery and Bishop, 1987). Both of these approaches have been used to produce functional IgG heterodimers with normal heavy and light chain composition in the BEV system (Hasemann and Capra, 1990). The ability of this system to produce larger, even more complex oligomeric assemblies, including virus-like particles, is well-documented. Subviral particles consisting of hepatitis B virus, bluetongue virus, or rotavirus proteins were among the first to be described (Urakawa and Roy, 1988; Estes et al, 1987; Kang

et al, 1987). This was followed by an example of protein processing in which a BEV was used to express the poliovirus genome in insect cells and the resulting polyprotein was properly cleaved and assembled into stable, noninfectious poliovirus-like particles (Urakawa et al, 1989). These early studies led to widespread use of the BEV system to express multiple viral proteins and produce many different types of virus-like particles that hold great promise as noninfectious vaccines and diagnostic reagents (Pearson and Roy, 1993). Most recently, potential multivalent vaccines have been produced by incorporating heterologous epitopes into the virus-like particles or other supramolecular protein complexes that can be assembled in this system (Gamier et al, 1995b; Belyaev and Roy, 1992). Virus-like particles containing exogenous DNA also have been produced and used to efficiently transfer DNA into eukaryotic cells, indicating that these particles could be good tools for gene therapy (Forstova et al, 1995).

f. Protein Targeting

Protein targeting signals had not been widely investigated in insect systems when the BEV system was first developed, so it was not known whether insect cells would be able to recognize protein targeting signals in foreign proteins. Today, it is known that insect cells can recognize heterologous targeting signals, which suggests that these cells have similar protein trafficking machinery. Foreign proteins destined for secretion or the cell surface can enter the insect cell secretory pathway and native or heterologous signal peptides can be cleaved accurately, as discussed above. Polarized cell-surface expression of foreign proteins can occur in midgut epithelial cells of insect larvae (Kuroda, et al, 1989). Mitochondrial proteins localize to the mitochondria (Takagi et al, 1992) and nuclear proteins localize to the nuclei of BEV-infected insect cells and two baculovirus-encoded nuclear proteins contain nuclear targeting signals similar to those found in higher eukaryotes (Broussard et al, 1996; Jarvis et al, 1991). However, lysosomal enzymes produced in the BEV system lack the lysosomal targeting signal, mannose-6-phosphate, and are secreted by default (Boose et al, 1990; Martin et al, 1988). Biochemical assays indicate that Sf9 cells lack the phosphotransferase activity responsible for this modification (Aeed and Elhammer,

1994). A curious feature of protein trafficking in insect cells is that they secrete the

intracellular domain of rabbit prolactin receptor, which lacks a typical signal peptide (Gamier et al, 1995a). Furthermore, this domain can mediate secretion and ubiquitination of heterologous proteins, which suggests that lepidopteran insect cells have an unusual secretory pathway that can respond to this novel targeting signal.

g. Variation and the Art of Molecular Genetics

Structural analyses of recombinant proteins and biochemical analyses of cellular protein processing activities have produced a wealth of information on protein processing pathways in the BEV system. However, it is important to recognize the limitations of these biochemical approaches. They are indirect and provide only a retrospective view of protein processing pathways, which must be inferred from the structures of the end-products or the presence or absence of processing activities. These conclusions can be confused by degradative pathways, which might alter the product of the biosynthetic pathway and lead to misinterpretations. Also, the inability to detect a processing activity clearly does not prove the absence of that activity. Conclusions drawn from structural data on any one recombinant protein need to be applied only to that protein and not to the pathway in general. These conclusions also should be applied only to the specific host that was used to produce the recombinant protein under analysis. Finally, the possible effects of baculovirus infection on the host need to be considered. An alternative approach which circumvents many of these problems is to use molecular genetics to isolate genes encoding insect cell processing enzymes. This makes it possible to study these genes, their expression, the conditions that influence their expression, and, ultimately, the properties of the enzymes they encode. Examples herein below detail the isolation and characterization of class I and II α-mannosidase cDNAs from Sf9 cells.

Overall, the biochemical evidence suggests that foreign proteins can be appropriately processed in the BEV system. However, it is important to recognize that there are some exceptions and caveats to this generalization. BEV-infected cell lines clearly lack certain protein processing capabilities, like alpha-amidation and lysosomal targeting. There also are clear differences in the structures of the N-linked glycans found on most recombinant glycoproteins produced in this system. Inefficient processing of recombinant proteins is a

common problem in the BEV system. Nonetheless, this problem does not preclude the use of this expression system because, if adequate yields of a perfectly processed recombinant protein can be obtained, a high background of unprocessed material can be irrelevant. The "inefficiency" of protein processing in this system might reflect adverse effects of baculovirus infection or the inability of the cellular processing machinery to cope with the high levels of foreign gene transcription provided by BEVs. There also might be subtle differences in the protein processing machinery of insect cells and higher eukaryotes, which reduce the functional efficiency of foreign protein processing in this expression system. Theoretically, any of these protein processing problems can be addressed by metabolic engineering, which could be used to improve the BEV system, as discussed further below.

4. Selected Applications of BEV-Expressed Proteins a. Vaccines

One of the best-recognized applications of the BEV system is vaccine production. There are far too many examples of this application to discuss here and a comprehensive list with references is available (Luckow, 1991). However, it is appropriate to summarize some general conclusions and new discoveries that have arisen from immunological studies on recombinant proteins produced in this system. Recombinant proteins from BEV-infected insect cells are invariably recognized by antibodies produced against the corresponding native proteins, indicating that they are antigenically authentic. Moreover, recombinant proteins from the BEV system usually induce protective immunity in laboratory animals. HIV gpl60 produced in this system has been used extensively for human clinical trials and the results indicate that this product is safe and immunogenic. Unfortunately, although gpl60 can induce both humoral and cell-mediated immune responses, these are usually weak, transient, and non-neutralizing. On the positive side, clinical trials on BEV-expressed recombinant gpl60 showed that it has a therapeutic effect in previously infected individuals and the new concept of "vaccine therapy" emerged from these results (Redfield et al, 1991). It also was found that stronger humoral and cell-mediated immune responses could be obtained by using a combined vaccine regimen involving priming with a live recombinant vaccinia virus encoding gpl60 and boosting with BEV-expressed recombinant gpl60

(Cooney et al, 1993; Graham et al, 1993).

b. Diagnostic Tests

Another exciting application of recombinant proteins produced in the BEV system is diagnostic testing. Recombinant proteins produced in the BEV system have been used to develop diagnostic tests for many different infectious agents, including viruses, protozoa, rickettsia, and bacteria, as well as tests for human autoantibodies and cancer markers. Diagnostic testing with recombinant proteins from the BEV system has progressed beyond the developmental state, as these proteins have been used for several large epidemiological studies (Numata et al, 1994).

c. Three Dimensional Structural Analyses

The BEV system is being used with increasing frequency to produce recombinant proteins for three dimensional structural analyses. Rat acid phosphatase was one of the first recombinant proteins to be crystallized (Vihko et al, 1993) and, subsequently, many recombinant proteins have been crystallized and analyzed by x-ray diffraction. In addition, the three-dimensional structures of many of the virus-like particles produced in this system have been examined by x-ray crystallography (Roy, 1996; Agbandje et al, 1991) and electron cryomicroscopy (Prasad et al, 1994).

D. Preventing Adverse Effects of Baculovirus Infection

BEVs ultimately kill the host that is producing the foreign protein of interest. Thus, recombinant protein production with the BEV system is a "batch" process and fresh cells and virus must be used to produce each batch of recombinant protein. BEVs also have adverse effects on host protein processing pathways long before they kill the cells and encode at least one protease and phosphatase that might degrade or dephosphorylate the foreign protein being produced.

One way to address these problems is to use viral promoters to develop insect cell expression systems that avoid using a BEV altogether. This can be done by producing stably-transformed insect cells that express a foreign gene constitutive ly under the control of baculovirus early promoters (Jarvis, et al, 1990). The production levels obtained with transformed insect cells are usually lower than those obtained by infecting insect ceils with

polh-ha ed BEVs. However, where polh-hased BEVs fail to produce high levels of a foreign protein, as in the case of many secretory pathway proteins, transformed insect cells can provide similar levels of recombinant product. Furthermore, stably-transformed cells can produce these proteins continuously over a long time period and process them faster and more efficiently than infected cells. Thus, stably-transformed insect cells hold promise for foreign protein production, but this approach would be significantly more attractive if it could provide higher production levels. This may be accomplished by developing gene amplification methods or using stronger promoters.

Another way to circumvent the adverse effects of baculovirus infection is to develop BEVs that can provide high-level foreign gene expression without the cytopathic effects.

One example is a "miniviral replicon": a baculovirus-based DNA molecule encoding only the cis- and trans-acting functions needed for autonomous replication and transcription of strong viral promoters in insect cells. This replicon lacks all other viral functions. It replicates as an episome and produce a foreign protein(s) of interest at high levels, but has no adverse side-effects on the host cell and produce no progeny virus. Efforts to identify the functions required for baculovirus DNA replication and late/very late transcription are proceeding at a rapid pace. Thus, these efforts may lead to the development of a miniviral replicon expression vector.

E. Metabolic Engineering

Another reason for the relatively lower levels of secretory pathway protein production in baculovirus-infected insect cells is that host protein processing activities might be saturated. If specific cellular processing activities are limiting, it should be possible to improve the system by "metabolic engineering" to increase available levels of these activities. One approach would be to use insect cells that have been stably- transformed to overexpress processing activities as modified hosts for conventional BEVs, as proposed previously (Jarvis, et αl., 1990). However, this approach is complicated by the unexpected finding that baculovirus infection shuts down expression of integrated genes, even when their expression is controlled by a viral promoter that is normally active throughout infection (Jarvis, 1993). An alternative approach is to use modified BEVs that include and can overexpress genes encoding cellular protein processing enzymes.

This latter approach was used to try to improve the assembly of steroid receptors (Alnemri and Litwack, 1993) and immunoglobulins (Hsu et al, 1994), both of which were inefficiently processed and formed insoluble protein aggregates when overexpressed in BEV-infected insect cells. Coexpression of the steroid receptors and hsp90 or hsp70 failed to enhance assembly and prevent aggregation. Coexpression of immunoglobulins with immunoglobulin binding protein produced higher levels of soluble intracellular immunoglobulin, but failed to increase secretion.

As provided herein by the present invention, metabolic engineering of protein glycosylation pathways is another way to improve the BEV system. Insect cell glycosylation pathways are modified by increasing the levels of existing processing activities or by adding new processing activities thought to be missing in these cells.

Modified host cells or modified viruses can be used for either purpose, as described herein.

II. Baculovirus Expression A. Vectors

Baculovirus expression vectors are useful tools for the production of proteins for a variety of applications (Summers and Smith, 1987; O'Reilly et al, 1992; also U.S. Patent Nos., 5,077,214 (Guarino and Jarvis) and 5,162,222, (Guarino and Jarvis), each incorporated herein by reference). Baculovirus expression vectors are recombinant insect vectors in which the coding region of a particular gene of interest is placed behind a promoter in place of a nonessential baculoviral gene. The classic approach used to isolate a recombinant baculovirus expression vector is to construct a plasmid in which the foreign gene of interest is positioned downstream of the polyhedrin promoter. Then, via homologous recombination, that plasmid can be used to transfer the new gene into the viral genome in place of the wild-type polyhedrin gene (Summers and Smith, 1987; O'Reilly et al, 1992).

The resulting recombinant virus can infect cultured lepidopteran insect cells or larvae and express the foreign gene under the control of the polyhedrin promoter, which is strong and provides very high levels of transcription during the very late phase of infection. The strength of the polyhedrin promoter is an advantage of the use of recombinant

baculoviruses as expression vectors because it usually leads to the synthesis of large amounts of the foreign gene product during infection.

Ironically, while it is an advantage of conventional baculovirus expression vectors, the present inventor reasoned that the use of the polyhedrin promoter also presents some clear limitations. These limitations stem from the fact that this promoter requires virus- encoded factors for its transcriptional activity that only become available during the very late phase of infection (Huh and Weaver, 1990; Passarelli and Miller, 1993; McLachlin and Miller, 1994; Lu and Miller, 1995; Todd et al, 1995; Xu et al, 1995). Thus, while the polyhedrin promoter ultimately can provide high expression levels, it cannot provide any expression until the viral replication cycle is nearly complete. This is undesirable for foreign glycoprotein production as evidence suggests that cellular glycoprotein processing pathways are compromised at late times of infection (Jarvis and Summers, 1989; Jarvis et al, 1990; Murphy et al, 1990).

B. Methods

The present invention contemplates the use of a vector comprising one or more eukaryotic oligosaccharide processing genes to modify the insect cell N-glycosylation pathway by directing the expression of heterologous processing enzyme(s). The one or more encoded enzyme(s) then function as part of the insect cell oligosaccharide processing machinery. This contributes to the production of a protein of interest that has a complex biantennary oligosaccharide structure containing penultimate galactose and terminal sialic acid residues, similar to that obtained from mammalian cell culture techniques.

The baculovirus expression vectors of the present invention also contemplate the use of additional promoter and enhancer elements, heterologous genes encoding proteins which aid in protein folding and/or other post translational modifications, and additional features which expand the breadth and utility of the current baculovirus expression vectors. Each of these features of the present invention will be discussed in greater detail below.

The present invention contemplates at least four different modes of using the novel baculovirus expression vectors. While each of the vectors will have common features, each of these modes of use requires different features to be incorporated into the vector of choice for the desired application.

1. Vectors for use in coinfection method

The first method of use contemplated for the present invention would take advantage of the heterologous coding sequence of interest already being cloned into a current baculovirus expression vector, behind a promoter. The present invention provides a second baculovirus expression vector, which in a preferred embodiment supplies all of the oligosaccharide processing enzyme coding regions required to produce a protein of interest with the desired oligosaccharide structure. These two vectors are used independently to make recombinant baculoviruses, which are then used to coinfect an insect cell host. This class of vector is the least complex, comprising only the common elements of all five classes. This class of vector comprises one or more oligosaccharide processing enzyme transcription unit(s), further comprising appropriate promoter and enhancer elements to achieve optimal temporal expression (discussed in greater detail below). These vectors further comprise expression unit(s) encoding protein(s) which aid in the protein of interest folding or being otherwise modified properly in the cellular host. Additional embodiments of these vectors comprise 5' and 3' flanking DNA segments, for directing the replacement of the recombinant baculovirus expression vector into the baculovirus host. These vectors further comprise baculovirus structural genes and promoters, providing a method to identify recombinant baculoviruses, or providing essential gene function to the recombinant baculoviruses. Additional embodiments comprise selectable markers which can also be used to identify recombinant baculoviruses. These vectors are discussed in detail in Example 22 below.

2. Vectors for infection method The second method of use contemplated for the present invention comprises all of the features of the first vectors, and would further comprise a cloning site, preferably a multiple cloning site, for the insertion of the heterologous gene or cDNA encoding the protein of interest. A preferred embodiment of the second vectors would include a promoter element functionally positioned upstream of the multiple cloning site, and would further comprise an enhancer element to increase transcription of the heterologous coding region.

This vector is used alone to produce recombinant baculoviruses, which are used to infect an insect cell host. These vectors are discussed in detail in Example 22 below.

3. Additional vectors for infection method The third method of use contemplated for the present invention represents an improvement over the first vectors. In addition to comprising one or more oligosaccharide processing enzyme transcription unit(s) as described for the first vectors, these vectors further comprise features that allow for the more efficient insertion of one or more genes encoding any protein of interest, under the control of a promoter. The insertion is carried out using conventional baculovirus transfer plasmids and a conventional method involving linearization of the viral DNA by digestion with Bsu36I. The resulting recombinants, which are produced at a much higher efficiency than previous methods, are used to express the protein of interest during infection of conventional insect cell lines. These vectors are discussed in detail in Example 22 below.

4. Vectors that create a stably transformed insect cell line

The fourth method of use contemplated for the present invention produces a stable insect cell line, which incorporates all of the desired features of the first vectors. These vectors comprise all of the features of the first vectors, wherein the selectable marker provides the insect cell host resistance to a cellular toxin. The selectable marker which provides the insect cell host resistance to a cellular toxin can be either on the same vector as the rest of the elements, in which case the single vector would be transfected into the host cell, or on a separate vector from the rest of the elements, in which case co-transfection of the two vectors would be used. A further embodiment of the present invention comprises using multiple baculovirus expression vectors with different toxin resistance markers and different regions of their genomes replaced to stepwise or in combination stably incorporate all of the desired features described above into an insect cell line. The stably transformed insect cell line is then infected with baculoviruses produced from a standard baculovirus expression vector, wherein the heterologous coding sequence of interest is cloned behind a promoter. Further, these stable cell lines can also be used for infection with one or more of the novel recombinant baculoviruses described herein.

The particular features of the four classes of baculovirus expression vectors will now be discussed in greater detail.

III. Oligosaccharide Processing A. Oligosaccharide Processing Pathway

Insect cells and higher eukaryotes begin oligosaccharide processing along a similar pathway. Both add Glc ₃ -Man ₉ -GlcNAc ₂ precursors to appropriate recognition sites in nascent polypeptides followed by the trimming of glucose residues to produce Man ₉ - GlcNAc ₂ . The four α-l ,2-linked mannose residues are removed by "class I" α- marmosidases, producing a Man ₅ GlcNAc structure (Moremen et al, 1994). Following the addition of a single GlcNAc residue by N-acetylglucosaminyltransferase I, two more mannose residues are removed by α-mannosidase II, a "class II" mannosidase to produce GlcNAc-Man ₃ -GlcNAc ₂ (Moremen et al, 1994).

At this point in the pathway, insect cells and higher eukaryotes diverge. In higher eukaryotes, GlcNAc-Man ₃ -GlcNAc ₂ can be extended by N-acetylglucosaminyltransferase

II, galactosyltransferase, and sialyltransferase to produce a complex biantennary structure containing penultimate galactose and terminal sialic acid residues (Kornfeld and Kornfeld, 1985). However, in insect cells GlcNAc-Man ₃ -GlcNAc ₂ appears to be converted to Man ₃ - GlcNAc ₂ by a novel insect cell β-N-acetylglucosaminidase (Licari et al, 1993; Altmann et al, 1995; Wagner et al, 1996a). This final structure is found either with or without fucose linked to the chitobiose core (Butters and Hughes, 1981; Hsieh and Robbins, 1984; Ryan et al, 1985; Nagao et al, 1987; Kuroda et al, 1990; Chen et al, 1991; Wathen et al, 1991 ; Williams et al, 1991; Knepper et al, 1992; Grabenhorst et al , 1993; Yeh et al, 1993; Kubelka et al, 1994; Manneberg et al, 1994). The widely-used host cell lines for baculovirus vectors are Sf21 (Vaughn et al,

1977), Sf9 (Summers and Smith, 1987), and High Five (Wickham et al, 1992) and these are reported to have low levels of the glucosaminyltransferases I and II (Altmann et al, 1993; Velardo et al, 1993), but no galactosyl- or sialyltransferase activities. There are two reports of lectin blotting analyses which claim to demonstrate sialic acid on insect cell-expressed glycoproteins (Davis and Wood, 1995; Sridhar et al, 1993), but these are completely invalid as controls were not included to show that the lectins were binding to sugars. There

is one report of βl,4-galactosyltransferase activity in insect cells (Ogonah et al, 1996) and one group which has found penultimate galactose and terminal sialic acid on one human glycoprotein (Davidson et al, 1990; Davidson and Castellino, 1991a). However, it is clear that this observation is peculiar to the glycoprotein used in that study as it has not been convincingly demonstrated by any other researchers for any other glycoprotein in the intervening five years even though this is a highly desirable result. Thus, although insect cells are theoretically capable of producing oligosaccharide structures similar to those produced in higher eukaryotes, this has yet to yield practical benefits. The unpredictability of the glycosylation pattern for any given protein, and the differences in the glycosylation pattern from protein to protein are clear limitations of the current system.

B. Oligosaccharide Processing Genes

There are at least seven different enzymes responsible for the complete processing of

N-linked oligosaccharides to form a complex biantennary structure containing penultimate galactose and terminal sialic acid residues (FIG. 13). A table containing cloned glycosyltransferases, along with the source of the clone and the GenBank accession number is shown below (Field and Wainwright, 1995).

TABLE 1

Enzyme EC designation GenBank accession

Sialyltransferases α2 ,3 -sialyltransferase H. sapiens: cDNA X74570 α2,3-sialyltransferase H. sapiens: cDNA L23768 α2 ,3 - sialyltransferase H. sapiens: cDNA L23767 α2,3-sialyltransferase S.scrofa: cDNA M97753, M98463 α2.3-sialyltransferase R.rattus M97754 α2 ,3 -sialyltransferase M.musculus: cDNA X73523 α2, 3 -sialyltransferase M.musculus: cDNA X76988, X76988 α2,3-sialyltransferase M.musculus: cDNA D28941 α2,3-sialyltransferase G.gallus: cDNA X77775 α2,3-sialyltransferase G.gallus: cDNA X74946 α2,6-sialyltransferase H. sapiens A17362

Enzyme EC designation GenBank accession α2,6-sialyltransferase H.sapiens: cDNA XI 7247 α2,6-sialyltransferase H.sapiens: cDNA X62822 α2,6-sialyltransferase H..sapiens: cDNA S55693, S55689 α2,6-sialyltransferase H.sapiens: cDNA X54363 α2,6-sialyltransferase H.sapiens: cDNA LI 1720 α2,6-sialyltransferase H.sapiens: cDNA M38193 α2,6-sialyltransferase R.rattus: cDNA M83142, M83143, M83141 α2,6-sialyltransferase R.rattus: cDNA M73985, M73986, M73987 α2,6-sialyltransferase R.rattus: genomic M54999 α2,6-sialyltransferase R.rattus: cDNA Ml 8769 α2,6-sialyltransferase M.musculus: cDNA D16106 α2,6-sialyltransferase G.gallus: cDNA X75558 α2,8-sialyltransferase H.sapiens X77922 α2,8-sialyltransferase H.sapiens D26360

Sialyltransferase H.sapiens: cDNA U14550

Sialyltransferase H.sapiens: cDNA D 13972

Fucosyltransf erases a 1 ,2fucosyltransferase H.sapiens: cDNA M35531 α 1 ,2fucosyltransferase R.norwegicus: L26009, L26010 cDNA αl,3fucosyltransferase III H.sapiens: cDNA X53578 αl,3fucosyltransferase IV H.sapiens: genomic S52967, S52968 αl,3 ucosyltransferase IV H.sapiens L01698 αl,3fucosyltransferase VI H.sapiens: cDNA M98825 αl ,3fucosyltransferase VII H.sapiens: cDNA X78031 αl ,3fucosyltransferase VII H.sapiens: cDNA U081 12, U1 1282 α 1 ,3fucosyltransferase H.sapiens M65030 α 1 ,3 fucosyltransferase H.sapiens: genomic S65161

Enzyme EC designation GenBank accession α 1 ,3fucosyltransferase H.sapiens M81485 α 1 ,3 fucosy ltransferase H.sapiens: cDNA M58596, M58597 Galactosyltransferases α 1 ,3 galactosyltransferase H.sapiens: genomic J05421 α 1 ,3 galactosyltransferase H.sapiens M65082 α 1 ,3 galactosyltransferase H.sapiens M60263 α 1 ,3 galactosyltransferase H.sapiens J05421 α 1 ,3 galactosyltransferase B.taurus: cDNA J04989 α 1 ,3 galactosyltransferase M.musculus M26925 αl ,3 galactosyltransferase M.musculus: cDNΛ M85153 αl ,3 galactosyltransferase C.aethiops M73307 α 1 ,3galactosyltransferase P.paniscus M72526 α 1 ,3galactosyltransferase E.patos M73308 α 1 ,3galactosyltransferase G. gorilla M73304 α 1 ,3 galactosyltransferase M.mulatta M73306 αl ,3galactosyltransferase A.geoffrovi M73309 α 1 ,3galactosyltransferase P.pygmucus M73305 α 1 ,3 galactosyltransferase S.scieureus M73310 α 1 ,3 galactosyltransferase A. cur ay a M7331 1 βl ,4galactosy ltransferase H.sapiens: cDNA M22921. X14085 β 1 ,4galactosyltransferase H.sapiens: cDNA X51589 βl ,4galactosy ltransferase H.sapiens: cDNA X55415 βl ,4galactosyltransferase H.sapiens: cDNA XI 3223 β 1 ,4galactosyltransferase H.sapiens: cDNA U10472, U10473,

U 10474 β 1 ,4galactosyltransferase H.sapiens Ml 4624 β 1 ,4galactosyltransferase H.sapiens: genomic M70427,M70428,

M70429, M70430,

M70432, M70433 βl ,4galactosyltransferase B.taurus J05217

Enzyme EC designation GenBank accession β 1 ,4galactosy ltransferase B.taurus: cDNA M25398 βl ,4galactosyltransferase B.taurus: cDNA M13569 β 1 ,4galactosyltransferase B.taurus: cDNA X14558 β 1 ,4galactosyltransferase M.musculus LI 6840 βl ,4galactosy ltransferase M.musculus: cDNA D00314, D00315 β 1 ,4galactosyltransferase M.musculus: cDNA D37790, D37791 β 1 ,4galactosyltransferase M.musculus: M27917 through genomic M27923 β 1 ,4galactosyltransferase M.musculus M36289 β 1 ,4galactosyltransferase M.musculus J03880 β 1 ,4galactosyltransferase G.gallus: cDNA L12565 β 1 ,4galactosyltransferase G.gallus: cDNA X16336

Galactosyltransferase H.sapiens: cDNA M13701

Galactosyltransferase B.taurus: cDNA M13214

Galactosyltransferase R.norwegicus: L21698, S66862 cDNA

Galactosyltransferase R.norwegicus: U07683 cDNA

Galactosyltransferase C.elegans: genomic Z29095

Galactosyltransferase L.donovani: LI 1348 genomic

NAcetylglucosaminyltransferases

GlcNActransferaseN AG 1 PTase M.musculus: U03603 genomic

GlcN ActransferaseNAG 1 PTase M.musculus: cDNA X65603, S41875 GlcN ActransferaseNAG 1 PTase C.longicaudarus: J05590, M22755 cDNA

GlcNActransferaseNAG 1 PTase L.mexicana M96635 GlcN ActransferaseNAG 1 PTase S.cerevisiae Y00126

Enzyme EC designation GenBank accession

GlcN ActransferaseNAG 1 PTase S.pombe U09454 β 1 ,2GlcN Actransferase C.elegans: genomic Z46381 β 1 ,4GlcN Actransferase L.stagnalis: cDNA X80228 βl ,6GlcN Actransferase H.sapiens cDNA M97347 β 1 ,6GlcN Actransferase H.sapiens: cDNA Z19550, L19656 β 1 ,6GlcN Actransferase M.musculus: cDNA U 19295 β 1 ,6GlcN Actransferase C.elegans: genomic Z36752 β 1 ,6GlcN Actransferase C.elegans: genomic Z37092

GlcNActransferasel H.sapiens: cDNA M55621

G 1 cN Actransferasel H.sapiens: cDNA T08544

GlcNActransferasel H.sapiens M61829

GlcNActransferasel R.rattus: cDNA D 16302

GlcNActransferasel M.musculus: M73491 genomic

GlcNActransferasel M.musculus: L07037 genomic

GlcNActransferasel O.cuniculus: cDNA M57301

GlcNActransferasel C.elegans Z46381

GlcNActransferasell R.rattus: cDNA U21662

GlcNActransferasell H.sapiens: genomic U15128, L36537

GlcNActransferaselll H.sapiens D13789

GlcNActransferaselll R.rattus: cDNA D10852

GlcNActransferaseV H.sapiens: cDNA D17716

GlcNActransferaseV R.rattus: cDNA L14284

N-Acetylgalactosaminyltransferases αl ,3 GalNActransferase H.sapiens: cDNA J05173 α 1 ,3 GalN Actransferase H.sapiens: cDNA S44054 β 1 ,4GalN Actransferase H.sapiens: cDNA M83651

Protein: GalNActransferase B.taurus: cDNA L07780

Protein: GalNActransferase B.taurus: cDNA L17437, L16925

Enzyme EC designation GenBank accession

Mannosyltransferases

Mannosyltransferase C.elegans: cDNA M75918

Mannosyltransferase S.cerevisiae: LI 9169, LI 9700 genomic

Mannosyltransferase S.cerevisiae: L05146 genomic

Mannosyltransferase S.cerevisiae J04184 αl ,2mannosy ltransferase S.cerevisiae: cDNA M81 1 10 αl .όmannosy ltransferase S.cerevisiae: D11095 genomic β 1 ,4mannosyltransferase S.cerevisiae J05416, Z35979

Mannosyltransferase S.cerevisiae: LI 7083 genomic

Mannosyltransferase S.cerevisiae X62941

Mannosyltransferase S.cerevisiae X62647

Mannosyltransferase S.cerevisiae

Mannosyltransferase S.cerevisiae L23753

Mannosyltransferase S.cerevisiae L23752

Mannosyltransferase S.cerevisiae Z38059

Mannosyltransferase S.cerevisiae Z46728

The combination of α-glucosidase I and α-glucosidase II cleave the three glucose residues from the Glc ₃ -Man ₉ -GlcNAc ₂ precursors, α-glucosidase I and α-glucosidase II from eukaryotic sources are preferred for use in the present invention. The enzyme from Aspergillus oryzae (Minetoki et al, 1995) is an example.

The next step in the pathway is catalyzed by "class I" α-mannosidases, producing a Man ₅ GlcNAc ₂ structure. Eukaryotic α-mannosidase genes or cDNAs are generally preferred for use in the present invention. Those from yeast (Camirand et al, 1991), Aspergillus (Inoue et al, 1995), Penicillium (Yoshida and Ichishima, 1995), Drosophila (Kerscher et al, 1995), rabbit (Lai et al, 1994), mouse (Herscovics et al, 1994; Lai et al,

1994) and human (Bause et al, 1993) are examples. Particularly preferred is the α- mannosidase cDNA from Spodoptera (Example 6; SEQ ID NO:l).

Next, N-acetylglucosaminyltransferase I catalyzes the addition of a single GlcNAc residue to Man ₅ -GlcNAc ₂ . Genes or cDNAs encoding N-acetylglucosaminyltransferase I from eukaryotic sources are preferred for use in the present invention. Those from rabbit

(Sarkar et al, 1991), mouse (Pownall et al, 1992; Kumar et al, 1992), rat (Fukada et al,

1994) and human (Kumar et al, 1990) are examples.

The next step in the pathway is the removal of two more mannose residues by α- mannosidase II, a "class II" mannosidase to produce GlcNAc-Man ₃ -GlcNAc ₂ . Preferred for use in the present invention is α-mannosidase II from eukaryotic sources. Examples are the yeast vacuolar mannosidase (Yoshihisa and Anraku, 1989; Accession no. M29146), rat ER α-mannosidase (Bischoff et al, 1990; Accession no. M57547), mouse α-mannosidase II (Moremen and Robbins, 1991; Accession no. X61 172), human α-mannosidase II (Misago et al, 1995; Accession no. U31520), human α-mannosidase II ^X (Misago et al, 1996; Accession no. D55649) and Drosophila α-mannosidase II (Foster et al, 1995; Accession no.

X77652). Particularly preferred is the α-mannosidase II cDNA from lepidopteran insect (Sf9) cells (Example 6; SEQ ID NO:3).

Concomitant with the removal of the two mannose residues is the addition of a fucose residue, catalyzed by fucosyltransferase. Eukaryotic genes or cDNAs which encode fucosyltransferase are preferred for use in the present invention. The human cDNA (Larsen et al, 1990) is an example.

At this point, in insect cells, N-acetylglucosaminidase converts one of the intermediates in the oligosaccharide processing pathway to a structure which not a substrate for the enzymes which add the penultimate galactose and terminal sialic acid residues. Estigmene acrea lacks this enzyme (Wagner, 1 96a), which should lead to the accumulation of the intermediate which is a substrate for N-acetylglucosaminyltransferase II, the committed step in the production of complex oligosaccharide side chains containing penultimate galactose and terminal sialic acid residues. The inventor contemplates deleting the N-acetylglucosaminidase gene from a Spodoptera cell line using standard gene knockout techniques, or using antisense technology to reduce the levels of protein production in the insect cell.

The conversion of GlcNAc -Man ₃ -GlcNAc ₂ to GlcNAc ₂ -Man ₃ -GlcNAc ₂ is catalyzed by N-acetylglucosaminyltransferase II. Eukaryotic genes or cDNAs encoding N- acetylglucosaminyltransferase II are generally preferred for use in the current invention. Those from rat (D'Agostaro et al, 1995) and human (Tan et al, 1995) are examples. The next step in the pathway is the addition of a galactose residue to each branch of the oligosaccharide structure. This reaction is catalyzed by the enzyme βl ,4- galactosyltransferase. βl,4-galactosyltransferase genes or cDNAs from eukaryotic sources are preferred for use in the present invention. Those from mouse (Nakazawa et al, 1988), human (Masri et al, 1988; Chatterjee et al, 1995), rat (Bendiak et al, 1993) and Lymnaea stagnalis (Bakker et al, 1994) are examples. More preferred is the full-length cDNA encoding the short protein isoform of bovine βl ,4-galactosyltransferase (Harduin-Lepers et al, 1993; Russo et α/., 1992.

The final processing step in the formation of complex biantennary oligosaccharide structures is the addition of sialic acid residues to each galactose residue at the end of the oligosaccharide branches. This reaction is catalyzed by various sialyltransferases.

Eukaryotic cDNAs or genes encoding α2,6-sialyltransferase are preferred for use in the present invention. The human gene (Wang et al, 1993) is an example.

C. Oligosaccharide Gene Combinations The present invention provides to insect cells high levels of one or more of the enzymes needed to produce the complex oligosaccharide found in higher eukaryotes. A preferred method is by providing eukaryotic cDNAs or genes encoding α-glucosidase I, α- glucosidase II, α-mannosidase I, N-acetylglucosaminyltransferase I, α-mannosidase II, fucosyltransferase, N-acetylglucosaminyltransferase II, a galactosyltransferase and a sialyltransferase. A further embodiment is to provide various combinations of the coding sequences for these enzymes, to specifically design the oligosaccharide pattern of choice. A particularly preferred embodiment is to provide eukaryotic cDNAs or genes encoding the enzymes which are barely detectable or absent in insect cells, N- acetylglucosaminyltransferase I, N-acetylglucosaminyltransferase II, βl,4- galactosyltransferase and sialyltransferase.

It will be understood that where the use of two or more oligosaccharide processing genes is contemplated, the genes may be combined in the vector in any desired combination. There is no requirement for any particular gene to be inserted before or after any other particular gene, when considering the DNA sequence in the 5' to 3' direction. One may therefore insert two or more genes into the vectors of the present invention in any order that is convenient, as may be determined by different cloning strategies or restriction enzyme sites.

In embodiments of the invention where different promoters are used to express two or more oligosaccharide processing genes, it may be preferred in certain embodiments to use a baculovirus early promoter to express genes that encode protein products that act at earlier steps in the glycosylation pathways. This may be useful in ensuring that the required partially processed recombinant polypeptide is available to act as a substrate for the processing enzymes that catalyze subsequent steps in the overall pathway. However, it will be understood that this is by no means a limitation of the present invention and is simply provided as one embodiment thereof.

D. Assays for the Effects of Glycosylation on Protein Substrates

While it is known that glycosylation of a protein in general can alter the functional aspects of the protein (Welply, 1991), delineation of the precise effects of individual glycosylation steps requires the use of enzyme inhibitors (Elbein, 1991 ), for example tunicamycin, castanospermine (which inhibits glucosidase I), deoxymannojirimycin (which inhibits α-mannosidase I) or swainsonine (which inhibits α-mannosidase II; Moremen et al, 1994). However, some of the enzymes in the oligosaccharide processing pathway have no known inhibitors. The present invention provides a method for using conventional and modified baculovirus expression systems to study the influence of N-linked oligosaccharide processing on glycoprotein function. Example 14 shows that there was no significant difference in the in vitro growth properties of wild type AcMNPV and an immediate early recombinant expressing βl,4-galactosyltransferase, which contained nongalactosylated and galactosylated gp64, respectively. This approach can be used to produce nongalactosylated and galactosylated versions of any recombinant glycoprotein for interesting functional comparisons. This is an important application because there are no

specific βl,4-galactosy ltransferase inhibitors that can be used to study the function of this late step in N-linked oligosaccharide processing.

The present invention provides for sequential addition of oligosaccharide residues to a protein of interest by adding additional processing enzyme coding units into the baculovirus expression vector. A preferred embodiment of the present invention is to use vectors that contain step-wise additions of N-acetylglucosaminyltransferase I, N- acetylglucosaminyltransferase II, βl,4-galactosyltransferase and sialyltransferase expression units, to study the effect of adding N-acetylglucosamine, galactose and sialic acid on protein function. It will be therefore understood that it is not a requirement of this invention to produce one or more recombinant proteins that are modified exactly in the manner that the counteφart mammalian or human protein appears in its natural environment. Even where a functional protein with complete or moderate biological activity is desired, it may still be the case that the glycosylation pattern does not have to directly correspond to that of the natural protein. Proteins that are modified to any degree further than those previously expressed in insect cells will naturally represent an advance in this technology. Proteins that more closely resemble the naturally occurring mammalian or human proteins will, of course, be preferred in many embodiments.

However, as outlined above, it is not always required or even desired to produce a protein with complete or even substantial biological activity. In fact, in terms of identifying inhibitors of particular glycosylation enzymes, all that is required is to produce a protein which may be analyzed to determine which sugar groups it contains. This provides a ready means for conducting screening assays to identify various inhibitors.

To conduct such a screening assay, one would generally provide to an insect cell a particular glycosylation enzyme and test the effect of the enzyme on a protein from the cell that lends itself to ready analysis. The glycosylation enzyme for use in such embodiments will be chosen so that it catalyzes a glycosylation step that is not readily conducted in the natural insect cell. Expression of the enzyme will thus result in a protein with a different glycosylation pattern. Once this has been confirmed, the recombinant insect cell can then be exposed to a "candidate substance". A candidate substance that reduces the level of the newly modified protein, and results in the production of larger amounts of proteins that

correspond to those produced in natural insect cells, will then be identified as having the ability to inhibit the expressed glycosylation enzyme and is therefore categorized as a "inhibitory substance".

IV. Genes Which Encode Accessory Proteins That Aid in Protein Folding

The proper folding of a protein into its correct three-dimensional structure is important for the proper function of the protein. For large, glycosylated proteins, folding in vivo is a complex process that requires other proteins. Many of these proteins belong to families which are evolutionarily conserved. These protein families fall into two major classes (Gething and Sambrook, 1992, incorporated herein by reference, including the incorporation of each of the references cited therein). The first class includes enzymes which catalyze isomerization reactions which are rate limiting in the folding process of some proteins. The second class includes chaperone proteins which associate with other proteins during the folding process to prevent the formation of incorrect intermediate structures.

There are two rate determining steps in the in vitro folding of proteins, thiol/disulphide interchange reactions and proline cis-trans isomerization. These reactions are catalyzed by protein disulphide isomerase and peptidyl prolyl cis-trans isomerase, respectively. Protein disulphide isomerase has been described from a number of sources, including E. coli, plants, yeast, Drosophila and higher eukaryotes. Likewise, peptidyl prolyl cis-trans isomerase has been detected in both prokaryotes and eukaryotes.

Protein chaperones generally fall into three major classes, which are all highly conserved between plants, prokaryotes and eukaryotes. These classes are referred to as chaperonin-60, stress-70 and stress-90 (Gething and Sambrook, 1992). Examples of proteins which belong to the chaperonin-60 class are E. coli GroEL and the yeast and mammalian Hsp60. Representatives of the stress-70 class are E. coli DnaK and the BiP/GRP78 homologs from plants, yeast (Normington et al, 1989), Drosophila (Rubin et al, 1993), and higher eukaryotes such as rat (Munro and Pelham, 1986) and hamster (Ting et al, 1987). The stress-90 class is represented by Hsp83 from Drosophila, yeast and mammals, and the Gφ94 protein from mammals.

A potential method of improving protein processing in insect cells is by providing increased levels of proteins which assist in protein folding in the cell. For example, it has been demonstrated that coexpression of BiP (GRP78) resulted in an increase in the intracellular levels of functional immunoglobulin IgG (Hsu, 1994). However the promoter used in the previous example was the very late polyhedrin promoter.

The present invention contemplates the administration of proteins such as protein disulphide isomerase, peptidyl prolyl cis-trans isomerase and chaperone proteins, either alone or in conjunction with the oligosaccharide processing enzymes. A preferred method is by providing eukaryotic cDNAs or genes encoding eukaryotic protein disulphide isomerase, peptidyl prolyl cis-trans isomerase and chaperone proteins. Another preferred embodiment is a eukaryotic BiP/GRP78 gene. A particularly preferred embodiment is a eukaryotic BiP/GRP78 gene functionally positioned downstream from a baculovirus immediate-early promoter. The present invention further contemplates the cloning of the insect ho olog of BiP/GRP78 (see section XI below). After identifying an appropriate DNA molecule, it may be inserted into any one of the many vectors in the present invention.

The present invention additionally contemplates the administration of additional protein modification enzymes, such as those involved in phosphorylation, acylation, acetylation, methylation and amidation, as described in Section I above.

V. Promoters and Enhancers

The promoters and enhancers that control the transcription of protein encoding genes in eukaryotic cells are composed of multiple genetic elements. The cellular machinery is able to gather and integrate the regulatory information conveyed by each element, allowing different genes to evolve distinct, often complex patterns of transcriptional regulation. The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of

DNA, and containing one or more recognition sites for transcriptional activator proteins.

At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV 40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between elements is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between elements can be increased to 50bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.

Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Aside from this operational distinction, enhancers and promoters are very similar entities.

Promoters and enhancers have the same general function of activating transcription in the cell. They are often overlapping and contiguous, often seeming to have a very similar modular organization. Taken together, these considerations suggest that enhancers and promoters are homologous entities and that the transcriptional activator proteins bound to these sequences may interact with the cellular transcriptional machinery in fundamentally the same way.

There are two basic procedures for expressing cloned genes from promoters, which are both useful in insect cell systems. In transient systems, the gene of interest is introduced into the insect cell by infection with a recombinant baculovirus. In the most widely used systems, the gene of interest is under the control of the polyhedrin promoter. The polyhedrin promoter is a very late promoter, which means that the expression of the gene of interest does not start until the late phase of the baculovirus infection. The expression levels are high, but transient as the baculovirus infection eventually leads to cell death.

The second method for expressing cloned genes from control regions is stable transfection. Stable transfection may allow for moderate expression levels from a transfected gene to be obtained in a long term continuous culture. In this method the recombinant DNA molecule and promoter/enhancer combination is introduced via transfection, with a gene encoding a selectable marker protein either on the same vector (transfection), or on a separate vector (co-transfection; Jarvis et al. , 1990). After selection for clones which express the marker protein, the cells are assayed for the presence of the gene of interest (for example by Southern analysis of the genomic DNA, northern analysis of the RNA or western analysis of the protein product). Cells which have the gene of interest incoφorated into the genomic DNA of the host cell will stably express the gene.

In any event, it will be understood that promoters are DNA elements which when positioned functionally upstream of a gene leads to the expression of that gene. Each heterologous gene in the vector of the present invention is functionally positioned downstream of a promoter element. Promoters which are active in insect cells to drive transcription are intended for use in the present invention. Preferred are viral promoters, more preferred are baculoviral promoters, and a particularly preferred embodiment uses immediate-early promoters.

A. Eukaryotic and Viral Promoters and Enhancers

Below are a list of viral promoters, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the present invention. Additionally any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of structural genes encoding

oligosaccharide processing enzymes, protein folding accessory proteins, selectable marker proteins or a heterologous protein of interest.

TABLE 2

ENHANCER REFERENCES

Immunoglobulin Heavy Chain Hanerji et al, 1983; Gilles et al, 1983; Grosschedl and Baltimore, 1985; Atchinson and Perry, 1986, 1987; Imler et al, 1987; Weinberger et al, 1988; Kiledjian et al, 1988; Porton et al, 1990

Immunoglobulin Light Chain Queen and Baltimore, 1983; Picard and Schaffner, 1984

T-Cell Receptor Luria et al, 1987, Winoto and Baltimore, 1989; Redondo et al, 1990

HLΛ DQ a and DQ β Sullivan and Peterlin, 1987

β-Interferon Goodbourn et al, 1986; Fujita et al, 1987; Goodbourn and Maniatis, 1985

Interleukin-2 Greene et al, 1989

Interleukin-2 Receptor Greene et al, 1989; Lin et al, 1990

MHC Class II 5 Koch et l, 1989

MHC Class II HLA-DRa Sherman et al, 1989

β-Actin Kawamoto et al, 1988; Ng et al, 1989

Muscle Creatine Kinase Jaynes et al, 1988; Horlick and Benfield, 1989; Johnson et al, 1989a

Prealbumin (Transthyretin) Costa et al, 1988

Elastase I Omitz et α/., 1987

Metallothionein Karin et al, 1987; Culotta and Hamer, 1989

ENHANCER REFERENCES

Collagenase Pinkert et al, 1987; Angel et al, 1987

Albumin Gene Pinkert et al, 1987, Tronche et al, 1989, 1990

a-Fetoprotein Godbout et al, 1988; Campere and Tilghman, 1989

t-Globin Bodine and Ley, 1987; Perez-Stable and Constantini, 1990

β-Globin Trudel and Constantini, 1987

e-fos Cohen et al, 1987 c-HA-ras Triesman, 1986; Deschamps et al, 1985

Insulin Edlund et al, 1985

Neural Cell Adhesion Molecule Hirsch et al, 1990 (NCAM)

^a l-Antιtrypaιn Latimer et al, 1990

H2B (TH2B) Histone Hwang et l, 1990

Mouse or Type I Collagen Ripe et al, 1989

Glucose-Regulated Proteins Chang et al, 1989 (GRP94 and GRP78)

Rat Growth Hormone Larsen et al., 1986

Human Serum Amyloid A Edbrooke et al, 1989

(SAA)

Troponin I (TN I) Yutzey et al., 1989

Platelet-Derived Growth Factor Pech et α/., 1989

Duchenne Muscular Dystrophy Klamut et al., 1990

ENHANCER REFERENCES

SV40 Banerji et al., 1981 ; Moreau et al, 1981 ; Sleigh and Lockett, 1985; Firak and Subramanian, 1986; Herr and Clarke, 1986; Imbra and Karin, 1986; Kadesch and Berg, 1986; Wang and Calame, 1986; Ondek et al, 1987; Kuhl et al, 1987 Schaffner et al, 1988

Polyoma Swartzendruber and Lehman, 1975; Vasseur et al, 1980; Katinka et al. 1980, 1981 ; Tyndell et al, 1981; Dandolo et al, 1983; deVilliers et al, 1984; Hen et al, 1986; Satake et al, 1988; Campbell and Villarreal, 1988

Retroviruses Kriegler and Botchan, 1982, 1983; Levinson et al, 1982; Kriegler et tf/., 1983, 1984a,b, 1988; Bosze et al, 1986; Miksicek et al, 1986; Celander and Haseltine, 1987; Thiesen et al, 1988; Celander et al, 1988; Choi et al, 1988; Reisman and Rotter, 1989

Papilloma Virus Campo et al, 1983; Lusky et al, 1983; Spandidos and Wilkie, 1983; Spalholz et al, 1985; Lusky and Botchan, 1986; Cripe et al, 1987; Gloss et al, 1987; Hirochika et al, 1987, Stephens and Hentschel, 1987; Glue et l, 1988

Hepatitis B Virus Bulla and Siddiqui, 1986; Jameel and Siddiqui, 1986; Shaul and Ben-Levy, 1987; Spandau and Lee, 1988; Vannice and Levinson, 1988

Human Immunodeficiency Muesing et al, 1987; Hauber and Cullan, 1988; Virus Jakobovits et al, 1988; Feng and Holland, 1988; Takebe et al, 1988; Rowen et al, 1988; Berkhout

ENHANCER REFERENCES et al., 1989; Laspia et al, 1989; Shaφ and Marciniak, 1989; Braddock et al, 1989

Cytomegalovirus Weber et al., 1984; Boshart et al., 1985; Foecking and Hofstetter, 1986

Gibbon Ape Leukemia Virus Holbrook et al, 1987; Quinn et al, 1989

TABLE 3

Element Inducer References

MT II Phorbol Ester (TFA) Palmiter et al, 1982;

Heavy metals Haslinger and Karin, 1985; Searle et α/., 1985; Stuart et al, 1985; Imagawa et al, 1987; Karin ®, 1987; Angel et al, 1987b; McNeall et al,

1989

MMTV (mouse Glucocorticoids Huang et al, 1981 ; Lee et al, mammary tumor virus) 1981; Majors and Varmus, 1983; Chandler et al, 1983; Lee et al, 1984; Fonta et al, 1985; Sakai et α/., 1986

β-Interferon poly(rI)X Tavemier et al, 1983 poly(rc)

Adenovirus 5 E2 Ela Imperiale and Nevins, 1984

Collagenase Phorbol Ester (TPA) Angle et al, 1987a

Stromelysin Phorbol Ester (TPA) Angle et al, 1987b

SV40 Phorbol Ester (TFA) Angel et al, 1987b

Element Inducer References

Murine MX Gene Interferon, Newcastle Disease Virus

GRP78 Gene A23187 Resendez et al, 1988

a-2-Macroglobulin IL-6 Kunz et α/., 1989

Vimentin Serum Rittling et al., 1989

MHC Class I Gene H- Interferon Blanar et α/., 1989 2κb

HSP70 Ela, SV40 Large T Taylor et al., 1989; Taylor and Antigen Kingston, 1990a,b

Proliferin Phorbol Ester-TPA Mordacq and Linzer, 1989

Tumor Necrosis Factor FMA Hensel et al, 1989

Thyroid Stimulating Thyroid Hormone Chatterjee et α/., 1989 Hormone a Gene

B. Cellular Promoters and Enhancers

Vector constructs incoφorating insect cellular promoters have been used successfully, including Drosophila HSP70 (Vlak et al, 1990; Zuidema et al, 1990) and Bombyx mori actin (Johnson et al, 1992). Multiple genes have also been successfully coexpressed in insect cells coinfected with more than one recombinant baculovirus (O'Reilly and Miller, 1988; St Angelo et al, 1987). Cellular promoter and enhancer elements which are active in insect cells are preferred for use in the present invention.

C. Baculoviral Promoters and Enhancers

There are four distinct phases of a baculovirus infection, termed immediate-early, delayed-early, late and very late. Therefore, different baculovirus genes may be classified according to the phase of the viral infection during which they are expressed. Also there are a class of genes which have been defined as early genes, which have not been

subcatagorized as either immediate-early or delayed-early. Different classes of promoters control each class of gene.

1. Immediate-Early Promoters This class of promoters are distinguished by needing only host cell factors to drive expression. Examples are the / ^' el (Guarino and Summers, 1987), teN (/e2; Carson et al, 1991) and ieO promoters, with the ie 1 promoter being particularly preferred for use in the present invention.

2. Delayed-Early Promoters

This class of promoters are distinguished by needing only products of the immediate-early genes, in addition to host cell factors to drive expression. Examples are the

39K (Guarino and Smith, 1990) and gp64 (Blissard and Rohrmann, 1989; Whitford et al,

1989) promoters, with the 39K promoter particularly preferred for use in the present invention.

3. Early Promoters

This class of promoters have not been placed into the specific immediate-early of delayed-early class. Examples include the DA26, ETL and 35K promoters.

4. Late Promoters

This class of promoters requires products of the delayed-early and immediate-early genes, as well as other host cell factors, to drive expression. Examples are the gp64 (Blissard and Rohrmann, 1989; Whitford et al, 1989), p6.9 (Wilson et al, 1987) and capsid (p39; Thiem and Miller, 1989) promoters.

5. Very Late Promoters

This class of promoters requires a number of baculovirus gene products, in addition to other host cell factors, to drive expression. Examples of promoters from this class are the polyhedrin (Hooft van Iddekinge et al, 1983) and the plO (Kuzio et al, 1984) promoters.

The best characterized and most often used baculoviral promoter is the polyhedrin promoter. The use of the polyhedrin promoter is a preferred embodiment of the present invention.

As mentioned, enhancers are DNA elements which can be positionally located to enhance transcription from a given promoter. Enhancers which are active in insect cells to drive transcription are preferred in the present invention. Preferred are viral enhancers, and most preferred are baculoviral enhancers.

Examples of baculoviral enhancers include hrl, hr2, hr3, hr4 and hr5 (Guarino et al, 1986), with the use of the hr5 enhancer being a particularly preferred embodiment.

VI. Selectable Marker Genes

The present invention also provides recombinant candidate screening methods which are based upon whole cell assays and which, preferably, employ a reporter gene that confers on its recombinant hosts a readily detectable phenotype that emerges only under conditions where a general DNA promoters positioned upstream of the reporter gene is functional. Generally, reporter genes encode a polypeptide not otherwise produced by the host cell which is detectable by analysis of the cell culture, e.g., by fluorometric, radioisotopic or spectrophotometric analysis of the cell culture. Exemplary enzymes include esterases, phosphatases, proteases (tissue plasminogen activator or urokinase) and other enzymes capable of being detected by their activity, as will be known to those skilled in the art. Preferred examples are the enzyme chloramphenicol acetyltransferase (CAT) which may be employed with a radiolabelled substrate, firefly and bacterial luciferase, β-galactosidase, β-glucuronidase and even green fluorescent protein (GFP) as a marker for gene expression (Chalfie et al, 1994). The use of GFP does not need exogenously added substrates, only irradiation by near UV or blue light, and thus has significant potential for use in monitoring gene expression in living cells.

Another class of reporter genes which confer detectable characteristics on a host cell are those which encode polypeptides, generally enzymes, which render their transformants resistant against toxins. Examples of this class of reporter genes are the neo gene (Colberre- Garapin et al, 1981) which protects host cells against toxic levels of the antibiotic G418, the gene conferring streptomycin resistance (U. S. Patent 4,430,434), the gene conferring hygromycin B resistance (Santerre et al, 1984; U. S. Patents 4,727,028, 4,960, 704 and

4,559,302), a gene encoding dihydrofolate reductase, which confers resistance to methotrexate (Alt et al, 1978) along with many others well known in the art (Kaufman, 1990).

It is the genes or cDNAs encoding drug resistance proteins, which allow for the selection of recombinant clones in the preparation of stable cell lines, that are particularly preferred in the present invention.

VII. Baculovirus Structural Genes and Flanking Baculovirus DNA

There are three main locations in the baculovirus genome into which recombinant expression cassettes can be transplaced. These are the gp64, the plO and the polyhedrin loci. The baculovirus gp64 gene plays a central role in baculovirus infection, apparently mediating penetration of the virus into host cells during adsoφtive endocytosis (Volkman and Goldsmith, 1985; Volkman et al, 1984; Volkman, 1986; Blissard and Wenz, 1992; Charlton and Volkman, 1993). The present invention contemplates incoφorating a functional copy of the baculovirus gp64 structural gene and promoter, as well as 5' and 3' flanking gp64 DNA segments, for constructs which use the gp64 locus of the baculovirus host for replacement of the recombinant baculovirus expression vector.

The polyhedrin gene can be used as a method for screening recombinant baculovirus constructs (Summers and Smith, 1987; Webb and Summers, 1990; Miller 1988). Further embodiments of the present invention comprise the 5' and 3' flanking polyhedrin DNA segments, for constructs which use the polyhedrin locus of the baculovirus host for replacement of the recombinant baculovirus expression vector. These recombinant vectors can be identified in plaque assays by their occlusion-negative phenotypes. A further embodiment would comprise the polyhedrin structural gene and promoter, enabling the recombinant viruses to be identified in plaque assays by their occlusion-positive phenotypes.

The present invention contemplates incoφorating 5' and 3' flanking plO DNA segments, either with or without a functional copy of the baculovirus plO structural gene, for constructs which use the pi 0 locus of the baculovirus host for replacement of the recombinant baculovirus expression vector. Further embodiments of the present invention incoφorate the necessary flanking DNA segments and structural genes and promoters into

separate baculovirus expression vectors so that any combination of the three loci described above can be used for replacement of multiple recombinant baculovirus expression vectors.

The present invention also contemplates the use of immediate early and conventional baculovirus vectors as biocontrol agents, based on the idea that expression of appropriate foreign genes earlier in infection should allow immediate early recombinants to kill insect larvae faster or stop their feeding earlier than conventional polyhedrin- or pJO- based recombinants. An immediate early vector designed to express an insect-specific toxin under z ^' e7 control failed to kill insect larvae faster than a conventional vector designed to express the same toxin under /.10 control, but the vector actually reduced feeding activity more effectively than the conventional vector. Infection of live insects or larvae require the products of the plO and polyhedrin loci. This embodiment of the present invention contemplates incoφorating a functional copy of the baculovirus plO or polyhedrin structural gene and promoter when these loci are used for replacement of the recombinant vectors.

VIII. Heterologous Structural Genes and Other Nucleic Acids

A vast number of heterologous cDNAs have been expressed using the baculovirus expression system. Particularly preferred for use in the present invention is any heterologous coding region encoding for a protein in which oligosaccharide processing is desired. Below is a list of selected cloned structural genes that could be used in the present invention. The list is not in any way meant to be inteφreted as limiting, only as exemplary of the types of structural genes contemplated for use in the present invention.

TABLE 4

Selected Cloned Structural Genes

Gene Clone Type* Reference activin porcine-cDNA Mason AJ, Nat, 318:659, 1985 adenosine deaminase h-cDNA Wiginton DA, PNAS, 80:7481, 1983 angiotensinogen I r-cDNA Ohkubo H, PNAS, 80:2196, 1983 r-gDNA Tanaka T, JBC, 259:8063, 1984 antithrombin III h-cDNA Bock SC. NAR 10:8113, 1982 h-cDNA and gDNA Prochownik EV, JBC, 258:8389, 1983

Selected Cloned Structural Genes

Gene Clone Type* Reference antitrypsin, alpha I h-cDNA Kurachi K, PNAS, 78:6826, 1981 h-gDNA Leicht M, Nat, 297:655, 1982

RFLP Cox DW, AJHG, 36:134S, 1984 apolipoprotein A-I h-cDNA, h-gDNA Shoulders CC, NAR, 10:4873, 1982

RFLP Karathanasis SK, Nat, 301 :718, 1983 h-gDNA Kranthanasis SK, PNAS, 80:6147, 1983 apolipoprotein A-II h-cDNA Shaφe CR, NAR, 12:3917, 1984

Chr Sakaguchi AY, AJHG, 36:207S, 1984 h-cDNA Knott TJ, BBRC, 120:734, 1984 apolipoprotein C-I h-cDNA Knott TJ, NAR, 12:3909, 1984 apolipoprotein C-II h-cDNA Jackson CL, PNAS, 81 :2945, 1984 h-cDNA Mykelbost O, JBC, 259:4401, 1984 h-cDNA Fojo SS, PNAS, 81 :6354, 1984

RFLP Humphries SE, C Gen, 26:389, 1984 apolipoprotein C-III h-cDNA and gDN; Karanthanasis SK, Nat, 304:371, 1983 h-cDNA Shaφe CR, NAR, 12:3917, 1984 apolipoprotein E h-cDNA Breslow JL, JBC, 257:14639, 1982 atrial natriuretic h-cDNA Oikawa S, Nat, 309:724, 1984 factor h-cDNA Nakayama K, Nat, 310:699, 1984 h-cDNA Zivin RA, PNAS, 81 :6325, 1984 h-gDNA Seidman CE, Sci, 226: 1206, 1984 h-gDNA Nemer M, Nat, 312:654, 1984 h-gDNA Greenberg Bl, Nat, 312:665, 1984 chorionic h-cDNA Fiddes JC, Nat, 281 :351, 1981 gonadotropin, RFLP Boethby M, JBC, 256:5121, 1981 alpha chain chorionic h-cDNA Fiddes JC, Nat, 286:684, 1980 gonadotropin, h-gDNA Boorstein WR, Nat, 300:419, 1982

Selected Cloned Structural Genes

Gene Clone Type" Reference beta chain h-gDNA Talmadge K, Nat, 307:37, 1984 chymosin, pro bovine-cDNA Harris TJR, NAR, 10:2177, 1982 (rennin) complement, factor h-cDNA Woods DE, PNAS, 79:5661, 1982 B h-cDNA and gDNA Duncan R, PNAS, 80:4464, 1983 complement C2 h-cDNA Bentley DR, PNAS, 81 :1212, 1984 h-gDNA (C2, C4, Carroll MC, Nat, 307:237, 1984 and B) complement C3 m-cDNA Domdey H, PNAS, 79:7619, 1983 h-gDNA Whitehead AS, PNAS, 79:5021, 1982 complement C4 h-cDNA and gDNA Carroll MC, PNAS, 80:264, 1983 h-cDNA Whitehead AS, PNAS, 80:5387, 1983 complement C9 h-cDNA DiScipio RC, PNAS, 81 :7298, 1984 corticotropin sheep - cDNA Furutani Y, Nat, 301 :537, 1983 releasing h-gDNA Shibahara S, EMBO J, 2:775, 1983 factor epidermal growth m-cDNA Gray A, Nat, 303:722, 1983 factor m-cDNA Scott J, Sci, 221 :236, 1983 h-gDNA Brissenden JE, Nat, 310:781, 1984 epidermal growth h-cDNA and Chr La CR, Sci, 224:843, 1984 factor receptor, oncogene c-erb B epoxide dehydratase r-cDNA Gonzalez FJ, JBC, 256:4697, 1981 erythropoietin h-cDNA Lee-Huang S, PNAS, 81 :2708, 1984 esterase inhibitor, Cl h-cDNA, Stanley KK, EMBO J, 3 : 1429, 1984 factor VIII h-cDNA and gDNA Gitschier J, Nat, 312:326, 1984 h-cDNA Toole JJ, Nat, 312:342, 1984 factor IX, Christmas h-cDNA Kutachi K, PNAS, 79:6461 , 1982

Selected Cloned Structural Genes

Gene Clone Type" Reference factor h-cDNA Choo KH, Nat, 299: 178, 1982

RFLP Camerino G, PNAS, 81 :498, 1984 h-gDNA Anson DS, EMBO J, 3:1053, 1984 factor X h-cDNA Leytus SP, PNAS, 81 :3699, 1984 fibrinogen A alpha, h-cDNA Kant JA, PNAS, 80:3953, 1983 B beta, gamma h-gDNA (gamma) Fomace AJ, Sci, 224:161, 1984 h-cDNA (alpha Imam AMA, NAR, 11 :7427, 1983 gamma) Fomace AJ, JBC, 259:12826, 1984 h-gDNA (gamma) gatrin releasing h-cDNA Spindel ER, PNAS, 81 :5699, 1984 peptide glucagon, prepro hamster-cDNA Bell GI, Nat, 302:716, 1983 h-gDNA Bell GI, Nat, 304:368, 1983 growth hormone h-cDNA Martial JA, Sci, 205:602, 1979 h-gDNA DeNoto FM, NAR, 9:3719, 1981

GH-like gene Owerbach D, Sci, 209:289, 1980 growth hormone RF, h-cDNA Gubler V, PNAS, 80:431 1 , 1983 somatocrinin h-cDNA Mayo KE, Nat, 306:86:1983 hemopexin h-cDNA Stanley KK, EMBO J, 3:1429, 1984 inhibin porcine-cDNA Mason AJ, Nat, 318:659, 1985 insulin, prepro h-gDNA Ullrich a, Sci, 209:612, 1980 insulin-like growth h-cDNA Jansen M, Nat, 306:609, 1983 factor I h-cDNA Bell GI, Nat, 310:775, 1984

Chr Brissenden JE, Nat, 310:781, 1984 insulin-like growth h-cDNA Bell GI, Nat, 310:775, 1984 factor II h-gDNA Dull TJ, Nat, 310:777, 1984

Chr Brissenden JE, Nat, 310: 781 , 1984 interferon, alpha h-cDNA Maeda S, PNAS, 77:7010, 1980 (leukocyte), multiple h-cDNA (8 distinct) Goeddel DV, Nat, 290:20, 1981

Selected Cloned Structural Genes

Gene Clone Type" Reference h-gDNA Lawn RM, PNAS, 78:5435, 1981 h-gDNA Todokoro K, EMBO J, 3: 1809, 1984 h-gDNA Torczynski RM, PNAS, 81 :6451, 1984 interferon, beta h-cDNA Taniguchi T, Gene, 10:1 1, 1980 (fibroblast) h-gDNA Lawn RM, NAR, 9:1045, 1981 h-gDNA (related) Sehgal PB, PNAS, 80:3632, 1983 h-gDNA (related) Sagar AD, Sci, 223:1312, 1984 interferon, gamma h-cDNA Gray PW, Nat, 295:503, 1982 (immune) h-gDNA Gray PW, Nat, 298:859, 1982 interleukin-1 m-cDNA Lomedico PT, Nat, 312:458, 1984 interleukin-2, T-cell h-cDNA Devos R, NAR, 1 1 :4307, 1983 growth factor h-cDNA Taniguchi T, Nat, 302:305, 1983 h-gDNA Hollbrook NJ, PNAS, 81 : 1634, 1984

Chr Siegel LF, Sci, 223:175, 1984 interluekin-3 m-cDNA Fung MC, Nat, 307:233, 1984 kininogen, two bovine-cDNA Nawa H, PNAS, 80:90, 1983 forms bovine-cDNA and Kitamura N, Nat, 305:545, 1983 gDNA luteinizing hormone, h-gDNA and Chr Talmadge K, Nat, 207:37, 1984 beta subunit luteinizing hormone h-cDNA and gDNA Seeburg PH, Nat, 311 :666, 1984 releasing hormone lymphotoxin h-cDNA and gDNA Gray PW, Nat, 312:721 , 1984 mast cell growth m-cDNA Yokoya T, PNAS, 81 : 1070, 1984 factor nerve growth factor, m-cDNA Scott J, Nat, 302:538, 1983 beta subunit h-gDNA Ullrich A. Nat, 303:821, 1983

Chr Franke C, Sci, 222:1248, 1983 oncogene, c-sis, h-gDNA Dalla-Favera R, Nat, 295:31, 1981

Selected Cloned Structural Genes

Gene Clone Type* Reference

PGDF chain A h-cDNA Clarke MF, Nat, 208:464, 1984 pancreatic h-cDNA Boel E, EMBO J, 3:909, 1984 polypeptide and icosapeptide parathyroid h-cDNA Hendy GN, PNAS, 78:7365, 1981 hormone, prepro h-gDNA Vasicek TJ, PNAS, 80:2127, 1983 plasminogen h-cDNA and gDNA Malinowski DP, Fed P, 42:1761, 1983 plasminogen h-cDNA Edlund T, PNAS, 80:349, 1983 activator h-cDNA Pennica D, Nat, 301 :214, 1983 h-gDNA Ny T, PNAS, 81 :5355, 1984 prolactin h-cDNA Cook NE, JBC, 256:4007, 1981 r-gDNA Cooke NE, Nat, 297:603, 1982 proopiomelanocortin h-cDNA DeBold CR, Sci, 220:721, 1983 h-gDNA Cochet M, Nat, 297:335, 1982 protein C h-cDNA Foster D, PNAS, 81 :4766, 1984 prothrombin bovine-cDNA MacGillivray RTA, PNAS, 77:5153, 1980 relaxin h-gDNA Hudson P, Nat, 301 :628, 1983 h-cDNA (2 genes) Hudson P, EMBO J, 3:2333, 1984

Chr Crawford RJ, EMBO J, 3:2341, 1984 renin, prepro h-cDNA Imai T, PNAS, 80:7405, 1983 h-gDNA Hobart PM, PNAS 81:5026, 1984 h-gDNA Miyazaki H, PNAS, 81 :5999, 1984

Chr Chirgwin JM, SCMG, 10:415, 1984 somatostatin h-cDNA Shen IP, PNAS, 79:4575, 1982 h-gDNA and Ri-IP Naylot SI, PNAS, 80:2686, 1983 tachykinin, prepro, bovine-cDNA Nawa H, Nat, 306:32, 1983 substances P&K bovine-gDNA Nawa H, Nat, 312:729, 1984 urokinase h-cDNA Verde P, PNAS, 81 :4727, 1984

Selected Cloned Structural Genes Gene Clone Type* Reference vasoactive intestinal h-cDNA Itoh N, Nat, 304:547, 1983 peptide, prepro vasopressin r-cDNA Schmale H, EMBO J, 2:763, 1983

Key to Table 4: *cDNA - complementary DNA; Chr - chromosome; gDNA - genomic DNA; RFLP - restriction fragment polymoφhism; h - human; m - mouse; r - rat A. Ribozymes

Another method for inhibiting gene expression or viral replication and/or propagation contemplated in the present invention is via ribozymes. Although proteins traditionally have been used for catalysis of nucleic acids, another class of macromolecules has emerged as useful in this endeavor. Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, 1987; Gerlach et al, 1987; Forster and Symons, 1987). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech et al, 1981 ; Michel and Westhof, 1990; Reinhold- Hurek and Shub, 1992). This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.

Ribozyme catalysis has primarily been observed as part of sequence-specific cleavage/ligation reactions involving nucleic acids (Joyce, 1989; Cech et l, 1981). For example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of gene expression may be particularly suited to therapeutic applications (Scanlon et al, 1991 ; Sarver et al, 1990; Sioud et al , 1992). Recently, it was reported that ribozymes elicited genetic changes in some cells lines to which they were applied; the altered genes included

the oncogenes H-ras, c-fos and genes of HIV. Most of this work involved the modification of a target mRNA, based on a specific mutant codon that is cleaved by a specific ribozyme.

Several different ribozyme motifs have been described with RNA cleavage activity (Symons, 1992). Examples that are expected to function equivalently for the down regulation of gene regulation or viral replication include sequences from the Group I self splicing introns including Tobacco Ringspot Virus (Prody et al, 1986), Avocado Sunblotch Viroid (Palukaitis et al, 1979; Symons, 1981), and Lucerne Transient Streak Virus (Forster and Symons, 1987). Sequences from these and related viruses are referred to as hammerhead ribozyme based on a predicted folded secondary structure. Other suitable ribozymes include sequences from RNase P with RNA cleavage activity (Yuan et al, 1992, Yuan and Altman, 1994, U.S. Patent Nos. 5,168,053 and 5,624,824), haiφin ribozyme structures (Berzal-Herranz et al, 1992; Chowrira et al, 1993) and Hepatitis Delta virus based ribozymes (U.S. Patent No. 5,625,047). The general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach, 1988, Symons, 1992, Chowrira et al, 1994; Thompson et al, 1995).

The other variable on ribozyme design is the selection of a cleavage site on a given target RNA. Ribozymes are targeted to a given sequence by virtue of annealing to a site by complimentary base pair interactions. Two stretches of homology are required for this targeting. These stretches of homologous sequences flank the catalytic ribozyme structure defined above. Each stretch of homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for defining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site. For hammerhead ribozyme, the cleavage site is a dinucleotide sequence on the target RNA is a uracil (U) followed by either an adenine, cytosine or uracil (A,C or U) (Perriman et al. , 1992; Thompson et al, 1995). The frequency of this dinucleotide occurring in any given

RNA is statistically 3 out of 16. Therefore, for a given target messenger RNA of 1000 bases, 187 dinucleotide cleavage sites are statistically possible.

The large number of possible cleavage sites in mRNAs or in viruses containing RNA genomes, such as hepatitis A, C, D, E and G, coupled with the growing number of sequences with demonstrated catalytic RNA cleavage activity indicates that a large number of ribozymes are available. Additionally, due to the sequence variation among the different

hepatitis viruses, ribozymes could be designed to specifically cleavea particular hepatitis RNA genome. Designing and testing ribozymes for efficient cleavage of a target RNA is a process well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira et al, (1994) and Lieber and Strauss (1995), each incoφorated by reference. The identification of operative and preferred sequences for use in the instant ribozymes is simply a matter of preparing and testing a given sequence, and is a routinely practiced "screening" method known to those of skill in the art.

B. Antisense In certain preferred embodiments discussed above, the nucleic acids employed may actually encode antisense constmcts that hybridize, under intracellular conditions, to viral or cellular nucleic acids. The term "antisense construct" is intended to refer to nucleic acids, preferably oligonucleotides, that are complementary to the base sequences of a target DNA or RNA. Targeting double-stranded (ds) DNA with an antisense construct leads to triple- helix formation; targeting RNA will lead to double-helix formation. Antisense nucleic acids, when introduced into a target cell, specifically bind to their target polynucleotide, for example hepatitis viral DNA or mRNA, and interfere with transcription, RNA processing, transport, translation, viral replication and/or propagation and/or stability. Antisense RNA constmcts, or DNA encoding such antisense RNAs, may be employed to inhibit gene transcription or translation or both, or viral replication and/or propagation within the cells of the present invention.

Antisense constmcts may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. Antisense RNA constmcts, or DNA encoding such antisense RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject. Nucleic acid sequences which comprise "complementary nucleotides" are those which are capable of base-pairing according to the standard Watson-Crick complementarity mles. That is, that the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T), in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-

methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.

As used herein, the term "complementary" means nucleic acid sequences that are substantially complementary over their entire length and have very few base mismatches. For example, nucleic acid sequences of fifteen bases in length may be termed complementary when they have a complementary nucleotide at thirteen or fourteen positions with only a single mismatch. Naturally, nucleic acid sequences which are "completely complementary" will be nucleic acid sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense constmct which has limited regions of high homology, but also contains a non-homologous region (e.g., a ribozyme) could be designed. These molecules, though having less than 50%o homology, would bind to target sequences under appropriate conditions. While all or part of the gene or viral genomic sequence may be employed in the context of antisense constmction, short oligonucleotides are easier to make and increase in vivo accessibility. However, both binding affinity and sequence specificity of an antisense oligonucleotide to its complementary target increases with increasing length. One can readily determine whether a given antisense nucleic acid is effective at targeting of the corresponding host cell gene simply by testing the constmcts in vitro to determine whether the function of the endogenous gene is affected or whether the expression of related genes having complementary sequences is affected.

In certain embodiments, one may wish to employ antisense constructs which include other elements, for example, those which include C-5 propyne pyrimidines. Oligonucleotides which contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression.

IX. Cloning Site Cloning sites allow for the insertion and proper orientation of a heterologous gene of interest. Cloning sites are DNA regions comprising a recognition site for a DNA restriction

endonuclease. Multiple cloning sites are DNA regions comprising two or more recognition sites for DNA restriction endonucleases, improving the utility of vectors which contain them. DNA fragments containing multiple cloning sites are commercially available or easily synthesized, and well known to practicioners in the art. A multiple cloning site comprising the recognition sites for five, six, seven, eight, nine, ten or more DNA restriction endonucleases is preferred for use in the present invention. A multiple cloning site positioned downstream from a promoter element is a particularly preferred embodiment of the present invention.

X. Insect Cell Lines

Insect cell lines which contain appropriate transcriptional factors to drive expression of the structural genes provided in the baculovirus expression vectors of the present invention are preferred for use. Examples include Spodoptera frugiperda, Bombyx mori,

Heliothis virescens, Heliothis zea, Mamestra brassicas, Estigmene acrea and Trichoplusia ni.

XI. Methods for Transfection, Infection, Cell Culture, and Protein Production and Purification

General methods involved in the use of the present invention, including methods for cell growth and maintenance, production of recombinant baculovimses, infection of insect cells, and analysis of expressed proteins in insect cells are provided in detail in the

Examples below. Also, good general references on the various techniques needed to practice the current invention are available (O'Reilly et al, 1992).

XII. α-Mannosidase I and α-Mannosidase II DNA Segments

Further aspects of the present invention concern isolated DNA segments and recombinant vectors encoding α-mannosidase I and α-mannosidase II, and the creation and use of recombinant host cells through the application of DNA technology, that express α- mannosidase I and α-mannosidase II. The present invention concerns DNA segments, isolatable from uninfected

Spodoptera frugiperda Sf-9 cells, that are free from total genomic DNA and are capable of

conferring α-mannosidase I and α-mannosidase II activity to a recombinant host cell when incoφorated into the recombinant host cell. As used herein, the term α-mannosidase I and α-mannosidase II activity indicates the ability to cleave mannose residues from Man ₉ - GlcNAc to produce Man ₅ -GlcNAc ₂ (α-mannosidase I) and the ability to cleave two mannose residues from Man ₅ -GlcNAc ₂ to produce Man ₃ -GlcNAc ₂ (α-mannosidase II).

As used herein, the term "DNA segment" refers to a DNA molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a DNA segment encoding α-mannosidase I and α-mannosidase II refers to a DNA segment that contains α- mannosidase I and α-mannosidase II coding sequences yet is isolated away from, or purified free from, total genomic DNA of Spodoptera frugiperda. Included within the term "DNA segment", are DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, vimses, and the like.

Similarly, a DNA segment comprising an isolated or purified α-mannosidase I or α- mannosidase II gene refers to a DNA segment including α-mannosidase I or α-mannosidase

II gene coding sequences and, in certain aspects, regulatory sequences, isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term "gene" is used for simplicity to refer to a functional protein, polypeptide or peptide encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences, cDNA sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides or peptides.

"Isolated substantially away from other coding sequences" means that the gene of interest, in this case α-mannosidase I or α-mannosidase II gene, forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.

In particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incoφorating DNA sequences that encode an α-mannosidase I or α- mannosidase II gene that includes within its amino acid sequence a contiguous amino acid

sequence from SEQ ID NO:2 (α-mannosidase I) and SEQ ID NO:4 (α-mannosidase II), corresponding to Spodoptera frugiperda.

Naturally, where the DNA segment or vector encodes a full length α-mannosidase I or α-mannosidase II protein, or is intended for use in expressing the α-mannosidase I or α- mannosidase II protein, the most preferred sequences are those that are essentially as set forth in the full length contiguous sequence of SEQ ID NO:2 (α-mannosidase I) and SEQ ID NO:4 (α-mannosidase II), and that encode a protein that retains α-mannosidase I or α- mannosidase II activity, e.g., as may be determined by the α-mannosidase assay, as disclosed herein (Example 10). Sequence of the present invention will substantially correspond to a contiguous portion of SEQ ID NO:2 (α-mannosidase I) and SEQ ID NO:4 (α-mannosidase II), and have relatively few amino acids that are not identical to, or a biologically functional equivalent of, the amino acids of SEQ ID NO:2 (α-mannosidase I) and SEQ ID NO:4 (α- mannosidase II). The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein (Section XVI).

Accordingly, sequences that have between about 70% and about 80%; or more preferably, between about 81% and about 90%; or even more preferably, between about 91% and about 99%; of amino acids that are identical or functionally equivalent to the amino acids of SEQ ID NO:2 (α-mannosidase I) and SEQ ID NO:4 (α-mannosidase II) will be sequences that are "essentially as set forth in SEQ ID NO:2 (α-mannosidase I) and SEQ

ID NO:4 (α-mannosidase II).

In certain other embodiments, the invention concerns isolated DNA segments and recombinant vectors that include within their sequence a contiguous nucleic acid sequence from SEQ ID NO:l (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II). This definition is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a contiguous portion of SEQ ID NO:l (α- mannosidase I) and SEQ ID NO:3 (α-mannosidase II) and has relatively few codons that are not identical, or functionally equivalent, to the codons of SEQ ID NO:l (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II). Again, DNA segments that encode proteins exhibiting α-mannosidase I or α-mannosidase II activity will be most preferred. The term

"functionally equivalent codon" is used herein to refer to codons that encode the same

amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids. See Table 5 below.

TABLE 5

Amino Acids Codons

Alanine Ala A GCA GCC GCG GCU

Cysteine Cys C UGC UGU

Aspartic acid Asp D GAC GAU

Glutamic acid Glu E GAA GAG

Phenylalanine Phe F UUC UUU

Glycine Gly G GGA GGC GGG GGU

Histidine His H CAC CAU

Isoleucine He I AUA AUC AUU

Lysine Lys K AAA AAG

Leucine Leu L UUA UUG CUA cue CUG CUU

Methionine Met M AUG

Asparagine Asn N AAC AAU

Proline Pro P CCA CCC CCG ecu

Glutamine Gin Q CAA CAG

Arginine Arg R AGA AGG CGA CGC CGG CGU

Serine Ser S AGC AGU UCA UCC UCG UCU

Threonine Thr T ACA ACC ACG ACU

Valine Val V GUA GUC GUG GUU

Tryptophan Tφ w UGG

Tyrosine Tyr Y UAC UAU

It will also be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-

coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

Excepting intronic or flanking regions, and allowing for the degeneracy of the genetic code, sequences that have between about 70% and about 79%; or more preferably, between about 80% and about 89%; or even more preferably, between about 90% and about

99% of nucleotides that are identical to the nucleotides of SEQ ID NO:l (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II) will be sequences that are "essentially as set forth in SEQ ID NO: 1 (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II). Sequences that are essentially the same as those set forth in SEQ ID NO: l (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II) may also be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO:l (α- mannosidase I) and SEQ ID NO:3 (α-mannosidase II) under relatively stringent conditions. Suitable relatively stringent hybridization conditions will be well known to those of skill in the art and are clearly set forth herein (Example 7). Naturally, the present invention also encompasses DNA segments that are complementary, or essentially complementary, to the sequence set forth in SEQ ID NO: l (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II). Nucleic acid sequences that are "complementary" are those that are capable of base-pairing according to the standard Watson-Crick complementarity mles. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:l (α-mannosidase I) and SEQ ID NO:3 (α-mannosidase II) under relatively stringent conditions such as those described herein in Example 7. The nucleic acid segments of the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, nucleic acid fragments may be prepared

that include a short contiguous stretch identical to or complementary to SEQ ID NO: l (α- mannosidase I) and SEQ ID NO:3 (α-mannosidase II), such as about 14 nucleotides, and that are up to about 10,000 or about 5,000 base pairs in length, with segments of about 3,000 being preferred in certain cases. DNA segments with total lengths of about 1,000, about 500, about 200, about 100 and about 50 base pairs in length (including all intermediate lengths) are also contemplated to be useful.

It will be readily understood that "intermediate lengths", in these contexts, means any length between the quoted ranges, such as 14, 15, 16, 17, 18, 19, 20, etc.; 21, 22, 23, etc; 30, 31, 32, etc.; 50, 51, 52, 53, etc.; 100, 101 , 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through the 200-500; 500-1,000; 1,000-2,000; 2,000-3,000; 3,000-

5,000; 5,000-10,000 ranges, up to and including sequences of about 12,001, 12,002, 13,001, 13,002 and the like.

It will also be understood that this invention is not limited to the particular nucleic acid and amino acid sequences of SEQ ID NO:l and SEQ ID NO:2 (α-mannosidase I) and SEQ ID NO:3 and SEQ ID NO:4 (α-mannosidase II), respectively. Recombinant vectors and isolated DNA segments may therefore variously include the α-mannosidase I and α- mannosidase II coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include α-mannosidase I and α-mannosidase II -coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.

The DNA segments of the present invention encompass biologically functional equivalent α-mannosidase I and α-mannosidase II proteins and peptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded.

Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site- directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the

protein or to test α-mannosidase I and α-mannosidase II mutants in order to examine α- mannosidase I and α-mannosidase II activity at the molecular level.

If desired, one may also prepare fusion proteins and peptides, e.g., where the α- mannosidase I and α-mannosidase II coding regions are aligned within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection puφoses (e.g., proteins that may be purified by affinity chromatography and enzyme label coding regions, respectively).

XIII. Cloning Insect Oligosaccharide Processing and Protein Folding Accessory Genes

The present inventor contemplates cloning oligosaccharide processing and protein folding accessory genes or cDNAs from insect cells, and particularly, α-glucosidase I and α-glucosidase II, N-acetylglucosaminyltransferase I, N-acetylglucosaminyltransferase II, protein disulphide isomerase, peptidyl prolyl cis-trans isomerase and BiP/GRP78. The insect cells contemplated for use include Sf-9, High Five and Ea cells.

A technique often employed by those skilled in the art of protein production today is to obtain a so-called "recombinant" version of the protein, to express it in a recombinant cell and to obtain the protein from such cells. These techniques are based upon the "cloning" of a DNA molecule encoding the protein from a DNA library, i.e., on obtaining a specific DNA molecule distinct from other portions of DNA. This can be achieved by, for example, cloning a cDNA molecule, or cloning a genomic-like DNA molecule.

The first step in such cloning procedures is the screening of an appropriate DNA library, such as, in the present case, a lambda ZAP II™ cDNA library from uninfected Sf-9 cells. The screening procedure may be an expression screening protocol employing antibodies directed against the protein, or activity assays. For example, antibody screening is very routinely employed. Alternatively, screening may be based on the hybridization of oligonucleotide probes, designed from a consideration of portions of the amino acid sequence of the protein, or from the DNA sequences of genes encoding related proteins. The operation of such screening protocols are well known to those of skill in the art and are described in detail in the scientific literature, for example, in Sambrook et al. (1989), incoφorated herein by reference. Moreover, as the present invention encompasses the

cloning of genomic segments as well as cDNA molecules, it is contemplated that suitable genomic cloning methods, as known to those in the art, may also be used.

XIV. Use in Insect Control Baculovimses have been used throughout this century for insect pest control. The present invention contemplates two novel uses of baculovimses in this manner. The gp64 protein is involved in the infectivity and vimlence of baculovims, mainly through the oligosaccharide side chains. The current invention provides for a method of alteration of the oligosaccharides on gp64 (Example 13 and 14). An embodiment of the current invention is to use the vectors described herein to alter the glycoprotein stmcture, thereby altering the infectivity and vimlence of the recombinant baculovimses. A further embodiment includes delivering known insect toxins, such as Bacillus thuringiensis crystal toxin, protease inhibitor II, rice lectin, AalT, LqhIT2 or juvenile hormone esterase, with juvenile hormone esterase particularly preferred.

XV. Site-Specific Mutagenesis

Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, for example, incoφorating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.

In general, the technique of site-specific mutagenesis is well known in the art as exemplified by publications (Adelman et al, 1983). As will be appreciated, the technique typically employs a phage vector which exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3

phage (Messing et al, 1981). These phage are readily commercially available and their use is generally well known to those skilled in the art. Double stranded plasmids are also routinely employed in site directed mutagenesis which eliminates the step of transferring the gene of interest from a plasmid to a phage. In general, site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector or melting apart the two strands of a double stranded vector which includes within its sequence a DNA sequence which encodes an oligosaccharide processing enzyme. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically, for example by the method of Crea et al. (1978). This primer is then annealed with the single-stranded vector, and subjected to DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected which include recombinant vectors bearing the mutated sequence arrangement.

The preparation of sequence variants of the selected oligosaccharide processing gene using site-directed mutagenesis is provided as a means of producing potentially useful oligosaccharide processing enzyme species and is not meant to be limiting as there are other ways in which sequence variants of the oligosaccharide processing enzyme may be obtained. For example, recombinant vectors encoding the desired oligosaccharide processing enzyme gene may be treated with mutagenic agents to obtain sequence variants (see, e.g., a method described by Εichenlaub, 1979) for the mutagenesis of plasmid DNA using hydroxylamine.

XVI. Protein Purification

Further aspects of the present invention concern the purification, and in particular embodiments, the substantial purification, of a recombinant heterologous protein. The term "purified recombinant heterologous protein" as used herein, is intended to refer to a recombinant heterologous protein composition, isolatable from recombinant host insect cells, wherein the recombinant heterologous protein is purified to any degree relative to its

naturally-obtainable state, i.e., in this case, relative to its purity within a natural extract. A purified recombinant heterologous protein therefore also refers to a recombinant heterologous protein free from the environment in which it may naturally occur.

Generally, "purified" will refer to a recombinant heterologous protein composition which has been subjected to fractionation to remove various non-insect cell components such as other cell components. Various techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulphate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, lectin affinity and other affinity chromatography steps; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques.

Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. Inactive products also have utility in certain embodiments, such as, e.g., in antibody generation.

Partially purified recombinant heterologous protein fractions for use in such embodiments may be obtained by subjecting a insect cell extract to one or a combination of the steps described above. Substituting certain steps with improved equivalents is also contemplated to be useful. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater - fold purification than the same technique utilizing a low pressure chromatography system.

XVII. Biological Functional Equivalents

As mentioned above, modification and changes may be made in the structure of oligosaccharide processing enzymes and still obtain a molecule having like or otherwise desirable characteristics. For example, certain amino acids may be substituted for other amino acids in a protein stmcture without appreciable loss of oligosaccharide processing capabilities. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a protein with like (agonistic) properties. Equally, the same

considerations may be employed to create a protein or polypeptide with countervailing (e.g., antagonistic) properties. It is thus contemplated by the inventors that various changes may be made in the sequence of oligosaccharide processing proteins or peptides (or underlying DNA) without appreciable loss of their biological utility or activity. In terms of functional equivalents, It is also well understood by the skilled artisan that, inherent in the definition of a biologically functional equivalent protein or peptide, is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule and still result in a molecule with an acceptable level of equivalent biological activity. Biologically functional equivalent peptides are thus defined herein as those peptides in which certain, not most or all, of the amino acids may be substituted. Of course, a plurality of distinct proteins/peptides with different substitutions may easily be made and used in accordance with the invention.

It is also well understood that where certain residues are shown to be particularly important to the biological or stmctural properties of a protein or peptide, e.g., residues in active sites, such residues may not generally be exchanged.

Conservative substitutions well known in the art include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamate; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.

In making such changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte & Doolittle, 1982, incoφorated herein by reference). It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incoφorated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the protein, use this shorter portion for non- immunological stuff It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent protein.

As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1) glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0) threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0) methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3) phenylalanine (-2.5); tryptophan (-3.4).

In making changes based upon similar hydrophilicity values, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred. While discussion has focused on functionally equivalent polypeptides arising from amino acid changes, it will be appreciated that these changes may be effected by alteration of the encoding DNA; taking into consideration also that the genetic code is degenerate and that two or more codons may code for the same amino acid. A table of amino acids and their codons is presented herein for use in such embodiments, as well as for other uses, such as in the design of probes and primers and the like.

XVIII. Pharmaceutical Compositions

Aqueous compositions of the present invention comprise an effective amount of a baculovims comprising an appropriate expression system, or such like, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. Aqueous compositions of gene therapy vectors expressing any of the foregoing are also contemplated.

The phrases "pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate.

As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absoφtion delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incoφorated into the compositions. For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

The biological material should be extensively dialyzed to remove undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle, where appropriate. The active compounds will then generally be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, intralesional, or even intraperitoneal routes, with intravenous injection being preferred. As the liver is the "first pass" organ in clearance from plasma, and since the recombinant baculovimses interact specifically with hepatocytes, delivery of nucleic acid segments to hepatocytes via intravenous injection is expected to be quite efficient. The preparation of an aqueous composition that contains a recombinant baculovims comprising a baculovims expression system as an active component or ingredient will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

A recombinant baculovims of the present invention can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. In terms of using peptide therapeutics as active ingredients, the technology of U.S. Patents 4,608,251 ; 4,601,903; 4,599,231; 4,599,230; 4,596,792; and 4,578,770, each incoφorated herein by reference, may be used.

The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absoφtion of the injectable compositions can be

brought about by the use in the compositions of agents delaying absoφtion, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The preparation of more, or highly, concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but dmg release capsules and the like can also be employed.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

The recombinant baculovimses of the present invention may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 or even about 10 milligrams per dose or so. Multiple doses can also be administered. In terms of multiplicity of infection (MOI), MOIs of less than 100-200 are preferred.

In addition to the compounds formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; time release capsules; and any other form currently used, including cremes. One may also use nasal solutions or sprays, aerosols or inhalants in the present invention. Nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, the aqueous nasal solutions usually are isotonic and slightly buffered to maintain a pH of 5.5 to 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, and appropriate dmg stabilizers, if required, may be included in the formulation. Various commercial nasal preparations are known and include, for example, antibiotics and antihistaminesand are used for asthma prophylaxis.

Additional formulations which are suitable for other modes of administration include vaginal suppositories and pessaries. A rectal pessary or suppository may also be used.

Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or the urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%.

Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders. In certain defined embodiments, oral pharmaceutical compositions will comprise an inert

diluent or assimilable edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incoφorated directly with the food of the diet. For oral therapeutic administration, the active compounds may be incoφorated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, symps, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 75% of the weight of the unit, or preferably between 25-60%. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained.

The tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, comstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as co starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavoring agent, such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A symp of elixir may contain the active compounds sucrose as a sweetening agent methyl and propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor.

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1 Construction of pIElHRl. 2.3. and 4

These four plasmids are designed to facilitate the expression of foreign gene products under iel control in stably-transformed or transiently transfected lepidopteran insect cells. The iel 5' untranslated region and most of the open reading frame were deleted from the Autographa californica multicapsid nuclear polyhedrosis vims (AcMNPV) e7 gene by digesting pAcIEl (Guarino and Summers, 1986) with Smal and Hindi. The deleted fragment was replaced with a blunt-ended PCR™ amplimer containing the 5' end of the iel gene from -84 to +3. The primers used to produce this amplimer (IE1-84+: 5'- CAGTATAAATTGACGTTC-3' (SEQ ID NO:5); and IE1+3-: 5'-

TTTTGGATCCATAGTCACTTGGTTGTT-3' (SEQ ID NO:6)) were designed to add a BamHI site just downstream of the initiation codon in the iel gene (the first base of this ATG is defined as position +1).

The sequence of the cloned PCR™ amplimer was checked by direct sequencing of double-stranded templates using a commercial sequencing kit (Sequenase™ 2.0; United

States Biochemical Coφ., Cleveland, OH). The resulting plasmid, pIE184„3_w., was used to isolate a DNA fragment containing the 5' end of the iel gene from -38 to +2 followed immediately by a BamHI site (GGATCC), a short cap sequence (AAAA) from the downstream PCR™ primer (IE1+3-; SEQ ID NO:6), a sequence from the 3' end of the /e7 gene (from position +1255 to +2491), and a short sequence from the pUC8 vector (from

HmdIII in the multiple cloning site to Nαrl in the lacZ gene). This 1431 bp fragment was used to replace the corresponding fragment in pAcIEl, which resulted in regeneration of the iel untranslated region from position -600 to -1, followed by the ATG, an overlapping BamHI site, the short cap sequence, the 3' end of the /e7 gene from position +1255 to +2491, which includes a polyadenylation site, and the pUC8 vector.

This new plasmid, pIE1600Pre_5αm, was linearized with BamHI, the overhangs were removed with mung bean nuclease, and a blunt-ended Mlul fragment from pΗR5, which contains the AcMNPV hr5 enhancer element (Guarino et al. , 1986), was inserted. This produced pIE1600_5few.HR, in which the enhancer element is oriented in the same direction as the iel promoter at the upstream BamHI site (position -600). A synthetic oligonucleotide encoding a multiple cloning site (mcs) was inserted into the single remaining BamHI site of

pϊElβOOBamHR to produce pIElHRl and pIElHR2 (FIG. 1A), which have the insert in opposite orientations with respect to the z ^' e7 promoter (mcsl (SEQ ID NO:7) and mcs2 (SEQ ID NO:8)). This same linker also was inserted into the unique BamHI site of pIE16005α HRDATG, in which the iel translational initiation site (ACTATG) of pIE1600_3amHR had been changed to ACCGCG by site-directed mutagenesis (Kunkel,

1985). This produced pIElHR3 and pIElHR4 (FIG. 1A), which lack the iel initiation codon and contain the mcs in opposite orientations with respect to the z ^' e promoter (mcs3 (SEQ ID NO:9) and mcs4 (SEQ ID NO: 10)).

The pIElHR plasmids (FIG. 1A) are designed to facilitate transient expression of a foreign gene in uninfected insect cells (Guarino and Summers, 1986) or isolation of transformed insect cell clones that can express a foreign gene constitutively, in the absence of baculovims infection (Jarvis et al, 1990; Jarvis, 1993; Jarvis and Guarino, 1995; Kleymann et al, 1993; Joyce et al, 1993; Vulsteke et al, 1993; Cartier et al, 1994. Each of these plasmids has the AcMNPV hr5 enhancer element (483 bp; Guarino et al, 1986) positioned upstream and in the same orientation as the iel promoter. In pIElHRl and 2, the z ^' e promoter sequence extends from position -600 to +3, with +1 defined as the first nucleotide of the iel ATG (Guarino and Summers, 1987). In pIElHR3 and 4, the promoter sequence extends from position -600 to -2. Thus, pIElHRl and 2 include the iel translational initiation site and can be used to produce fusion proteins, while pIElHR3 and 4 lack this site and can be used to produce native proteins. The z ^' e promoter in these four plasmids is followed by a mcs with several unique restriction sites. The mcs found in each plasmid is designated by a number (mcsl, mcs2, mcs3, or mcs4) that matches the number of the plasmid (pIElHRl, pIElHR2, pIElHR3, or pIElHR4) and the sequence of each mcs region, beginning at position -6 of the iel promoter, is shown in the brief description of FIG. 1 herein above. Each mcs is followed by the 3' end of the z ^' e7 gene (positions +1255 to

+2491), which includes a polyadenylation site. These plasmids are all derivatives of pUC8 (Vieira and Messing, 1982), which carries an ampicillin resistance marker and has the pMBl replicon.

The immediate early expression plasmids shown in FIG. 1A facilitate transient expression assays in insect cells or the production of stably-transformed insect cells by providing flexibility in cloning foreign genes under ze control. These plasmids include all

the promoter sequences that have been shown to be important for ze 7 -mediated gene expression in uninfected insect cells (Pullen and Friesen, 1995). They also include the hr5 enhancer element, which has been shown to stimulate z ^' e7-mediated foreign gene expression (Pullen and Friesen, 1995; Rodems and Friesen, 1993; Guarino and Dong, 1994). Therefore, these plasmids provide optimal levels of foreign gene transcription in transiently- transfected or stably-transformed insect cells (Cartier et al, 1994; Pullen and Friesen, 1995; Rodems and Friesen, 1993). In addition to their potential utility as a tool for foreign glycoprotein production, stably-transformed insect cells produced using these plasmids can be used as helper cells to facilitate studies on essential baculovims, or as modified hosts to study insect cell biology and the baculovirus-host cell interaction (Cartier et al, 1994;

Jarvis, 1993).

Construction of pAcP(-HElTV5 and 6 and pAcP(+)IE!TVl. 2. 3. and 4

The pAcP(-)IElTV5 and 6 plasmids are designed to facilitate the isolation of occlusion-negative recombinant baculovimses in which a foreign gene of interest can be expressed under the control of the z ^' e7 promoter during the immediate early phase of infection. pAcP(-)IElTV5 was constmcted by replacing the EcoRV-_5αmHI fragment of pVL1393 (O'Reilly et al, 1992) with the Smal-BamHl fragment of pIΕ1600_5αmHR. This effectively replaced the polyhedrin sequence from -92 to +177 with the z ^' e sequence from - 600 to +3, regenerated an overlapping unique BamHI site, and maintained some additional unique cloning sites immediately downstream (FIG. IB). This same strategy was used to construct pAcP(-)IElTv ^T 6, except the EcoRV-_5α HI fragment from pVL1393 was replaced with the Smal-BamHl fragment of pIΕ1600£αmHRDATG, in which the iel ATG had been eliminated by site-directed mutagenesis. The pAcP(+)IElTv ^T l, 2, 3, and 4 plasmids are designed for the isolation of occlusion-positive recombinants that can express a foreign gene under z ^' e control during the immediate early phase of infection. First pAcPolh was constmcted, which contained the full-length AcMNPV polyhedrin gene with about 2 Kb and 1.5 Kb of 5' and 3' flanking sequences, respectively, and ultimately served as the target for inserting a DNA fragment encoding the hr5 enhancer, z ^' e7 promoter, and mcs. A precursor, pAcPolh-5', was constmcted by inserting the Xhol-BamHl fragment of pAcPstl-D into the Sall-BamHl sites

of pUC18 (Yanisch-Perron et al , 1985), then the 1.94 Kb BamHI fragment of pAcPstl-D was inserted into the unique _9αmHI site of pAc-Polh-5' to produce pAcPolh. pAcP(+)IElTVl, 2, 3, or 4 (FIG. 1C) were constmcted by inserting the hr5-.e7-mcs fragments from pIElHRl, 2, 3, or 4, respectively, into the unique EcoRV site of pAcPolh. pAcP(+)IΕlTVl and 2 contain the hr5 enhancer element, the z ^' e promoter from -600 to -1, and the iel ATG, followed by mcsl or mcs2. pAcP(+)IElTV3 and 4 have the enhancer and the z ^' e promoter from -600 to -2, followed by mcs3 or mcs4, but lack the iel ATG.

The pAcP(-)IElTV (FIG. IB) and pAcP(+)IElTV (FIG. 1C) transfer plasmids are designed for the production of occlusion-negative or -positive recombinant baculovims vectors, respectively, that can express a foreign gene beginning immediately after infection.

Each of these plasmids has the hr5 enhancer and z ^' e7 promoter from positions -600 to +3 or - 600 to -2, as described above. Thus, some include the z ^' e7 translational start site and can be used to express fusion proteins, whereas others lack it and can be used to express native proteins. The z ^' e7 promoter in each plasmid is followed by a mcs with several unique restriction sites; as above, the number following the name of the plasmid indicates which mcs it contains and the various mcs sequences are shown in the brief description of FIG. 1 herein above.

In the pAcP(-)IElTV plasmids, the mcs is followed by sequences which begin in the middle of the polyhedrin open reading frame (at position +177 with respect to the polyhedrin ATG) and extend about 2.8 Kb downstream through the polyhedrin polyadenylation site. The sequence on the other side of the hr5-.e7-mcs complex in the pAcP(-)IElTV plasmids begins at the EcoRV site in the polyhedrin promoter region (position -92 with respect to the polyhedrin ATG) and extends about 4.0 kb in the 5' direction with respect to the polyhedrin ATG. Thus, as in conventional polyhedrin-hased baculovims transfer plasmids, these long flanking sequences will target the foreign gene to the polyhedrin locus where it can be inserted by homologous recombination. This produces /?o/ /.e rz . -negative recombinants, which can be identified in plaque assays by their occlusion-negative phenotypes.

By contrast, the mcs in the pAcP(+)IΕlTV plasmids is followed by sequences that begin at the EcoRV site in the promoter region of the polyhedrin gene (position -92) and extend about 2.1 kb in the 5' direction with respect to the polyhedrin ATG (FIG. 1C). The

sequences preceding the hr5-z ^' e7-mcs complex in the pAcP(+)IElTV plasmids begin at the EcoRV site and extend about 2.2 Kb in the 3' direction with respect to the polyhedrin ATG. Thus, these plasmids have an intact polyhedrin promoter, open reading frame, and 3' flanking sequence positioned upstream and in opposite orientation to the hr5-z ^' e7-mcs and a long flanking sequence from the 5' side of the polyhedrin gene positioned downstream and in opposite orientation to the hr5-z ^' e7-mcs. As with the pAcP(-)IΕlTV plasmids, the pAcP(+)IElTV plasmids can be used to insert the foreign gene into the polyhedrin locus by homologous recombination. However, these latter transfer plasmids will produce occlusion- positive recombinants that can be distinguished by their plaque phenotypes only if genomic DNA from an occlusion-negative vims is used as the target for homologous recombination.

The immediate early baculovims transfer plasmids shown in FIG. IB and FIG. 1C are designed to facilitate the isolation of either occlusion-negative or -positive recombinant baculovimses that can be used to express foreign genes during the early phase of infection.

The availability of multiple plasmids designed to produce recombinants with either plaque phenotype provides flexibility in the choice of screening techniques and allows one to produce either environmentally labile (occlusion-negative) or stable (occlusion-positive) recombinants for use as biopesticides (Section XIII). It should be noted that the pAcP(- )IE1TV and pAcP(+)IElTV transfer plasmids will target the ze -driven foreign gene for insertion into the viral genome in opposite orientations and the sequences, including potential polyadenylation sites, downstream of the inserts will be completely different.

These differences might influence the levels of expression that can be obtained with immediate early baculovims vectors produced with these different types of transfer plasmids.

EXAMPLE 2

Isolation and analysis of immediate early baculovirus vectors that express E. coli β-gal.

The E. coli lacZ gene was inserted into pAcP(-)IElTVl or pAcP(+)IElTVl and the resulting plasmids were used to isolate immediate early baculovims vectors. The BamHI fragment of pVL1393-βgal was inserted into the unique BamHI site of pAcP(-)IElTV5 or

Bglll site of pAcP(+)IEHVl to produce pAcP(-)IElβgal or pAcP(+)IEl βgal, respectively.

pAcP(-)IElβgal is designed to express a fusion protein under the influence of the hr5 enhancer and z ^' e7 promoter which initiates at the iel ATG and has two linker amino acids (D-P) fused to amino acids 10-1024 of β-gal. pAcP(+)IElβgal is identical, except it encodes a fusion protein with four linker amino acids (D-L-D-P) fused to β-gal and also has an intact polyhedrin gene oriented in the opposite direction.

Working stocks of these vimses were prepared, titered, and used as follows. Occlusion-negative or -positive recombinant vimses were isolated after calcium phosphate- mediated cotransfection of Sf9 cells with a mixture of the appropriate transfer plasmid and viral DNA, as described previously (Summers and Smith, 1987). The transfer plasmids used to isolate occlusion-negative recombinants expressing β-gal, CAT (Example 3), or t-

PA (Example 4) were pAcP(-)IElβgal, pAcP(-)IElCAT, and pAcP(-)IEltPA, respectively. The viral DNA was from wild-type AcMNPV and recombinants were identified by their occlusion-negative blue (β-gal) or white (CAT and t-PA; Examples 3 and 4) phenotypes in plaque assays containing X-gal (Research Organics Inc., Cleveland, OH). The transfer plasmids used to isolate occlusion-positive recombinants were pAcP(+)IEl βgal, pAcP(+)IElCAT, pAcP(+)IEltPA, or pAc?(+)IElSfMaι_II, respectively. The viral DNA was Bsu36I-linearized BAKPAK6 (32), and recombinants were identified by their occlusion-positive blue (β-gal) or white (CAT, t-PA, and SfManll; Examples 3, 4 and 5) phenotypes in plaque assays containing X-gal. Once the desired recombinants were identified, well-isolated plaques were picked, taken through one additional round of plaque purification, and working vims stocks were prepared and titered in Sf9 cells, as described below.

Sf9 cells were routinely maintained as a spinner culture in TNM-FH medium supplemented with fetal bovine semm, antibiotics, and pluronic F68, as previously described (Summers and Smith, 1987). The E2 strain of wild-type AcMNPV and the recombinant baculovimses used were routinely propagated and titrated by plaque assay in

Sf9 cells and working vims stocks were stored frozen in the dark at -85°C (Summers and

Smith, 1987, Jarvis and Garcia, 1994). The recombinant vimses used as controls for this study, which express β-gal (VL941-βgal), CAT (Ac360CAT; Example 3), t-PA (PreProTPA; Example 4), or the Sf9 a-mannosidase II protein (AcSfManll; Example 5)

under the influence of the polyhedrin promoter, have been described previously (Jarvis et al, 1993; Luckow and Summers, 1988, 1989; Example 6-10).

Working stocks of these vimses were used to compare the kinetics and levels of β- gal expression obtained in infected Sf9 cells to those obtained with a conventional polyhedrin-hased baculovims vector. Sf9 cells were grown in suspension to a density of 1

X 10^ cells per ml and infected with the appropriate vims at a multiplicity of infection of 5 plaque-forming units per cell. The vims was allowed to adsorb for one hr at 28°C, then the inoculum was removed and the cells were washed twice with TN-MFH medium supplemented with 10% serum, antibiotics, and pluronic F68 and twice with Grace's medium (Summers and Smith, 1987) supplemented with 0.5% semm, antibiotics, and pluronic F68. The infected cells were resuspended in the latter medium at a density of 1 X lθ6 per ml, returned to the spinner, and samples containing 5 X 10^ or 5 X 10^ cells were removed at various times after infection for extraction of total RNA or protein, respectively. Total RNA was prepared (Chirgwin et αl, 1979) and 20 μg, 10 μg and 5 μg aliquots were analyzed by dot blot assays on nitrocellulose filters (Schleicher and Schuell, Inc.;

Keene, NH; Luckow and Summers, 1988), as described previously. The probe was a 625 bp internal Hindi fragment of the E. coli lacZ gene that was twice gel-purified and radiolabeled by the random primer method (Feinberg and Vogelstein, 1983).

For analysis of β-gal, CAT (Example 3), and SfManll (Example 5) expression, total protein was extracted from infected cell pellets by trituration in protein dismption buffer (50 mM Tris-HCl, pH 6.8; 4% sodium dodecyl sulfate; 4% β-mercaptoethanol) through a syringe equipped with a 22 ga needle followed by boiling for 3 min. For t-PA (Example 4), extracellular medium was harvested, clarified, freeze-dried, and redissolved by boiling in protein dismption buffer. Proteins were subsequently resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis using the discontinuous buffer system (Laemmli 1970), and either stained with Coomassie Brilliant Blue or transferred to Immobilon™ PVDF filters (Millipore Coφoration, Bedford, MA) using a standard wet electrophoretic transfer method

(Towbin et αl., 1979). The filters were incubated overnight at 4°C with blocking buffer (50 mM Tris-HCl, pH 7.5; 150 M NaCl; 1% NP40; 5% nonfat dry milk), then probed in the same buffer containing appropriately diluted rabbit anti-β-gal, rabbit anti-CAT (Example 3), or goat anti-t-PA (Example 4). After washing away the unbound primary antibodies, the

filters were incubated with appropriately diluted goat or rabbit secondary antibody conjugated to alkaline phosphatase. The unbound secondary antibody was washed away, then the immunoblots were rinsed and developed using a standard color reaction (Blake et al, 1984). β-gal, CAT (Guarino and Summers, 1986; Example 3), and Sf9 α-mannosidase II

(Example 5) activities were measured by biochemical assays done on cytosolic extracts of infected cells prepared by freeze-thaw or detergent lysis at various times after infection, as described previously. Human t-PA activity (Example 4) was measured by a fibrin agar plate lysis assay done on clarified extracellular medium from infected cells isolated at various times after infection, as described previously (Jarvis et al, 1993).

Immunoblotting analysis showed that β-gal could be detected in cells infected with either immediate early vector (AcP(+)IElβgal or AcP(-)IEl βgal) as early as 4 hr postinfection. In both cases, the β-gal protein accumulated with increasing time of infection and reached peak steady-state levels at 24 hr postinfection. The occlusion-positive immediate early vector produced larger amounts of β-gal than the occlusion-negative vector, particularly at eailier times after infection, β-gal was not detected in cells infected with a conventional baculovims vector (941 βgal; polyhedrin promoter) until 24 hr postinfection and, at that time point, the amount of accumulated β-gal produced by that vector was lower than the amount produced by the immediate early vectors. However, at later times after infection, the conventional baculovims vector provided higher levels of accumulated β-gal protein. It was previously demonstrated that immunoblotting provided reasonably quantitative estimates of the relative levels of total β-gal protein in insect cell lysates (Jarvis et al, 1990), but it is possible that the difference in the amounts observed at 48 hr postinfection is underrepresented by this analysis. The amounts of β-gal enzyme activity produced by the immediate early or conventional baculovims vectors were also compared and the results, which were consistent with the immunoblotting results, are shown on a log scale plot in FIG. 2. The immediate early vectors produced β-gal activity earlier, with a peak at 24 hr postinfection, and the occlusion-positive vector produced more activity than the occlusion-negative vector. The occlusion-positive immediate early vector produced about twice as much β-gal activity as the conventional vector by 24 hr postinfection, but about 25-fold and 50-fold lower activity

by 36 and 48 hr postinfection, respectively. The reason for the difference in RNA levels was unclear, but a major difference between the two types of immediate early vector was the orientation of the z -controlled foreign gene with respect to the rest of the viral genome. Whereas the foreign genes in the occlusion-positive vectors are oriented from right to left on the AcMNPV map (Summers and Smith, 1987; O'Reilly et al, 1992), the same genes are oriented from left to right in the occlusion-negative vectors. This was not a specifically designed difference between the two different types of immediate early vectors; rather, it was a by-product of the desire to position the iel and polyhedrin promoters in the occlusion- positive vectors in back-to-back orientation. Transcriptional analysis of lacZ expression by dot blot assays showed that lacZ- specific RNA was detectable as early as 4 hr postinfection in cells infected with either immediate early baculovims vector. Cells infected with the occlusion-positive vector contained more lacZ RNA than cells infected with the occlusion-negative vector. In both cases, lacZ RNA levels reached plateaus at 24 hr postinfection and, at this time point, cells infected with the immediate early vectors contained more lacZ RNA than cells infected with a conventional vector. LacZ RNA was first detected in cells infected with a conventional vector at 24 hr postinfection and the levels continued to rise to 48 hr postinfection. These results were consistent with the results observed for expression of β-gal protein and enzymatic activity.

EXAMPLE 3 Isolation and analysis of immediate early baculovirus vectors that express E. coli CAT. Occlusion-negative and -positive immediate early baculovims vectors containing the E. coli CAT gene were produced. The BamHI fragment of pCAT#3 was inserted into the unique BamHI site of pAcP(-)IElTV5 or the Bglll site of pAcP(+)IElTVl to produce pAcP(-)IElCAT or pAcP(+)IElCAT, respectively. pAcP(-)IElCAT is designed to express CAT as a fusion protein which initiates at the z ^' el ATG and has twelve linker amino acids (D-P-S-R-F-S-G-A-K-E-A-K; SEQ ID NO: 16) fused to amino acids 1-219 of the CAT protein. pAcP(+)IElCAT encodes a fusion protein which initiates at the iel ATG and has fourteen linker amino acids iD-L-D-P-S-R-F-S-G-A-K-E-A-K; SEQ ID NO: 17) joined to

the CAT sequence and also includes the intact polyhedrin gene oriented in the opposite direction.

The kinetics and levels of CAT protein expression provided by these vectors was compared to those provided by a conventional baculovims vector (Ac360CAT; polyhedrin promoter). The immediate early vectors produced the foreign protein at earlier times after infection, with a plateau at 24 hr postinfection, and the occlusion-positive recombinant produced larger amounts than the occlusion-negative recombinant. CAT protein was first detected in cells infected with a conventional baculovims vector at 24 hr postinfection and, even at that time point, the conventional vector produced more CAT than either of the immediate early vectors. These results were consistent with the results of CAT activity assays, which showed that the immediate early vectors produced about 10-fold less activity at 24 hr postinfection and about 80-fold less activity by 36 hr postinfection (FIG. 3). These results also were consistent with previous results (Morris and Miller, 1992), which indicated that CAT activity was expressed at very low levels under iel control.

EXAMPLE 4 Isolation and analysis of immediate early baculovirus vectors that express human t-PA. The results in Examples 2 and 3 showed that immediate early baculovims vectors could produce two different prokaryotic enzymes earlier in infection, but that conventional baculovims vectors containing the polyhedrin promoter could ultimately provide higher levels of both protein and enzymatic activity. Previous findings had indicated that earlier expression would probably be advantageous for foreign glycoprotein expression (Jarvis and Summers, 1989; Jarvis et al, 1990; Muφhy et al, 1990; Sridhar et al, 1993), but this idea had never been tested by using the z ^' e7 promoter to express a foreign glycoprotein gene in baculovims-infected insect cells. Therefore, immediate early recombinants capable of expressing human t-PA, a foreign secreted glycoprotein, under z ^' e7 control were produced. This also provided a test of immediate early baculovims vectors designed to express unfused, native proteins. The native t-PA gene was inserted into pAcP(-)IElTV6 and pAcP(+)IElTV3 and the resulting plasmids were used to isolate immediate early baculovims vectors. The

BamHl-Kpnl fragment of pPrePro-t-PA (Jarvis et al, 1993) was inserted into the BamHl- Kpnl sites of pAcP(-)IElTV6 to produce pAcP(-)IEltPA, which is designed to express the native t-PA protein under the influence of the hr5 enhancer and ze7 promoter. A similar strategy was used to produce pAcP(+)IEltPA, except the Kpnl site was blunt-ended with T4 DNA polymerase and the BamHl-Kpnl (blunt) fragment was inserted into the BgHl-Stul sites of pAcP(+)IElTV3.

These vectors were used to infect Sf9 cells and the amounts of t-PA protein in the extracellular fraction of these cells were monitored by immunoblotting. As had been observed with β-gal and CAT, the immediate early vectors produced extracellular t-PA starting at 4 hr postinfection, with a peak at 24 hr postinfection, and the occlusion-positive vector produced larger amounts than the occlusion-negative vector. The conventional baculovims vector (PreProTPA; polyhedrin promoter) first produced extracellular t-PA at 24 hr postinfection and, at that time point, the amount was similar to the amount produced by the occlusion-negative immediate early vector and lower than that produced by the occlusion-positive immediate early vector. At 36 hr postinfection, the medium from cells infected with the occlusion-positive immediate early vector still contained more t-PA than medium from cells infected with the conventional vector. By 48 hr postinfection, there was a clear reduction in the amount of extracellular t-PA in the medium of cells infected by either immediate early vector, which probably reflected turnover of the extracellular t-PA product, and, at that time, the medium from cells infected with the conventional baculovims vector contained more immunoreactive t-PA protein.

The results of t-PA activity assays showed that the immediate early vectors produced t-PA activity earlier than the conventional vectors and that the levels of activity produced by the former were about equal to those produced by the latter, even at 48 hr postinfection. Thus, unlike β-gal and CAT, a conventional baculovims vector was unable to produce significantly more extracellular human t-PA protein or activity than the immediate early vectors described herein.

EXAMPLE 5

Isolation and analysis of immediate early baculovirus vectors that express Sf9 α-mannosidase II.

An occlusion-positive immediate early baculovirus vector capable of expressing a membrane-bound secretory pathway glycoprotein, α-mannosidase II, was isolated. The

BgRl-Notl fragment of pSfManll (Example 6) was inserted into the BgHl-Notl sites of pAcP(+)IElTV3 to produce pAcP(+)IElSfManII, which is designed to express the native Sf9 cell α-mannosidase II protein under the influence of the hr5 enhancer and z ^' e7 promoter. Since no antibody is available, a comparison of the amounts of total Sf9 α-mannosidase II protein expressed by immediate early or conventional baculovims vectors (AcSfManll; polyhedrin promoter) was limited to SDS-PAGE and Coomassie Brilliant Blue staining of infected cell lysates.

The results showed that the Sf9 α-mannosidase II protein, which has an M _r of approximately 131 ,000, could only be seen against the background of other infected cell proteins in lysates from cells infected for 48 hr with the conventional vector. However, when α-mannosidase II activity in these same lysates was measured, the immediate early baculovims vector produced activity earlier, with a peak at 24 hr postinfection, and at higher levels than the conventional vector at all time points examined (FIG. 4). Thus, the immediate early baculovims vector produced less total Sf9 α-mannosidase II protein, but more enzymatically active protein than the conventional vector, even as late as 48 hr postinfection. This might be related to adverse effects of baculovims infection on the host cell secretory pathway at late times of infection (Jarvis and Summers, 1989; Jarvis et al,

1990; Muφhy et al, 1990). Alternatively, it might indicate that the levels of newly synthesized protein expressed under polyhedrin control at late times of infection exceed the capabilities of the host protein processing machinery and only a relatively small proportion can be processed to an enzymatically active form.

EXAMPLE 6

Isolation and characterization of α-mannosidase II and α-mannosidase I cDNAs from Sf9 cells. An α-mannosidase II cDNA from lepidopteran insect (Sf9) cells was isolated using a degenerate oligonucleotide PCR™ approach (Moremen, 1989). Genomic DNA was isolated

from Sf9 cells by a standard method (Sambrook et al, 1989) and used for PCR™ (Saiki et al, 1985) with degenerate oligonucleotide primers

(GGITGGIIIATHGAYCCITTYGGNCA; SEQ ID NO: 13, and GGNCKISWIIIRAA RTAICCISDCCARTA; SEQ ID NO: 14) designed against conserved amino acid sequences in two class II α-mannosidases (Moremen et al, 1994), namely, murine Golgi α- mannosidase II (Moremen and Robbins, 1991) and the lysosomal α-mannosidase from Dictyostelium discoideum (Schatzle et al, 1992). PCRs™ were done in a total volume of 25 ml containing 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 2.5 mM MgCl ₂ , 0.01% (w/v) gelatin, 0.2 mM dNTP's, 1 mM primers, 1 mg of genomic DNA, and 2.5 U of Taq polymerase (Perkin-Elmer Coφ., Norwalk, CT). After 40 cycles of denaturation (45 sec at 92°C), annealing (45 sec at 45°C), and extension (3 min at 72°C) in a Perkin-Elmer thermal cycler, a final extension was done for 5 min at 72°C and the amplification products were analyzed on 1% agarose gels.

The resulting 669 bp amplification product was identical in size to a positive control RT-PCR™ product derived from murine liver mRNA. Similar RT-PCR™ products were obtained using mRNA isolated from either uninfected or baculovims-infected Sf9 cells. The PCR™ product from Sf9 genomic DNA was cloned a plasmid vector designed to facilitate direct cloning of PCR™ products (pCRII™; Invitrogen, San Diego, CA), and its sequence was determined by the chain termination method (Sanger et al, 1977). The translation of the amplimer sequence was compared to a translation of the GenBank sequence database.

The cDNA sequence was assembled using the sequence assembly package of Staden (1987). The sequence of the amplimer translation was compared to the six frame translation of the GenBank non-redundant DNA sequence database (version 91) using the TFASTA subroutine of the University of Wisconsin Genetics Computer Group (GCG) software package (Program Manual for the Wisconsin Package, Version 8.1 , Genetics Computer Group, Madison, WI). The pairwise sequence comparisons were performed using the Bestfit subroutine and multiple sequence alignments and dendrograms were prepared using the Pileup and Boxshade subroutines of the GCG software package.. Only class II mannosidases, including murine and human α-mannosidase II (42.3% and 43.3% identity, respectively) and D. discoideum and human lysosomal α-mannosidase (29.4% and 26.1%

identity, respectively), were identified by this analysis. This suggested that the Sf9 amplimer was derived from a gene that is related to the class II marmosidases and is more similar to the Golgi processing than the lysosomal mannosidases.

The Sf9 amplimer DNA sequence was used to design exact-match primers against the putative Sf9 α-mannosidase II coding region and these primers were used for PCRs™ with total λ DNA from an unfractionated Sf9 cDNA library. Electrophoretic analysis of the reaction products revealed one major DNA fragment of about the same size as the RT- PCR™ product. The same result was obtained with total λ DNA from an unfractionated Sf9 genomic DNA library or with the pCRII clone containing the Sf9 amplimer, but not in negative controls which lacked template DNA or contained one specific and one nonspecific primer. These results indicated that the uninfected Sf9 cell cDNA library included a clone containing the putative Sf9 α-mannosidase II coding region. This cDNA was isolated by using a sibling selection and PCR™ screening approach (Moremen, 1989).

Briefly, an Sf9 cDNA library in λZAPII™ (Short et al, 1988; Stratagene, La Jolla, CA) was split into 43 pools of 50,000 clones, each pool was amplified in E. coli, and total λ

DNA was prepared from 2 x 10 progeny using a commercial anti-lambdaphage immunosorbent (Lambdasorb), according to the manufacturer's instmctions (Promega Coφ., Madison, WI). These DNAs were used as templates for PCRs™ with the exact- match primers to determine which pools included an Sf9 α-mannosidase II clone. One positive pool was split into eight subpools of 10,000 clones, each subpool was reamplified in E. coli, total λ DNA was isolated, and the PCR™ screening process was repeated. Finally, one positive subpool, which theoretically included an Sf9 α-mannosidase II clone at a frequency of at least 1 in 10,000, was screened by plaque hybridization (Benton and Davis, 1977; Sambrook, 1989). The hybridization probe, which was the original Sf9 α- mannosidase II PCR™ amplimer that had been cloned into pCRII™, was excised with

EcoRI, gel-purified twice, and uniformly labeled by the random primer method (Feinberg and Vogelstein, 1983).

Positive plaques from high-density plates were taken through two additional rounds of low density plaque hybridization for further purification and screening. The cDNA inserts in two λZAPII™ clones that remained positive through all three rounds of screening were excised as Bluescript™-based plasmid subclones by coinfection with M13R408 helper

phage, as described previously (Short et al, 1988). The resulting plasmids were isolated by standard alkaline lysis extraction and CsCl-EtBr gradient centrifugation procedures (Sambrook et al, 1989) and used as templates to sequence the cDNA inserts with universal and gene-specific primers (Sanger et al, 1977). The largest cDNA (about 6.5 Kb) was sequenced with universal and gene-specific primers and compared to mammalian α- mannosidase II DNA sequences. This analysis revealed extensive similarities, but indicated that the cDNA clone lacked the 5' end of the α-mannosidase II coding region.

The 5' end of the Sf9 α-mannosidase II cDNA was isolated by using ligation- anchored PCR™ (Troutt et al, 1992) as outlined in FIG. 5A. Total RNA was prepared from a log phase culture of uninfected Sf9 cells by the method of Chirgwin and coworkers (1979) and used to prepare poly A+ RNA by oligo-dT cellulose column chromatography (Aviv and Leder, 1972). One microgram of the poly A+ RNA was used for first-strand cDNA synthesis with random hexamer primers and an RNase H-minus form of MoMuLV reverse transcriptase (Superscript™ II; Life Technologies, Gaithersburg, MD). After reverse transcription, the RNA was digested with RNAse H and the reaction mixture was diluted and desalted by ultrafiltration in a Microcon™ 100 filter (Amicon, Inc., Beverly, MA). The single-stranded cDNA was recovered and a 5'-phosphorylated, 3 '-blocked primer complementary to the T3 primer (5'-TCCCTTTAGTGAGGGTTAATTT-NH2-3' SEQ ID NO: 15) was ligated to its 3' end with T4 RNA ligase (New England Biolabs, Beverly, MA). The resulting anchored first-strand cDNA product was used as the template for a

PCR™ with T3 as the upstream primer and an Sf9 α-mannosidase Il-specific oligonucleotide (Sf31+92- in FIG. 5 A) as the downstream primer, under the conditions described by Apte and Siebert (1993). The amplification product was extracted with phenol-chloroform and a fraction was used as the template for a secondary PCR™ under the same conditions as the primary PCR™ with T3 as the upstream primer and a different Sf9 α-mannosidase Il-specific oligonucleotide (SfManII+157- in FIG. 5A) as the downstream primer. The secondary products were extracted with phenol-chloroform, gel-purified on a 1% agarose gel, and a band of interest identified by Southern blotting with the gene-specific 5' end probe shown in FIG. 5A. After the second round of PCR™ amplification, several products were observed by ethidium bromide staining, but only two (175 and 750 bp) hybridized with the 5' end probe. The 750 bp product was cloned into pCRII™, sequenced,

and the results showed that it overlapped and extended the 5' end of the Sf9 α-mannosidase cDNA clone by an additional 681 bp.

The resulting sequence information was used to design exact-match primers for amplification of the 5' end of the putative α-mannosidase II cDNA from the original Sf9 cell cDNA preparation, as diagrammed in FIG. 5B. The 5' primer (Bglll...-20 in FIG. 5B) was designed to incoφorate a unique Bglll site at position -20, with respect to the putative translational initiation site, and the 3' primer (SfManll-Al in FIG. 5B) was located downstream of a unique _ 7zoI site. This amplification product was cloned into pCRII™ to produce pSfManII-5', several independent transformants were sequenced, and the _9g7Il- Xhol fragment from a representative clone was excised and gel-purified. In parallel, the

Xhol-Dral fragment of the partial α-mannosidase II cDNA clone from the Sf9 library was subcloned into a modified form of pBSKS™+ (pBSDK/BS in FIG. 5B) to produce pSfManII-3'. Finally, the full-length Sf9 α-mannosidase II cDNA was assembled by inserting the BgH -Xhol fragment of pSfManII-5' into _9g II-A7zoI-digested pSfManII-3' to produce pSfManll, as shown in FIG. 5B. The complete sequence of the Sf9 α-mannosidase

II cDNA was assembled and analyzed using version 8.1 of the University of Wisconsin Genetics Computer Group software package (Program Manual for the Wisconsin Package, Version 8.1 , Genetics Computer Group, Madison, WI).

The assembled full-length open reading frame of the Sf9 α-mannosidase II cDNA, together with 176 bp of 5' and 179 bp of 3' sequence, is shown in SEQ ID NO:3. The 3393 bp open reading frame encodes a polypeptide of 1 130 amino acids (SEQ ID NO:4) with a 37% identity to murine Golgi α-mannosidase II (Moremen and Robbins, 1991). The first in-frame ATG in the long open reading frame is preceded by a purine at the critical -3 position, suggesting that it serves as the translation initiation site (Kozak, 1983, 1986a). Hydropathy analysis (Kyte and Doolittle, 1982) revealed a potential transmembrane domain between amino acids 14 and 34 and predicted a type II transmembrane topology similar to all other cloned Golgi processing hydrolases and glycosyltransferases (Paulson and Colley, 1989, Lowe, 1991; Moremen et al, 1994). In addition, the putative Sf9 α-mannosidase protein would have seven potential N-glycosylation sites. The protein encoded by the Sf9 α-mannosidase cDNA was compared to the protein sequences of other class II α-mannosidases. An optimized multiple sequence alignment

was generated using the Pileup and Boxshade subroutines, as described above. Protein sequences included in the alignment were the yeast vacuolar mannosidase (Yoshihisa and Anraku, 1989; Accession no. M29146), rat ER α-mannosidase (Bischoff et al, 1990; Accession no. M57547), Dictyostelium discoideum lysosomal α-mannosidase (Schatzle et al, 1992; Accession no. M82822), human lysosomal α-mannosidase (Nebes and

Schmidt, 1994, Accession no. U05572), mouse α-mannosidase II (Moremen and Robbins, 1991; Accession no. X61172), human α-mannosidase II (Misago et al, 1995; Accession no. U31520), human α-mannosidase II ^X (Misago et al, 1996; Accession no. D55649), Drosophila α-mannosidase II (Foster et al, 1995; Accession no. X77652), and Sf9 α- mannosidase II (SEQ ID NO:4).

The protein encoded by the Sf9 α-mannosidase cDNA has extensive amino acid sequence similarity to a subclass of the class II marmosidases (Moremen et al, 1994). This subclass is typified by the mammalian Golgi glycoprotein processing enzyme, α- mannosidase II, and a recently cloned homolog, α-mannosidase II ^X (Misago et al, 1995; FIG. 6). The regions of lowest sequence similarity are localized to the NH ₂ terminal 124 amino acids of the Sf9 α-mannosidase polypeptide, which encode the putative cytoplasmic tail, transmembrane domain, and "stem region". These regions were previously shown to be unessential for the catalytic activity of mammalian α-mannosidase II (Moremen et al, 1991), indicating that there would be little selective pressure to maintain their primary sequences during evolution. Suφrisingly, the predicted Sf9 α-mannosidase protein is more similar to the mammalian α-mannosidase II proteins than to the putative α-mannosidase II protein encoded by a cDNA recently isolated from Drosophila (Foster et al, 1995).

Using the same general methodology described above, an α-mannosidase I cDNA was isolated from Sf9 cells (Examples 15 through 19 below). The nucleic acid sequence is shown in SEQ ID NO: 1 , and the amino acid sequence is shown in SEQ ID NO:2.

EXAMPLE 7 Southern blotting analysis of the Sf9 α-mannosidase II gene.

Southern blotting analyses were done to examine the stmcture of the Sf9 α-mannosidase II gene and its relationship to α-mannosidase II genes from other insects and higher eukaryotes. Genomic DNA from the lepidopteran insect cell lines Sf9, Sf21, High

Five, Ea, Bm, and Md and from a mammalian cell line COS was isolated by a standard method (Sambrook et al., 1989). Twenty micrograms of the genomic DNA samples were digested with Hindlll, which does not cut the Sf9 α-mannosidase II cDNA, or with Pstl, which cuts this cDNA five times, and the digests were resolved on a 1% agarose gel. The DNA was transferred to a positively charged nylon filter (Zetaprobe™; Bio-Rad

Laboratories, Hercules, CA) under alkaline conditions (Southern, 1975; Reed and Mann, 1985) and the filter was prehybridized for at least one hour at 68°C in a buffer containing 1.5 x SSPE (15 mM NaPO ₄ , pH 7.0; 270 mM NaCl, and 15 mM EDTA), 1% (w/v) sodium dodecyl sulfate (SDS), 0.5% (w/v) nonfat dry milk, and 150 μg/ml of sheared salmon sperm DNA (Sigma). High stringency hybridizations were done overnight at 68°C in the same buffer with a twice gel-purified, random primer-labeled (Feinberg and Vogelstein, 1983), Xhol-Dral fragment of the Sf9 α-mannosidase II cDNA clone (FIG. 5A). After hybridization, the filters were washed for 15 min at room temperature with 2 x SSC plus 0.1% SDS, then with 0.5 x SSC plus 0.1% SDS, then with 0.1 x SSC plus 0.1% SDS, and finally, for 30 min with 0.1 x SSC plus 1% SDS that had been prewarmed to 50°C. For low stringency hybridizations, the hybridization temperature was reduced to 55°C and the last wash was done at room temperature. After washing, the filters were sealed in plastic bags and exposed to Kodak (Rochester, N.Y.) X-OMAT AR™ film with Fisher (Pittsburgh, PA) intensifying screens for various times at -85°C. The Hz ^' ndlll digests of DNA from Sf9, Sf21 , Bm, and Md cells produced single bands with similar hybridization intensities, suggesting that these cells have single copy, closely related α-mannosidase II genes. Pstl digests of DNA from these four cell lines produced identical multiple banding patterns (there were only four bands because two of the six expected Pstl fragments were too small to be retained by the gel) with similar hybridization intensities, supporting the idea that they all have closely related α- mannosidase II genes. By contrast, H dlll and Pstl digests of genomic DNA from High 5 and Ea cells produced different banding patterns and weaker hybridization signals, suggesting that the α-mannosidase II genes in these cell lines differ from the α-mannosidase II genes in the former cell lines. This conclusion was supported by the Southern blotting results obtained after digesting genomic DNA from Sf9, High 5, and Ea cells with six different enzymes (EcoRI, H dIII, Pstl, Sspl, Styl and Xbal), which revealed significant

differences in the restriction maps of the α-mannosidase II genes in these cell lines. The Sf9 probe failed to hybridize with DNA from COS cells, indicating that the Sf9 α- mannosidase II gene is less closely related to the α-mannosidase II genes in these mammalian cells than it is to the α-mannosidase II genes in the various lepidopteran insect cell lines. When the blots were stripped and rehybridized under lower stringency, the hybridization signals obtained with DNA from the various lepidopteran insect cells were approximately equal, but no hybridization was detected with COS cell DNA.

The nearly full-length Sf9 α-mannosidase II probe also was used for low stringency hybridizations on Southern blots of H dlll and Pstl digests of genomic DNA from insects belonging to the Orders Lepidoptera (H. virescens and //. zea), Coleoptera (7. molitor),

Orthoptera (S. gregaria), Blattaria (B. discoidalis), and Diptera (D. melanogaster), and from Xenopus laevis. The results showed that the probe hybridized with DNA from two different lepidopteran insects, Heliothis virescens (tobacco budworm) and Helicoverpa zea (co earworm), but the hybridization signal was weaker and the digestion patterns were different, when compared to the Sf9 cell controls. The Sf9 α-mannosidase II probe failed to detectably hybridize to any non-lepidopteran insect DNA, including beetle (Coleoptera), locust (Orthoptera), cockroach (Blattaria), and fruitfly (Diptera), or to frog (Xenopus) DNA. These results supported the idea that the Sf9 α-mannosidase II gene is more closely related to the α-mannosidase II genes of other lepidopteran insects than to these same genes in animals outside of the Order Lepidoptera.

EXAMPLE 8 Transcription of the Sf9 α-mannosidase II gene.

Initially, Northern blotting was used to try to examine transcription of the Sf9 α- mannosidase II gene in uninfected and baculovims-infected Sf9 cells, but this approach failed even using 20 mg of poly A+ RNA, despite being able to obtain specific RT-PCR™ products from these RNAs. Therefore, the inventors turned to the use of a more sensitive technique, ribonuclease protection (Lee and Costlow, 1987), with a 431 bp antisense riboprobe consisting of 19 bp of vector sequence followed by 412 bp of sequence from the middle of the Sf9 α-mannosidase II cDNA (positions 966-1384 in SEQ ID NO:3).

Sf9 cells were grown in 500 ml spinner flasks (Bellco Glass Co., N.J.) to a density of 1 x lθ6 cells per ml and either mock-infected or infected with wild-type baculovims (Autographa californica multicapsid nuclear polyhedrosis vims) at a multiplicity of five plaque-forming units per cell. After adsoφtion for one hour at 28°C, the cells were separated from the inoculum by low speed centrifugation, gently resuspended in 500 ml of

TN-MFH medium supplemented with 10% semm, antibiotics, and pluronic F68, and returned to the spinner flask. Total RNA either was extracted immediately from the mock- infected cells or was extracted 12, 24, or 48 h later from the infected cells and used to isolate poly A+ RNA, as described in Example 6. Twenty microgram samples of each mRNA preparation were analyzed by RNase protection assays using a commercial kit according to the manufacturer's instmctions (Ambion, Inc., Austin TX). The riboprobe for these assays was synthesized in vitro with T7 RNA polymerase (Melton et al, 1984) and [α- ³² P]-GTP (800 Ci/mmol; DuPont NEN, Boston, MA) using a commercial kit (Ambion) according to the manufacturer's instmctions. The DNA template for the transcription reactions was pSfManllDBst, a derivative of pSfManll (FIG. 5B), linearized at the PmR site. Transcription of this template produced a 431 bp antisense RNA consisting of 19 bp from the vector followed by 412 bp beginning at the _5stXI site and ending at the PmR site of the Sf9 α-mannosidase II cDNA (positions 1384 and 966, respectively, in SEQ ID NO:3). Protected fragments were analyzed on 5% acrylamide-7M urea gels, as described previously (Jarvis, 1993b), and the gels were dried and exposed to Kodak X-OMAT AR™ film with intensifying screens for various times at - 85°C.

The results showed that RNA from mock-infected Sf9 cells protected a 412 bp fragment of the probe, indicating that the α-mannosidase II gene is expressed in these cells. The steady state levels of α-mannosidase Il-specific RNA must be very low, since no protection was detected in assays with 20 μg of total RNA and large amounts ( 10 μg) of poly A+ RNA produced only a relatively weak signal. The signals observed with poly A+ RNA from infected cells were even weaker than the signal obtained from uninfected cells and little, if any, protection was observed with RNA from cells infected for 48 hours. Ethidium bromide staining of the poly A+ RNA samples used for this study indicated that

equal amounts had been loaded, suggesting that steady state levels of Sf9 α-mannosidase II RNA are reduced by baculovims infection.

EXAMPLE 9 in vitro translation and processing of the Sf9 α-mannosidase II protein.

To obtain further evidence that the Sf9 α-mannosidase II open reading frame encodes a protein, a plasmid constmct containing the Sf9 α-mannosidase II cDNA was linearized, transcribed in vitro, and the resulting RNA was used for in vitro translation studies. For these studies, the full-length Sf9 α-mannosidase II open reading frame was subcloned downstream of an SP6 promoter in the plasmid pGem7Zf+™ (Promega) to produce pGemSfManll. RNA was synthesized in vitro from Λ7_.al-linearized pGemSfManll as described above, except SP6 RNA polymerase was used instead of T7 RNA polymerase and the [α- PJ-GTP was replaced by nonradioactive rGTP.

A portion of the in vitro transcribed RNA was used for in vitro translation reactions in a rabbit reticulocyte lysate (Promega) in the presence or absence of canine pancreatic microsomal membranes (Blobel and Dobberstein, 1975; Promega), as described previously (Moremen and Robbins, 1991). Subsequently, translation reactions were treated with water, 100 mg/ml trypsin, or trypsin plus 0.1% (v/v) Nonidet-P40 (Zilberstein et al, 1980), as described previously (Moremen and Robbins, 1991 ). The reaction products were acetone- precipitated and the precipitates were dried, redissolved in protein dismption buffer [50 mM

Tris-HCl, pH 6.8; 4% (w/v) SDS; 4% (v/v) β-mercaptoethanol], and heated at 65°C for 10 min. Total solubilized proteins were analyzed by SDS-PAGE using the discontinuous buffer system (Laemmli 1970) and the gels were fluorographed with Autofluor (National Diagnostics, Atlanta, GA), dried, and exposed to Kodak X-OMAT AR™ film at -85°C. The results showed that a protein of about the expected size was produced when a rabbit reticulocyte lysate was primed with Sf9 α-mannosidase II RNA. Several additional lower molecular weight proteins were also observed, which had been seen previously in translations of murine α-mannosidase II cDNA (Moremen and Robbins, 1991), and might be explained by premature translational termination or degradation of the full-length product. When translations were done in the presence of canine pancreatic microsomal membranes, a new product was observed that was larger than the largest product translated

in the absence of microsomes. Unlike the smaller products, this one was not degraded by subsequent trypsin treatment, but was converted to a slightly smaller form.

This result indicated that the majority of the protein was oriented towards the lumen of the microsomes, where it was protected from trypsin as a result of co-translational translocation during synthesis. In support of this conclusion, this product was completely degraded when trypsin treatments were perfomied in the presence of a nonionic detergent to solubilize the membranes. The larger size of the translation product prior to proteolysis also suggested that one or more of the potential N-glycosylation sites are utilized during synthesis. Together, these results indicate that the Sf9 α-mannosidase II cDNA encodes a protein with the characteristics of a type II membrane glycoprotein.

EXAMPLE 10 Expression of the Sf9 α-mannosidase II protein in the baculovirus system.

In vivo evidence that the Sf9 α-mannosidase II cDNA encodes a protein was obtained by using a recombinant baculovims to express the cDN A under the control of the strong polyhedrin promoter in infected Sf9 cells. A standard method was used to isolate a recombinant baculovims containing the Sf9 α-mannosidase II cDNA (Summers and Smith, 1987; O'Reilly et al, 1992). The intact Sf9 α-mannosidase II open reading frame was excised from pSfManll and subcloned into the baculovims transfer vector, pVL1392 (Webb and Summers, 1990). The resulting plasmid, in which the Sf9 α-mannosidase II cDNA was positioned downstream of the strong polyhedrin promoter, was mixed with wild type viral DNA and the mixture was used to cotransfect Sf9 cells by a modified calcium phosphate precipitation method (Summers and Smith, 1987). Viral progeny were harvested five days after transfection and resolved by plaque assay in Sf9 cells, as described previously (Summers and Smith, 1987). Recombinants were identified by their occlusion-negative plaque phenotypes and taken through two additional rounds of plaque-purification. Vims stocks were prepared and titered by plaque assay in Sf9 cells and stored frozen in the dark at -85°C (Jarvis and Garcia, 1994).

The procedures used for baculovims infections and analysis of recombinant protein biosynthesis have been described previously (Jarvis and Summers, 1989; Jarvis et al,

1991). Briefly, Sf9 cells were seeded into 6-well plates (Coming Glass Works, Coming,

NY) at a density of 1 x 10 cells per well, mock-infected or infected at a multiplicity of about 5 plaque-forming units per cell, and incubated at 28°C until 24, 36, 48, or 72 h postinfection. At these time points, the cells were gently squirted off the plastic into the medium, pelleted, 0.5 ml of protein dismption buffer was added, and the cell pellets were triturated through a 1 ml syringe equipped with a 22 ga needle. The sheared lysates were boiled for 3 min, total solubilized proteins were resolved by SDS-PAGE, and the gels were stained with Coomassie Brilliant Blue, destained, and photographed.

SDS-PAGE analysis of total protein lysates of Sf9 cells infected for 48 or 72 h with this recombinant vims revealed large amounts of a new protein of about the expected size, which was not detected in mock or wild-type vims-infected lysates at any time after infection. This result, together with the kinetics of appearance and accumulation of this protein during recombinant baculovims infection, suggested that this protein is the product of the Sf9 α-mannosidase II cDNA. Evidence that the protein encoded by the Sf9 α- mannosidase II cDNA is actually an α-mannosidase II was obtained by biochemical activity assays with p-nitrophenyl-α-D-mannopyranoside as the substrate (FIG. 7A and FIG. 7B).

Sf9 cells were infected with wild-type or recombinant baculovimses were harvested by centrifugation at various times after infection, and pellets containing 1 x 10^ cells were resuspended in 100 μl of assay buffer (0.1 M MES, pH 6.3; 0.5% Triton- X-100). The cell suspensions were assayed for α-mannosidase activity by mixing 25 μl of the cell extracts with 25 μl of 10 mM p-nitrophenyl α-D-mannopyranoside in the presence or absence of various concentrations of swainsonine. The reaction mixtures were incubated in a microtiter plate for 1 hr at 37°C with gentle agitation, then quenched by the addition of 200 μl of stop solution (133 mM glycine, 67 mM NaCl, 83 mM Na CO ₃ ). Absorbance was measured at 410 nm on a plate reader (Dynatech Model MR 5000), corrected for light scattering at 570 nm, and the corrected absorbance values were converted to nmol p-nitrophenol using a standard curve produced on the same plate reader.

Extracts from Sf9 cells infected with the recombinant baculovims clearly contained higher levels of pNP-α-mannosidase activity than extracts from wild- type vims-infected controls. The levels of α-mannosidase activity increased with increasing time of infection with the recombinant, but not the wild type vims. The putative SfManll protein accumulated in the recombinant vims-infected cells to levels that could be detected by SDS-

PAGE and Coomassie blue staining of total cell lysates prepared at 48 hr postinfection. At this very late time after infection, the overexpressed protein had low specific activity. However, this was not unexpected, as previous studies have shown that production of enzymatically active secretory pathway proteins in the baculovims system is inefficient due to adverse effects of vims infection on host cell secretory pathway function (Jarvis and

Summers, 1989; Example 5). Finally, the α-mannosidase activity detected in the recombinant baculovims-infected cell extracts was sensitive to swainsonine, a known inhibitor of class II α-mannosidases (Moremen et al., 1994).

EXAMPLE 11

Construction of immediate early baculovirus vectors containing a βl,4-galactosyltransf erase cDNA.

A bovine βl,4-galactosyltransferase cDNA was subcloned into two different immediate early baculovims transfer vectors. A full-length cDNA encoding the short protein isoform of bovine βl ,4-galactosyltransferase (Harduin-Lepers et al, 1993; Russo et al, 1992) was excised from pSP65 (Promega Coφ., Madison, WI) and the resulting 1.5 Kb BamHI fragment was gel-purified, recovered, and inserted into the unique BamHI or _5glII sites of the immediate early transfer vectors pAcP(-)IElTV2 and pAcP(+)IElTV3, respectively (Example 1). The resulting plasmids (FIG. 8A and FIG. 8B) contained the βl,4- galactosyltransferase cDNA under the control of the viral iel promoter, which is active immediately after the vims enters the cell. These plasmids also included the Autographa californica nuclear polyhedrosis vims (AcMNPV) hr5 enhancer to maximize z ^' e7-mediated transcription (Guarino et al, 1986; Rodems and Friesen, 1993) and upstream and downstream flanking sequences from the AcMNPV polyhedrin gene to target the new DNA sequences to this nonessential region of the viral genome (Smith et al, 1983a). The major differences between these two plasmids were the presence or absence of the polyhedrin open reading frame, which determines whether recombinant vimses will be occlusion positive or negative, and the orientation of the z ^' e7-βl ,4-galactosyltransferase sequence with respect to other viral DNA sequences.

EXAMPLE 12 Expression of βl,4-galactosyltransferase activity.

The two plasmids shown in FIG. 8A and FIG. 8B were used to produce recombinant baculovimses and the ability of these vimses to produce βl,4-galactosyltransferase activity during infection of Sf9 cells was examined as described below. The resulting plasmids, pAcP(-)IElGaIT and pAcP(+)IElGalT (FIG. 8 A and FIG. 8B), were mixed with AcMNPV viral DNA or Bsu36I-digested BakPakό viral DNA (Kitts and Possee, 1993), respectively, and the mixtures were cotransfected onto Sf9 cells using a modified calcium phosphate precipitation method (Summers and Smith, 1987; O'Reilly et al, 1992). Several days later, the growth media were recovered from the cotransfected cells, progeny vimses were resolved by plaque assay on Sf9 cells, and recombinant vimses were visually identified by their distinctive plaque phenotypes. This was straightforward because the occlusion negative recombinant, AcP(-)IElGalT, was derived from an occlusion-positive parent (AcMNPV) and the occlusion positive recombinant, AcP(+)IElGalT, was derived from an occlusion-negative parent (BakPakό). Putative recombinants were plaque-purified twice more, passaged once, and screened for the production of βl,4-galacto sy ltransferase activity.

Cell extracts were assayed for β 1 ,4-galactosyltransferase activity by adapting previously described methods (Berger et al, 1986; Whiteheart et al, 1989). Briefly, Sf9 cells were grown to a density of about 2.5 x 10 in 25 cm flasks (Coming Glass Works, Coming, NY) and mock-infected or infected at a multiplicity of about 5 plaque-forming units per cell. After a 1 hr adsoφtion period at 28°C, the inocula were removed and the cells were rinsed and fed with fresh medium. The flasks were incubated for various times at 28°C, then the cells were dislodged and pelleted in a clinical centrifuge (IEC Model HN- SII; Needham Heights, MA). The cells were washed with cold Tris-buffered saline (25 mM Tris-HCl, pH 7.4; 140 mM NaCl), resuspended in cold assay buffer (10 mM HEPES, pH

7.4; 140 mM NaCl; 5 mM MnCl ₂ , and 0.5% NP40), and frozen at -85°C. The frozen extracts were slow-thawed, clarified for 10 min in a microcentrifuge (Fisher Model 235C; Fisher Scientific Co., Pittsburgh, PA), and total protein concentrations in the supernatants were measured using the bicinchoninic acid method (Smith et al, 1985; Pierce Chemical Company; Rockford, IL) with BSA as the standard.

Triplicate samples of the clarified extracts, each containing 100 μg of protein, were assayed for β 1 ,4-galactosyltransferase activity in a total volume of 0.1 1 ml of fresh assay buffer containing 0.3 μCi of uridine diphosphate [6- ³ H] Gal (15 Ci/mmol; American Radiolabeled Chemicals, Inc.; St. Louis, MO) and 450 μg/ml of ovalbumin (Grade V, Sigma). After 1 hr at 37°C, the reaction mixtures were quenched with 0.4 ml of cold assay buffer and spotted onto glass fiber filters (Whatman GF/D; Hillsboro, OR). The filters were dried and washed once with cold 10% (w/v) trichloroacetic acid, twice with cold 5% (w/v) trichloroacetic acid, and once with cold 95% (v/v) ethanol, then the filters were redried, placed in vials containing liquid scintillation cocktail (Packard UltimaGold; Meriden, CT), and radioactivity was measured in a liquid scintillation counter (Beckman Model LS6000-

IC; Fullerton, CA).

No activity was detected in extracts from mock- or wild type AcMNPV-infected cells, but activity was detected in extracts from recombinant vims-infected cells beginning at 4 hr postinfection and rising to a plateau at 12 hr postinfection (FIG. 9). These results were similar to those observed with analogous recombinants expressing E coli β- galactosidase, chloramphenicol acetyltransferase, human tissue plasminogen activator, or Sf9 α-mannosidase II under z ^' e7 control (Examples 2-5).

EXAMPLE 13 Modification of the insect cell N -glycosylation pathway.

The inventor contemplated that the novel immediate early recombinant baculovimses could be used to modify the N-linked oligosaccharide processing capabilities of lepidopteran insect cells. The strategy was to use the viral iel promoter (Jarvis et al, 1996) to express a bovine βl,4-galactosy ltransferase cDNA (Harduin-Lepers et al, 1993; Russo et al, 1992) early in infection and determine if this enzyme could contribute to the insect cell N-glycosylation pathway and modify a foreign glycoprotein synthesized later in infection.

The gp64 protein is the major stmctural glycoprotein in progeny virions that bud from the surface of AcMNPV-infected cells (Volkman, 1986). Biosynthesis of AcMNPV gp64 peaks at 24 hr postinfection and at least one of its N-linked oligosaccharide side chains is processed to an endo-β-D-N-acetylglucosaminidase H-resistant form (Jarvis and Garcia,

1994), but it contains no galactose (Jarvis and Finn, 1995). Thus, if gp64 from recombinant virions contained galactose, this would indicate that the β 1 ,4-galactosyltransferase encoded by the recombinant vims had contributed to the host cell processing pathway and extended one or more of the N-linked oligosaccharide side chains on gp64. Sf9 cells were grown to a density of about 1 10 cells per ml in 100 ml spinner flasks (Bellco Glass Inc., Vineland, N.J.) and infected with wild-type or recombinant baculovims at a multiplicity of about 4 plaque-forming units per cell. At 48 hr postinfection, the infected cells were harvested, pelleted, and progeny budded vims particles were partially purified from the cell-free supernatant as described previously (Jarvis and Garcia, 1994). The budded vims preparations were treated for 10 min on ice with cold extraction buffer [50 mM Tris, pH 8.0; 100 mM NaCl, 1% (v/v) NP40, 0.2 mM leupeptin], the extracts were clarified in a microcentrifuge (Fisher Model 235C).

The gp64 protein was immunoprecipitated from the supernatants with a monoclonal antibody (AcVl; 54) as described previously (Jarvis and Summers, 1989). The immunoprecipitates were washed, dismpted, resolved by discontinuous SDS-PAGE

(Laemmli, 1970), and proteins were transferred to Immobilon™ membranes (Millipore Coφ.; Bedford, MA). The membranes were cut into strips corresponding to individual lanes and the strips were probed with either digoxigenylated lectins (Boehringer Mannheim Biochemicals; Indianapolis, IN) or rabbit anti-gp64, as described previously (Jarvis and Finn, 1995). Bound lectins or antibodies were detected by secondary reactions with alkaline phosphatase-conjugated anti-digoxigenin (Boehringer) or alkaline phosphatase-conjugated goat anti-rabbit IgG (Sigma), respectively, followed by an alkaline phosphatase color reaction (Blake et al, 1984). For some lectin blotting studies, gp64 was pretreated with peptide :N-glycosidase F (New England Biolabs, Beverly, MA) as described previously (Jarvis and Finn, 1995).

Lectin blotting analyses showed that Ricinus communis agglutinin (RCA), which binds to β-linked galactose, bound strongly to gp64 from recombinant virions (FIG. 10B). Binding was carbohydrate-specific, as indicated by the inability of RCA to bind to gp64 from wild type virions (FIG. 10A) or to gp64 from recombinant virions when the reaction was done in the presence of competing galactose (FIG. 10B). RCA binding was not observed after pretreatment of gp64 from recombinant virions with peptide :N-glycosidase F,

which showed that the galactose on gp64 was part of an N-linked oligosaccharide side chain (FIG. 1 1).

EXAMPLE 14 Influence of galactose addition on glycoprotein function.

The AcMNPV gp64 protein plays a key role in baculovims infection, serving as a usogen which apparently mediates penetration of budded vims particles into the host cell during adsoφtive endocytosis (Volkman, 1986; Blissard and Wenz, 1992; Volkman and Goldsmith, 1985; Volkman et al, 1986). This led to the question of whether galactosylation of gp64 and/or other virion glycoproteins influenced the growth of the immediate early recombinant vims.

To address this question, the one-step growth curves of wild type AcMNPV and immediate early recombinants expressing βl,4-galactosy ltransferase or β-galactosidase under z ^' e7 control were compared. For the one-step growth studies, viral titers were determined by TCID ₅₀ assays and the results were converted to plaque-forming units per ml using a Microsoft ^® Excel spreadsheet (Summers and Smith, 1987; O'Reilly et al, 1992). The results showed that there was no significant difference in the growth rates or numbers of infectious progeny produced by any of these vimses during in vitro infection of cultured Sf9 cells (FIG. 12).

EXAMPLE 15 Isolation and Characterization of an αK2-Mannosidase cDNA from Sf9 Cells

The presence of different types of oligosaccharide side-chains is one source of functional and stmctural diversity in glycoproteins. During the past ten years, a large number of genes encoding the enzymes that modify N-linked glycans have been cloned and characterized (Moremen et al, 1994; Field and Wainwright, 1995). Glycoproteins acquire their N-linked oligosaccharide side-chains in the lumen of the endoplasmic reticulum (ER) by the transfer of a preassembled Glc _j MangGlcNAc _j precursor from dolichol pyrophosphate to specific asparagine residues in the nascent polypeptide. These side-chains are then remodeled by the action of processing enzymes. In mammals, this involves trimming of the glucose residues and up to six of the nine mannose residues followed by the addition of fucose, N-acetylglucosamine, galactose, and sialic acid residues (reviewed by Kornfeld and Kornfeld, 1985). One part of this pathway that is being intensively investigated is trimming of the αl,2-linked mannose residues. Studies have shown that this is accomplished by a family of αl,2-mannosidases that act on glycoproteins in both the ER and Golgi apparatus

(Moremen et al, 1994).

It is generally accepted that insect cells, like mammalian cells, can trim N-linked glycans and extend them by adding fucose and N-acetylglucosamine. However, data suggest that insect cells differ from higher eukaryotes by their inability to add antennary galactose or sialic acid to these side-chains (Marz et al, 1995). Insect cells clearly have αl,2-mannosidase activity involved in the trimming of N-linked glycans. This was demonstrated by the ability of 1-deoxymannojirimycin (dMNJ), a specific inhibitor of class I α-mannosidases, to block the processing of N-linked glycans on gp64, the major virion glycoprotein produced in baculovims-infected lepidopteran cells (Jarvis and Garcia, 1994). More direct evidence was provided by Ren and coworkers (1995), who purified an enzymatically active αl,2-mannosidase from a membrane fraction of baculovims-infected lepidopteran insect cells (Ren et al, 1995). Finally, a putative αl,2-mannosidase gene was recently cloned from Drosophila (Kerscher et al. , 1995), although it was not proven that this gene actually encodes an active enzyme. Cloning and characterization of the genes encoding these enzymes from various organisms will help to elucidate the stmctural and functional relationships among these enzymes. The present Example details the cloning of

an αl,2-mannosidase cDNA homolog from a lepidopteran insect cell-line Sf9 cDNA library.

This cDNA contains an open reading frame which encodes a 670 amino acid protein with a calculated molecular weight of 75,225 Da and, like other αl,2-mannosidases, is predicted to be a type II integral membrane protein with a short N-terminal cytoplasmic domain and a large C-terminal catalytic domain. This protein has two potential N- glycosylation sites, two consensus calcium binding sequences, and is predicted to be a type II integral membrane protein with a 22 amino acid transmembrane domain (residues 31 to 52). The amino acid sequence of this protein is 35-57% identical to Drosophila, human, murine and yeast αl,2-mannosidases. A transcript of approximately six kilobases was detected by Northern blot analysis of Sf9 mRNA. Genomic Southern blots probed with an intron-free fragment of the α 1 ,2-mannosidase gene indicated that there are at least two copies or cross-hybridizing variants of this gene in the Sf9 genome. In vivo expression of the cDNA using a recombinant baculovims produced a protein which released [ H]mannose from [ ³ H]Man9GlcNAc. This activity required calcium, but not magnesium, and was inhibited by 1-deoxymannojirimycin. These results indicate that Sf9 cells encode and express an αl,2-mannosidase with properties similar to those of other eukaryotic processing α 1 ,2-mannosidases.

A 675 bp fragment of an αl ,2-mannosidase homolog was amplified by polymerase chain reaction (PCR™) from an Sf9 cDNA library in λ ZapII. Degenerate oligonucleotide 1

(GAYWSITTYTAYGARTAYYTIYTNAA; SEQ ID NO:18) and degenerate oligonucleotide 2 (RTGNGCYTCNGTRTTRAA; SEQ ID NO: 19), corresponding to conserved amino acid sequences in yeast (Camirand et al, 1991) and rabbit (Lai et al, 1994) αl,2-mannosidases (Herscovics et al, 1994) were used to amplify a putative αl,2- mannosidase fragment from an Sf9 cDNA library in 1-ZAPII (Short et al, 1988; Stratagene,

La Jolla, CA). The template for the polymerase chain reactions (PCRs™; Saiki et al, 1985) was 2.5 ml of a clarified λ-ZAPII plate lysate (5 x 10 pfu/ml) prepared in SM buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 8 mM MgSO ₄ ) and the reactions were done in a total volume of 50 ml containing final concentrations of 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM MgCl ₂ , 0.2 mM dNTP's, 1.25 units of Taq polymerase, and 1 mM of each primer.

PCRs™ were performed in a Perkin-Elmer thermal cycler (Perkin-Elmer Coφ., Norwalk,

CT) programmed for 5 min at 94°C followed by 40 cycles of 1 min at 94°C, 1 min at 45°C, 3 min at 72°C, and a final extension of 7 min at 72°C.

The identity of the PCR™ amplimer as a putative α 1 ,2-mannosidase fragment was confirmed by Southern blotting (Southern, 1975; Sambrook et al, 1989), with an end- labeled degenerate oligonucleotide (RTAIARRTAYTTIARIGTYTCIGCNA; SEQ ID

NO:20) designed against a third conserved amino acid sequence located between the two conserved regions used to design the PCR™ primers. The PCR™ amplimer was gel- purified, cloned into pBSKS+ (Stratagene), and sequenced using the chain termination method (Sanger et al, 1977). The sequencing results were used to design exact-match oligonucleotide primers

(Sf Manl +1310+ (GCATCATGTTCGACACG; SEQ ID NO:21) and Sf Manl +1791- (GTGGTAGACGTTCACGAGAC; SEQ ID NO:22); the numbers identify the position of the 5' end of the oligo with respect to the start of the Sf9 α 1 ,2-mannosidase ORF, and the signs following these numbers indicate sense (+) or anti-sense (-)) to isolate an αl,2- mannosidase clone from the Sf9 cDNA library by sibling selection and PCR™, as described previously (Moremen, 1989; Example 6 above). The PCR™ reaction conditions were as described above except the annealing step was done at 54°C instead of 45 °C. The library was initially split into 22 subpools of 50,000 clones. A positive subpool of 50,000 was further split into 15 "daughter" subpools of 5,000 clones, and a positive subpool of 5,000 was finally split into 12 daughter subpools of 2,000 clones. A positive subpool of 2,000 was then screened by plaque hybridization (Benton and Davis, 1977) with the cloned PCR™ amplimer, which had been excised from the vector, gel-purified twice, and uniformly labeled with [α- ³² P]dATP (Feinberg and Vogelstein, 1983).

A positive clone was identified and plaque purified once more. The cDNA was excised in vivo as a pBluescript-based subclone by coinfecting E. coli XLI-Blue

(Stratagene) with this λ-ZAPII isolate plus M13-R408 helper phage. Double-stranded plasmid DNA was prepared and sequenced using the ABI PRISM™ Dye Terminator cycle sequencing method with AmpliTaq DNA polymerase (Perkin-Elmer Coφ.).

This initial cDNA clone lacked about 600 bp from the 5 ^' end of the putative αl ,2-mannosidase ORF. Hence, the 22 subpools (50,000 clones each) of the cDNA library were re-screened for a full-length clone using a modified 5 ^' rapid amplification of cDNA

ends (5'-RACE) procedure (Frohman et al., 1988), as outlined in FIG. 14. Briefly, a T7- adapter primer (TTGCGTCTACTGCAGTCTACGACTCACTATAGGGC; SEQ ID NO:23) was designed to be complementary to the T7 promoter sequence in the λ-ZAP II vector and to include a 17-base adapter sequence at its 5 ^' end. This primer could anneal to the T7 promoter sequence of every cDNA clone in the library. The other primers in the reaction were an Sf9 αl,2-mannosidase-specific primer (AAGTGAGCTCGCTTCGACAT; SEQ ID NO:30) complementary to an internal sequence near the 5' end of the partial cDNA clone and a primer corresponding to the adapter sequence at the 5' end of the T7-adapter- primer. These two primers could anneal only to clones containing the Sf9 αl,2- mannosidase cDNA. The size of the amplimer produced by this procedure reveals the length of the cDNA sequence located upstream of the Sf9 α 1 ,2-mannosidase-specifιc primer in the clone being amplified.

PCRs™ were done as described above with 54°C for annealing and the following primer concentrations: 70 nM of the T7-adapter-primer (SEQ ID NO:23), 1 mM of the 17- base adapter primer (TTGCGTCTACTGCAGTC; SEQ ID NO:24), and 1 mM of the sequence-specific primer. A subpool that included a putative full-length α 1,2 -mannosidase clone was identified and the clone was isolated by sibling selection and plaque hybridization as described above except the modified RACE procedure was used to screen the various subpools. Finally, the cDNA was excised and sequenced as described above and was found to contain a complete ORF encoding a putative l,2-mannosidase. Computer analyses of the cDNA sequence were carried out using the Fragment Assembly System, Peptide stmcture, and GAP subroutines of the University of Wisconsin Genetics Computer Group software package (Program Manual for the Wisconsin Package, Version 8, September 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 5371 1). This screening procedure identified a full-length αl ,2-mannosidase cDNA clone which contains an ORF that begins with an ATG in a favorable sequence for translational initiation (SEQ ID NO:l ; Kozak, 1984, 1986; Cavener and Ray, 1991). This ORF encodes a 670 amino acid protein (SEQ ID NO:2) with a calculated molecular weight of 75,225 Da. The amino acid sequence of this putative Sf9 αl,2-mannosidase is 57%, 47%, 46%, 46%, and 35% identical to Drosophila (Kerscher et al, 1995; GenBank Accession # X82640), mouse IA (Lai et al., 1994; GenBank Accession # U04299), mouse IB (Herscovics et al,

1994; GenBank Accession # U03458), human (Bause et al, 1993; GenBank Accession # X74837), and yeast (Camirand et al, 1991 ; GenBank Accession # M63598) processing αl,2-mannosidases, respectively. The putative Sf9 αl,2-mannosidase is predicted to be a type II integral membrane protein with a 22 amino acid transmembrane domain (residues 31 to 52). It contains two potential N-glycosylation sites (residues 61 and 332) and two putative calcium binding sequences (residues 258 to 269 and 273 to 284) as defined by Marsden and coworkers (1990). In addition, there are several other potential calcium binding sequences, but these have less than three acidic residues available for binding calcium and are therefore less likely to be significant (Marsden et al. , 1990). The N-glycosylation pathway in insects is thought to be a tmncated version of the mammalian pathway, lacking the ability to add antennary galactose or sialic acid to oligosaccharide side-chains (reviewed in Marz et al, 1995). On the other hand, there have been a few reports which indicate that baculovims-infected lepidopteran insect cells can produce N-linked glycans containing penultimate galactose and terminal sialic acid (Davidson et al, 1990) and that this process might be facilitated by baculovims induction of an α 1,2 -mannosidase with preferential activity toward Man ₆ GlcNAc ₂ (Davidson et al, 1991). An enzyme with this activity was recently purified from a membrane fraction of baculovims-infected lepidopteran insect cells by Ren and coworkers (1995). However, since the gene encoding this enzyme has not been isolated, the relationship, if any, between this enzyme and the instant αl ,2-mannosidase is unclear.

EXAMPLE 16

PCR™ screening of introns within the Sf9 αl ,2-mannosidase gene and genomic Southern blotting Preliminary PCR™ studies using primers corresponding to selected regions in the

Sf9 αl,2-mannosidase sequence were done to identify an intron-free region in the Sf9 αl,2-mannosidase gene that could be used as an unambiguous probe for genomic Southern blots. Several pairs of exact-match primers corresponding to various regions in the Sf9 αl,2-mannosidase cDNA were used for PCR's™ on Sf9 genomic DNA to determine if it contained any introns. The primer pairs were: pair 1, Sf MI +1310+ (SEQ ID NO:21) and

Sf MI +2123- (CCTTGCTATTTACTCTCGTC; SEQ ID NO:25); pair 2. Sf MI +843+

(TGTGTTCGAGACGACGATC; SEQ ID NO:26) and Sf MI +1492- (GACATCGAGTTGTCCAGG; SEQ ID NO:27); and finally pair 3, Sf MI -25+ (GTGTAGGTTCTGTGTTTACG; SEQ ID NO:28) and Sf MI +306- (TTCACCATGGTGAGCGATC; SEQ ID NO:29). PCR's™ were done as described above, except the template was 100 ng of Sf9 genomic DNA isolated as described previously

(Sambrook, 1989). The presence of introns was indicated by an increase in the size of the product amplified from the genomic DNA template relative to the size of the product amplified from the cDNA clone. The identity of the PCR™ products as fragments of the αl,2-mannosidase gene was confirmed by Southern blotting (Southern, 1975) with the full- length Sf9 α 1 ,2-mannosidase cDNA, which had been excised from the vector, gel purified

32 twice, and uniformly labeled with [α- PjdATP (Feinberg and Vogelstein, 1983).

These studies identified two regions containing introns, as indicated by an increase in the size of the product amplified from Sf9 genomic DNA relative to the size of the product amplified from the cDNA. It is important to note that there could be other intron- containing regions within the gene, since the PCR™ screening was not comprehensive.

However, one region of this gene, corresponding to positions -25 to +306 contained no detectable introns. Therefore, the inventors used a 302 bp SnaBI (position -6)-Nco7 (position +296) fragment from this region as a probe for genomic Southern blotting analyses. Genomic DΝA from Sf9, Bm, High Five, Ea, or COS cells was digested with either

Nco7 alone, or with both SnaBI and Nco7, and analyzed by Southern blotting under high stringency conditions. Sf9 cells are derived from the IPLB-Sf21-AE cell line, which was originally isolated from Spodoptera frugiperda (fall armyworm) ovaries (Vaughn et al, 1977). Sf9 cells were maintained as a suspension culture at densities between 0.3 and 3.0 x IO ⁶ cells per ml in TΝM-FH medium (Summers and Smith, 1987) supplemented with 10%

(v/v) heat-inactivated fetal bovine semm (Sigma Chemical Co., St. Louis, MO), 1.25 mg/ml amphotericin B (Sigma), 25 mg/ml gentamicin (Sigma), and 0.1% (w/v) pluronic F68 (BASF Wynandotte Coφ., Parsippany, ΝJ; Murhammer and Goochee, 1988). The other lepidopteran insect cell lines used in this study were BTI-Tn-5Bl-4 (High Five; Wickham et al, 1992), derived from Trichoplusia ni (cabbage looper) eggs; Bm 5 (Bm; Grace, 1967), derived from Bombyx mori (silkmoth) ovaries; and BTI-EaA (Ea; Granados and Νaughton,

1975), derived from Estigmene acrea (saltmarsh cateφillar). COS-1 (Gluzman, 1981) is an SV40-transformed monkey kidney cell line.

Approximately seven mg of genomic DNA from Sf9, Bm, High Five, Ea, and COS cells were digested with either Ncol only or with both SnaBI and Nco7. The DΝA's were resolved on 1% agarose gels, depurinated by soaking in 0.25 M HC1 for 10 min, and transferred to positively charged nylon membranes (Zeta-Probe ; Bio-Rad Laboratories,

Hercules, CA) in 0.4 M ΝaOH (Southern, 1975; Reed and Mann, 1985).

The membranes were prehybridized for one hour in a solution of 7%(w/v) SDS, 0.12 M Νa ₂ HPO ₄ (pH 7.2), 0.25 M NaCl, 1 mM EDTA, and a formamide concentration of 50%, 42%, or 35% for decreasing levels of stringency. Hybridization was carried out overnight at

43°C in the same solution using a fragment of the Sf9 α 1 ,2-mannosidase cDNA prepared as described above. For these analyses, however, the probe was an internal 302 bp, SnaBl- Ncol fragment corresponding to positions -6 (SnaBI) to +296 (Nco7 ) of the cDΝA with respect to the start of the ORF. PCR™ analysis of Sf9 genomic DΝA had shown that there were no introns within this region of the genomic copy of the αl,2-mannosidase gene.

After hybridization, the membranes were rinsed in 2X SSC then washed successively with vigorous agitation for 15 min in each of the following solutions: 2X SSC/0.1% SDS at room temperature; 0.5X SSC/0.1% SDS at room temperature; 0.1X SSC/0.1% SDS at either 65°C for high stringency (50% formamide) or room temperature for low stringency (42% or 35% formamide). The membranes were then blotted dry and exposed to Kodak (Rochester,

Ν.Y.) BioMax MS film for 24 hours with an intensifying screen.

The probe hybridized with two fragments from the Nco7-digested Sf9 DΝA, suggesting that there are two copies or two cross-hybridizing variants of the l,2- mannosidase gene in the Sf9 genome. The same probe hybridized with a single 302 bp fragment of the SnaBI and Nco7 doubly-digested Sf9 DΝA, indicating that the two α- mannosidase genes differ with respect to the positions of their upstream Nco7 sites, and that the positions of the SnaBI and downstream Nco7 sites are conserved. Similar results were obtained with genomic DΝA from Bm cells, except the upper fragment detected in the Nco7 digest was lighter. Very light hybridization was detected with DΝA from High Five cells, and no hybridization was detected with DΝA from Ea or COS cells. These results indicated that the α 1 ,2-mannosidase genes present in High Five, Ea, and COS cells are significantly

different from those present in Sf9 and Bm cells. This might help to explain why these cell lines have differing N-glycan processing capabilities (Davis et al, 1993; Ogonah et al, 1996).

To further investigate these differences, the Southern blotting analyses of Sf9, High Five, and Ea genomic DNA were repeated under less stringent conditions (42% formamide and 35% formamide). Under these conditions, the probe hybridized with three major fragments of Nco7-digested Sf9 DΝA, one major fragment of Nco7-digested High Five cell DΝA, and several fragments of Nco/-digested DΝA from Ea cells. The probe hybridized with multiple fragments of various sizes with SnaBI and Nco7 double-digests of the DΝA from these three insect cell lines.

EXAMPLE 17 Expression of the αl .,2-mannosidase gene

To study the expression of the α-l,2-mannosidase gene, Northern blotting analysis of Sf9 mRNA was conducted with the full-length Sf9 αl ,2-mannosidase ORF as a probe. g

Total RNA from approximately 2 x 10 Sf9 cells was prepared by the method of Chirgwin and coworkers (1979) and messenger RNA was isolated on an oligo-dT cellulose column (Aviv and Leder, 1972). Ten mg of the Sf9 mRNA were resolved on a 1.2% agarose/0.66 M formaldehyde gel and transferred to a positively charged nylon membrane (Zeta-Probe ; Bio-Rad) in 50 mM NaOH. Prehybridization, hybridization, washing, and autoradiography were done as described in Example 16, except 10% (w/v) PEG-8000 (Sigma) was used in the hybridization solution and the probe contained the complete ORF of the Sf9 αl,2- mannosidase gene.

Northern blotting analysis of Sf9 mRNA with the full-length Sf9 αl,2-mannosidase ORF as a probe revealed a single transcript of about 6 kb. Since the αl ,2-mannosidase ORF is only about 2 kb in length, most of the remaining 4 kb is probably 3 ^' untranslated region in the mRNA transcript. This speculation is supported by the fact that the initial (partial) Sf9 αl,2-mannosidase cDNA clone contained about 3 kb of 3' untranslated sequence.

EXAMPLE 18 Baculovirus-mediated overexpression of the Sf9 αl ,2-mannosidase

A recombinant baculovims was produced that encoded the Sf9 α 1 ,2-mannosidase cDNA under the control of the strong polyhedrin promoter and used to express the Sf9 α 1 ,2-mannosidase protein. The Sf9 αl,2-mannosidase ORF was subcloned into a baculovims transfer plasmid (pVL1393; Webb and Summers, 1990) downstream of the polyhedrin promoter. The resulting plasmid was used to produce a baculovims expression vector encoding the Sf9 αl,2-mannosidase gene under polyhedrin control by using standard methods (Summers and Smith, 1987; O'Reilly et al, 1992). The viral DNA used as the target for homologous recombination was BacPAK6 (Kitts and Possee, 1993) that had been digested with Bsu36I (New England Biolabs, Beverly, MA). Recombinant vimses were plaque purified twice, titered by plaque assay, and used to infect Sf9 cells. Expression of the αl,2-mannosidase protein was assessed by discontinuous SDS-polyacrylamide gel electrophoresis (PAGE) and Coomassie-blue staining of total protein lysates, as described previously (Laemmli,1970; Jarvis et al, 1996).

A protein with an apparent molecular weight of about 68 kDa was observed in total lysates from cells infected with the recombinant baculovims, but not in lysates from mock- infected or wild-type baculovims-infected cells at 48 and 72 hours postinfection. The 29 kDa polyhedrin protein was detected only in lysates from wild-type baculovims-infected cell lysates at 48 and 72 hours postinfection. These results are consistent with those expected of a recombinant baculovims encoding a foreign protein under the control of the polyhedrin promoter.

EXAMPLE 19 α-mannosidase activity assays

Sf9 cell lysates were used for αl,2-mannosidase activity assays with [ HJMangGlcNAc as described previously (Herscovics and Jelinek-Kelly, 1987) with some modifications. The cells were seeded into 25 cm tissue culture flasks (Coming Glass Works, Coming, NY) at a density of 3 million cells per flask and infected at a multiplicity of infection of 10 plaque forming units per cell with either a recombinant baculovims encoding the Sf9 α 1 ,2-mannosidase cDNA under the control of the polyhedrin promoter, or

wild type baculovims as a control. The cells were harvested by centrifugation at selected times after infection, washed with 100 mM Na MES (pH 6.0), and lysed using 1 ml per 30,000 cells of the same buffer containing 0.5% Triton X-100 with or without 80 mM EDTA. Five ml of the lysates were used in each reaction of the αl,2-mannosidase activity assays. Cell lysates for negative control reactions were boiled for 3 min prior to being added to the reactions. All reactions were carried out in a total volume of 40 ml containing 75 mM Na ⁺ MES (pH 6.0), 0.0625% Triton X-100, and 6000 cpm of [ ³ H]Man _< ,GlcNAc. In addition, some reactions contained CaCl ₂ , MgCl ₂ , EDTA, or dMNJ. The reactions were incubated at 37°C for 2.5 hours, boiled for 2 min, and 250 ml of a 5 mM solution of CaCl ₂ ,

MgCl ₂ , and MnCl ₂ , and 175 ml of a 2.25 mg/ml solution of concanavalin A (Boehringev- Mannheim, Indianapolis, IN) in 3.8 M NaCl were added to each reaction. The solutions were vortexed gently and incubated at room temperature for two minutes, then 1 ml of 25% PEG-8000 was added and the solutions were vortexed and incubated for another 5 min at room temperature. The solutions were then centrifuged for 2 min at 10,000 X g, 1 ml of the supernatant was added to 4 ml of a scintillation cocktail (Ultima Gold™; Packard

Instmment Company, Meriden, CT), and radioactivity was measured using a Beckman liquid scintillation counter (Model LS 6000IC; Beckman Instmments, Inc., Fullerton, CA).

Using this assay, there was no difference in the levels of α-mannosidase activity detected in lysates from wild-type vims-infected cells or in boiled lysates (FIG. 15A). This result indicated that the endogenous activity in wild type vims-infected cells was too low to be detected by this assay. By contrast, recombinant vims-infected cells contained significantly higher levels of activity than boiled lysates. Activity was detected at 24, 36, and 48, but not at 12 hours postinfection, and more activity was detected at 36 and 48 than at 24 hours postinfection (FIG. 15 A). Like the protein profiles, these results were consistent with those expected of a recombinant baculovims encoding a foreign enzyme under the control of the polyhedrin promoter. The α-mannosidase activity observed in recombinant baculovims-infected cells was strongly inhibited by dMNJ, an inhibitor of class I α- mannosidases, and by EDTA (FIG. 15B). The inhibition by EDTA could be reversed by the addition of calcium, but not magnesium. These properties are identical to those of αl ,2- mannosidases from other eukaryotes (Moremen et al, 1994).

EXAMPLE 20

Isolation and Characterization of Stably-transformed Sf9 Cells that Express Mammalian βl,4-galactosyltransferase Expression plasmids and methods have been described that can be used to produce stably-transformed insect cell subclones that express foreign genes constitutively (Jarvis et al., 1990; Jarvis and Guarino, 1995; Examples 1-5 above). Briefly, various expression plasmids were constmcted containing a baculovims IE1 promoter and hr5 enhancer that can be used to express any gene of interest or selectable marker in uninfected insect cells. Sf9 cells were cotransfected with derivatives of these constmcts containing various genes of interest, selected for neomycin resistance, and subclones were produced by limiting dilution. After amplification, the subclones were screened for their ability to express the gene of interest.

This general procedure was used to successfully produce a variety of stably- transformed Sf9 subclones that express different gene products, including E. coli β- galactosidase, human tissue plasminogen activator, and the baculovims IE2, pp31, and gp64 proteins (Jarvis et al, 1990, Examples 1-5 above). Other labs also have used this approach to produce stably-transformed insect cells that express various foreign gene products (Cartier et al, 1994; Henderson et al, 1995; Joyce et al, 1993). As described above, it has been demonstrated that IE 1 -based recombinant baculovims vectors could be used to express a bovine βl ,4-galactosy ltransferase (β4-GT) cDNA and modify the Sf9 cell N-glycosylation pathway, as detailed above (Examples 11-14 above). The present Example describes the isolation of a stably-transformed Sf9 cell subclone that constitutively expresses β4-GT.

Sf9 cells were cotransfected with immediate-early expression plasmids containing the β4-GT or neo genes positioned under IE1 control. The cotransfected cells were selected in neo, as described above, and extracts from ten independent subclones were screened for β4-GT activity, as previously described (Examples 11-14 above). The results showed that all ten of these subclones produced β4-GT activity, though expression levels were quite variable. Subclone 9, which expressed the highest levels of activity was designated SfGalT and further characterized by genomic Southern blotting. The results showed that these cells

have multiple tandem duplications of the expression plasmid integrated at one site and a single copy inserted at one additional site.

The ability of these cells to modify a foreign glycoprotein was demonstrated by comparing the lectin blotting profiles of gp64 isolated from progeny virions from either Sf9 or SfGalT cells infected with wild-type baculovims. The results of the lectin blots showed that RCA failed to bind specifically to gp64 from the progeny from Sf9 cells, whereas it clearly bound to gp64 from the progeny from SfGalT cells (FIG. 16A and FIG. 16B). These results indicated that gp64 produced by Sf9 cells lacks β-linked galactose, while gp64 produced by SfGalT cells contains β-linked galactose. Thus, a stably-transformed insect cell subclone has been successfully produced which has an N-glycosylation pathway that has been genetically and biochemically engineered to include mammalian β4-GT activity.

Lectin blotting results also showed that the SfGalT cells differentially modified human tissue plasminogen activator, which was expressed when these cells were infected with a conventional recombinant baculovims expression vector. Tissue plasminogen activator produced under the control of the polyhedrin promoter in Sf9 cells failed to bind to

RCA, whereas the same protein produced by the same vims in SfGalT cells bound to RCA (FIG. 17A and FIG. 17B). These results indicate that SfGalT cells can be used to produce more extensively N-glycosylated foreign glycoproteins when used in conjunction with conventional baculovims expression vectors.

EXAMPLE 21 Isolation and characterization of stablv-transformed Sf9 cells that express mammalian βl.4-galactosyltransf erase and α2,6-sialyltransferase This example describes the production of a new Sf9 cell subclone that has both mammalian β4-GT and c.2,6-sialyltransferase (α2,6-ST) activity. A new immediate early expression plasmid was constmcted that contains two copies of the IE1 promoter. The starting materials were pIElHR4 and pAcP(-)IElTV6 (Examples 1-5 above), which were recombined to produce an expression plasmid with two back-to-back IE1 promoters separated by the hr5 enhancer element. Each promoter is followed by at least one unique restriction site, which was used for the subsequent insertion of bovine β4-GT (Shaper et al,

1°88) and rat α2,6-ST (Weinstein et al, 1987) cDNAs.

The ability of the resulting plasmid to express β4-GT and rat α2,6-ST is tested by transient transfection assays. Briefly, Sf9 cells are transfected with 10 μg of plasmid DNA, detergent extracts are prepared at 24 hr after transfection, and β4-GT and rat α2,6-ST activities are measured. Cell extraction and radioassay methods for both enzyme activities have been described (Examples 1 1-14 above; Paulson et al, 1977). Control transfections are done using the dual expression plasmid with no inserts, or IE1 expression plasmids containing the individual β4-GT and rat α2,6-ST cDNAs.

Next, the plasmid was used for coselection of an Sf9 cell subclone, as described in Example 19 above. Sf9 cells were cotransfected with the dual IE1 expression plasmid plus IE 1 Neo, and transformants were isolated by selection in neomycin followed by limiting dilution. Subclones are amplified and screened for both activities. Subclones that have both activities are characterized by genomic Southern blotting to evaluate the nature of the genetic modification. The ability of these cells to differentially glycosylate gp64 is assessed first by lectin-blotting assays designed to specifically detect β-linked galactose or α2,6- linked sialic acid. The same proteins expressed in untransformed Sf9 cells with the same recombinant viruses and lectins preincubated in the presence of competing sugars are used as controls.

EXAMPLE 22 Recombinant Baculoviruses and Transfer Plasmids

1. AcP(+)DIE-GTST

AcP(+)DIE-GTST (FIG. 20A) is a recombinant baculovims that contains early- promoted and hr-enhanced galactosyltransferase (GT) and sialyltransferase (ST) genes in the polyhedrin region. This vims is used together with a conventional recombinant baculovims to coinfect conventional host cell lines. AcP(+)DIE-GTST expresses GT and

ST early in infection and extends the insect cell N-glycosylation pathway. This occurs before the protein of interest is expressed, preferably under the control of a late or very late baculovims promoter by the conventional recombinant baculovims. The protein of interest is more extensively processed by the modified N-glycosylation pathway, resulting in the production of a more authentic recombinant protein.

The inventor contemplates a number of variations for use with this novel recombinant baculovims. First, any early viral or constitutive cellular promoter may be used to express GT and ST. Second, any enhancer may be used to increase expression of GT and ST. Third, the relative positions of the GT, ST, and polh genes are unimportant. Fourth, similar embodiments provide other types of protein processing (e.g., folding, phosphorylation, acylation, acetylation, methylation or amidation).

2. pAcP(-)DIE-GTST pAcP(-)DIE-GTST (FIG. 20B) is a recombinant transfer plasmid that contains early- promoted and hr-enhanced GT and ST genes and a late-promoted gene encoding any protein of interest, all embedded within polyhedrin flanking sequences. This plasmid is used to produce recombinant baculovimses that are used, in turn, to infect conventional host cell lines. These recombinant vimses express GT and ST earlier in infection, extending the insect N-glycosylation pathway. These same recombinants also express the protein of interest, preferably later in infection. This design provides more extensive processing of the protein of interest and produces a more authentic recombinant protein without having to resort to coinfection.

The inventor additionally contemplates a number of variations for use with this novel recombinant transfer plasmid. First, any early viral or constitutive cellular promoter may be used to express GT and ST. Second, any enhancer may be used to increase expression of GT and ST. Third, any promoter, preferably a late or very late viral promoter, may be used to express protein of interest. Fourth, the relative positions of the GT, ST, and polh genes are unimportant. Fifth, the precise nature of the multiple cloning site is unimportant. And sixth, similar embodiments provide other types of protein processing, as detailed above.

3. AcSWT-1

AcSWT-1 (FIG. 20C) is a recombinant baculovims that contains early-promoted and hr-enhanced GT and ST genes inserted into the gp64 region of the baculoviral genome together with multiple Bsu36I sites in ORF-603, polh-LacZ, and ORF- 1629. The genes are inserted into the gp64 locus using the transfer plasmid (pAc64DIE-GTST). This

recombinant viral DNA is used as a target for the insertion of one or more genes encoding any protein of interest, under the control of a promoter, preferably a late or very late promoter. The insertion is carried out using conventional baculovims transfer plasmids and a conventional method involving linearization of the viral DNA by digestion with Bsu36I. The resulting recombinants are used to express the protein of interest during infection of conventional insect cell lines. Unlike existing baculoviral vectors, however, recombinant baculovimses produced with AcSWT-1 viral DNA express GT and ST early in infection, which extends the insect cell N-glycosylation pathway. Thus, the protein of interest that is expressed, preferably later in infection, is more authentic due to vims-mediated modification of the host protein processing machinery.

The inventor also contemplates a number of variations for use with this novel recombinant baculovims. First, any early viral or constitutive cellular promoter may be used to express GT and ST. Second, any enhancer may be used to increase expression of GT and ST. Third, the GT and ST genes may be inserted into other nonessential locations in viral genome (e.g., plO, see below). Fourth, any promoter, preferably a late or very late viral promoter, may be used to express the protein of interest. Fifth, the relative positions of the GT and ST genes are unimportant. And sixth, as above, similar embodiments provide other types of protein processing.

4. AcSWT-2

AcSWT-2 (FIG. 20D) is a recombinant baculovims that contains early-promoted and hr-enhanced GT and ST genes inserted into the gp64 region of the baculovims genome, early-promoted and enhanced N-acetylglucosaminy ltransferase (GlcNAc-T) I and II genes inserted into the plO region of the baculovims genome, and multiple Bsu36I sites in ORF- 603, polh-LacZ, and ORF- 1629. This recombinant viral DNA is used exactly as described above for AcSWT-1. However, in addition to providing GT and ST, which are believed to be absent in insect cells, AcSWT-2 also provides GlcNAc-TI and GlcNAc-TII, which are present only at very low levels in insect cells. Thus, recombinant baculovimses produced with AcSWT-2 viral DNA express GlcNAc-TI, GlcNAc-TII, GT, and ST early in infection, which increase the levels of existing activities and add new activities to the insect cell N- glycosylation pathway. The protein of interest that is expressed, preferably later in

infection, is more authentic due to vims-mediated enhancement and extension of host protein processing machinery.

As with the embodiments above, any early viral or constitutive cellular promoter may be used to express processing enzymes, and any enhancer may be used to increase expression of processing enzymes. The GT and ST genes may be inserted into other nonessential locations in viral genome, and the relative positions of the GT, ST, GlcNAc- I and GlcNAc-TII genes are unimportant. Any promoter, preferably a late or very late viral promoter, may be used to express the protein of interest, and similar embodiments provide other types of protein processing.

EXAMPLE 23 Production and Use of Insect Cells With Stably Integrated Glycosylation Genes 1. SfGalT plus AcP(+)IEl ST

This is a combination of an Sf9 cell subclone that contains an early-promoted and hr-enhanced GT gene stably integrated into the genome of the cell, and a novel recombinant baculovims that contains an early-promoted and enhanced ST gene (FIG. 21C). The SfGalT cells, which were isolated and characterized as described above in Example 20, contain stably-integrated copies of the expression plasmid, pIElGT, and constitutively express GT activity. AcP(+)IElST contains an early-promoted and enhanced ST gene in the polyhedrin region of the baculovims genome. The infection of SfGalT cells with AcP(+)IEl ST results in terminal sialylation of gp64 (FIG. 18A and FIG. 18B). This does not occur when SfGalT cells are infected with wild-type baculovims, nor when Sf9 cells are infected with the AcP(+)IEl ST recombinant. The presence of terminal sialic acid residues was confirmed by linkage analysis of the oligosaccharides on gp64 (FIG. 19). Thus, the constitutive GT activity and the ST activity expressed by the vims early in infection collaborate to modify gp64, which is a natural vims-encoded product expressed predominantly during the late phase of infection.

As discussed above for the recombinant baculovimses, any early viral or constitutive cellular promoter may be used to express the processing enzymes, and any enhancer may be used to increase expression of processing enzymes. Additionally, any promoter may be used to express the protein of interest. The ST gene may be inserted into other nonessential

locations in viral genome. Further, any insect cell line may be used as the parent for stable transformation. Also, similar embodiments provide other types of protein processing, as discussed above.

2. SfGalT plus AcP(-)IElST

This is a combination of an Sf9 cell subclone that contains an early-promoted and hr-enhanced GT gene stably integrated into the genome of the cell, and a novel recombinant baculovims that contains an early-promoted and enhanced ST gene and also encodes a late-promoted gene of interest (FIG. 2 ID). The SfGalT cells, which were isolated and characterized as described above, contain stably-integrated copies of the expression plasmid, pIElGT, and constitutively express GT activity. AcP(-)IElST contains an early-promoted and enhanced ST gene and a late-promoted protein of interest in the polyhedrin region. Infection of SfGalT cells with AcP(+)IElST results in terminal sialylation of the protein of interest. With this system, as described above, any early viral or constitutive cellular promoter may be used to express processing enzymes, and any enhancer may be used to increase expression of processing enzymes. The relative positions of the ST gene and the gene of interest are unimportant, and the ST gene may be inserted into other nonessential locations in the viral genome. Any promoter may be used to express the protein of interest, and any insect cell line may be used as the parent for stable transformation. As with all of these recombinant baculovimses and cell lines, similar embodiments provide other types of protein processing.

3. SfSWT-1 SfSWT-1 (FIG. 21 A) is an Sf9 cell subclone that contains early-promoted and hr- enhanced GT and ST genes. The cells were produced by cotransfecting Sf9 cells with pDIE-GTST plus pIElNeo, followed by selection with G418 and limiting dilution. These cells contain stably-integrated copies of the expression plasmid and constitutively express GT and ST activities. Thus, these cells have a modified N-glycosylation pathway that can process a protein of interest more extensively. The protein of interest is expressed by

infecting the cells with a conventional baculovirus expression vector, which contains the gene of interest under the control of any promoter.

As described above, any early viral or constitutive cellular promoter may be used to express processing enzymes, any enhancer may be used to increase expression of processing enzymes, and any promoter may be used to express the protein of interest. The relative positions of the GT and ST genes are unimportant. Again, any insect cell line may be used as the parent for stable transformation, and similar embodiments provide other types of protein processing.

4. SfSWT-2

SfSWT-2 (FIG. 2 IB) is an Sf9 cell subclone that contains early-promoted and hr- enhanced GT, ST, GlcNAc-TI, and GlcNAc-TII genes. These cells are produced by cotransfecting the SfSWT-1 cells from above with pDIE-GNTI-II plus pIElHygro, followed by selection with G418 plus hygromycin and limiting dilution. These cells contain stably- integrated copies of both expression plasmids (pDIE-GTST and pDIE-GNTI-II) and thus constitutively express not only GT and ST activities, as with the SfSWT-1 cells, but also express GlcNAc-TI and GlcNAc-TII, which are present only at very low levels in insect cells.

As described above for SfSWT-1, any early viral or constitutive cellular promoter may be used to express processing enzymes, any enhancer may be used to increase expression of processing enzymes, and any promoter may be used to express the protein of interest. Any insect cell line may be used as the parent for stable transformation, and the relative positions of the GT, ST, GlcNAc-TI and GlcNAc-TII genes are unimportant. Similar embodiments provide other types of protein processing.

EXAMPLE 24 Vectors for Delivery of Nucleic Acid Segments to Hepatocytes 1. pAcP(+)IEGalTVl and AcP(+)IEGalTVLuc pAcP(+)IEGalTVl is a recombinant plasmid that contains an early-promoted and hr- enhanced galactosyltransferase (GT) gene and a unique restriction site in the polyhedrin region. Any gene of interest, designed to be expressed in liver cells under the control of an

appropriate promoter operative in a hepatocyte, can be inserted into this plasmid. The promoter-coding sequence combination used for this puφose in the present example was the immediate early (IE) promoter of human cytomegalovims and the coding sequence for Renilla luciferase protein. After inserting the gene of interest, the resulting plasmid is used to produce a recombinant baculovims by standard techniques. The approach used is to cotransfect Sf9 cells with Bsu36I-linearized BakPAKό viral DNA plus pAcP(+)IEGalTV- Luc, harvest progeny vims, and isolate occlusion-positive recombinants by plaque assays. The resulting recombinant vims is amplified in conventional host cell lines.

Due to the ability of the recombinant vims to express galactosyltransferase during the early phase of infection, the major virion glycoprotein, gp64, and other virion glycoproteins on the surface of progeny vims particles, contain terminal galactose moieties (Jarvis and Finn, 1996). These galactose moieties are recognized by the abundant asialoglycoprotein receptor (ASGR) on the hepatocyte cell surface, leading to enhanced specificity and efficiency of uptake, as detailed above. Any early viral or constitutive cellular promoter can be used to express GT, and any enhancer can be included to increase expression of GT. The relative positions of the GT, gene of interest, and polh genes are unimportant. Additionally, GT and/or the gene of interest can be inserted into other nonessential regions of viral genome.

2. SfGalT cells plus a conventional baculovirus expression vector

This mode of practicing the invention involves the use of an Sf9 cell subclone containing an early-promoted and hr-enhanced GT gene together with a conventional recombinant baculovims vector containing a gene of interest designed to be expressed in liver cells under the control of an appropriate promoter operative in hepatocytes. SfGalT cells, which were isolated and characterized as described above, contain stably-integrated copies of the expression plasmid, pIElGT, and constitutively express GT activity. Infection of SfGalT cells with wild-type baculovims produces progeny virions with terminally galactosylated gp64. Thus, the constitutive GT activity expressed by SfGalT cells modifies the gp64 expressed by any baculovims and the resulting progeny virion particles are decorated with terminal galactose. These galactose moieties are recognized by ASGR on

the hepatocyte cell surface, leading to enhanced specificity and efficiency of uptake, as detailed above.

As described above, any early viral or constitutive cellular promoter can be used to express GT, and the constmcts can include any enhancer to increase expression of GT. Furthermore, any insect cell line can be used as the parent for stable transformation.

All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions, and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incoφorated herein by reference.

Ackermann et al, Baculovirus and Insect Cell Gene Expr. Conf. Abstr., ST13, 1995.

Adams and McClintock, In: Atlas of Invertebrate Viruses, Adams, J.R. and Bonami, J.R. eds., CRC Press, Inc., Boca Raton, Florida, 87-204, 1991. Adang and Miller, J. Virol, 44:782, 1982.

Adelman et al. DNA 2:183, 1983.

Aeed and Elhammer, Biochemistry, 33:8793, 1994.

Agarwal et al, Oncogene, 11 :427, 1995.

Agbandje et al, Virology, 184:170, 1991. Alnemri and Litwack, Biochemistry, 32:5387, 1993.

Alt et al, J. Biol. Chem., 253:1357, 1978.

Altmann et al, Glycobiology, 3:619-625, 1993.

Altmann et al, J. Biol. Chem., 270:17344-17349, 1995.

Andersons et al, Biochem. J., 280:219, 1991. Apte and Siebert, Biotechniques, 15:890-893, 1993.

Aφ et al, J. Gen. Virol, 74:211, 1993.

Aviv and Leder, Proc. Nat. Acad. Sci. U.S.A., 69:1408-1412, 1972.

Ayres et al, Virology, 202:586, 1994.

Bailer et al, Prot. Expr. Pur., 6:546, 1995. Bakker et al., J Biol. Chem., 269(48):30326-33, 1994.

Bause et al, Eur. J. Biochem, 217:535-540, 1993.

Beames et al, Biotechniques, 1 1 :378, 1991.

Becker et al, Bio/Technology, 12:69, 1994.

Belyaev and Roy, Virology, 190:840, 1992.

Belyaev et al, Gene, 156:229, 1995.

Bendiak et al, Eur. J. Biochem. 216(2):405-17, 1993. Beniya et al. , Virology, 216: 12, 1996.

Benton and Davis, Science, 196:180-182, 1977.

Berger et al, FEBS Letters, 203:64-68, 1986.

Bischoff et α/., J. Biol. Chem., 165:171 10-171 17, 1990.

Bishop et al, inNovations, 4:1, 1995. Blake et al, Anal Biochem., 36:175-179, 1984.

Blissard and Rohrmann, Virology, 170:537-555, 1989.

Blissard and Rohrmann, Ann. Rev. Entomol, 35: 127, 1990.

Blissard and Wenz, J. Virol, 66:6829-6835, 1992.

Blobel and Dobberstein, J. Cell Biol, 67:852-862, 1975. Bonning et al. , J. Gen. Virol. , 75 : 1551 , 1994.

Boose et al , Prot. Expr. Pur. , 1 :11 1, 1990.

Boublik et al. , Bio/Technology, 13:1079, 1995.

Bozon et tf/., J. Mol. Endocrinol, 14:277, 1995.

Broussard et al, Virology, 222:318, 1996. Buss et al. , Mol. Cell. Biol. , 11 : 1523 , 1991.

Butters and Hughes, Biochim. Biophys. Acta, 640:655-671 , 1981.

Camirand et al, J. Biol. Chem., 266:15120-15127, 1991.

Capone, Gene Anal. Tech., 6:62, 1989.

Carson et al, Virology, 182:279-286, 1991. Cartier et al, J. Virol, 68:7728-7737, 1994.

Cavener and Ray, Nuc. Acids Res., 19:3185-3192, 1991.

Chalfie et al, Science, 263:802-805, 1994.

Chatterjee et al, Int. J. Biochem. Cell Biol. 27(3):329-36, 1995.

Chazenbalk and Rapoport, J. Biol. Chem., 270:1543, 1995.

Chen et α/., J. Biol. Chem., 266:4081-4087, 1991. Chirgwin et al. , Biochemistry, 18:5294-5299, 1979.

Chisholm and Henner, J Virol, 62:3193, 1988.

Chou et al, Proc. Natl Acad. Sci. USA, 92:4417, 1995.

Choudary et al , in: Baculovims Expression Protocols, (C. D. Richardson ed.), Humana Press, Clifton, N.J, pp. 243-264, 1995. Colberre-Garapin et al. , J. Mol. Biol. , 150: 1 , 1981

Cooney et al, Proc. Natl Acad. Sci. USA, 90: 1882, 1993.

D'Agostaro et a/., J Biol. Chem. 270(25): 1521 1-21, 1995.

Davidson and Castellino, Biochemistry, 30:6167-6174, 1991a.

Davidson et al, Biochemistry, 30:981 1-9815, 1991. Davidson et al. , Biochemistry, 29:5584-5590, 1990.

Davies and Morgan, Biochem. J, 295:889, 1993.

Davis and Wood, In Vitro Cellular & Developmental Biology, Animal 31 :659-663, 1995.

Davis et al, In Vitro Cellular and Developmental Biology. Animal, 29A:842-846, 1993.

Davrinche et al, Biochem. Biophys. Res. Comm., 195:469, 1993. Delchambre et al, EMBOJ., 8:2653, 1989.

Deutschmann and Jager, Enz. Microb. Tech., 16:506, 1994.

Domingo and Trowbridge, J. Biol Chem., 263:13386, 1988.

Eichenlaub, J. Bacteriol 138:559-566, 1979.

Elbein, FASEB J., 5:3055-3063, 1991. Emery and Bishop, Prot. Engr. , 1 :359, 1987.

Engelhard et al, Proc. Natl. Acad. Sci. USA, 91 :3224, 1994.

E st et al, Nuc. Acids Res., 22:2855, 1994.

Estes et /., J. Virol, 61:1488, 1987.

Feinberg and Vogelstein, Analyt. Biochem., 132:6-13, 1983.

Field and Wainwright, Glycobiology, 5:463-472, 1995. Ford et al, Prot. Expr. Pur., 2:95, 1991.

Forstova et al, Human Gene Therapy, 6:297, 1995.

Foster et al, Gene, 154:183-186, 1995.

Frohman et al, Proc. Natl Acad. Sci. USA, 85:8998-9002, 1988.

Fuchs et al, Eur. J. Biochem., 228:625, 1995. Fuchs et al. , J. Virol. , 48:641 , 1983.

Fukada et al, Biosci. Biotechnol. Biochem. 58(1):200-1, 1994.

Furlong et al. , Biotech. Appl. Biochem., 10:454, 1988.

Gamier et al. , Bio/Technology, 13:1 101, 1995a.

Gamier et al, J. Virol, 69:4060, 1995b. Gething and Sambrook, Nature, 355:33-45, 1992.

Giese et α/., J Virol, 63:3080, 1989.

Gluzman, Cell, 23:567-572, 1981.

Godeau et al, Nuc. Acids Res., 20:6239, 1992.

Grabenhorst et al, Eur. J. Biochem., 215: 189-197, 1993. Grabenhorst et al. , Eur. J. Biochem. , 232:7 ' 18-725, 1995.

Grace, Nature (London), 216:613, 1967.

Graham et al, The NIAID AIDS Vaccine Clinical Trials Network, J. Inf. Dis., 167:533, 1993.

Granados and Naughton, Intervirology, 5:62-68, 1975. Guarino and Dong, Virology, 200:328-335, 1994.

Guarino and Smith, Virology, 179:1-8, 1990.

Guarino and Summers, J Virol , 57:563-571, 1986

Guarino and Summers, J Virol , 61 :2091-2099, 1987

Guarino et al., J Virol , 60.224-229, 1986.

Guarino et al , J Virol , 60:224-229, 1986. Han et al , Biochemistry, 34: 10835, 1995

Harduin-Lepers et al , J Biol Chem., 268:14348-14359, 1993

Hart, Curr Op Cell Biol , 4:1017, 1992.

Hartig et al , Dev. Biol Std , 76:313, 1992.

Hasemann and Capra, Proc Natl Acad Sci USA, 87:3942, 1990. Hawtin et al , Virology, 212:673, 1995.

Hellers et al , Eur J Biochem , 199:435, 1991.

Henderson et al , FEBS Letters, 371(3):293-6, 1995

Herscovics and Jelinek-Kelly, Anal Biochem , 166:85-89, 1987.

Herscovics et al , J Biol Chem , 269:9864-9871, 1994 Hill-Perkins and Possee, J Gen Virol , 71 :971, 1990

Hills and Crane-Robinson, Biochim Biophys Acta, 1260:14, 1995.

Hink et al , Biotech Progr , 7:9, 1991.

Hooft van Iddekinge et al , Virology, 131 :561-565, 1983.

Hopp, U S. Patent 4,554,101. Hoss et al , J Virol , 64:4799, 1990.

Hsieh and Robbins, J. Biol Chem , 259:2375-2382, 1984

Hsu et al , Prot Expr Pur , 5:595, 1994.

Hu et al , J Virol , 61:3617, 1987.

Huh and Weaver, J Gen Virol , 71: 195-202, 1990. Iatrou et al , Proc Natl Acad Sci USA, 86.9129, 1989

Jarvis and Finn, Virology, 212:500-511, 1995.

Jarvis and Garcia, BioTechniques, 16:508-513, 1994.

Jarvis and Garcia, Jr., Virology, 205:300-313, 1994.

Jarvis and Guarino, In: Methods in Molecular Biology, CD. Richardson (ed.), Baculovims Expression Protocols., Humana Press, Clifton, N.J, 39: 187-202, 1995. Jarvis and Summers, In: Recombinant DNA vaccines: rationale and strategies, R.E.

Isaacson (ed.), Marcel Dekker, Inc., New York, 265-291, 1992.

Jarvis and Summers, Mol. Cell Biol, 9:214-223, 1989.

Jarvis, In: Insect cell culture engineering, M.F.A Goosen, A. Daugulis, and P.Faulkner (eds.), Marcel Dekker, Inc., New York, 193-217, 1993a Jarvis, J. Virol, 67:2583-2591, 1993b.

Jarvis, J. Virol, 67:2583, 1993.

Jarvis et al, Virology, 185:795-810, 1991.

Jarvis et al, Bio/Technology, 8:950-955, 1990.

Jarvis et al, Biol. Control, 7:228, 1996. Jarvis et al. , . Biol. Chem., 268:16754-16762, 1993.

Jeang et al. , J. Virol. , 61 : 1761 , 1987.

Johnson et al, Virology, 190:815-823, 1992.

Joyce et al, FEBS Lett., 335:61-64, 1993.

Kalman et α/., J. Biol. Chem., 270:14835, 1995. Kalsner et al. , Glycoconjugate J. , 12:360-370, 1995.

Kang et z/., J Gen. Virol, 68:2607, 1987.

Kaufman, Methods in Enzymology, 185:537-566, 1990.

Keddie et al, Science, 243:1728, 1989.

Kerscher et α/., ev. Biol, 168:613-626, 1995. Kim and Weaver, Virology, 195:587, 1993.

King and Possee, "The baculovims system: a laboratory guide," Chapman and Hall, London, 1992.

Kitts and Possee, Biotechniques, 14:810-817, 1993.

Kitts et al, Nuc. Acids Res., 18:5667, 1990.

Kleymann et al, Eur. J. Biochem., 213:797-804, 1993.

Knepper et al, Biochemistry, 31 :11651-11659, 1992.

Kornfeld and Kornfeld, Ann. Rev. Biochem., 54:631-664, 1985. Kovacs et al, Virology, 185:633, 1991.

Kozak, Microbiol Rev., 47:1-45, 1983.

Kozak, J. Cell Biol, 108:229-241, 1986a.

Kozak, Nuc. Acids Res., 12:857-872, 1984.

Kozak, Cell, 44:283-292, 1986b. Kozma et al, J. Biol. Chem., 268:7134, 1993.

Kretzschmar et al, Biol. Chem. Hoppe-Seyler, 375:23, 1994.

Ku and Omary, Exp. Cell Res., 211 :24, 1994.

Kubelka et α/., _4rc/Y Bioch. Biophys., 308:148-157, 1994.

Kuhn and Zipfel, Gene, 162:225, 1995. Kumar et al, Glycobiology 2(4):383-93, 1992.

Kumar et al, Proc. Natl. Acad. Sci. U.S.A., 87:9948-9952, 1990.

Kunkel, Proc. Natl. Acad. Sci. U.S.A., 82:488-492, 1985.

Kuroda et al, Virology, 174:418-429, 1990.

Kuroda et al. , J. Virol. , 63 : 1677, 1989. Kuroda et al. , EMBO J. , 5 : 1359, 1986.

Kuroda et al, Virology, 180:159, 1991.

Kuzio et al, Virology, 139:414-418, 1984.

Kyte and Doolittle, J. Mol. Biol, 157:105-132, 1982.

Laemmli, Nature, 227:680-685, 1970. Lai et al, J. Biol. Chem., 269:9872-9881 , 1994.

Lanford, Virology, 167:72, 1988.

Larsen et al. Proc Natl Acad Sci USA 87(17):6674-8, 1990.

Lawrie et al, J. Biotech, 39:1, 1995.

Lebacq-Verheyden et al, Mol. Cell. Biol, 8:3129, 1988.

Lee and Costlow, Meth. Enzymol, 152:633-648, 1987. Lee and Miller, J. Virol. , 27:754, 1978.

Lee et α/., J. Biol. Chem., 264:13848-13855, 1989.

Lerch and Friesen, Nuc. Acids Res., 21 :1753, 1993.

Leusch et α/., Ge,ϊe, 160:191, 1995.

Licari et al, Biotech. Prog, 9:146-152, 1993. Lowe, Sem. Cell Biol. , 2:289-307, 1991.

Lowe et al, J. Biol Chem., 266:1672, 1991.

Lowe et al, Biochem. Soc. Trans., 20:484, 1992.

Lu and Miller, J. Virol, 69:975-982, 1995.

Lu and Miller, Biotechniques, 21 :63, 1996. Luckow and Summers, Virology 170:31 -39, 1989

Luckow and Summers, Virology 167:56-71, 1988

Luckow and Summers, Bio/Technology, 6:47, 1988.

Luckow, In: Recombinant DNA technology and applications, (A. Prokop, R. K. Bajpai and C. S. Ho, eds.), McGraw-Hill, Inc., New York, pp. 97-152, 1991. Luckow et al. , J. Virol. , 67 :4566, 1993.

Maeda, Ann. Rev. Entomol, 34:351, 1989.

Maeda et al, Nature, 315:592, 1985.

Maiorella et al, Bio/Technology, 6:1406, 1988.

Malitschek and Schartl, Biotechniques, 11 :177, 1991. Manneberg et al. , Protein Science, 3:30-38, 1994.

Manns and Grosse, Biotechniques, 10: 154, 1991.

Marsden et al, Biochem. Cell Biol, 68:587-601, 1990.

Martens, et al, J. Virol. Meth, 52:15, 1995.

Martin et al. DNA, 7:99, 1988.

Marz et al, In: Glycoproteins, Montreuil, J., Vliegenthart, J.F.G. and Schachter, H. (eds), Elsevier, Amsterdam, Vol. 29a, pp. 543-563, 1995.

Marz et al, In: Glycoproteins, (J. Montreuil, J. F. G. Vliegenthart and H. Schachter, eds.), Elsevier, Amsterdam, Vol. 29a, pp. 543-563, 1995.

Masri et al , Biochem. Biophys. Res. Commun. 157(2):657-63, 1988.

Matsuura et α/., J. Gen. Virol, 68:1233, 1987. McCutchen et al. , Bio/Technology, 9:848, 1991.

McLachlin and Miller, J. Virol, 68:7746-7756, 1994.

Melton et al, Nuc. Acids Res., 12:7035-7055, 1984.

Merryweather et al , J. Gen. Virol. , 71 : 1535, 1990.

Messing et al, Third Cleveland Symposium on Macromoleculesand Recombinant DNA, Editor A. Walton, Elsevier, Amsterdam, 1981.

Miller, Ann. Rev. Microbiol, 42:177-199, 1988.

Miller, J. Virol, 39:973, 1981.

Min and Bishop, J. Gen. Virol, 72:2551 , 1991.

Minch et a/., 5/otec/mo/. Prog, 1 1 :348-351, 1995. Minetoki et al, Biosci. Biotechnol Biochem. 59(8): 1516-21, 1995.

Misago et al, Proc. Natl. Acad. Sci. U.S.A., 92: 1 1766-11770, 1995.

Montreuil et al, In: New Comprehensive Biochemistry, (A. Neuberger and L. L. M. Van Deenen, series eds.), Elsevier, Amsterdam, 1995.

Moremen and Robbins, J. Cell Biol, 1 15: 1521-1534, 1991. Moremen, Proc. Natl. Acad. Sci. U.S.A., 86:5276-5280, 1989.

Moremen et al. . Biol. Chem., 266:16876-16885, 1991.

Moremen et al, Glycobiology, 4:1 13-125, 1994.

Morris and Miller, J Virol, 66:7397-7405, 1992.

Mouillac et al, J. Biol. Chem., 267:21733, 1992.

Mroczkowski et al, J. Biol. Chem., 269:13522, 1994.

Munro and Pelham, Cell, 46:291-300, 1986.

Murhammer and Goochee, Bio/Technology, 6:141 1-1418, 1988. Muφhy et al, Gen. Anal Tech. Appl , 7:160-171 , 1990.

Muφhy et al, Prot. Expr. Pur., 4:349, 1993.

Nagao et al, Insect Biochem., 17:531-538, 1987.

Nakazawa et a/., Jβ/oc/ze/κ 104(2):165-8, 1988.

Nebes and Schmidt, Biochem. Biophys. Res. Comm., 200:239-245, 1994. Normington et al, Cell, 57:1223-1236, 1989.

Numata et al. , J. Clin. Micro. , 32 : 121 , 1994.

O'Reilly and Miller, J. Virology, 62:3109-3119, 1988.

O'Reilly e al, In Baculovirus expression vectors, W.H. Freeman and Company, N.Y, 1992. Ogonah et al. , Bio/Technology, 14:197-202, 1996.

Ohkawa et al, J. Virol, 68:6619, 1994.

Oker-Blom et al, Biochim. Biophys. Acta, 1176:269, 1993.

Ooi and Miller, Virology, 166:515, 1988.

Ooi et al, J. Mol. Biol, 210:721, 1989. Page et al. , J. Biol Chem. , 264: 19147, 1989.

Pajot-Augy et al, J. Mol. Endocrinol, 14:51, 1995.

Parekh et al, Prot. Expr. Pur., 6:537, 1995.

Park et al, J. Virol. Meth, 45:303, 1993.

Passarelli and Miller, J. Virol, 67:2149-2158, 1993. Passarelli et al. , J. Virol , 68:4673, 1994.

Patel et al, Nuc. Acids Res., 20:97, 1992.

Paulson and Colley, J. Biol. Chem., 264:17615-17618, 1989.

Paulson et al, J. Biol. Chem., 252(2356-2362), 1977.

Peakman et al, Nuc. Acids Res., 20:6111 , 1992a.

Peakman et al, Nuc. Acids Res., 20:495, 1992b. Pearson and Roy, Immunol. Cell Biol, 71 :381 , 1993.

Pen et al , Nuc. Acids Res. , 17:451 , 1989.

Peng et al, Biotechniques, 14:274, 1993.

Pennock et al, Mol. Cell. Biol, 4:399, 1984.

Possee and Howard, Nuc. Acids Res., 15:10233, 1987. Pownall et al, Genomics 12(4):699-704, 1992.

Prasad et al. , J. Virol. , 68:5117, 1994.

Pullen and Friesen, J. Virol, 69:156-165, 1995.

Qin et fl/., J. Gen. Virol, 70:1273, 1989.

Ranjan and Hasnain, Virus Genes, 9:149, 1995. Rankin et al, Gene, 70:39, 1988.

Rankl et al, Prot. Expr. Pur., 5:346, 1994.

Redfield et al, New Engl. J. Med, 324:1677, 1991.

Reed and Mann, Nuc. Acids Res., 13, 7207-7221 , 1985.

Reed and Muench, Am. J. Hyg, 27:493, 1938. Ren et al. , Biochemistry 34:2489-2495, 1995.

Richardson, ed., "Baculovims expression protocols," Vol 39 In: Methods in Molecular Biology, (J. M. Walker, series ed.), Humana Press, Totowa, New Jersey, 1995.

Risinger et α/., J. Biol. Chem., 267:5680, 1992.

Rodems and Friesen, J. Virol, 67:577 '6-5785, 1993. Roeivink, et al, J. Gen. Virol, 73:1481, 1992.

Rohrmann, J. Gen. Virol, 67:1499, 1986.

Roy, Virology, 216:1, 1996.

Rubin et al , Gene, 128:155-163, 1993.

Russo et al, J. Biol. Chem., 267:9241-9247, 1992.

Ryan et al, Arch. Biochem. Biophys., 243:115-124, 1985. Saiki et al, Science, 230:1350-1354, 1985.

Saint Angelo et al, J. Virology, 61 :361-365.

Sambrook et al, In Molecular Cloning: A Laboratory Manual, Second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.

Sanger et al, Proc. Natl Acad. Sci. U.S.A., 74:5463-5467, 1977. Santerre, et al, Gene, 30:147, 1984.

Sareneva et al, J. Interf Res., 13:267, 1993.

Sarkar et al, Proc Natl Acad Sci USA, 88(l):234-8, 1991.

Schatzle et al., J. Biol. Chem., 267:4000-4007, 1992.

Shaper et al, J. Biol. Chem., 263:10420-10428, 1988. Short et al , Nuc. Acids. Res. , 16:7583-7600, 1988.

Shuler et al, "Baculovims expression systems and biopesticides," Wiley-Liss, Inc., New York, 1995.

Sisk et al, Biotechniques, 13:186, 1992.

Slightom and Sieu, Biotechniques, 13:94, 1992. Smith et al. , J. Virol. , 46:584-593, 1983a.

Smith et al, Anal. Biochem., 150:76-85, 1985.

Smith et α/., J. Biol. Chem., 265:6225-6234, 1990.

Smith et al, Mol Cell Biol, 3:2156, 1983b.

Smith et al., 1 Virol, 45:215, 1983c. Southern, J. Mol Biol, 98:503-517, 1975.

Sridhar et al, FEBS Lett., 315:282-286, 1993.

Sridhar et al, FEBS Lett., 315:282, 1993.

St. Angelo et al. . Virol, 61 :361, 1987.

Staden, In: Nucleic acid and protein sequence analysis, a practical approach, M.J. Bishop and CJ. Rawlings (eds.), IRL Press Limited, Eynsham, Oxford, England, 173-217, 1987. Staudacher et al. , Eur. J. Biochem. , 207:987-993, 1992.

Stewart et al, Nature, 352:85, 1991.

Stoltz et α/., J. Gen. Virol, 19: 145, 1973.

Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555, 1987.

Suzuki et al, EMBO J., 9:4259, 1990. Takagi et al. , Biochem. Biophys. Res. Comm. , 184:471 , 1992.

Tan et al. , Eur J Biochem, 231 (2):317-28, 1995.

Taticek et o/., Curr. Op. Biotech, 5:165, 1994.

Tessier et al. , Gene, 98 : 177, 1991.

Thiem and Miller, J. Virology, 63:2008-18, 1989. Thiem and Miller, et al, Gene, 91 :87, 1990.

Thompsen et al. , J. Cell. Biochem., 43:67, 1990.

Ting et al, Gene, 55:147-152, 1987.

Todd et al, J. Virol, 69:968-974, 1995.

Tomita t α/., Cytotechnology, 17:65, 1995. Towbin et al, Proc. Natl Acad. Sci. U.S.A. 76:4350-4353, 1979.

Tramper et al, Bioproc. Tech. , 17:139, 1993.

Troutt et al, Proc. Natl. Acad. Sci. U.S.A., 89:9823-9825, 1992.

Tsao et al, J. Biol. Chem., 265:5188, 1990.

Urakawa and Roy, J. Virol, 62:3919, 1988. Urakawa et al, J. Gen. Virol, 70:1453, 1989.

Urbancikova and Hitchcock-DeGregori, J. Biol. Chem., 269:24310, 1994.

Vail et al, J. Invert. Path., 17:383, 1971.

Vakharia et al, Insect Biochem. Mol. Biol, 25:583, 1995. van Lier et al, Biotech. Progr., 10:60, 1994.

Vaughn et al, In Vitro, 13:213-217, 1977,

Veit et al, FEBS Lett., 339:160, 1994. Velardo et al, J. Biol. Chem. 268:17902-7, 1993.

Vialard and Richardson, J. Virol, 67:5859, 1993.

Vialard et /., J. Virol, 64:37, 1990.

Vieira and Messing, Gene, 19:259-268, 1982.

Vihko et al, Proc. Natl. Acad. Sci. USA, 90:799, 1993. Vlak et al. , Virology, 179:312-320, 1990.

Vlak et al. , J. Virol. , 40:762, 1981.

Volkman and Goldsmith, Virology, 143: 185-195, 1985.

Volkman and Goldsmith, Virology, 143:185-195,1985.

Volkman and Summers, J. Invert. Path, 30:102, 1977. Volkman, Curr. Top. Microbiol Immunol , 131 : 103- 1 18, 1986.

Volkman et al, "Vims Taxonomy, in: Sixth Report of the International Committee on Taxonomy of Vimses, (F. A. Muφhy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo and M. D. Summers, eds.), Springer-Verlag, Wien, pp. 104, 1995. Volkman et al, Virology, 133:354-362, 1984.

Volkman et al., J. Virol, 19:820, 1976.

Vulsteke et al, Insect Mol. Biol, 2:195-204, 1993.

Wagner et al., 1 Virol, 70:4103-4109, 1996a.

Wagner et al, Glycobiology, 6:165-175, 1996b. Wang and Fraser, J. Virol. Meth. , 31 : 113 , 1991.

Wang et al, JBiol Chem, 268(6):4355-61, 1993.

Wang et al, Gene, 100:131, 1991.

Wathen et al. , Biochemistry, 30:2863-2868, 1991.

Webb and Summers, Technique, 2:173-188, 1990.

Webb et al, Biotechniques, 1 1 :512, 1991.

Weinstein et α/., J. Biol. Chem., 262:17735-17743, 1987. Weiss et al, in: Baculovims Expression Protocols, (C D. Richardson ed.), Humana Press,

Clifton, N.J.79, pp. 79-95, 1995a.

Weiss et al, In: Baculovirus Expression Protocols, (C. D. Richardson ed.), Humana Press, Clifton, N.J., pp. 65-78, 1995b.

Welply, Bio/Technology. 17:59, 1991. Westwood et al , Virology, 195 :90, 1993.

Weyer and Possee, J. Gen. Virol, 72:2967, 1991.

Weyer and Possee, J. Gen. Virol, 70:203, 1989.

Weyer et al, J. Gen. Virol, 71 :1525, 1990.

Whiteheart et al, Meth. Enzymol, 179:82-95, 1989. Whitford et al, J. Virology, 63:1393-1399, 1989.

Wickham et al , Biotechnology Progress 8:391-396, 1992.

Williams et al, Biochim. Biophys. Acta, 1075:146-153, 1991.

Wilson et al, J. Virol 61 :661-666, 1987.

Wilson et al. , J. Virol. , 61 :661, 1987. Winter et al, Ann. Rev. Immunol, 12:433, 1994.

Wong et al, Cytotechnology, 15:157, 1994.

Xia et al, Virology, 196:817, 1993.

Xie et al, J. Biol. Chem., 267:4939, 1992.

Xu et al, J. Virol. , 69, 2912-2917, 1995. Yamshchikov et al, Virology, 214:50, 1995.

Yanisch-Perron et al, Gene, 33, 103-1 19, 1985.

Yeh et al, Biochemistry, 32:11087-1 1099, 1993.

Yoshihisa and Anraku, Biochem. Biophys. Res. Comm., 163, 908-915, 1989. Zilberstein et al, Cell, 21, 417-427, 1980. Zuidemaettf/.,J Gen. Virology, 71:2201-2209, 1990.

SEOUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: The Texas A&M University System

(B) STREET: 310 Wisenbaker

(C) CITY: College Station

(D) STATE: Texas

(E) COUNTRY: USA

(F) POSTAL CODE (ZIP) : 77843-3369

(ii) TITLE OF INVENTION: MODIFYING INSECT CELL GLYCOSYLATION PATHWAYS WITH BACULOVIRUS EXPRESSION VECTORS

(iii) NUMBER OF SEQUENCES: 30

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (EPO)

(v) CURRENT APPLICATION DATA:

APPLICATION NUMBER: Unknown (vi) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US US 60/024,078

(B) FILING DATE: 16-AUG-1996

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2167 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(i ) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION:46..2010

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

CTATTTATTT AGATTTTTAA GTGTAGGTTC TGTGTTTACG TAAAC ATG ACG GGG 54

Met Thr Gly

1

ATT TTA CCT ACC TAC CAG CGA TTT GTA AAT GGA GTT CCT GTA CCG TCC 102 lie Leu Pro Thr Tyr Gin Arg Phe Val Asn Gly Val Pro Val Pro Ser 5 10 15

ATT TCT CGA CGT TCG TTC CGT CTA CGG GAG AAA TAT TTG ATT GTT TCT 150 lie Ser Arg Arg Ser Phe Arg Leu Arg Glu Lys Tyr Leu lie Val Ser 20 25 30 35

GTA CTT TTG ACA TTC GGG ATC GTG TGG TTA GGA GCA TTA TTC TAC TTG 198 Val Leu Leu Thr Phe Gly lie Val Trp Leu Gly Ala Leu Phe Tyr Leu 40 45 50

CCA GAG TTT AAA AGT TCA AAT AGT GTG AAC GAT AGT GTT TAC AAT GTA 246 Pro Glu Phe Lys Ser Ser Asn Ser Val Asn Asp Ser Val Tyr Asn Val 55 60 65

TAC AAA AGA ATC CAG AAA GCT GGC CCA GAG CTG CTC ATG CCG CCT CCT 294 Tyr Lys Arg lie Gin Lys Ala Gly Pro Glu Leu Leu Met Pro Pro Pro 70 75 80

CTG GCA CAA AAC GAT GTC GGT GAC TTT CCT GTG ATT GGG ATC GCT CAC 342 Leu Ala Gin Asn Asp Val Gly Asp Phe Pro Val lie Gly lie Ala His 85 90 95

CAT GGT GAA GGG GGT GAT GAT CCT CAC GTA ATT GAG GAC AGG AAC CGG 390 His Gly Glu Gly Gly Asp Asp Pro His Val lie Glu Asp Arg Asn Arg 100 105 110 115

CTA CGA GCT AAG ATA GAG GAG GAT ATG GGA ATG AAA GTG TTG GAG AGG 438 Leu Arg Ala Lys lie Glu Glu Asp Met Gly Met Lys Val Leu Glu Arg 120 125 130

CCT CAG TTT GAC GTA GCA CCT TCC GTG TCG TCT TCG CGA GGG CCC AGC 486 Pro Gin Phe Asp Val Ala Pro Ser Val Ser Ser Ser Arg Gly Pro Ser 135 140 145

AAG CCG CCA GTC GAT GCG ATT GAG GAG CCC GCG GTA GGG AAC AAT GCA 534 Lys Pro Pro Val Asp Ala lie Glu Glu Pro Ala Val Gly Asn Asn Ala 150 155 160

GCT AAC AAA GAC GTG TCG CCG TCA GGC CCG AAG GCT GAG AGC TCG GAC 582 Ala Asn Lys Asp Val Ser Pro Ser Gly Pro Lys Ala Glu Ser Ser Asp 165 170 175

AAG TTT GTG GCT GTG GCC CTG GCA CCA GGA GCT GAC CCT GAG ATC AAG 630 Lys Phe Val Ala Val Ala Leu Ala Pro Gly Ala Asp Pro Glu lie Lys 180 185 190 195

CAC AAG CTG GAG ACT GTC AAA AAG ATG ATG CTG CAC GCG TGG TAC AAC 678 His Lys Leu Glu Thr Val Lys Lys Met Met Leu His Ala Trp Tyr Asn 200 205 210

TAC AAG CTG TAT GCT TGG GGC AAG AAT GAG CTG AAG CCG ATG TCG AAG 726 Tyr Lys Leu Tyr Ala Trp Gly Lys Asn Glu Leu Lys Pro Met Ser Lys 215 220 225

CGA GCT CAC TTG TCC AGC GTG TTC GGC GCG GGC GAA CTT GGC GCC ACC 774 Arg Ala His Leu Ser Ser Val Phe Gly Ala Gly Glu Leu Gly Ala Thr 230 235 240

ATC GTC GAT GGT CTC GAC ACC CTC TAC CTC ATG GGA CTC AAC GAC GAA 822 lie Val Asp Gly Leu Asp Thr Leu Tyr Leu Met Gly Leu Asn Asp Glu 245 250 255

TTC CGA GAG GGC CGC GAC TGG GTC GCT GAA CAT TTG CAT ATT AAT GAA 870 Phe Arg Glu Gly Arg Asp Trp Val Ala Glu His Leu His He Asn Glu 260 265 270 275

ATC GAT TCC GAC TTA TCT GTG TTC GAG ACG ACG ATC CGG TTT GTC GGA 918 He Asp Ser Asp Leu Ser Val Phe Glu Thr Thr He Arg Phe Val Gly 280 285 290

GGT CTC CTG TCA TGT TAC GCG CTG ACC GGC GAC ACG ATG TTC CGA GAC 966 Gly Leu Leu Ser Cys Tyr Ala Leu Thr Gly Asp Thr Met Phe Arg Asp 295 300 305

AAG GCG GCG GAA GTA GGC GAC GCT TTG CTG CCA GCA TTC GAC ACA CCC 1014 Lys Ala Ala Glu Val Gly Asp Ala Leu Leu Pro Ala Phe Asp Thr Pro 310 315 320

ACC GGG TTG CCA TAT GCT CTC ATC AAC CCG TCC ACC AAG GCA AGC CGT 1062 Thr Gly Leu Pro Tyr Ala Leu He Asn Pro Ser Thr Lys Ala Ser Arg 325 330 335

CAG TAC CAC TGG GCG GGT CCG AAC AGC ATC CTA TCG GAG CTG GGA ACG 1110 Gin Tyr His Trp Ala Gly Pro Asn Ser He Leu Ser Glu Leu Gly Thr 340 345 350 355

CTC CAC CTC GAG TTC ACG TAC CTC AGT GAC GTC ACG GGC CGT GAT ATT 1158 Leu His Leu Glu Phe Thr Tyr Leu Ser Asp Val Thr Gly Arg Asp He 360 365 370

TAC AGA CAA AAA GTG AGC CGC ATC CGT GAG GTT TTG GAT CAG ATC GAC 1206 Tyr Arg Gin Lys Val Ser Arg He Arg Glu Val Leu Asp Gin He Asp 375 380 385

AAA CCT GGC GAC TTG TAC CCC AAC TTC ATC AAC CCA CGC ACT GGA CAA 1254 Lys Pro Gly Asp Leu Tyr Pro Asn Phe He Asn Pro Arg Thr Gly Gin 390 395 400

TGG GGA CAA AGG CAC ATG TCT CTG GGC GCT CTC GGC GAC TCG TTC TAC 1302 Trp Gly Gin Arg His Met Ser Leu Gly Ala Leu Gly Asp Ser Phe Tyr 405 410 415

GAG TAC TTA CTG AAG GCG TGG CTG ATG TCT GGC GGC GCT GAC GAG CAG 1350 Glu Tyr Leu Leu Lys Ala Trp Leu Met Ser Gly Gly Ala Asp Glu Gin 420 425 430 435

GCT CGC ATC ATG TTC GAC ACG GCC ATG CAG GCG GCG CTC GAC AAA ATG 1398 Ala Arg He Met Phe Asp Thr Ala Met Gin Ala Ala Leu Asp Lys Met 440 445 450

CTG CGT GTC TCG CCC TCC GGC CTC GCT TAC CTC GCC GAG CTC AAG TAC 1446 Leu Arg Val Ser Pro Ser Gly Leu Ala Tyr Leu Ala Glu Leu Lys Tyr 455 460 465

GGA CGT ATC ATT GAA GAG AAG ATG GAC CAC CTT TCG TGC TTC GCT GGC 1494 Gly Arg He He Glu Glu Lys Met Asp His Leu Ser Cys Phe Ala Gly 470 475 480

GGT ATG TTC GCA CTG GCG TCG ACT ACC CTG GAC AAC TCG ATG TCG GAG 1542 Gly Met Phe Ala Leu Ala Ser Thr Thr Leu Asp Asn Ser Met Ser Glu 485 490 495

CGC TAC ATG GAC GTG GCC AAG AAG CTG ACC AAT ACC TGC CAC GAG AGC 1590 Arg Tyr Met Asp Val Ala Lys Lys Leu Thr Asn Thr Cys His Glu Ser 500 505 510 515

TAC GCG CGA TCC GAG ACC AAA CTC GGC CCT GAA GCA TTC CGA TTC TCC 1638 Tyr Ala Arg Ser Glu Thr Lys Leu Gly Pro Glu Ala Phe Arg Phe Ser 520 525 530

AAC GCG GCC GAG GCG CGT GCA CAG AAG AGC AAT GAG AAG GTG TAC CTC 1686 Asn Ala Ala Glu Ala Arg Ala Gin Lys Ser Asn Glu Lys Val Tyr Leu 535 540 545

CTG CGG CCG GAG ACG TTC GAG AGC TAC TTC ATC ATG TGG AGA CTC ACC 1734 Leu Arg Pro Glu Thr Phe Glu Ser Tyr Phe He Met Trp Arg Leu Thr 550 555 560

AAG CAA CAG ATG TAC CGC GAC TGG GCC TGG GAG GCT GTG CAG GCT CTG 1782 Lys Gin Gin Met Tyr Arg Asp Trp Ala Trp Glu Ala Val Gin Ala Leu 565 570 575

GAG AAA CAC TGC CGC GTG GAG GGC GGC TAC ACC GGT CTC GTG AAC GTC 1830 Glu Lys His Cys Arg Val Glu Gly Gly Tyr Thr Gly Leu Val Asn Val 580 585 590 595

TAC CAC GCC AAC CCT CAG GGA GAC GAC GTG CAG CAG AGC TTC TTC CTC 1878 Tyr His Ala Asn Pro Gin Gly Asp Asp Val Gin Gin Ser Phe Phe Leu 600 605 610

GCT GAG ACA CTC AAG TAC TTA TAC CTG ATA TTC GGT GAC GAT TCG TTC 1926 Ala Glu Thr Leu Lys Tyr Leu Tyr Leu He Phe Gly Asp Asp Ser Phe 615 620 625

CTG CCG CTC GAC GAG TGG GTG TTC AAC ACG GAA GCC CAT CCA TTC CCG 1974 Leu Pro Leu Asp Glu Trp Val Phe Asn Thr Glu Ala His Pro Phe Pro 630 635 640

ATC AGG GGC AAG AAC CCG CTG TAC CGC GCT GTC GAC AAACCGGTCC 2020

He Arg Gly Lys Asn Pro Leu Tyr Arg Ala Val Asp 645 650 655

TGCCAGAACC TGCGCATGCG CAAAACAACA GGATATAAGA CCGTCACTCA AGTAATTTGT 2080

TTTAAAAATG TTTCATTTTG TTAGAACTGA AGAAGCCAGA CTGTACCAAC AGTGTCTGGT 2140

TAGGTATTGA CGAGAGTAAA TAGCAAG 2167

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 655 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Met Thr Gly He Leu Pro Thr Tyr Gin Arg Phe Val Asn Gly Val Pro 1 5 10 15

Val Pro Ser He Ser Arg Arg Ser Phe Arg Leu Arg Glu Lys Tyr Leu 20 25 30

He Val Ser Val Leu Leu Thr Phe Gly He Val Trp Leu Gly Ala Leu 35 40 45

Phe Tyr Leu Pro Glu Phe Lys Ser Ser Asn Ser Val Asn Asp Ser Val 50 55 60

Tyr Asn Val Tyr Lys Arg He Gin Lys Ala Gly Pro Glu Leu Leu Met 65 70 75 80

Pro Pro Pro Leu Ala Gin Asn Asp Val Gly Asp Phe Pro Val He Gly 85 90 95

He Ala His His Gly Glu Gly Gly Asp Asp Pro His Val He Glu Asp 100 105 110

Arg Asn Arg Leu Arg Ala Lys He Glu Glu Asp Met Gly Met Lys Val 115 120 125

Leu Glu Arg Pro Gin Phe Asp Val Ala Pro Ser Val Ser Ser Ser Arg 130 135 140

Gly Pro Ser Lys Pro Pro Val Asp Ala He Glu Glu Pro Ala Val Gly 145 150 155 160

Asn Asn Ala Ala Asn Lys Asp Val Ser Pro Ser Gly Pro Lys Ala Glu 165 170 175

Ser Ser Asp Lys Phe Val Ala Val Ala Leu Ala Pro Gly Ala Asp Pro 180 185 190

Glu He Lys His Lys Leu Glu Thr Val Lys Lys Met Met Leu His Ala 195 200 205

Trp Tyr Asn Tyr Lys Leu Tyr Ala Trp Gly Lys Asn Glu Leu Lys Pro 210 215 220

Met Ser Lys Arg Ala His Leu Ser Ser Val Phe Gly Ala Gly Glu Leu 225 230 235 240

Gly Ala Thr He Val Asp Gly Leu Asp Thr Leu Tyr Leu Met Gly Leu 245 250 255

Asn Asp Glu Phe Arg Glu Gly Arg Asp Trp Val Ala Glu his Leu His 260 265 270

Ile Asn Glu He Asp Ser Asp Leu Ser Val Phe Glu Thr Thr He Arg 275 280 285

Phe Val Gly Gly Leu Leu Ser Cys Tyr Ala Leu Thr Gly Asp Thr Met 290 295 300

Phe Arg Asp Lys Ala Ala Glu Val Gly Asp Ala Leu Leu Pro Ala Phe 305 310 315 320

Asp Thr Pro Thr Gly Leu Pro Tyr Ala Leu He Asn Pro Ser Thr Lys 325 330 335

Ala Ser Arg Gin Tyr His Trp Ala Gly Pro Asn Ser He Leu Ser Glu 340 345 350

Leu Gly Thr Leu His Leu Glu Phe Thr Tyr Leu Ser Asp Val Thr Gly 355 360 365

Arg Asp He Tyr Arg Gin Lys Val Ser Arg He Arg Glu Val Leu Asp 370 375 380

Gin He Asp Lys Pro Gly Asp Leu Tyr Pro Asn Phe He Asn Pro Arg 385 390 395 400

Thr Gly Gin Trp Gly Gin Arg His Met Ser Leu Gly Ala Leu Gly Asp 405 410 415

Ser Phe Tyr Glu Tyr Leu Leu Lys Ala Trp Leu Met Ser Gly Gly Ala 420 425 430

Asp Glu Gin Ala Arg He Met Phe Asp Thr Ala Met Gin Ala Ala Leu 435 440 445

Asp Lys Met Leu Arg Val Ser Pro Ser Gly Leu Ala Tyr Leu Ala Glu 450 455 460

Leu Lys Tyr Gly Arg He He Glu Glu Lys Met Asp His Leu Ser Cys 465 470 475 480

Phe Ala Gly Gly Met Phe Ala Leu Ala Ser Thr Thr Leu Asp Asn Ser 485 490 495

Met Ser Glu Arg Tyr Met Asp Val Ala Lys Lys Leu Thr Asn Thr Cys 500 505 510

His Glu Ser Tyr Ala Arg Ser Glu Thr Lys Leu Gly Pro Glu Ala Phe 515 520 525

Arg Phe Ser Asn Ala Ala Glu Ala Arg Ala Gin Lys Ser Asn Glu Lys 530 535 540

Val Tyr Leu Leu Arg Pro Glu Thr Phe Glu Ser Tyr Phe He Met Trp 545 550 555 560

Arg Leu Thr Lys Gin Gin Met Tyr Arg Asp Trp Ala Trp Glu Ala Val 565 570 575

Gin Ala Leu Glu Lys His Cys Arg Val Glu Gly Gly Tyr Thr Gly Leu 580 585 590

Val Asn Val Tyr His Ala Asn Pro Gin Gly Asp Asp Val Gin Gin Ser 595 600 605

Phe Phe Leu Ala Glu Thr Leu Lys Tyr Leu Tyr Leu He Phe Gly Asp 610 615 620

Asp Ser Phe Leu Pro Leu Asp Glu Trp Val Phe Asn Thr Glu Ala His 625 630 635 640

Pro Phe Pro He Arg Gly Lys Asn Pro Leu Tyr Arg Ala Val Asp 645 650 655

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3748 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION:177..3566

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

GGCTTATTAA CCCTCACTAA AGGGAGAGTC AGGAGCACGC TGTGGTGTTT GGCTGTCGCA 60

TGCAAGTGCG AGCCGATAAC TTACACTGCA GATAAATAAA TAATTGACTT TATCTGGAGT 120

AAAATAAAAT GTAAACATTG TTTTCAAAAA AATCGTGACA TAAAAAATAT TGCACA 176

ATG AGG ACT CGT GTC CTT CGT TGC CGG CCG TTC TCC ACC CGG ATC CTG 224 Met Arg Thr Arg Val Leu Arg Cys Arg Pro Phe Ser Thr Arg He Leu 1 5 10 15

CTG CTG CTG CTA TTT GTC CTT GCG TTT GGG GTC TAC TGC TAT TTC TAC 272 Leu Leu Leu Leu Phe Val Leu Ala Phe Gly Val Tyr Cys Tyr Phe Tyr 20 25 30

AAT GCA TCT CCT CAG AAC TAT AAC AAA CCA AGA ATC AGT TAC CCA GCC 320 Asn Ala Ser Pro Gin Asn Tyr Asn Lys Pro Arg He Ser Tyr Pro Ala 35 40 45

AGT ATG GAG CAC TTC AAA TCT TCC CTC ACT CAC ACC GTC AAG AGC CGA 368 Ser Met Glu His Phe Lys Ser Ser Leu Thr His Thr Val Lys Ser Arg 50 55 60

GAC GAG CCA ACT CCG GAT CAA TGC CCT GCA TTG AAG GAA AGC GAA GCG 416 Asp Glu Pro Thr Pro Asp Gin Cys Pro Ala Leu Lys Glu Ser Glu Ala 65 70 75 80

GAC ATC GAC ACC GTG GCG ATA TAC CCA ACT TTT GAT TTT CAG CCG AGC 464 Asp He Asp Thr Val Ala He Tyr Pro Thr Phe Asp Phe Gin Pro Ser 85 90 95

TGG TTG CGT ACA AAG GAA TTT TGG GAC AAG TCC TTC GAG GAT CGG TAT 512 Trp Leu Arg Thr Lys Glu Phe Trp Asp Lys Ser Phe Glu Asp Arg Tyr 100 105 110

GAA AGA ATT CAT AAC GAC ACT ACA CGG CCT AGA CTG AAG GTA ATC GTG 560 Glu Arg He His Asn Asp Thr Thr Arg Pro Arg Leu Lys Val He Val 115 120 125

GTT CCT CAC TCA CAC AAC GAC CCG GGA TGG CTG AAG ACG TTT GAA CAG 608 Val Pro His Ser His Asn Asp Pro Gly Trp Leu Lys Thr Phe Glu Gin 130 135 140

TAC TTC GAG TGG AAG ACC AAG AAC ATT ATC AAC AAC ATA GTG AAC AAA 656 Tyr Phe Glu Trp Lys Thr Lys Asn He He Asn Asn He Val Asn Lys 145 150 155 160

CTG CAC CAG TAC CCC AAC ATG ACC TTC ATT TGG ACC GAG ATA TCG TTT 704 Leu His Gin Tyr Pro Asn Met Thr Phe He Trp Thr Glu He Ser Phe 165 170 175

CTG AAT GCC TGG TGG GAA AGG TCG CAC CCT GTC AAA CAA AAG GCA TTG 752 Leu Asn Ala Trp Trp Glu Arg Ser His Pro Val Lys Gin Lys Ala Leu 180 185 190

AAA AAA CTT ATC AAA GAA GGT CGT CTC GAG ATC ACG ACG GGC GGC TGG 800 Lys Lys Leu He Lys Glu Gly Arg Leu Glu He Thr Thr Gly Gly Trp 195 200 205

GTG ATG CCG GAC GAA GCC TGC ACG CAT ATC TAT GCG CTA ATT GAC CAG 848 Val Met Pro Asp Glu Ala Cys Thr His He Tyr Ala Leu He Asp Gin 210 215 220

TTT ATT GAA GGA CAT CAC TGG GTG AAA ACT AAT CTC GGC GTC ATC CCG 896 Phe He Glu Gly His His Trp Val Lys Thr Asn Leu Gly Val He Pro 225 230 235 240

AAG ACA GGA TGG TCT ATT GAC CCC TTC GGC CAC GGG GCC ACT GTG CCT 944 Lys Thr Gly Trp Ser He Asp Pro Phe Gly His Gly Ala Thr Val Pro 245 250 255

TAC CTG CTA GAC CAG AGC GGC CTT GAG GGA ACC ATT ATA CAG AGA ATC 992 Tyr Leu Leu Asp Gin Ser Gly Leu Glu Gly Thr He He Gin Arg He 260 265 270

CAT TAT GCG TGG AAA CAG TGG CTG GCG GAG CGA CAG ATT GAG GAG TTT 1040 His Tyr Ala Trp Lys Gin Trp Leu Ala Glu Arg Gin He Glu Glu Phe 275 280 285

TAC TGG CTG GCG AGT TGG GCT ACT ACG AAG CCG TCC ATG ATA GTG CAC 1088 Tyr Trp Leu Ala Ser Trp Ala Thr Thr Lys Pro Ser Met He Val His 290 295 300

AAT CAG CCG TTT GAT ATT TAT TCA ATA AAA AGC ACG TGT GGC CCG CAC 1136 Asn Gin Pro Phe Asp He Tyr Ser He Lys Ser Thr Cys Gly Pro His 305 310 315 320

CCT TCA ATT TGT CTC AGT TTC GAC TTC AGG AAG ATT CCC GGC GAA TAT 1184 Pro Ser He Cys Leu Ser Phe Asp Phe Arg Lys He Pro Gly Glu Tyr 325 330 335

TCT GAA TAC ACA GCT AAG CAC GAA GAC ATC ACG GAA CAC AAC TTG CAC 1232 Ser Glu Tyr Thr Ala Lys His Glu Asp He Thr Glu His Asn Leu His 340 345 350

AGC AAG GCA AAG ACT TTG ATA GAG GAG TAC GAC CGT ATC GGG TCC CTG 1280 Ser Lys Ala Lys Thr Leu He Glu Glu Tyr Asp Arg He Gly Ser Leu 355 360 365

ACT CCA CAC AAC GTG GTG CTG GTG CCG CTC GGA GAC GAC TTC AGA TAC 1328 Thr Pro His Asn Val Val Leu Val Pro Leu Gly Asp Asp Phe Arg Tyr 370 375 380

GAG TAC AGC GTC GAG TTT GAT GCC CAA TAC GTC AAT TAT ATG AAA ATG 1376 Glu Tyr Ser Val Glu Phe Asp Ala Gin Tyr Val Asn Tyr Met Lys Met 385 390 395 400

TTT AAC TAC ATC AAT GCT CAC AAG GAA ATC TTC AAC GCT GAC GTA CAG 1424 Phe Asn Tyr He Asn Ala His Lys Glu He Phe Asn Ala Asp Val Gin 405 410 415

TTC GGA ACT CCT CTC GAT TAC TTT AAC GCC ATG AAA GAA AGA CAT CAA 1472 Phe Gly Thr Pro Leu Asp Tyr Phe Asn Ala Met Lys Glu Arg His Gin 420 425 430

AAT ATA CCC AGC TTA AAG GGA GAT TTC TTC GTT TAC TCC GAT ATT TTC 1520 Asn He Pro Ser Leu Lys Gly Asp Phe Phe Val Tyr Ser Asp He Phe 435 440 445

AGC GAA GGT AAA CCA GCG TAC TGG TCA GGT TAC TAC ACT ACT AGA CCC 1568 Ser Glu Gly Lys Pro Ala Tyr Trp Ser Gly Tyr Tyr Thr Thr Arg Pro 450 455 460

TAC CAA AAA ATC CTC GCC CGT CAG TTC GAA CAC CAA CTG CGA TCG GCA 1616 Tyr Gin Lys He Leu Ala Arg Gin Phe Glu His Gin Leu Arg Ser Ala 465 470 475 480

GAG ATT TTA TTC ACC CTT GTA TCG AAC TAC ATC AGA CAG ATG GGT CGC 1664 Glu He Leu Phe Thr Leu Val Ser Asn Tyr He Arg Gin Met Gly Arg 485 490 495

CAA GGA GAG TTC GGA GCT TCT GAG AAA AAG TTA GAA AAA TCT TAC GAG 1712 Gin Gly Glu Phe Gly Ala Ser Glu Lys Lys Leu Glu Lys Ser Tyr Glu 500 505 510

CAG CTT ATC TAT GCT CGA CGG AAC TTG GGT CTG TTT CAA CAT CAC GAT 1760 Gin Leu He Tyr Ala Arg Arg Asn Leu Gly Leu Phe Gin His His Asp 515 520 525

GCG ATT ACT GGA ACA TCA AAG TCC AGT GTG ATG CAA GAT TAC GGA ACC 1808 Ala He Thr Gly Thr Ser Lys Ser Ser Val Met Gin Asp Tyr Gly Thr 530 535 540

AAA CTG TTC ACA AGT CTG TAT CAC TGC ATC CGC CTG CAG GAG GCC GCG 1856 Lys Leu Phe Thr Ser Leu Tyr His Cys He Arg Leu Gin Glu Ala Ala 545 550 555 560

CTC ACC ACC ATC ATG TTG CCT GAC CAG TCG TTG CAC TCG CAG AGC ATT 1904 Leu Thr Thr He Met Leu Pro Asp Gin Ser Leu His Ser Gin Ser He 565 570 575

ATA CAA AGC GAG GTT GAG TGG GAA ACT TAC GGA AAA CCG CCC AAG AAG 1952 He Gin Ser Glu Val Glu Trp Glu Thr Tyr Gly Lys Pro Pro Lys Lys 580 585 590

CTG CAA GTG TCC TTC ATT GAC AAG AAG AAA GTT ATA CTT TTT AAT CCG 2000 Leu Gin Val Ser Phe He Asp Lys Lys Lys Val He Leu Phe Asn Pro 595 600 605

TTG GCT GAG ACT CGA ACT GAA GTG GTC ACG GTT AGA TCC AAC ACG TCC 2048 Leu Ala Glu Thr Arg Thr Glu Val Val Thr Val Arg Ser Asn Thr Ser 610 615 620

AAC ATC CGG GTG TAC GAT ACA CAC AAG AGG AAG CAC GTC TTG TAT CAG 2096 Asn He Arg Val Tyr Asp Thr His Lys Arg Lys His Val Leu Tyr Gin 625 630 635 640

ATA ATG CCC AGC ATC ACA ATC CAA GAC AAC GGC AAG AGT ATC GTA AGC 2144 He Met Pro Ser He Thr He Gin Asp Asn Gly Lys Ser He Val Ser 645 650 655

GAC ACC ACG TTC GAC ATA ATG TTC GTG GCC ACC ATC CCG CCC CTC ACC 2192 Asp Thr Thr Phe Asp He Met Phe Val Ala Thr He Pro Pro Leu Thr 660 665 670

TCC ATC TCG TAC AAG CTG CAG GAG CAC ACC AAC ACT TCC CAC CAC TGC 2240 Ser He Ser Tyr Lys Leu Gin Glu His Thr Asn Thr Ser His His Cys 675 680 685

GTC ATT TTC TGC AAC AAC TGC GAA CAA TAC CAG AAA TCC AAT GTG TTC 2288 Val He Phe Cys Asn Asn Cys Glu Gin Tyr Gin Lys Ser Asn Val Phe 690 695 700

CAA ATT AAG AAA ATG ATG CCT GGT GAC ATA CAA TTA GAA AAT GCA GTG 2336 Gin He Lys Lys Met Met Pro Gly Asp He Gin Leu Glu Asn Ala Val 705 710 715 720

CTA AAA CTT CTC GTT AAT AGG AAC ACC GGC TTT CTG AGA CAA GTC TAT 2384 Leu Lys Leu Leu Val Asn Arg Asn Thr Gly Phe Leu Arg Gin Val Tyr 725 730 735

AGA AAG GAC ATC CGG AAG AGA ACT GTC GTT GAC GTA CAA TTC GGC GCA 2432 Arg Lys Asp He Arg Lys Arg Thr Val Val Asp Val Gin Phe Gly Ala 740 745 750

TAT CAA AGT GCC CAA AGA CAT TCT GGT GCT TAC CTC TTC ATG CCT CAT 2480 Tyr Gin Ser Ala Gin Arg His Ser Gly Ala Tyr Leu Phe Met Pro His 755 760 765

TAC GAC TCA CCT GAG AAG AAT GTT CTG CAT CCC TAC ACT AAT CAG AAC 2528 Tyr Asp Ser Pro Glu Lys Asn Val Leu His Pro Tyr Thr Asn Gin Asn 770 775 780

AAC ATG CAA GAT GAT AAC ATA ATC ATA GTG TCC GGA CCT ATT TCT ACG 2576 Asn Met Gin Asp Asp Asn He He He Val Ser Gly Pro He Ser Thr 785 790 795 800

GAA ATC ACG ACC ATG TAC TTG CCC TTC TTG GTG CAC ACT ATT AGG ATA 2624 Glu He Thr Thr Met Tyr Leu Pro Phe Leu Val His Thr He Arg He 805 810 815

TAC AAC GTG CCG GAC CCG GTA CTG TCG CGT GCT ATT CTA TTA GAG ACC 2672 Tyr Asn Val Pro Asp Pro Val Leu Ser Arg Ala He Leu Leu Glu Thr 820 825 830

GAT GTA GAT TTC GAG GCG CCA CCT AAG AAC AGA GAG ACT GAG TTA TTT 2720 Asp Val Asp Phe Glu Ala Pro Pro Lys Asn Arg Glu Thr Glu Leu Phe 835 840 845

ATG AGA TTA CAG ACT GAT ATA CAA AAC GGT GAC ATT CCC GAA TTT TAC 2768 Met Arg Leu Gin Thr Asp He Gin Asn Gly Asp He Pro Glu Phe Tyr 850 855 860

ACC GAT CAG AAC GGA TTC CAG TAC CAA AAG AGG GTC AAA GTG AAT AAA 2816 Thr Asp Gin Asn Gly Phe Gin Tyr Gin Lys Arg Val Lys Val Asn Lys 865 870 875 880

CTA GGA ATA GAA GCT AAT TAC TAC CCG ATC ACT ACC ATG GCG TGC CTG 2864 Leu Gly He Glu Ala Asn Tyr Tyr Pro He Thr Thr Met Ala Cys Leu 885 890 895

CAA GAC GAG GAG ACC CGG CTC ACT CTG CTG ACG AAC CAC GCT CAA GGC 2912 Gin Asp Glu Glu Thr Arg Leu Thr Leu Leu Thr Asn His Ala Gin Gly 900 905 910

GCT GCT GCA TAC GAA CCA GGA CGC TTA GAA GTC ATG CTC GAT CGT CGA 2960 Ala Ala Ala Tyr Glu Pro Gly Arg Leu Glu Val Met Leu Asp Arg Arg 915 920 925

ACT CTT TAT GAT GAC TTC AGA GGA ATC GGT GAA GGA GTA GTC GAT AAC 3008 Thr Leu Tyr Asp Asp Phe Arg Gly He Gly Glu Gly Val Val Asp Asn 930 935 940

AAA CCG ACG ACT TTC CAG AAC TGG ATT TTA ATT GAA TCC ATG CCA GGC 3056 Lys Pro Thr Thr Phe Gin Asn Trp He Leu He Glu Ser Met Pro Gly 945 950 955 960

GTG ACG CGA GCC AAG AGA GAC ACT AGT GAA CCA GGT TTC AAA TTT GTT 3104 Val Thr Arg Ala Lys Arg Asp Thr Ser Glu Pro Gly Phe Lys Phe Val 965 970 975

AAT GAA CGT CGT TTT GGC CCC GGC CAG AAG GAA AGC CCT TAC CAA GTA 152 Asn Glu Arg Arg Phe Gly Pro Gly Gin Lys Glu Ser Pro Tyr Gin Val 980 985 990

CCG TCG CAG ACT GCG GAC TAC CTG AGC AGG ATG TTC AAT TAC CCG GTG 3200 Pro Ser Gin Thr Ala Asp Tyr Leu Ser Arg Met Phe Asn Tyr Pro Val 995 1000 1005

AAC GTG TAC CTG GTG GAC ACT AGC GAG GTT GGC GAG ATC GAG GTG AAG 3248 Asn Val Tyr Leu Val Asp Thr Ser Glu Val Gly Glu He Glu Val Lys 1010 1015 1020

CCG TAC CAG TCG TTC CTG CAG AGC TTC CCG CCC GGC ATC CAC CTG GTC 3296 Pro Tyr Gin Ser Phe Leu Gin Ser Phe Pro Pro Gly He His Leu Val 1025 1030 1035 1040

ACC CTG CGC ACC ATC ACC GAC GAC GTG CTC GAA CTC TTC CCC AGC AAC 3344 Thr Leu Arg Thr He Thr Asp Asp Val Leu Glu Leu Phe Pro Ser Asn 1045 1050 1055

GAA AGC TAC ATG GTA CTG CAC CGA CCA GGA TAC AGC TGC GCT GTC GGA 3392 Glu Ser Tyr Met Val Leu His Arg Pro Gly Tyr Ser Cys Ala Val Gly 1060 1065 1070

GAG AAG CCA GTC GCC AAG TCT CCC AAG TTT TCG TCC AAA ACC AGG TTC 3440 Glu Lys Pro Val Ala Lys Ser Pro Lys Phe Ser Ser Lys Thr Arg Phe 1075 1080 1085

AAT GGT CTG AAC ATT CAG AAC ATC ACT GCA GTC AGC CTG ACC GGC CTG 3488 Asn Gly Leu Asn He Gin Asn He Thr Ala Val Ser Leu Thr Gly Leu 1090 1095 1100

AAG TCA CTC CGA CCT CTC ACA GGT CTG AGT GAC ATC CAC CTG AAC GCT 3536 Lys Ser Leu Arg Pro Leu Thr Gly Leu Ser Asp He His Leu Asn Ala 1105 1110 1115 1120

ATG GAG GTA AAA ACT TAC AAG ATC AGG TTT TAAAGACTGC TAGTAGTAAT 3586 Met Glu Val Lys Thr Tyr Lys He Arg Phe 1125 1130

AGGTGTAACA CATTTGTAAT TTTATAATAT TTACAAACTT TATCGTGAAC TTACAGCCTC 3646

ACACCTCGGC TATGTAAGTG GAATAAGTAG GAAGATACAA TTTTGATGGT ACTTTAGTAG 3706

AGCCTCGTAC TAACGGGCCG CGTAATAGTA TAATGGTATT AG 3748

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1130 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Met Arg Thr Arg Val Leu Arg Cys Arg Pro Phe Ser Thr Arg He Leu 1 5 10 15

Leu Leu Leu Leu Phe Val Leu Ala Phe Gly Val Tyr Cys Tyr Phe Tyr 20 25 30

Asn Ala Ser Pro Gin Asn Tyr Asn Lys Pro Arg He Ser Tyr Pro Ala 35 40 45

Ser Met Glu His Phe Lys Ser Ser Leu Thr His Thr Val Lys Ser Arg 50 55 60

Asp Glu Pro Thr Pro Asp Gin Cys Pro Ala Leu Lys Glu Ser Glu Ala 65 70 75 80

Asp He Asp Thr Val Ala He Tyr Pro Thr Phe Asp Phe Gin Pro Ser 85 90 95

Trp Leu Arg Thr Lys Glu Phe Trp Asp Lys Ser Phe Glu Asp Arg Tyr 100 105 110

Glu Arg He His Asn Asp Thr Thr Arg Pro Arg Leu Lys Val He Val 115 120 125

Val Pro His Ser His Asn Asp Pro Gly Trp Leu Lys Thr Phe Glu Gin 130 135 140

Tyr Phe Glu Trp Lys Thr Lys Asn He He Asn Asn He Val Asn Lys 145 150 155 160

Leu His Gin Tyr Pro Asn Met Thr Phe He Trp Thr Glu He Ser Phe 165 170 175

Leu Asn Ala Trp Trp Glu Arg Ser His Pro Val Lys Gin Lys Ala Leu 180 185 190

Lys Lys Leu He Lys Glu Gly Arg Leu Glu He Thr Thr Gly Gly Trp 195 200 205

Val Met Pro Asp Glu Ala Cys Thr His He Tyr Ala Leu He Asp Gin 210 215 220

Phe He Glu Gly His His Trp Val Lys Thr Asn Leu Gly Val He Pro 225 230 235 240

Lys Thr Gly Trp Ser He Asp Pro Phe Gly His Gly Ala Thr Val Pro 245 250 255

Tyr Leu Leu Asp Gin Ser Gly Leu Glu Gly Thr He He Gin Arg He 260 265 270

His Tyr Ala Trp Lys Gin Trp Leu Ala Glu Arg Gin He Glu Glu Phe 275 280 285

Tyr Trp Leu Ala Ser Trp Ala Thr Thr Lys Pro Ser Met He Val His 290 295 300

Asn Gin Pro Phe Asp He Tyr Ser He Lys Ser Thr Cys Gly Pro His 305 310 315 320

Pro Ser He Cys Leu Ser Phe Asp Phe Arg Lys He Pro Gly Glu Tyr 325 330 335

Ser Glu Tyr Thr Ala Lys His Glu Asp He Thr Glu His Asn Leu His 340 345 350

Ser Lys Ala Lys Thr Leu He Glu Glu Tyr Asp Arg He Gly Ser Leu 355 360 365

Thr Pro His Asn Val Val Leu Val Pro Leu Gly Asp Asp Phe Arg Tyr 370 375 380

Glu Tyr Ser Val Glu Phe Asp Ala Gin Tyr Val Asn Tyr Met Lys Met 385 390 395 400

Phe Asn Tyr He Asn Ala His Lys Glu He Phe Asn Ala Asp Val Gin 405 410 415

Phe Gly Thr Pro Leu Asp Tyr Phe Asn Ala Met Lys Glu Arg His Gin 420 425 430

Asn He Pro Ser Leu Lys Gly Asp Phe Phe Val Tyr Ser Asp He Phe 435 440 445

Ser Glu Gly Lys Pro Ala Tyr Trp Ser Gly Tyr Tyr Thr Thr Arg Pro 450 455 460

Tyr Gin Lys He Leu Ala Arg Gin Phe Glu His Gin Leu Arg Ser Ala 465 470 475 480

Glu He Leu Phe Thr Leu Val Ser Asn Tyr He Arg Gin Met Gly Arg 485 490 495

Gin Gly Glu Phe Gly Ala Ser Glu Lys Lys Leu Glu Lys Ser Tyr Glu 500 505 510

Gin Leu He Tyr Ala Arg Arg Asn Leu Gly Leu Phe Gin His His Asp 515 520 525

Ala He Thr Gly Thr Ser Lys Ser Ser Val Met Gin Asp Tyr Gly Thr 530 535 540

Lys Leu Phe Thr Ser Leu Tyr His Cys He Arg Leu Gin Glu Ala Ala 545 550 555 560

Leu Thr Thr He Met Leu Pro Asp Gin Ser Leu His Ser Gin Ser He 565 570 575

Ile Gin Ser Glu Val Glu Trp Glu Thr Tyr Gly Lys Pro Pro Lys Lys 580 585 590

Leu Gin Val Ser Phe He Asp Lys Lys Lys Val He Leu Phe Asn Pro 595 600 605

Leu Ala Glu Thr Arg Thr Glu Val Val Thr Val Arg Ser Asn Thr Ser 610 615 620

Asn He Arg Val Tyr Asp Thr His Lys Arg Lys His Val Leu Tyr Gin 625 630 635 640

He Met Pro Ser He Thr He Gin Asp Asn Gly Lys Ser He Val Ser 645 650 655

Asp Thr Thr Phe Asp He Met Phe Val Ala Thr He Pro Pro Leu Thr 660 665 670

Ser He Ser Tyr Lys Leu Gin Glu His Thr Asn Thr Ser His His Cys 675 680 685

Val He Phe Cys Asn Asn Cys Glu Gin Tyr Gin Lys Ser Asn Val Phe 690 695 700

Gin He Lys Lys Met Met Pro Gly Asp He Gin Leu Glu Asn Ala Val 705 710 715 720

Leu Lys Leu Leu Val Asn Arg Asn Thr Gly Phe Leu Arg Gin Val Tyr 725 730 735

Arg Lys Asp He Arg Lys Arg Thr Val Val Asp Val Gin Phe Gly Ala 740 745 750

Tyr Gin Ser Ala Gin Arg His Ser Gly Ala Tyr Leu Phe Met Pro His 755 760 765

Tyr Asp Ser Pro Glu Lys Asn Val Leu His Pro Tyr Thr Asn Gin Asn 770 775 780

Asn Met Gin Asp Asp Asn He He He Val Ser Gly Pro He Ser Thr 785 790 795 800

Glu He Thr Thr Met Tyr Leu Pro Phe Leu Val His Thr He Arg He 805 810 815

Tyr Asn Val Pro Asp Pro Val Leu Ser Arg Ala He Leu Leu Glu Thr 820 825 830

Asp Val Asp Phe Glu Ala Pro Pro Lys Asn Arg Glu Thr Glu Leu Phe 835 840 845

Met Arg Leu Gin Thr Asp He Gin Asn Gly Asp He Pro Glu Phe Tyr 850 855 860

Thr Asp Gin Asn Gly Phe Gin Tyr Gin Lys Arg Val Lys Val Asn Lys 865 870 875 880

Leu Gly He Glu Ala Asn Tyr Tyr Pro He Thr Thr Met Ala Cys Leu 885 890 895

Gin Asp Glu Glu Thr Arg Leu Thr Leu Leu Thr Asn His Ala Gin Gly 900 905 910

Ala Ala Ala Tyr Glu Pro Gly Arg Leu Glu Val Met Leu Asp Arg Arg 915 920 925

Thr Leu Tyr Asp Asp Phe Arg Gly He Gly Glu Gly Val Val Asp Asn 930 935 940

Lys Pro Thr Thr Phe Gin Asn Trp He Leu He Glu Ser Met Pro Gly 945 950 955 960

Val Thr Arg Ala Lys Arg Asp Thr Ser Glu Pro Gly Phe Lys Phe Val 965 970 975

Asn Glu Arg Arg Phe Gly Pro Gly Gin Lys Glu Ser Pro Tyr Gin Val 980 985 990

Pro Ser Gin Thr Ala Asp Tyr Leu Ser Arg Met Phe Asn Tyr Pro Val 995 1000 1005

Asn Val Tyr Leu Val Asp Thr Ser Glu Val Gly Glu He Glu Val Lys 1010 1015 1020

Pro Tyr Gin Ser Phe Leu Gin Ser Phe Pro Pro Gly He His Leu Val 1025 1030 1035 1040

Thr Leu Arg Thr He Thr Asp Asp Val Leu Glu Leu Phe Pro Ser Asn 1045 1050 1055

Glu Ser Tyr Met Val Leu His Arg Pro Gly Tyr Ser Cys Ala Val Gly 1060 1065 1070

Glu Lys Pro Val Ala Lys Ser Pro Lys Phe Ser Ser Lys Thr Arg Phe 1075 1080 1085

Asn Gly Leu Asn He Gin Asn He Thr Ala Val Ser Leu Thr Gly Leu 1090 1095 1100

Lys Ser Leu Arg Pro Leu Thr Gly Leu Ser Asp He His Leu Asn Ala 1105 1110 1115 1120

Met Glu Val Lys Thr Tyr Lys He Arg Phe 1125 1130

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: CAGTATAAAT TGACGTTC 18

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: TTTTGGATCC ATAGTCACTT GGTTGTT 27

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 52 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: GTGACTATGG ATCTAGATCT GCGGCCGCAG GCCTCGCGAC TAGTTTAAAC CC 52

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 53 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: GTGACTATGG ATCCCCGGGT TTAAACTAGT CGCGAGGCCT GCGGCCGCAG ATC 53

(2) INFORMATION FOR SEQ ID NO: 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 52 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: GTGACCGCGG ATCTAGATCT GCGGCCGCAG GCCTCGCGAC TAGTTTAAAC CC 52

(2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 53 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: GTGACCGCGG ATCCCCGGGT TTAAACTAGT CGCGAGGCCT GCGGCCGCAG ATC 53

(2) INFORMATION FOR SEQ ID NO: 11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 59 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: GTGACTATGG ATCCCGGGTA CCTTCTAGAA TTCCGGAGCG GCCGCTGCAG ATCTGATCC 59

(2) INFORMATION FOR SEQ ID NO: 12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 59 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: GTGACCGCGG ATCCCGGGTA CCTTCTAGAA TTCCGGAGCG GCCGCTGCAG ATCTGATCC 59

(2) INFORMATION FOR SEQ ID NO: 13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:3..18

(D) OTHER INFORMATION: /mod_base= i /note= "N = Inosine"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:24

(D) OTHER INFORMATION: /mod_base= OTHER /note= "N = A or C or G or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:12

(D) OTHER INFORMATION:/mod_base= OTHER /note= "H = A or C or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:15..21

(D) OTHER INFORMATION: /mod_base= OTHER /note= "Y = C or T/U"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

GGNTGGNNNA THGAYCCNTT YGGNCA 26

(2) INFORMATION FOR SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION:/mod_base= OTHER /note= "N = A or C or G or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION: /mod_base= OTHER /note= "K = G or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION:/mod_base= OTHER /note= "S = G or C"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION: /mod_base= OTHER /note= "W = A or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:12..27

(D) OTHER INFORMATION:/mod_base= OTHER /note= "R = A or G"

(ix) FEATURE:

(A) NAME/KEY: modif ed_base

(B) LOCATION:23

(D) OTHER INFORMATION: /modJoase= OTHER /note= "D = G or A or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS..21

(D) OTHER INFORMATION:/modJ_>ase= l /note= "N = Inosine"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

GGNCKNSWNN NRAARTANCC NSDCCARTA ₂ 9

(2) INFORMATION FOR SEQ ID NO: 15:

(l) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(IX) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION:1..22

(D) OTHER INFORMATION:/note= "5' -phosphorylated, 3 '-ammo blocked"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

TCCCTTTAGT GAGGGTTAAT TT 22

(2) INFORMATION FOR SEQ ID NO: 16:

(l) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 12 amino acids

(B) TYPE: ammo acid

(C) STRANDEDNESS:

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:

Asp Pro Ser Arg Phe Ser Gly Ala Lys Glu Ala Lys 1 5 10

(2) INFORMATION FOR SEQ ID NO: 17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS:

(D) TOPOLOGY: linear

( i) SEQUENCE DESCRIPTION: SEQ ID NO: 17:

Asp Leu Asp Pro Ser Arg Phe Ser Gly Ala Lys Glu Ala Lys

1 5 10

(2) INFORMATION FOR SEQ ID NO: 18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS ..22

(D) OTHER INFORMATION:/mod_base= OTHER /note= "Y = C or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION:/mod_base= OTHER /note= "W = A or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION:/mod_base= OTHER /note= "S = G or C"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS..21

(D) OTHER INFORMATION: /mod_base= i /note= "I = Inosine"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:24

(D) OTHER INFORMATION: /mod_base= OTHER /note= "N - A, C, G, or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:15

(D) OTHER INFORMATION:/mod_base= OTHER /note= "R = A or G"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:

GAYWSNTTYT AYGARTAYYT NYTNAA 26

(2) INFORMATION FOR SEQ ID NO: 19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:1..16

(D) OTHER INFORMATION:/mod_base= OTHER /note= "R = A or G"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS..10

(D) OTHER INFORMATION: /mod_base= OTHER /note= "N = A or C or G or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS

(D) OTHER INFORMATION: /mod_base= OTHER /note= "Y = C or T/U"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:

RTGNGCYTCN GTRTTRAA 18

(2) INFORMATION FOR SEQ ID NO: 20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:!..15

(D) OTHER INFORMATION: /mod_base= OTHER /note= "R = A or G"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION: 10..19

(D) OTHER INFORMATION: /mod_base= OTHER /note= "Y = C or T/U"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATIONS..22

(D) OTHER INFORMATION: /mod_base= i /note= "N = Inosine"

(ix) FEATURE:

(A) NAME/KEY: modified_base

(B) LOCATION:25

(D) OTHER INFORMATION:/mod_base= OTHER /note= "N = A or C or G or T/U"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

RTANARRTAY TTNARNGTYT CNGCNA 26

(2) INFORMATION FOR SEQ ID NO: 21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: GCATCATGTT CGACACG 17

(2) INFORMATION FOR SEQ ID NO: 22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: GTGGTAGACG TTCACGAGAC 20

(2) INFORMATION FOR SEQ ID NO: 23:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: TTGCGTCTAC TGCAGTCTAC GACTCACTAT AGGGC 35

(2) INFORMATION FOR SEQ ID NO: 24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24: TTGCGTCTAC TGCAGTC ₁ 7

(2) INFORMATION FOR SEQ ID NO: 25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: CCTTGCTATT TACTCTCGTC 20

(2) INFORMATION FOR SEQ ID NO: 26:

(i) SEQUENCE CHARACTERIS ICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: TGTGTTCGAG ACGACGATC 19

(2) INFORMATION FOR SEQ ID NO: 27:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27: GACATCGAGT TGTCCAGG 18

(2) INFORMATION FOR SEQ ID NO: 28:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOG : linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28: GTGTAGGTTC TGTGTTTACG 20

(2) INFORMATION FOR SEQ ID NO: 29:

<i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: TTCACCATGG TGAGCGATC 19

(2) INFORMATION FOR SEQ ID NO: 30:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: AAGTGAGCTC GCTTCGACAT 20