CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit under 35 U. S. C. § 119(e) of U.S. Provisional Application Nos. 61/074,986, filed on June 23, 2008 and 61/118,978, filed December 1, 2008, the contents of each of which is hereby incorporated by reference in its entirety into the present disclosure

FIELD OF THE INVENTION

This invention relates to the field of identifying the gender of a fetus by detecting fetal derived polynucleotides of the paternally inherited Y chromosome in the maternal bloodstream.

BACKGROUND OF THE INVENTION

Significant effort has been devoted to finding a method of determining the sex of a fetus by a safe, noninvasive procedure that is reliable. Ultrasound has been performed routinely after the twentieth week of pregnancy for decades and is both safe and noninvasive.

However, ultrasound often cannot make a clear determination of the sex of the fetus due to fetal positioning issues or lack of resolution. Chorionic villus sampling and amniocentesis are two techniques that are invasive and require obtaining fetal derived cells from either the placenta or cells in suspension in the amniotic fluid. The fetal cells are then subjected to various means of detecting the presence of the Y chromosomal DNA, including real time polymerase chain reaction (PCR). While these methods are highly accurate, sample must be collected in a clinical setting and there is risk to the mother or the fetus associated with either sampling technique. Thus, there is clearly a need for a safe, noninvasive and reliable method of determination of the gender of an unborn fetus. Ideally, sample collection for such a procedure should be as convenient as possible and not depend on a trip to a clinic or medical facility.

Dried blood samples (Guthrie cards) have been used for diagnosis of hereditary disorders since the pioneering work of Guthrie in diagnosis of phenylketonuria in neonates. Guthrie and Susi (1963) Pediatrics 23:38-343. Upon introduction of PCR technology, determination of genetic markers was expanded to dried blood samples with the demonstration that sickle cell anemia could be detected through PCR amplification of DNA from a dried blood sample. Jinks et al. (1989) Hum. Genet. 81:363-366.

It has long been known that there is fetal DNA in maternal blood. Lo et al. (1998) Lancet. 2(8676): 1363-1365 and Lo et al. (1990) Lancet. 335(8703): 1463-1464. This fetal DNA is derived from either nucleated fetal cells that pass into the mother's bloodstream or cell-free fetal DNA found in the plasma of the mother's blood. Bianchi et al. (1992) Hum. Genet. 90:368-370 and Lo et al. (1997) Lancet. 350(9076):485-487. The use of nucleated fetal cells derived from maternal blood for prenatal diagnosis is safe and noninvasive, but requires a relatively large amount of blood collected by venipuncture generally in a clinical setting by a phlebotomist. Simpson and Elias (1993) J. Am. Medical Assoc. 270:2357-2361 and Hamada et al. (1993) Hum. Genet. 91:427-432. Furthermore, the use of flow cytometry to enrich the fetal cells makes this an expensive and time consuming technique. More recently, the presence of fetal DNA or fetal DNA fragments in the plasma of maternal blood has been demonstrated and such cell- free preparations of maternal blood have been used for prenatal diagnosis and gender determination. Lo et al. (1997) Lancet. 350(9076):485-487. Importantly, the presence of fetal DNA in sufficient quantity in the plasma of a pregnant woman at all times 6 weeks after conception has been confirmed, but the reliability of gender determination was found to be highly dependent on the plasma sample size with the best results obtained with DNA from one milliliter of blood plasma. Galbiati et al. (2005) Hum. Genet. 117(2-3):243-248. A blood draw of this size would typically be performed by venipuncture in a clinical setting by a phlebotomist.

Thus, a need exists for a sensitive, reliable method of determining the gender of a fetus from a small sample of maternal blood. This invention satisfies this need and provides related advantages as well.

DESCRIPTION OF THE EMBODIMENTS

The present invention describes the determination of the gender of a fetus from a few drops of unfractionated maternal whole blood from a sample as small as that from a finger prick. The sample collection procedure can be performed at home and preserved in dried form making this procedure less expensive (since a phlebotomist is not needed) and more convenient (performed at home and not in a clinical setting) compared to other known methods described in the art. The dried blood sample can be sent through the mail without refrigeration. Furthermore, the ability to utilize a target in the Y chromosome derived from a repeat sequence enhances the sensitivity of the detection step allowing the use of a minimal dried blood sample. Thus, in one aspect, this invention relates to the determination of the gender of an unborn fetus in a mother, at least five weeks post conception, by means of detection of Y-chromosome specific sequences in a whole blood preparation. The presence of this Y-chromosome specific DNA sequence is indicative of at least one male fetus, while the absence is indicative of a female fetus.

In another aspect, this invention provides compositions and methods to determine the gender of a fetus at early gestation stage. For example, this invention provides an isolated oligonucleotide and compositions containing an isolated oligonucleotide, wherein the isolated oligonucleotide is complementary or substantially complementary to a centromeric alphoid repeat sequence of the human Y chromosome described in Table 1. Also provided are the complements to these oligonucleotides. The isolated oligonucleotide and compositions containing them can be used to hybridize, amplify and/or detect male fetal DNA present in a blood sample and in particular, a maternal whole blood sample which may or may not be dried. In a further aspect, the male fetal DNA is endogenously cleaved male fetal DNA. The invention also provides methods for detecting a centromeric alphoid repeat sequence of the human Y chromosome, described in Table 1, in a female blood sample such as a maternal whole blood sample. In another aspect, the invention provided a kit for detecting a centromeric alphoid repeat sequence of the human Y chromosome described in Table 1 and their use for determining the gender of a fetus in a pregnant female. In a yet further aspect is a system for detecting a centromeric alphoid repeat sequence in a maternal blood sample. Table 1 - Exemplified Nucleotide Sequences

SEQ Nucleotide Sequence ID NO.

1 ataaaaactacacagaagcatgctgagaaacctctttgtgatgtgtgtattcacctccgg ga gttcaacctatcatttgacagagcggttttgaaactctttttgtagaatctccaagtgga ta tttggagccctttgcattctactgtgaaaaggaaatatcttcacatc

2 1 aggcctcaaa gtgctccaaa tattcacttg tacattctac caaacgagta tttcaaaact

61 gctcaatcaa atggaaggtt caaaaccgtg acatgaatgc ccacatcaca aagtagtttc

121 tcagaatgct tctgtgtagt ttttatgtga agatatttcc ttttccacaa cagcgtgcaa

181 aacgcttcaa atatgccctt agagattcca caaaaagagt gtttccaaac tactcaaatc

241 aaaaaatgat ttcaactctg tgagatgaat gcacacatca caaactagtt tctcagaatg

301 tttctgcctg gttctcatgc gaagatagtt cctttttcac cataggccgc aatgtactcc

361 aaatatccac ctgcagattc tacaaaagtg agtttcaaaa ctgctctatc aaaagatcag

421 ttcgtctctg tgagttgaat gcatacatca aaaagaagct tctcaaaatg cttctgtgtg

481 gtttttcggt gaagatagtt ctttttctac cataggtctc aaaccactcc aaatatccac

541 ttgtagattc tataaaaagg aatgttcaaa attgctcaat aaaaataaag tttcaacacc

601 gtgagatgag tgcacaaatc acaaaggagt ttctcaaaat gcttctgggt agtttttctg

661 tgaagatagt tccttttcta ccatgggcca caaagggctc caaataccca cttgcagatt

721 ctacaaaaag agagtttcac aactgctcta tcaaacaata tgttcaactt tgtgggttga

781 acacaaatat cacaagaatt ttctcccaat gcttctgtgt agtttttatg tgaagacatt

841 tcttttccct ccatagtcca caaagtgctc caaatatcca cttacatatt ctagaaaaag

901 attgcttgga aactgcacaa tgaaaagaaa ggttcaaata tatgagatga atgcacacat

961 cacaaagaag tttctcagaa tctctctgtg taatttttat gtgaagatat ttcctttccc

1021 accttaggtc ttaaaacgct ccaaatatcc acttgcagat actacaagaa gattgtttca

1081 aaactgcaca aaaaaagaaa tgttcaattc tgtttgatga atgcacacat cacaaagaag

1141 tttctcagaa tgcttctctg tagtttttat gtgaagatat ttccttttcc acaataggcc

1201 tcaaagggct ccaaatatcc acttccagat tctatgaaaa gaatatttcc aaactgctca

1261 atcataggaa atgttcaact ctgtgagatg aatgcacaca tcacaagaaa tttctcagaa

1321 tccttcagtg taggttttat gagaagataa ttccttttcc acaatagttc tcaaagcact

1381 caaaatatcc acttgcagat tctacaaaag gagtatttca aaactgctca atcaaaagaa

1441 aggttcaact ctgtgagatg aatggacaca tcacaaagaa gtttctcaga atgcttctgt

1501 gtagtatttt tgtgaagata tttcttttcc accatagacc gccaggggac acaaatatcc

1561 actttcagat tctacaacaa gagaggttca aaactactcg atcaagagat ggtttcaact

1621 atgtgagttg aatgcacaca tcacaaagaa ctatgtcgga attcttctgt gtagttttta

1681 tgtgaagata tttccttttc cacaatagac gtcaaagtga tccagatatc cacttgcaga

1741 ttccacaaaa agagtgtttc aaaagtgcac aaccaaaaga aaggttcaac taggtgagat

1801 gaatgcacac atcagaagga agtttctcag aatgcttctg catagctttt aagggaagat

1861 acttcctttt ccaacatagg cctcaaagca ctccaaatat cctcctggag ataccacaaa

1921 aagagtgttt gcaaactgct caatcaaaag aaagatttaa ctctgtgaga tgaatccaca

1981 catgacaaag aagtttctca gaatgcttct gtgtagtttt tatgtgaaga tatttccttt

2041 tccacaataa gacccaaaag gctccaaata ttcacttgca gattctaaaa aaaacagtgt

2101 ttcaaaactg ctcaatcaaa agatagttca actctgtgag aagaatgctc acatcactga

2161 gaagtttctc agaatgcttc tgtgtagttt ttatatgaag atatttcctt tcccaccgta

2221 ggccacaaaa ggctccaaat atccacttgc agatactatg aaaagagagt ttcaaaactg

2281 ctcattcaaa agataggttc aactctgtgg tttgaatgca cacagcacaa agaagtttca

2341 cagaatgtgt ctgtgtagtt tttatgtgcg gatgtttcct tttccaccat atgcctaaat

2401 atttcccaat ttccacttgc agattctaca agaagagtgt ttcaaaactg ctgtatcaaa

2461 taaagttgaa ctctgtgagg tgaatgcaca cagcacaaaa tggtttctca gaatgcttcc

2521 ttgttgtttt tatatgaaga tgtttccttt tcaacaatag gcctcaaagt gcttcaaatg

2581 tccacttgca gattctacaa aaagagtgtt tcaaaactgc tcaatcaaaa gaaaggttcg

2641 actctgggaa attaatgcac acatcacaaa gaagtttctc agcttctgtg tagttttcat

2701 gtgaagttat ttccttttcc acaataggcc gcaaagggct ccaaatatca acttacagat

2761 tctaggaaaa gagagtttca aaactgctct acgaaaagat aggttgaact ctgtgagatg

2821 aatgcacaca tcacaaagaa gtttctcaga atgcatctgt gtagttttta cgggaagaca

2881 tttccttttc caccatcttc cacaaaggtc tccaagtaac cacttgcaga ttctacagaa

2941 agacacttta aaaactgctc tatcaaaaga tcagttcaag tctgtggttt gaatgcacac

3001 atcacaaaga attttctcag aatgcttctg tgtagttttc atatgaagat atttcctttt

3061 ccaccatagg cctcaaagca ctccaaatat ccacttgcag attctacaaa aagagatttt

3121 caaaactagt caatcaaaag aaaggttcaa ctctgtcagt tgaatgcaca tatcacaaac

3181 aagtttctcg gaatgcgtct gtgtagtttt tatgtgaaga tatttccttc tccacaacag

3241 gcctcaaagt gctccgaata tccacttgca gattttacta aagagtgttt ccaaactgct

3301 caatcaagag gaagtttcaa gtctgtgagc tgaacgcaca catcacaaag tagtttctga

3361 gaatgcttct gtgtagtttt tatgtgaaga tgtttccttt tccaccatag gctgcaaagg

3421 gctccaaata tccacttgca gattctacaa aaagagagtt tcaaaagtgc tctatcaaaa 3481 gataggttca actatgtgat atgaatgcac acatcacaaa gtagtttctc agaatgcttc

3541 tgtgtagttt ttatgtaaag atatttcctt ttccaccata ggcctcaaag cactccaaat

3601 atccacttgc agattctaca aaaagagatt ttcaaaacta tttaatcaaa agaaaggttc

3661 aaatctgtca gttgaaggta catatcacaa acaagtttat tggaatgctt ctgtgtagtt

3721 tttatgtgaa gatatttcct tttccacaac aggcctcaag gtgctccaaa tatccacttg

3781 cagatttcac taaaagtgtg tttccaagct gctcaatcaa gaggaagttt caagtctgtg

3841 aggtgaatgc acacattaca aagaagttac tgagaatgct tctgtgtagt ttttatgtga

3901 agatatttcc ttttccaccg caggcctcaa agcgctgcaa atatccactt gcagattcta

3961 caaaaagaga gtttcaaaac tgctgtatca aaagataggg tcaactctgc gagttgaata

4021 agcacatcac aaataagttt ctgggaacgc ttctgtatag ttttatgtga atatatttcc

4081 ttttccacca tatgcctcaa agcactccaa atatccactt gcacattata gaaacatagt

4141 ctttcaaaac ttgtcaatca aagaaaggtt caactccgtg agatgagtgc acacatcaca

4201 gagaagtttc tcggaatgtt tctgtgtagt ttttatgtga agatattgcc ttttccacaa

4261 taggcctcaa agcgttccaa atatccaatt gcagattcca caaaaaaagt tttttaaaac

4321 tgctcaatca aatgatagat taaactctgt gagattagtg cacacatgtc aaaaaagttt

4381 ctcagaatgc ttctgtgtac tttttagggg aagatatttc cttttccacc atcggccaca

4441 aaggactcca aataaccaca tgcagattct agtaacacag agtttcaaaa ctgctctatc

4501 aaaagataag ttcaactctg agagtttagt gcaaccatcg tgaagaagtt tctcagaatg

4561 cttctgagta gtgtttatgt gaagatattt ccttttccac cataggcctg aaagccctcc

4621 aaatatccac ttgcagatcc tacaaaaaga aagtttcgaa atgctctctc aaacgatagt

4681 ttcgactctg tggtatgaat acacacatca caaagaagtt tctcagaatg cttctgtgta

4741 gtttttaaat gaagatattt ctttttccac cataggcctc aaagcactcc aaatatgcac

4801 ttccagattc tacaaaaaga gtgtttcaga actgctcaat caaaaggaag gttccagtct

4861 gagacaaata cacacatcaa aaggtagttt ctcagaatgc ttctgtgtag tttttatgtg

4921 aagatatttt cctttccacc ataggccaca aatggctcta aatacccact tacattttcc

4981 acaaaaagag agtttcaaaa ctgctctacc aaaggtaagt ttaacgctgt gagttaagaa

5041 catcacaaag aagtttctca gaatgcttct gtgtagttct tacgtaaaga tatttccttt

5101 tacacaatag gcagaaaagt gctccaaata tccacttgaa gattctacag aaaccgtgtt

5161 tcaaaactgc cgaatcaaaa gaaaggttca actctgtgag atgaatgcac acataacaaa

5221 ggagtttctc agaatgcttc tgtgtagctt ttatatgaag acatttagtt ttccacaaca

5281 ggcctcaaag ctctctccat atccacttgc agattctacc gaaagagtgc ttccaaactg

5341 ctcaatcaaa agagacattc aaatctgtga ggtgaatgca gacatcgtaa agaagtttct

5401 cagaatgctt ctgtgtattt tttgtgtgaa gttattcgtt tttgcaccat aggcctccaa

5461 gcgttctaaa tatccacttc tagattctac aaaaagagag tttcaaaact actcaaacaa

5521 aaggttcaat tctgtgagtt gaaagcaaac atcacaaaga agtttctcag aatgcgtctg

5581 tgtagttttg atgtgaagat atttcctttt cacartagaa tgcaaagggc tccaaatatc

5641 cacttggaga ttctacaaaa agagtttcaa aaccgctctg tcaaatgata ggttgaactc

5701 ccggaggtga atacacacat cacaaagagg tttctcagca tgcttctgtg tagtttttat

5761 gtaaacatat ttccgtttct atcat

AGTAGAATGCAAAGGGCTCC

CACCTCCGGGAGTTCAACCTA

GTGAAGATATTTCCTTTTCACAGTAG

AATAGAATGCAAAGGGCTCC

GTGAAGATATTTCCTTTTCACAATAG

GATAGAAACGGAAATATGTTTACAT

GTGTATTCACCTCCGGGAGTTC

TTGTGATGTGTGTATTCACCTCCG

ATGATAGAAACGGAAATATG

ATGATAGAAACGGAAATATGTTTAC

AGTAGAATGCAAAGGGCTCC

ACCGCTCTGTCAAAT

ATTTGACAGAGCGGT

AAACCGCTCTGTCAA

In one aspect, this invention provides compositions comprising, or alternatively consisting essentially of or alternatively consisting of an isolated oligonucleotide of at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides complementary to a centromeric alphoid repeat sequence of the human Y chromosome (for example, SEQ ID NO. 1 or SEQ ID NO. 2), also referred to herein as "target polynucleotide". Also provided are oligonucleotides having at least 85 % sequence identity to these isolated oligonucleotides. The oligonucleotides of the invention will hybridize, amplify and/or detect male fetal DNA of the centromeric alphoid repeat sequence that may be present in a maternal whole blood sample. The method can comprise amplification of target polynucleotides in a maternal whole blood sample. In a further aspect of the invention, the amplification of the target polynucleotide is accomplished by a procedure comprising the polymerase chain reaction (PCR).

In another aspect, the invention provides individual primers of isolated oligonucleotides described in Table 1 (SEQ ID NOS. 3-13, and 18-27) which may be combined, for example as pairs described in Table 22, Table 23 or Table 24, below. These pairs of isolated oligonucleotides are comprised of a first and second oligonucleotide, wherein the first oligonucleotide is selected from SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 13, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 24, SEQ ID. NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 and the second oligonucleotide is selected from SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 18, SEQ ID NO. 22 or SEQ ID NO. 23. In another aspect, the invention provides a collection of at least two isolated oligonucleotides described above, wherein their primary nucleotides sequences are non-identical. The invention also provides a solid support comprising the isolated oliconucleotides described above attached thereto. In yet another aspect, the invention provides a composition of isolated oligonucleotides, primer pairs, or collection of isolated oligonucleotides described above and a carrier. In a further aspect, the carrier is a buffered solution such as, but not limited to, a PCR buffer solution.

In another aspect, the invention provides methods for determining the gender of a fetus using a human maternal whole blood sample by detecting the presence or absence of a centromeric alphoid repeat sequence of the human Y chromosome in the sample, wherein the presence of the sequence in the sample is a determination the gender of the fetus is male or alternatively the absence of the sequence in the sample is a determination the gender of the fetus is female. The sample is isolated at least 5 weeks, or alternatively at least 6 weeks, or alternatively at least 7 weeks from conception of the fetus. In another aspect, the sample is dried or is contained in a medium that serves to preserve the sample. In further aspect, the detecting step comprises contacting a polynucleotide isolated from the sample with an antibody that specifically recognizes the centromeric alphoid repeat sequence of the human Y chromosome, the contacting under conditions that favor formation of an antibody and polynucleotide complex and detecting any complex so formed, wherein the presence of said complex indicates the presence of the sequence, whereas the absence of said complex indicates the absence of the sequence. In another aspect, the method comprises detecting the presence or absence of the centromeric alphoid repeat sequence of the human Y chromosome in the sample by contacting an isolated oligonucleotide described above with nucleic acids or polynucleotides isolated from the sample of the human maternal whole blood under conditions favoring the formation of a hybridization complex between the isolated oligonucleotide and a centromeric alphoid repeat sequence of the human Y chromosome in the sample and detecting the formation of any hybridization complex so formed, wherein the presence of the detected hybridization complex is a determination that the gender of the fetus is male, whereas the absence is a determination that the gender of the fetus is female. In a further aspect, the detecting step comprises conventional sequencing techniques as described herein or mass spectroscopy of the hybridization complex so formed. In another aspect of the invention, the isolated oligonucleotides or compositions thereof can be used in a method to detect a paternally inherited nucleic acid of fetal origin in a human maternal whole blood sample. In one aspect of the invention, the nucleic acid of fetal origin is the paternally inherited Y chromosome. In a further aspect, the method comprises providing the human maternal whole blood sample, isolating nucleic acids or polynucleotides from the sample, contacting the isolated nucleic acids or polynucleotides with an isolated oligonucleotide that specifically hybridizes to a centromeric alphoid repeat sequence of the human Y chromosome under conditions favorable to form a nucleic acid hybridization complex between the oligonucleotide and the centromeric alphoid repeat sequence and detecting the presence of any hybridization complex so formed. In another aspect, the method comprises contacting a polynucleotide isolated from the sample with a first pair of isolated oligonucleotides comprising a first and second isolated oligonucleotide described herein under conditions favoring the formation of a hybridization complex between the first primer pair and a centromeric alphoid repeat sequence of the human Y chromosome in the sample, amplifying the centromeric alphoid repeat sequence of the human Y chromosome located between the first pair of isolated oligonucleotides, contacting the amplified sequence with a second pair of isolated oligonucleotides comprising a first and second isolated oligonucleotide described herein under conditions favoring the formation of a hybridization complex between the second pair of isolated oligonucleotides and the amplified sequence, and detecting the presence of any hybridization complex so formed between the second pair of isolated oligonucleotides and the amplified sequence. In yet further aspect, the nucleic acid of fetal origin is the region comprising the centromeric alphoid repeat sequence or a fragment thereof, of a human Y chromosome (for example, SEQ ID NO. 1 or SEQ ID NO. 2). In one aspect of the invention, the maternal whole blood sample is isolated at least 5 weeks, or alternatively at least 6 weeks, or alternatively at least 7 weeks from conception of a fetus. In yet another aspect, the sample is dried or is contained in a medium that serves to preserve the sample.

In a further aspect, the method comprises amplifying the target nucleic acid of fetal origin by any suitable amplification method such as, but not limited to, conventional sequencing technology, polymerase chain reaction ("PCR") by contacting the sample with at least one oligonucleotide probe or primer which selectively and/or detectably hybridizes to a centromeric alphoid repeat sequence of the human Y chromosome. The oligonucleotide probe or primer of this invention has the ability to hybridize, amplify and/or detect male fetal DNA isolated from a maternal whole blood sample. In one aspect, the oligonucleotide primer is selected from SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 of Table 1. In another aspect, the oligonucleotide probe is selected from SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, or SEQ ID NO. 17.

In a further aspect, at least one primer comprises at least 10 contiguous nucleotides of sequence of SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27 or equivalents of these sequences. In yet a further aspect, at least one probe comprises at least 10 contiguous nucleotides of SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, and SEQ ID NO. 17. In yet another aspect, the primer is a primer pair of isolated oligonucleotides described in Table 1 in combination with each other as described in Table 22, Table 23 or Table 24, below.

Applicants also provide the use of the probes and/or primers, alone or in combination as set forth herein, in methods to detect centromeric alphoid repeat sequence of the human Y chromosome as set forth herein.

Applicants also provide kits for detecting the target polynucleotide and for determining the gender of a fetus in a pregnant female. In one aspect, the kits are for performance of the assays described herein. These kits contain at least one composition of this invention and instructions for correlating the presence or absence of a centromeric alphoid repeat sequence of the human Y chromosome (for example, SEQ ID NO. 1 or SEQ ID NO. 2) to the gender of the fetus. In another aspect, the Applicants provide kits for collection and isolation of a human maternal blood sample comprising a medium to preserve the sample and instructions for applying the sample to the medium. In yet another aspect, the Applicants provide a system for determining the gender of a fetus in a maternal whole blood sample comprising the kit for collecting and isolating a human maternal blood sample and the kit for detecting the target polynucleotide for determining the gender of the fetus. BRIEF DESCRIPTION OF THE FIGURES

Three figures are attached to this application. The figures graphically illustrates the results of the experimental example.

Figure 1 shows the specificity and sensitivity achieved in detection of the centromeric alphoid repeat sequence of the human Y chromosome in purified genomic DNA dilutions. Serial dilutions of female DNA (triangles) and male DNA (diamonds) were assayed by the method described in Example 1. The X-axis represents the quantity of DNA by genome equivalent in each PCR reaction (GE/PCR). The Y-axis represents the cycle threshold (CT) at which a positive fluorescence signal is detected for the presence of the centromeric alphoid repeat sequence. An increase in fluorescence after 37 or more cycles is considered a negative identifier for the presence of the centromeric alphoid repeat sequence.

Figure 2 shows the sensitivity of detecting the multiple repeats sequence of the centromeric alphoid repeat sequence of the human Y chromosome compared to detecting a single copy gene, RNAse P. Serial dilutions of purified genomic male DNA were assayed by the method described in Example 1. The amplification of the alphoid repeat sequence (boxes) versus the single copy RNAse P gene (circles) at various dilutions of the DNA is shown. The X-axis represents the concentration of DNA by genome equivalent in each PCR reaction (GE/PCR). The Y-axis represents the cycle threshold (CT) at which a positive fluorescence signal is detected for the presence of either the centromeric alphoid repeat sequence or the RNAse P gene.

Figure 3 shows the determination of the gender of a fetus in a maternal whole blood sample isolated at 7 weeks gestation using the method described in Example 1. The identification of a male fetus was determined when the fluorescence of an amplification reaction increased above a standard threshold prior to approximately 37 cycles, which was therein defined as a positive reaction. The maternal whole blood sample with a female fetus results in a detectable single following several additional cycles in excess of about 37 cycles and thus was classified as a negative identifier for the presence of the centromeric alphoid repeat sequence. The fluorescence threshold for this reaction was set at 0.2016168. The darker lines represent the male DNA whereas the lighter lines represent female DNA. The X-axis represents the number of cycles the PCR reaction incurred. The Y-axis represents the change in detectable fluorescence level for each reaction (ΔRn). MODES FOR CARRYING OUT THE INVENTION

Before the compositions and methods are described, it is to be understood that the invention is not limited to the particular methodologies, protocols, cell lines, assays, and reagents described, as these may vary. It is also to be understood that the terminology used herein is intended to describe particular embodiments of the present invention, and is in no way intended to limit the scope of the present invention as set forth in the appended claims.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3 ^rd edition; the series

Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5 ^th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology; Manipulating the Mouse Embryo: A Laboratory Manual, 3 ^rd edition (Cold Spring Harbor Laboratory Press (2002)).

All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied ( + ) or ( - ) by increments of 0.1 or 1 where appropriate. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term "about". The term "about" also includes the exact value "X" in addition to minor increments of "X" such as "X + 0.1 or 1" or "X - 0.1 or 1," where appropriate. It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

Definitions

As used herein, certain terms may have the following defined meanings. As used in the specification and claims, the singular form "a," "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a polynucleotide" includes a plurality of polynucleotides, including mixtures thereof.

As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but not excluding others. "Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition or method. "Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this invention. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated methods steps or compositions (consisting of).

The term "isolated" as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs or RNAs, respectively, that are present in the natural source of the macromolecule. The term "isolated" as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an "isolated nucleic acid" is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.

The term "maternal" refers to a female subject who is carrying a fetus.

The term "paternal" refers to a male subject from whom a fetus received or inherited the Y chromosome which determines the gender of the fetus. A "subject," "individual" or "patient" is used interchangeably herein and refers to a vertebrate, for example a primate, a mammal or preferably a human. Mammals include, but are not limited to equines, canines, bovines, ovines, murines, rats, simians, humans, farm animals, sport animals and pets. The methods are particularly suited to mammals that are more likely than not produce a single offspring per pregnancy.

The term "whole blood" refers to blood which includes all components of blood circulating in a subject including, but not limited to, red blood cells, white blood cells, plasma, clotting factors, small proteins, platelets and/or cryoprecipitate. This is typically the type of blood which is donated when a human patient gives blood.

The term "allele", which is used interchangeably herein with "allelic variant" refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene. Alleles of a specific gene can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions and insertions of nucleotides. An allele of a gene can also be a form of a gene containing a mutation.

As used herein, the term "target polynucleotide" intends one or more polynucleotides identical to the centromeric alphoid repeat sequence of the human Y chromosome or a fragment of that sequence. The "target polynucleotide" also includes nucleotides or a polynucleotide sequence other than the centromeric alphoid repeat sequence of the human Y chromosome that is suitable as a positive or negative control sequence in an amplification assay.

The centromeric alphoid repeat sequence of the human Y chromosome is part of the alphoid repeat sequences found mainly at the centromeres of the chromosomes of many primates and are the only repetitive DNA sequences showing chromosome specificity. Tyler-Smith et al. (1987) J MoL Biol. 195:457-470; Jørgensen et al. (1986) J MoL Biol. 187(2):185- 196. The alphoid repeat sequence of the human Y chromosome is unique compared to the comparable centromeric repeats on other chromosomes. Wolfe et al. (1985) J MoL Biol. 182(4):477-485. The centromeric region of the Y chromosome is comprised of approximately 100 copies of a 5.5, 5.7 or 6.0 kilobase alphoid repeat sequence (see, for example SEQ ID NO. 2, a 5.7 kb repeat). Wolfe et al. (1985) J MoL Biol. 182(4):477-485; jørgensen et al. (1986) J MoL Biol. 187(2):185-196 and Tyler-Smith et al. (1987) J MoL Biol. 195:457-470. Furthermore, the alphoid repeat of the human Y chromosome is comprised of a series of smaller tandemly repeated sequences of approximately 170 or 171 base pairs (see, for example SEQ ID NO. 1).

In one aspect of the invention, the phrase "endogenously cleaved male fetal DNA" refers to the fragments of fetal derived polynucleotides that are no longer intact chromosomal DNA from a male fetus or a male fetal derived cell. These polynucleotide fragments have been endogenously cleaved or broken by naturally occurring processes including, but not limited to, enzymatic cleavage, apoptotic degradation or physical breaking. In another aspect, endogenously cleaved male fetal DNA may be derived from a progenitor cell from the fetus that has been released into the maternal blood stream.

"Cells," "host cells" or "recombinant host cells" are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

"Amplify" "amplifying" or "amplification" of a polynucleotide sequence includes methods such as traditional cloning methodologies, PCR, ligation amplification (or ligase chain reaction, LCR) or other amplification methods. These methods are known and practiced in the art. See, e.g., U.S. Patent Nos. 4,683,195 and 4,683,202 and Innis et al. (1990) MoL Cell Biol. 10(11):5977-5982 (for PCR); and Wu et al. (1989) Genomics 4:560-569 (for LCR). In general, the PCR procedure describes a method of gene amplification which is comprised of (i) sequence-specific hybridization of primers to specific genes within a DNA sample (or library), (ii) subsequent amplification involving multiple rounds of annealing, elongation, and denaturation using a DNA polymerase, and (iii) screening the PCR products for a band of the correct size. The primers used are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to each strand of the genomic locus to be amplified. Reagents and hardware for conducting PCR are commercially available. Primers useful to amplify sequences from a particular region are preferably complementary to, and hybridize specifically to sequences in the target region or in its flanking regions. Nucleic acid sequences generated by amplification may be sequenced directly. Alternatively the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments is known in the art.

A "primer" is a short polynucleotide, generally with a free 3 ' -OH group that binds to a target or "template" potentially present in a sample of interest by hybridizing with the target, and thereafter promoting polymerization of a polynucleotide complementary to the target. A "polymerase chain reaction" ("PCR") is a reaction in which replicate copies are made of a target polynucleotide using a "pair of primers" or a "set of primers" consisting of an "upstream" and a "downstream" primer, and a catalyst of polymerization, such as a DNA polymerase, and typically a thermally-stable polymerase enzyme. Methods for PCR are well known in the art, and taught, for example in MacPherson et al. (1991) PCR 1 : A Practical Approach (IRL Press at Oxford University Press). All processes of producing replicate copies of a polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "replication." A primer can also be used as a probe in hybridization reactions, such as Southern or Northern blot analyses. Sambrook and Russell (2001), supra.

Primers for use in the methods of this invention are comprised of contiguous nucleotides ranging from about 7 to about 100 nucleotides. In one aspect, the primer is at least about 7 contiguous nucleotides, or alternatively at least about 8 nucleotides, or alternatively at least about 9, or at least about 10 nucleotides, or alternatively at least about 11 nucleotides, or alternatively at least about 12 nucleotides, or alternatively at least about 13 nucleotides, or alternatively at least about 14 nucleotides, or alternatively at least about 15 nucleotides, or alternatively at least about 16 nucleotides, or alternatively at least about 17 nucleotides, or alternatively at least about 18 nucleotides, or alternatively at least about 19 nucleotides, or alternatively at least about 20 nucleotides, or alternatively at least about 21 nucleotides, or alternatively at least about 22 nucleotides, or alternatively at least about 23 nucleotides, or alternatively at least about 24 nucleotides, or alternatively at least about 25 nucleotides, or alternatively at least about 26 nucleotides, or alternatively at least about 27 nucleotides, or alternatively at least about 28 nucleotides, or alternatively at least about 29 nucleotides, or alternatively at least about 30 nucleotides, or alternatively at least about 50 nucleotides, or alternatively at least about 75 nucleotides or alternatively at least about 100 nucleotides. In another aspect of the invention, the primers are no more than about 110 nucleotides, or alternatively no more than about 100 nucleotides, or alternatively no more than about 75 nucleotides, or alternatively no more than about 50 nucleotides, or alternatively no more than about 30 nucleotides, or alternatively no more than about 29 nucleotides, or alternatively no more than about 28 nucleotides, or alternatively no more than about 27 nucleotides, or alternatively no more than about 26 nucleotides or alternatively no more than about 25 nucleotides or alternatively no more than about 24 nucleotides, or alternatively no more than about 23 nucleotides, or alternatively no more than about 22 nucleotides, or alternatively no more than about 21 nucleotides. In yet another aspect, the primers are from 7 to about 30 contiguous nucleotides, or alternatively from about 10 to about 30 contiguous nucleotides, or alternatively from about 15 to about 30 contiguous nucleotides, or alternatively from about 20 to about 30 contiguous nucleotides.

A "probe" when used in the context of polynucleotide manipulation refers to an oligonucleotide that is provided as a reagent to detect a target potentially present in a sample of interest by hybridizing with the target. Polynucleotide probes of the invention range in length from about 7 to about 5,000 nucleotides. In one aspect, the probe is at least about 7 contiguous nucleotides, or alternatively at least about 8 nucleotides, or alternatively at least about 9 nucleotides, or alternatively at least about 10 nucleotides, or alternatively at least about 12 nucleotides, or alternatively at least about 15 nucleotides, or alternatively at least about 20 nucleotides, or alternatively at least about 30 nucleotides, or alternatively at least about 50 nucleotides, or alternatively at least about 75, or alternatively at least about 100 nucleotides, or alternatively at least about 200 nucleotides, or alternatively at least about 500 nucleotides, or alternatively at least about 1000 nucleotides, or alternatively at least about 2000 nucleotides, or alternatively at least about 3000 nucleotides, or alternatively at least about 5000 nucleotides. In another aspect of the invention, the probe is no more than about 200, or alternatively no more than about 100 nucleotides, or alternatively no more than about 75 nucleotides, or alternatively no more than about 50 nucleotides, or alternatively no more than about 30 nucleotides, or alternatively no more than about 20 nucleotides, or alternatively no more than about 15 nucleotides. Usually, a probe will comprise a detectable label or a means by which a label can be attached, either before or subsequent to the hybridization reaction. Alternatively, a "probe" can be a biological compound such as a polypeptide, antibody, or fragments thereof that is capable of binding to the target potentially present in a sample of interest. In one aspect, the probe is attached to a solid support such as a gene chip or other similar device.

The term "genotype" refers to the specific allelic composition of an entire cell, a certain gene or a specific polynucleotide region of a genome, whereas the term "phenotype' refers to the detectable outward manifestations of a specific genotype.

As used herein, the term "gene" or "recombinant gene" refers to a nucleic acid molecule comprising an open reading frame and including at least one exon and (optionally) an intron sequence. The term "intron" refers to a DNA sequence present in a given gene which is spliced out during mRNA maturation.

"Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, though preferably less than 25% identity, with one of the sequences of the present invention.

A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 98 % or 99 %) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Ausubel et al. eds. (2007) Current Protocols in Molecular Biology. Preferably, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following Internet address: http://www.ncbi.nlm.nih.gov/blast/Blast.cgi, last accessed on May 21, 2008. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity.

The term "an equivalent nucleic acid" refers to a nucleic acid having a nucleotide sequence having a certain degree of homology with the nucleotide sequence of the nucleic acid or complement thereof. A homolog of a double stranded nucleic acid is intended to include nucleic acids having a nucleotide sequence which has a certain degree of homology with or with the complement thereof. In one aspect, homologs of nucleic acids are capable of hybridizing to the nucleic acid or complement thereof.

The term "interact" as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a hybridization assay. The term interact is also meant to include "binding" interactions between molecules. Interactions may be, for example, protein-protein, protein-nucleic acid, or nucleic acid-nucleic acid in nature.

"Hybridization" refers to a reaction in which one or more polynucleotides react to form a hybridization complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PCR reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.

Hybridization reactions can be performed under conditions of different "stringency". In general, a low stringency hybridization reaction is carried out at about 40 ⁰ C in about 1O x SSC or a solution of equivalent ionic strength/temperature. A moderate stringency hybridization is typically performed at about 50 ⁰ C in about 6 x SSC, and a high stringency hybridization reaction is generally performed at about 60 ⁰ C in about 1 x SSC. Hybridization reactions can also be performed under "physiological conditions" which is well known to one of skill in the art. A non-limiting example of a physiological condition is the temperature, ionic strength, pH and concentration OfMg ²⁺ normally found in a cell. When hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides, the reaction is called "annealing" and those polynucleotides are described as "complementary". A double-stranded polynucleotide can be "complementary" or "homologous" to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second. "Complementarity" or "homology" (the degree that one polynucleotide is complementary with another) is quantifiable in terms of the proportion of bases in opposing strands that are expected to form hydrogen bonding with each other, according to generally accepted base-pairing rules.

The term "mismatches" refers to hybridized nucleic acid duplexes which are not 100% homologous. The lack of total homology may be due to deletions, insertions, inversions, substitutions or frameshift mutations.

As used herein, the term "oligonucleotide" refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides. Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine. For purposes of clarity, when referring herein to a nucleotide of a nucleic acid, which can be DNA or an RNA, the terms "adenosine", "cytidine", "guanosine", and "thymidine" are used. It is understood that if the nucleic acid is RNA, a nucleotide having a uracil base is uridine.

The terms "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of this invention that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.

A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine when the polynucleotide is RNA. Thus, the term "polynucleotide sequence" is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. The term "polymorphism" refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene". A polymorphic region can be a single nucleotide, the identity of which differs in different alleles.

As used herein, the term "carrier" encompasses any of the standard carriers, such as a phosphate buffered saline solution, buffers, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see

Sambrook and Russell (2001), supra. Those skilled in the art will know many other suitable carriers for binding polynucleotides, or will be able to ascertain the same by use of routine experimentation. In one aspect of the invention, the carrier is a buffered solution such as, but not limited to, a PCR buffer solution.

The phrase "solid support" refers to non-aqueous surfaces such as "culture plates" "gene chips" or "microarrays." Such gene chips or microarrays can be used for diagnostic and therapeutic purposes by a number of techniques known to one of skill in the art. In one technique, oligonucleotides are attached and arrayed on a gene chip for determining the DNA sequence by the hybridization approach, such as that outlined in U.S. Patent Nos.: 6,025,136 and 6,018,041. The polynucleotides of this invention can be modified to probes, which in turn can be used for detection of a genetic sequence. Such techniques have been described, for example, in U.S. Patent Nos.: 5,968,740 and 5,858,659. A probe also can be attached or affixed to an electrode surface for the electrochemical detection of nucleic acid sequences such as described by Kayem et al. U.S. Patent No. 5,952,172 and by Kelley et al. (1999) Nucleic Acids Res. 27:4830-4837.

Various "gene chips" or "microarrays" and similar technologies are known in the art. Examples of such include, but are not limited to, LabCard (ACLARA Bio Sciences Inc.); GeneChip (Affymetric, Inc); LabChip (Caliper Technologies Corp); a low-density array with electrochemical sensing (Clinical Micro Sensors); LabCD System (Gamera Bioscience Corp.); Omni Grid (Gene Machines); Q Array (Genetix Ltd.); a high-throughput, automated mass spectrometry systems with liquid-phase expression technology (Gene Trace Systems, Inc.); a thermal jet spotting system (Hewlett Packard Company); Hyseq HyChip (Hyseq, Inc.); BeadArray (Illumina, Inc.); GEM (Incyte Microarray Systems); a high-throughput microarry system that can dispense from 12 to 64 spots onto multiple glass slides (Intelligent Bio-Instruments); Molecular Biology Workstation and NanoChip (Nanogen, Inc.); a microfluidic glass chip (Orchid Biosciences, Inc.); BioChip Arrayer with four PiezoTip piezoelectric drop-on-demand tips (Packard Instruments, Inc.); FlexJet (Rosetta Inpharmatic, Inc.); MALDI-TOF mass spectrometer (Sequnome); ChipMaker 2 and ChipMaker 3 (TeleChem International, Inc.); and GenoSensor (Vysis, Inc.) as identified and described in Heller (2002) Annu. Rev. Biomed. Eng. 4:129-153. Examples of "gene chips" or a "microarrays" are also described in U.S. Patent Publication Nos.: 2007/0111322; 2007/0099198; 2007/0084997; 2007/0059769 and 2007/0059765 and U.S. Patent Nos.: 7,138,506; 7,070,740 and 6,989,267.

In one aspect, "gene chips" or "microarrays" containing probes or primers homologous to a polynucleotide described herein are prepared. A suitable sample is obtained from the patient, extraction of genomic DNA, RNA, protein or any combination thereof is conducted and amplified if necessary. The sample is contacted to the gene chip or microarray panel under conditions suitable for hybridization of the gene(s) or gene product(s) of interest to the probe(s) or primer(s) contained on the gene chip or microarray. The probes or primers may be detectably labeled thereby identifying the sequence(s) of interest. Alternatively, a chemical or biological reaction may be used to identify the probes or primers which hybridized with the DNA or RNA of the gene(s) of interest. The genotypes or phenotype of the patient is then determined with the aid of the aforementioned apparatus and methods. As used herein, the term "label" intends a directly or indirectly detectable compound or composition that is conjugated directly or indirectly to the composition to be detected, e.g., polynucleotide or protein such as an antibody so as to generate a "labeled" composition. The term also includes sequences conjugated to the polynucleotide that will provide a signal upon expression of the inserted sequences, such as green fluorescent protein (GFP) and the like. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable. The labels can be suitable for small scale detection or more suitable for high-throughput screening. As such, suitable labels include, but are not limited to radioisotopes, fluorochromes, chemiluminescent compounds, dyes, and proteins, including enzymes. The label may be simply detected or it may be quantified. A response that is simply detected generally comprises a response whose existence merely is confirmed, whereas a response that is quantified generally comprises a response having a quantifiable (e.g., numerically reportable) value such as an intensity, polarization, and/or other property. In luminescence or fluorescence assays, the detectable response may be generated directly using a luminophore or fluorophore associated with an assay component actually involved in binding, or indirectly using a luminophore or fluorophore associated with another (e.g., reporter or indicator) component.

Examples of luminescent labels that produce signals include, but are not limited to bioluminescence and chemiluminescence. Detectable luminescence response generally comprises a change in, or an occurrence of, a luminescence signal. Suitable methods and luminophores for luminescently labeling assay components are known in the art and described for example in Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6 ^th ed.). Examples of luminescent probes include, but are not limited to, aequorin and luciferases.

In another aspect, the fluorescent label is functionalized to facilitate covalent attachment to a cellular component present in or on the surface of the cell or tissue such as a cell surface marker. Suitable functional groups, including, but not are limited to, isothiocyanate groups, amino groups, haloacetyl groups, maleimides, succinimidyl esters, and sulfonyl halides, all of which may be used to attach the fluorescent label to a second molecule. The choice of the functional group of the fluorescent label will depend on the site of attachment to either a linker, the agent, the marker, or the second labeling agent. Detectable labels suitable for use in the present invention include those identified above as well as any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., Dynabeads™), fluorescent dyes (e.g., fluorescein, , rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue™, and Texas Red, and the like), radiolabels (e.g., ³ H, ¹²⁵ 1, ³⁵ S, ¹⁴ C, or P) enzymes (e.g., horseradish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads. Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241. Other suitable optical dyes are described in the Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6 ^th ed.).

Means of detecting such labels are known to those of skill in the art. Thus, for example, radiolabels may be detected using photographic film or scintillation counters, fluorescent markers can be detected using a photodetector to detect emitted light. Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visualizing the colored label.

Patent Publication WO 97/10365 describes methods for adding the label to the target (sample) nucleic acid(s) prior to or alternatively, after the hybridization. These are detectable labels that are directly attached to or incorporated into the target (sample) nucleic acid prior to hybridization. In contrast, "indirect labels" are joined to the hybrid duplex after hybridization. Often, the indirect label is attached to a binding moiety that has been attached to the target nucleic acid prior to the hybridization. Thus, for example, the target nucleic acid may be biotinylated before the hybridization. After hybridization, an avidin- conjugated fiuorophore will bind the biotin bearing hybrid duplexes providing a label that is easily detected. For a detailed review of methods of labeling nucleic acids and detecting labeled hybridized nucleic acids, see Laboratory Techniques In Biochemistry And Molecular Biology, Vol. 24: Hybridization with Nucleic Acid Probes, P. Tijssen, ed. Elsevier, N.Y. (1993). In another aspect, isolated oligonucleotide probes described herein are conjugated with a minor groove binder, which non-covalently bind into the minor groove of the target double stranded DNA, also known as intercalating. Such minor groove binder are known in the art. See, U.S. Patent Nos. 4,835263; 6,312,894; 5,801,155 and Kutyavin et al. (2000) Nucleic Acid Research 28(2):655-661. Probes conjugated with such a minor groove binder form extremely stable duplexes, allowing for shorter probes useful for the methods described herein.

The nucleic acid sample also may be modified prior to hybridization to the high density probe array in order to reduce sample complexity thereby decreasing background signal and improving sensitivity of the measurement using the methods disclosed in International PCT Application No. WO 97/10365.

Results from the chip assay are typically analyzed using a computer software program. See, for example, EP 0717 113 A2 and WO 95/20681. The hybridization data is read into the program, which calculates the expression level of the targeted gene(s). This figure is compared against existing data sets of gene expression levels for diseased and healthy individuals. A correlation between the obtained data and that of a set of diseased individuals indicates the onset of a disease in the subject patient.

Nucleic Acids

In one aspect of the invention, the nucleic acid sequences of the centromeric alphoid repeat sequence of the human Y chromosome, or portions thereof, can be the basis for probes and/or primers, e.g., in methods for determining the gender of a fetus. Thus, they can be used in the methods of the invention to determine the presence or absence of the centromeric alphoid repeat sequence of the human Y chromosome in a maternal whole blood sample, wherein the presence of the centromeric alphoid repeat sequence of the human Y chromosome or a portion thereof identifies the gender of the fetus to be male.

The Applicant provides an isolated oligonucleotide comprising, or alternatively consisting essentially of, or yet further consisting of at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides complementary to at least a portion of the centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2). In one aspect, the isolated oligonucleotides have at least 85 %, or alternatively at least 90 %, or alternatively at least 95 %, or alternatively at least 98% sequence identity to the centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2). In a further aspect, the oligonucleotides of the invention have the ability to hybridize, amplify and/or detect male fetal DNA isolated from a maternal whole blood sample in an amplification assay. In one aspect of the invention, the male fetal DNA is endogenous Iy cleaved male fetal DNA. Amplification assays are well known in the art and non-limiting examples of which are described herein. One amplification assay of the invention comprises polymerase chain reaction (PCR). In a further aspect of the invention, the sample is greater than about 200 μl, or alternatively, greater than about 150 μl, or alternatively, greater than about 100 μl, or alternatively greater than about 50 μl of maternal whole blood. In another aspect of the invention, the sample of maternal whole blood is no more than about 50 μl, or alternatively, no more than about 20 μl, or alternatively, no more than about 10 μl, or alternatively, no more than about 5 μl, or alternatively, no more than about 1 μl.

In one aspect of the invention, the Applicants provide a single nucleotide polymorphism (SNP) located in the centromeric alphoid repeat sequence of the human Y chromosome. The SNP is located between nucleotide position 5,683 and 5,685 of SEQ ID NO. 1, wherein the SNP is either a dinucleotide of (AA) or a trinucleotide of (AAA). This SNP is useful for the design of primers and/or probes for use in the methods described herein.

In one aspect of the invention, the Applicants provide a single nucleotide polymorphism (SNP) located in the centromeric alphoid repeat sequence of the human Y chromosome. The SNP is located at nucleotide position 5,615 of SEQ ID NO. 1, wherein the SNP is either a guanosine or a adenosine. This SNP is useful for the design of primers and/or probes for use in the methods described herein.

In one aspect, the invention is a pair of isolated oligonucleotides, wherein the first oligonucleotide comprises, or alternatively consists essentially of, or yet further consists of at least ten contiguous nucleotides of SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 13, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 24, SEQ ID. NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 and the second oligonucletode comprises, or alternatively, consists essentially of, or yet further consists of at least ten contiguous nucleotides of SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 18, SEQ ID NO. 22 or SEQ ID NO. 23. In one aspect, the pair of isolated oligonuclides excludes the first oligonucleotide of SEQ ID NO. 3 or SEQ ID NO. 13 and the second oligonucleotide of SEQ ID NO. 12 or SEQ ID NO. 18 and the pair excludes the first oligonucleotide of SEQ ID NO. 5 and the second oligonucleotide of SEQ ID NO. 8 or SEQ ID NO. 12. In one aspect, the pair of isolated oligonucleotides have at least 85 %, or alternatively at least 90 %, or alternatively at least 95 %, or alternatively at least 98 % sequence identity to the first oligonucleotide of SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 13, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 24, SEQ ID. NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 and the second primer of SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 18, SEQ ID NO. 22 or SEQ ID NO. 23. In one aspect, the pair of isolated oligonuclides excludes the first oligonucleotide of SEQ ID NO. 3 or SEQ ID NO. 13 and the second oligonucleotide of SEQ ID NO. 12 or SEQ ID NO. 18 and the pair excludes the first oligonucleotide of SEQ ID NO. 5 and the second oligonucleotide of SEQ ID NO. 8 or SEQ ID NO. 12. In a further aspect, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 3 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 4, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 5 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 4, SEQ ID NO. 9, SEQ ID NO. 10 or SEQ ID NO. 18, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 13 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9 or SEQ ID NO. 10, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 20 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 8, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 21 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 12 or SEQ ID NO. 18, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 21 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 4, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 24 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 4, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 5 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 18, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 20 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 8, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 21 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 12, or alternatively, the first oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 and the second oligonucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO. 4. In further aspect, at least one of the first or second oligonucleotides is modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule as described below or alternatively to reduce probe or primer self-annealing.

In another aspect of the invention, the oligonucleotides described herein comprise or alternatively consist essentially of or yet further consist of at least 10 contiguous nucleotides of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 wherein the 10 nucleotides proximal to the 3' end of the oligonucleotide remain the same. In further aspect, the oligonucleotides described herein comprise or alternatively consist essentially of or yet further consist of at least 80 %, or alternatively at least 85 %, or alternatively at least 90 %, or alternatively at least 95 % sequence identity to SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 wherein the 10 contiguous nucleotides at the 3' end of the oligonucleotide remain the same and one or more nucleotide closest to the 5' end of the oligonucleotide sequence is changed modified to a non-complementary nucleotide (a nucleotide that will not form a hybridization complex), a modified nucleotide or an equivalent thereof. In one aspect, such a change in the oligonucleotide sequence results in a oligonucleotide that will hybridize to the target sequence. Non-limiting examples of oligonucleotide sequences described are provided in Tables 2 through 21. Furthermore, in Tables 2 through 21, the nucleotide designation of N represents the position at which a non-complementary nucleotide, modified nucleotide or equivalent thereof is located. The nucleotides in bold text indicate the 10 contiguous nucleotides at the 3' end of the oligonucleotide that remain the same.

In another aspect the invention is a probe that comprises or alternatively consists essentially of or yet further consists of at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides of SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, or SEQ ID NO. 17. In another aspect, the probe comprises at least 85 %, or alternatively at least 90 %, or alternatively at least 95 %, or alternatively at least 98 % sequence identity to SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, or SEQ ID NO. 17. In a further aspect, the probe is modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule as described below. In another aspect, the invention is a collection of isolated oligonucleotides, comprising, or alternatively consisting essentially of or yet further consisting of, at least two oligonucleotides described herein and the isolated oligonucleotides are non-identical to each other in their primary nucleotide sequence.

In a further aspect of the invention, the isolated oligonucleotides described herein are detectably labeled before or after hybridization to the target sequence. In yet another aspect, the invention provides a solid support comprising or alternatively consisting essentially of, or yet further consisting of one or more isolated oligonucleotide described herein or a collection of isolated oligonucleotides wherein the oligonucleotides are non-identical to their primary nucleotide sequences. In a further aspect, a detectable label is attached to the isolated oligonucleotides or collection thereof.

In another aspect, the invention provides a composition comprising, or alternatively consisting essentially of, or yet further, consisting of, at least one or more isolated oligonucleotide described herein or a collection thereof and a carrier. In a further aspect, the carrier is a buffered solution such as, but not limited to, a PCR buffer solution.

The methods of the invention can use nucleic acids isolated from vertebrates. In one aspect, the vertebrate nucleic acids are mammalian nucleic acids. In a further aspect, the nucleic acids used in the methods of the invention are human nucleic acids.

Primers for use in the methods of the invention are nucleic acids which hybridize to a nucleic acid sequence which is adjacent to the target polynucleotide or which covers the target polynucleotide and is extended. A primer can be used alone in a detection method, or a primer can be used together with at least one other primer or probe in a detection method.

Primers can also be used to amplify at least a portion of the target polynucleotide. Probes for use in the methods of the invention are nucleic acids which hybridize to the target polynucleotide and which are not further extended. For example, a probe is a nucleic acid which hybridizes to the target polynucleotide, and which by hybridization or absence of hybridization to the DNA of a subject will be indicative of the presence or absence of the target polynucleotide.

In one embodiment, primers comprise or alternatively consist essentially of or yet further consists of a nucleotide sequence which comprises a region having a nucleotide sequence which hybridizes under stringent conditions to about 6, or alternatively to about 8, or alternatively to about 10, or alternatively to about 12, or alternatively to about 15, or alternatively to about 20, or alternatively to about 25, or alternatively to about 30, or alternatively to about 40, or alternatively to about 50, or alternatively to about 75 consecutive nucleotides of the sequence of interest. In yet another aspect, primers comprise or alternatively consist essentially of or yet further consists of a nucleotide sequence which comprises a region having a nucleotide sequence which hybridizes under stringent conditions to no more than about 110 nucleotides, or alternatively no more than about 100 nucleotides, or alternatively no more than about 75 nucleotides, or alternatively no more than about 50 nucleotides, or alternatively no more than about 30 nucleotides, or alternatively no more than about 29 nucleotides, or alternatively no more than about 28 nucleotides, or alternatively no more than about 27 nucleotides, or alternatively no more than about 26 nucleotides or alternatively no more than about 25 nucleotides or alternatively no more than about 24 nucleotides, or alternatively no more than about 23 nucleotides, or alternatively no more than about 22 nucleotides, or alternatively no more than about 21 nucleotides of the sequence of interest

For amplifying at least a portion of a nucleic acid, a forward primer (i.e., 5' primer) and a reverse primer (i.e., 3' primer) will preferably be used. Forward and reverse primers hybridize to complementary strands of a double stranded nucleic acid, such that upon extension from each primer, a double stranded nucleic acid is amplified. Examples of which include, but are not limited to one or more of SEQ ID NOS. 3 through 13 or 18 through 27 or at least 10 contiguous nucleotides of either thereof. The probe or primer may further comprise a label attached thereto, which, e.g., is capable of being detected, e.g. the label group is selected from, but not limited to radioisotopes, fluorescent compounds, enzymes or enzyme co-factors.

Additionally, the isolated nucleic acids used as probes or primers may be modified to become more stable. Exemplary nucleic acid molecules which are modified include phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patent Nos.: 5,176,996; 5,264,564 and 5,256,775).

The probes and/or primers used in the methods of the invention can also be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule. The oligonucleotides, e.g., probes or primers, may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane. See, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. 84:648-652; and PCT Publication No. WO 88/09810, published Dec. 15, 1988), hybridization-triggered cleavage agents, (see, e.g., Krol et al. (1988) BioTechniques 6:958-976) or intercalating agents (see, e.g., Zon (1988) Pharm. Res. 5:539-549. Other exemplary modified nucleic acids include, PNA (peptide nucleic acid) and LNA (locked nucleic acid). PNA is a synthetic nucleic acid analogue in which the sugar/phosphate backbone is composed of repeating N-(2-aminoethyl)- glycine units linked by peptide bonds. See, e.g., Orum et al. (1993) Nucl. Acids Res. 21:5332-5336; Egholm et al. (1992) J Am. Chem. Soc. 114: 1895-1897; and Egholm et al. (1993) Nature 365:566-568. LNA is modified at the ribose moiety with an extra bridge connecting the 2' and 4' carbons. The bridge "locks" the ribose in the 3'-endo structural conformation, thereby providing significant increases in thermal stability of an oligonucleotide. See, e.g., Nielsen et al. (1997) J Chem. Soc, Perkin Trans. 1:3423-3433; Koshkin et al. (1998) Tetrahedron Letters 39:4381-4384; Singh and Wengel (1998) Chem. Commun. 1247-1248; and Singh et al. (1998) Chem. Commun. 455. To this end, the nucleic acid used in the methods of the invention may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

The isolated oligonucleotides used in the methods of the invention can also comprise, or alternatively consist essentially of or yet further consist of, at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose or, alternatively, comprise or alternatively consist essentially of or yet further consist of, at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.

The oligonucleotides, to be used in the methods of the invention, can be prepared according to methods known in the art and described, e.g., in Sambrook and Russell (2001), supra. For example, discrete fragments of the DNA can be prepared and cloned using restriction enzymes. Alternatively, discrete fragments can be prepared using the PCR using primers having an appropriate sequence under the manufacturer's conditions, (described above).

Oligonucleotides can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988) Nucl. Acids Res. 16:3209, methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports. Sarin et al. (1988) Proc. Natl. Acad. ScL U.S.A. 85:7448-7451.

Chemical synthesis of the nucleotides of the present invention can be done using techniques known to one of skill in the art. Chemical synthesis of oligonucleotides can be accomplished using a number of protocols, including the use of solid support chemistry, where an oligonucleotide is synthesized one nucleoside at a time while anchored to an inorganic polymer. The first nucleotide is attached to an inorganic polymer using a reactive group on the polymer which reacts with a reactive group on the nucleoside to form a covalent linkage. Each subsequent nucleoside is then added to the first nucleoside molecule by: 1) formation of a phosphite linkage between the original nucleoside and a new nucleoside with a protecting group; 2) conversion of the phosphite linkage to a phosphate linkage by oxidation; and 3) removal of one of the protecting groups to form a new reactive site for the next nucleoside as described in U.S. Patent. Nos. 4,458,066; 5,153,319; 5,132,418 and 4,973,679 all of which are incorporated by reference herein. Solid phase synthesis of oligonucleotides eliminates the need to isolate and purify the intermediate products after the addition of every nucleotide base. Following the synthesis of RNA, the oligonucleotides is deprotected (U.S. Patent No. 5,831,071) and purified to remove by-products, incomplete synthesis products, and the like.

U.S. Patent No. 5,686,599, describes a method for one-pot deprotection of RNA under conditions suitable for the removal of the protecting group from the 2' hydroxyl position. U.S. Patent No. 5,804,683, describes a method for the removal of exocyclic protecting groups using alkylamines. U.S. Patent No. 5,831,071, describes a method for the deprotection of RNA using ethylamine, propylamine, or butylamine. U.S. Patent No. 5,281,701, describes methods and reagents for the synthesis of RNA using 5'-O-protected-2'-O-alkylsilyl- adenosine phosphoramidite and 5'-O-protected-2'-O-alkylsilylguanosine phosphoramidite monomers which are deprotected using ethylthiotetrazole. Usman and Cedergren (1992)

Trends in Biochem. Sci. 17:334-339 describe the synthesis of RNA-DNA chimeras for use in studies of the role of 2' hydroxyl groups. Sproat et al. (1995) Nucleosides & Nucleotides 14:255-273, describe the use of 5-ethylthio-lH-tetrazole as an activator to enhance the quality of oligonucleotide synthesis and product yield. Gait et al. (1991) Oligonucleotides and Analogues, ed. F. Eckstein, Oxford University Press 25-48, describe general methods for the synthesis of RNA. U.S. Patent Nos.: 4,923,901; 5,723,599; 5,674,856; 5,141,813; 5,419,966; 4,458,066; 5,252,723; Weetall et al. (1974) Methods in Enzymology 34:59-72; Van Aerschot et al. (1988) Nucleosides and Nucleotides 7:75-90; Maskos and Southern (1992) Nucleic Acids Research 20: 1679-1684; Van Ness et al. (1991) Nucleic Acids Research 19:3345-3350; Katzhendler et al. (1989) Tetrahedron 45:2777-2792; Hovinen et al. (1994) Tetrahedron 50:7203-7218; GB 2,169,605; EP 325,970; PCT publication No. WO 94/01446; German Patent No. 280,968; and German Patent No. 4,306,839, all describe specific examples of solid supports for oligonucleotide synthesis and specific methods of use for certain oligonucleotides. Additionally, methods and reagents for oligonucleotide synthesis are known to one of skill in the art as described by U.S. Patent No. 7,205,399, here incorporated by reference in its entirety.

Detection Methods

The invention further provides detection methods, which are based, at least in part, on determination of the presence or absence of a paternally inherited nucleic acid of fetal origin identified as a centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2) in a human maternal whole blood sample. The maternal whole blood sample is isolated at least about 5 weeks, or alternatively, at least about 6 weeks, or alternatively, at least about 7 weeks, or alternatively, at least about 8 weeks, or alternatively, at least about 9 weeks, or alternatively, at least about 10 weeks from conception of a fetus. In some aspects, the method includes isolating nucleic acids or polynucleotides from the maternal whole blood sample, contacting the isolated nucleic acids or polynucleotides with an oligonucleotide probe or primer that specifically hybridizes to a centromeric alphoid repeat sequence of the human Y chromosome under conditions favorable to form a nucleic acid hybridization complex between the probe or primer oligonucleotide and the centromeric alphoid repeat sequence, and detecting the presence of any hybridization complex so formed. Detecting said hybridization complex identifies the presence of the paternally inherited nucleic acid of fetal origin in the human maternal whole blood sample.

In another aspect, the method comprises contacting a polynucleotide isolated from the sample with a first pair of isolated oligonucleotides comprising a first and second isolated oligonucleotide described herein under conditions favoring the formation of a hybridization complex between the first primer pair and a centromeric alphoid repeat sequence of the human Y chromosome in the sample, amplifying the centromeric alphoid repeat sequence of the human Y chromosome located between the first pair of isolated oligonucleotides, contacting the amplified sequence with a second pair of isolated oligonucleotides comprising a first and second isolated oligonucleotide described herein under conditions favoring the formation of a hybridization complex between the second pair of isolated oligonucleotides and the amplified sequence, and detecting the presence of any hybridization complex so formed between the second pair of isolated oligonucleotides and the amplified sequence.

In another aspect, the above methods further comprise, or alternatively consist essentially of or yet further consist of, providing a control sample of nucleic acids of non-fetal origin obtained at the same time as the human maternal whole blood sample. In yet another aspect, detecting a paternally inherited nucleic acid of fetal origin in a control sample comprising using the methods described above, wherein the control sample was obtained at the same time as the human maternal blood sample

In a further aspect of the invention, the above methods comprise or alternatively consist essentially of or yet further consists of, amplifying the nucleic acids of fetal origin by polymerase chain reaction comprising contacting the sample with at least one probe or primer oligonucleotide which selectively and/or detectably hybridizes to a centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2). In a further aspect, at least one primer oligonucleotide comprises or alternatively consists essentially of or yet further consists of, the nucleotide sequence of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID. NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 or at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides of either thereof or alternatively has at least 85%, or alternatively, at least 90%, or alternatively, at least 95% sequence identity of either thereof. In yet a further aspect, at least one probe comprises or alternatively consist essentially of or yet further consists of, the nucleotide sequence of SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, or SEQ ID NO. 17 or at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides of either thereof or alternatively has at least 85%, or alternatively, at least 90%, or alternatively, at least 95% sequence identity of either thereof.

In some aspect of the methods described herein, the whole blood sample is "dried" or is contained in a medium that serves to preserved the sample. The term "dried" in the context of this invention refers to a sample of whole blood which is allowed to dry in such a way as to preserve the sample for later use in the methods described herein. In one aspect, the whole blood sample is applied to or contained within a medium such as, but not limited to, FT A® medium (Whatman, part of GE Healthcare) or a medium as described in U.S. Patent Nos.: 5,496,562; 5,756,126; 5,807,527; 5,972,386; 5,985,327; 6,627,226; 6,645,717; 6,746,841; 6,750,059; 6,881,543; 6,958,392; ,7,122,304; and 7,224,561. In one aspect, the medium contains chemicals which lyse the cell membranes and organelles in the blood, denature proteins, captures any nucleic acids within the blood and protects the nucleic acids from nucleases, oxidative and/or UV damage.

In one embodiment, it is necessary to first amplify at least a portion of the sequence of interest prior to identifying the presence or absence of the sequence of interest in a sample. Amplification can be performed, e.g., by PCR and/or LCR, according to methods known in the art. In one embodiment, a maternal whole blood sample is exposed to two PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA. In one aspect of the invention, the number of cycles sufficient to produce the required amount of amplified DNA is at least about 15 cycles, or alternatively at least about 20 cycles, or alternatively at least about 25 cycles, or alternatively at least about 30 cycles, or alternatively at least about 35 cycles, or alternatively at least about 40 cycles, or alternatively at least about 45 cycles, or alternatively at least 50 cycles. Various non-limiting examples of PCR include the herein described methods.

Allele-specific PCR is a diagnostic or cloning technique used to identify or utilize single- nucleotide polymorphisms (SNPs). It requires prior knowledge of a DNA sequence, including differences between alleles, and uses primers whose 3' ends encompass the SNP. PCR amplification under stringent conditions is much less efficient in the presence of a mismatch between template and primer, so successful amplification with a SNP-specific primer signals presence of the specific SNP in a sequence. See, Saiki et al. (1986) Nature 324(6093): 163-166 and U.S. Patent Nos.: 5,821,062; 7,052,845 or 7.250,258.

Assembly PCR or polymerase cycling assembly (PCA) is the artificial synthesis of long DNA sequences by performing PCR on a pool of long oligonucleotides with short overlapping segments. The oligonucleotides alternate between sense and antisense directions, and the overlapping segments determine the order of the PCR fragments thereby selectively producing the final long DNA product. See, Stemmer et al. (1995) Gene 164(l):49-53 and U.S. Patent Nos.: 6,335,160; 7,058,504 or 7,323,336.

Asymmetric PCR is used to preferentially amplify one strand of the original DNA more than the other. It finds use in some types of sequencing and hybridization probing where having only one of the two complementary stands is required. PCR is carried out as usual, but with a great excess of the primers for the chosen strand. Due to the slow amplification in the reaction after the limiting primer has been used up, extra cycles of PCR are required. See, Innis et al. (1988) Proc Natl Acad Sci U.S.A. 85(24):9436-9440 and U.S. Patent Nos.: 5,576,180; 6,106,777 or 7,179,600. A recent modification on this process, known as Linear- After-The-Exponential-PCR (LATE-PCR), uses a limiting primer with a higher melting temperature (T _m ) than the excess primer to maintain reaction efficiency as the limiting primer concentration decreases mid-reaction. Pierce et al. (2007) Methods MoI. Med. 132:65-85. Colony PCR uses bacterial colonies, for example E. coli, which can be rapidly screened by PCR for correct DNA vector constructs. Selected bacterial colonies are picked with a sterile toothpick and dabbed into the PCR master mix or sterile water. The PCR is started with an extended time at 95 ⁰ C when standard polymerase is used or with a shortened denaturation step at 100°C and special chimeric DNA polymerase. Pavlov et al. (2006) "Thermostable DNA Polymerases for a Wide Spectrum of Applications: Comparison of a Robust Hybrid TopoTaq to other enzymes", in Kieleczawa J: DNA Sequencing II: Optimizing Preparation and Cleanup. Jones and Bartlett, pp. 241-257.

Helicase-dependent amplification is similar to traditional PCR, but uses a constant temperature rather than cycling through denaturation and annealing/extension cycles. DNA Helicase, an enzyme that unwinds DNA, is used in place of thermal denaturation. See, Myriam et al. (2004) EMBO Reports 5(8):795-800 and U.S. Patent No. 7,282,328.

Hot-start PCR is a technique that reduces non-specific amplification during the initial set up stages of the PCR. The technique may be performed manually by heating the reaction components to the melting temperature (e.g., 95 ⁰ C) before adding the polymerase. Chou et al. (1992) Nucleic Acids Research 20:1717-1723 and U.S. Patent Nos.: 5,576,197 and 6,265,169. Specialized enzyme systems have been developed that inhibit the polymerase's activity at ambient temperature, either by the binding of an antibody (Sharkey et al. (1994) Bio/Technology 12:506-509) or by the presence of covalently bound inhibitors that only dissociate after a high-temperature activation step. Hot-start/cold- finish PCR is achieved with new hybrid polymerases that are inactive at ambient temperature and are instantly activated at elongation temperature.

Intersequence-specific (ISSR) PCR is a method for DNA fingerprinting that amplifies regions between some simple sequence repeats to produce a unique fingerprint of amplified fragment lengths. Zietkiewicz et al. (1994) Genomics 20(2): 176-83.

Inverse PCR is a method used to allow PCR when only one internal sequence is known. This is especially useful in identifying flanking sequences to various genomic inserts. This involves a series of DNA digestions and self ligation, resulting in known sequences at either end of the unknown sequence. Ochman et al. (1988) Genetics 120:621-623 and U.S. Patent Nos.: 6,013,486; 6,106,843 or 7,132,587. Ligation-mediated PCR uses small DNA linkers ligated to the DNA of interest and multiple primers annealing to the DNA linkers; it has been used for DNA sequencing, genome walking, and DNA footprinting. Mueller et al. (1988) Science 246:780-786.

Methylation-specific PCR (MSP) is used to detect methylation of CpG islands in genomic DNA. Herman et al. (1996) Proc Natl AcadSci U.S.A. 93(13):9821-9826 and U.S. Patent Nos.: 6,811,982; 6,835,541 or 7,125,673. DNA is first treated with sodium bisulfite, which converts unmethylated cytosine bases to uracil, which are recognized by PCR primers as thymine bases. Two PCRs are then carried out on the modified DNA, using primer sets identical except at any CpG islands within the primer sequences. At these points, one primer set recognizes DNA with cytosines to amplify methylated DNA, and one set recognizes DNA with uracil or thymine to amplify unmethylated DNA. MSP using qPCR can also be performed to obtain quantitative rather than qualitative information about methylation.

Multiplex ligation-dependent probe amplification (MLPA) permits multiple targets to be amplified with only a single primer pair, thus avoiding the resolution limitations of multiplex PCR (see below).

Multiplex-PCR uses multiple, unique primer sets within a single PCR mixture to produce amplicons of varying sizes specific to different DNA sequences. See, U.S. Patent Nos.: 5,882,856; 6,531,282 or 7,118,867. By targeting multiple genes at once, additional information may be gained from a single test run that otherwise would require more time and reagents to perform. Annealing temperatures for each of the primer sets must be optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form distinct bands when visualized by gel electrophoresis.

Nested PCR increases the specificity of DNA amplification by reducing background due to non-specific amplification of DNA. Two sets of primers are used in two successive PCRs. In the first reaction, one pair of primers is used to generate DNA products, which besides the intended target, may still consist of non-specifically amplified DNA fragments. The product(s) are then used in a second PCR with a set of primers whose binding sites are completely or partially different from and located 3' of each of the primers used in the first reaction. See, U.S. Patent Nos.: 5,994,006; 7,262,030 or 7,329,493. In another aspect, one primer in the second PCR is the same as one of the primers used in the first PCR, while the second primer binds to a location 3' of the corresponding primer. This method is known in the art as semi-nested PCR. Nested PCR is often more successful in specifically amplifying long DNA fragments than conventional PCR, but it requires more detailed knowledge of the target sequences.

Overlap-extension PCR is a genetic engineering technique allowing the construction of a DNA sequence with an alteration inserted beyond the limit of the longest practical primer length.

Quantitative PCR (Q-PCR), also known as RQ-PCR, QRT-PCR and RTQ-PCR, is used to measure the quantity of a PCR product following the reaction or in real-time. See, U.S. Patent Nos.: 6,258,540; 7,101,663 or 7,188,030. Q-PCR is the method of choice to quantitatively measure starting amounts of DNA, cDNA or RNA. Q-PCR is commonly used to determine whether a DNA sequence is present in a sample and the number of its copies in the sample. The method with currently the highest level of accuracy is digital PCR as described in U.S. Patent No. 6,440,705; U.S. Publication No. 2007/0202525; Dressman et al. (2003) Proc. Natl. Acad. Sci USA 100(15):8817-8822 and Vogelstein et al. (1999) Proc. Natl. Acad. Sci. USA. 96(16):9236-9241. More commonly, RT-PCR refers to reverse transcription PCR (see below), which is often used in conjunction with Q-PCR. QRT-PCR methods use fluorescent dyes, such as Sybr Green, or fiuorophore-containing DNA probes, such as TaqMan, to measure the amount of amplified product in real time.

Reverse Transcription PCR (RT-PCR) is a method used to amplify, isolate or identify a known sequence from a cellular or tissue RNA. See, U.S. Patent Nos.: 6,759,195; 7,179,600 or 7,317, 111. The PCR is preceded by a reaction using reverse transcriptase to convert RNA to cDNA. RT-PCR is widely used in expression profiling, to determine the expression of a gene or to identify the sequence of an RNA transcript, including transcription start and termination sites and, if the genomic DNA sequence of a gene is known, to map the location of exons and introns in the gene. The 5' end of a gene (corresponding to the transcription start site) is typically identified by an RT-PCR method, named rapid amplification of cDNA ends (RACE-PCR).

Thermal asymmetric interlaced PCR (TAIL-PCR) is used to isolate unknown sequence flanking a known sequence. Within the known sequence TAIL-PCR uses a nested pair of primers with differing annealing temperatures; a degenerate primer is used to amplify in the other direction from the unknown sequence. Liu et al. (1995) Genomics 25(3):674-81. Touchdown PCR a variant of PCR that aims to reduce nonspecific background by gradually lowering the annealing temperature as PCR cycling progresses. The annealing temperature at the initial cycles is usually a few degrees (3-5 ⁰ C) above the T _m of the primers used, while at the later cycles, it is a few degrees (3-5 ⁰ C) below the primer T _m . The higher temperatures give greater specificity for primer binding, and the lower temperatures permit more efficient amplification from the specific products formed during the initial cycles. Don et al. (1991) Nucl Acids Res 19:4008 and U.S. Patent No. 6,232,063.

The various amplification methods described above, include steps of annealing, extending and/or melting of primers and/or probes. It is understood that one of still in the art is able to ascertain or experimentally determine the optimal temperature and/or incubation time needed to perform the amplification methods described herein. For example, for the primers described herein, an effective annealing and/or extension temperature for the primer is about 50 ⁰ C, or alternatively about 51 ⁰ C, or alternatively about 52°C, or alternatively about 53°C, or alternatively about 54°C, or alternatively about 55°C, or alternatively about 56°C, or alternatively about 57°C, or alternatively about 58°C, or alternatively about 59°C, or alternatively about 60 ⁰ C, or alternatively about 61 ⁰ C, or alternatively about 62°C, or alternatively about 63°C, or alternatively about 64°C, or alternatively about 65°C, or alternatively about 66°C, or alternatively about 67°C, or alternatively about 68°C, or alternatively about 69°C, or alternatively about 70 ⁰ C, or alternatively about 71 ⁰ C, or alternatively about 72°C. Additionally, an effective time required for performing the desired reaction is less than about 15 sec, or less than about 20 sec, or less than about 30 sec, or alternatively less than about 35 sec, or alternatively less than about 45 sec, or alternatively less than about 50 sec, or alternatively less than about 60 sec, or alternatively less than about 70 sec, or alternatively less than about 80 sec, or alternatively less than about 90 sec, or alternatively less than about 120 sec, or alternatively less than about 180 sec, or alternatively less than about 240 sec, or alternatively about 300 sec, or alternatively less than about 360 sec.

The various amplification methods described herein, include the use of a variety of components necessary for performing the amplification reactions including, but not limited to, enzymes such as Taq DNA polymerase, dNTPs (dATP, dCTP, dGTP and dTTP), reaction buffer and ions such as Mg ²⁺ . It is understood that one of still in the art is able to ascertain or experimentally determine the optimal concentration of these components needed to perform the amplification methods described herein. It is also understood that these components may be provided in a single predetermined "Master Mix" containing all of the above components necessary to perform the amplification reaction except for the target template, primers or probe. Such Master Mixes may be used at various final concentrations in the amplification reactions such as about 0.1X, or alternatively 0.5X, or alternatively IX, or alternatively 2X, or alternatively 4X, or alternatively 5X.

In another embodiment, the various amplification methods described herein results in a contiguous nucleotide sequence of about 50 to about 500 nucleotides, or alternatively, about 50 to about 400 nucleotides, or alternatively about 50 to about 350 nucleotides, or alternatively, about 50 to about 300 nucleotides, or alternatively, about 50 to about 250 nucleotides, or alternatively, about 96 to about 194 nucleotides, or alternatively, about 96 to about 133 nucleotides. In one embodiment, various amplification methods described herein results in a contiguous nucleotide sequence of about 108 nucleotides.

In one embodiment, identifying the presence or absence of the sequence of interest is obtained by analyzing the movement of nucleic acids comprising the sequence of interest by gel electrophoresis or by conventional sequencing technology. Gel electrophoresis is a technique used for the separation of deoxyribonucleic acid, ribonucleic acid, or protein molecules using an electric current applied to a gel matrix. Berg JM, Tymoczko JL Stryer L (2002) Biochemistry, 5th ed., W.H. Freeman, New York. It is usually performed for analytical purposes, but may be used as a preparative technique prior to use of other methods such as mass spectrometry, RFLP, PCR, cloning, DNA sequencing, or Southern blotting for further characterization. An alternative method of the invention is DNA electrophoresis. This method is an analytical technique used to separate DNA fragments by size. An electric field forces the fragments to migrate through a gel. DNA molecules normally migrate from negative to positive potential due to the net negative charge of the phosphate backbone of the DNA chain. At the scale of the length of DNA molecules, the gel looks much like a random, intricate network. Longer molecules migrate more slowly because they are more easily 'trapped' in the network.

After the separation is completed, the fractions of DNA fragments of different length are often visualized using a fluorescent dye specific for DNA such as, but not limited to, ethidium bromide. The gel shows bands corresponding to different DNA molecules populations with different molecular weight. Fragment size is usually reported in "nucleotides", "base pairs" or "kb" depending upon whether single- or double-stranded DNA has been separated. Fragment size determination is typically done by comparison to commercially available DNA ladders containing linear DNA fragments of known length.

The types of gel most commonly used for DNA electrophoresis are agarose and polyacrylamide. Gels have conventionally been run in a "slab" format, but capillary electrophoresis has become important for applications such as high-throughput DNA sequencing. The measurement and analysis are mostly done with a specialized gel analysis software.

Methods for Gender Determination

In another aspect, the invention is a method for determining the gender of a fetus. The method comprises providing a human maternal whole blood sample isolated at least 5 weeks, or alternatively, at least 6 weeks, or alternatively, at least 7 weeks, or alternatively, at least 8 weeks, or alternatively, at least 9 weeks, or alternatively, at least 10 weeks from conception of the fetus. The isolated maternal whole blood sample is contacted with an oligonucleotide probe or primer described herein that specifically hybridizes to a centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2) to form a polynucleotide hybridization complex. The presence of the hybridization complex is a determination the gender of the fetus is male.

In another aspect of the invention, determining the gender of a fetus is useful for treatment of diseases such as, but not limited to, congenital adrenal hyperplasia (CAH). In this non- limiting example, a mother identified as caring a female fetus with CAH may require dexamethasone treatment. Mercado et al. (1995) J CHn Endocrinol Metab 80(7):2014-2020.

In another aspect, the above methods comprise amplifying the nucleic acids of fetal origin by polymerase chain reaction comprising or alternatively consisting essentially of or yet further consisting of, contacting the sample with at least one probe or primer which selectively hybridizes to a centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2). In a further aspect, at least one primer oligonucleotide comprises or alternatively consists essentially of or yet further consists of, the nucleotide sequence of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID. NO. 25, SEQ ID NO. 26 or SEQ ID NO. 27 or at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides of either thereof or alternatively has at least 85%, or alternatively, at least 90%, or alternatively, at least 95% sequence identity of either thereof. In yet a further aspect, at least one probe comprises or alternatively consist essentially of or yet further consists of, the nucleotide sequence of SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, or SEQ ID NO. 17 or at least 7 contiguous nucleotides, or alternatively at least 8 contiguous nucleotides, or alternatively at least 9 contiguous nucleotides, or alternatively at least 10 contiguous nucleotides of either thereof or alternatively has at least 85%, or alternatively, at least 90%, or alternatively, at least 95% sequence identity of either thereof. In another aspect, the method further comprises or alternatively consists essentially of or yet further consists of, providing a control sample of nucleic acids of non- fetal origin isolated at the same time as the human maternal whole blood sample.

In another aspect, the amplification of the above method results in a contiguous nucleotide sequence of about 50 to about 500 nucleotides, or alternatively, about 50 to about 400 nucleotides, or alternatively about 50 to about 350 nucleotides, or alternatively, about 50 to about 300 nucleotides, or alternatively, about 50 to about 250 nucleotides, or alternatively, about 96 to about 194 nucleotides, or alternatively, about 96 to about 133 nucleotides. In one embodiment, amplification of the above method results in a contiguous nucleotide sequence of about 108 nucleotides.

The methods described herein may be performed, for example, by utilizing pre-packaged detection kits, such as those described below, comprising at least one probe or primer oligonucleotide described herein, which may be conveniently used, e.g., to determine the gender of a fetus from a maternal whole blood sample.

Nucleic acids for use in the above-described detection methods can be obtained from any cell type or tissue of a subject. For example, a subject's bodily fluid (e.g. blood) can be obtained by known techniques (e.g., venipuncture). In a preferred method of the invention, a subjects blood is obtained from a simple finger prick as typically done by diabetic patients to monitor blood glucose levels on a personal monitor. Alternatively, nucleic acid tests can be performed on, e.g., urine, amniotic fluid or other samples, fluid or dry, e.g., hair or skin. Fetal nucleic acid samples can be obtained from maternal blood as described in International Patent Application No. WO 91/07660 to Bianchi. Alternatively, amniocytes or chorionic villi can be obtained for performing the detection methods. In another aspect, transcervical samples can be obtained for use in the herein described invention as described in Bussani et al. (2007) MoL Diagn. Ther. 11(2): 117-121.

In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles can also be assessed in such detection schemes. Fingerprint profiles can be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.

The invention described herein relates to methods and compositions for determining and identifying presence or absence of a centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2) or a portion thereof in a maternal whole blood sample isolated from a pregnant female. This information is useful to determine the gender of a fetus. Probes can be used to directly determine the presence of the sequence of interest in the sample or can be used simultaneously with or subsequent to amplification. The term "probes" includes naturally occurring or recombinant single- or double-stranded nucleic acids or chemically synthesized nucleic acids. They may be labeled by nick translation, Klenow fill-in reaction, PCR or other methods known in the art. Probes of the present invention, their preparation and/or labeling are described in Sambrook and Russell (2001), supra. A probe can be a polynucleotide of any length suitable for selective hybridization to a nucleic acid containing a polymorphic region of the invention. Length of the probe used will depend, in part, on the nature of the assay used and the hybridization conditions employed.

In one embodiment of the invention, probes are labeled with two fluorescent dye molecules to form so-called "molecular beacons." Tyagi and Kramer (1996) Nat. Biotechnol. 14:303- 308. Such molecular beacons signal binding to a complementary nucleic acid sequence through relief of intramolecular fluorescence quenching between dyes bound to opposing ends on an oligonucleotide probe. The use of molecular beacons for genotyping has been described in Kostrikis (1998) Science 279:1228-1229 and the use of multiple beacons simultaneously Marras (1999) Genet. Anal. 14:151-156. A quenching molecule is useful with a particular fluorophore if it has sufficient spectral overlap to substantially inhibit fluorescence of the fluorophore when the two are held proximal to one another, such as in a molecular beacon, or when attached to the ends of an oligonucleotide probe from about 1 to about 25 nucleotides.

Labeled probes also can be used in conjunction with amplification of a polymorphism. Holland et al. (1991) Proc. Natl. Acad. Sci. 88:7276-7280. U.S. Patent No. 5,210,015 by Gelfand et al. describes fluorescence-based approaches to provide real time measurements of amplification products during PCR. Such approaches have either employed intercalating dyes (such as ethidium bromide) to indicate the amount of double-stranded DNA present, or they have employed probes containing fluorescence-quencher pairs (also referred to as the "Taq-Man" approach) where the probe is cleaved during amplification to release a fluorescent molecule whose concentration is proportional to the amount of double-stranded DNA present. During amplification, the probe is digested by the nuclease activity of a polymerase when hybridized to the target sequence to cause the fluorescent molecule to be separated from the quencher molecule, thereby causing fluorescence from the reporter molecule to appear. The Taq-Man approach uses a probe containing a reporter molecule- quencher molecule pair that specifically anneals to a region of a target polynucleotide containing the sequence of interest.

Antibodies directed against the target polynucleotide may also be used in determining the presence or absence of the target polynucleotide in a maternal whole blood sample. Such methods, may be used to detect abnormalities in the structure and/or sequence composition of the target polynucleotide. Polynucleotides from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to, methods described in Thomas et al. (1988) Anal. Biochem. 168(2):358-366; Robert-Nicoud et al. (1984) EMBO J. 3(4):721-731 and Sanford et al. (1988) Nucleic Acids Res 16(22): 10643-10655 or for a general description of methods using antibodies, see Sambrook and Russell (2000) supra.

Additionally, mass spectroscopy can be used to determine the presence or absence of the target polynucleotide in a maternal whole blood sample. Methods for using mass spectroscopy to detect various polynucleotide sequences are know in the art, for example see Ding et al. (2004) Proc. Natl. Acad. ScL 101(29): 10762-10767, U.S. Patent Nos.: 6,043,031; 5,777,324; and 5,605,798 and U.S. Patent Publication No. 2004/0072156. In some embodiments, a MassARRAY system (Sequenom, San Diego, Calif.) is used to detect the target polynucleotide. Fetal male DNA is isolated from the whole blood sample as described herein. Next, DNA regions of a suitable length from the target polynucleotide are amplified by an amplification method described herein such as PCR. The amplified fragments are then attached by one strand to a solid surface and the non-immobilized strands are removed by standard denaturation and washing. The remaining immobilized single strand then serves as a template for automated enzymatic reactions that produce genotype specific detection products. These detection products are then transferred to a mass spectrometer such as, but not limited to, a SpectroREADER or MALDI-TOF (Matrix Assisted Laser Desorption Ionization—Time of Flight) as used in the MassARRAY system, wherein the detection product's molecular weight is determined. In some aspects, the software provided with the systems calculates, records, compares and reports the genotypes of the target polynucleotide in the sample.

DNA or RNA sequencing can be used to determine the identity of bases along the length of a polynucleotide, in particular to determine the presence or absence of the target polynucleotide in a sample, including a maternal blood sample. Methods for using DNA or RNA sequencing to detect various polynucleotide sequences are known in the art, for example see (reference Sanger, 454, Illumine/Solexa, solid, helicos, etc). In some embodiments, PCR is used to amplify a region of interest prior to sequencing. In some embodiments, many samples (e.g., from different samples or clients) can be tagged with polynucleotide sequences for the purpose of identifying the several samples. So tagged, a large number of samples can be combined and sequenced together, in one instrumental run to determine the presence or absence of the target polynucleotide in each sample.

Kits

Applicants also provide kits for detecting the target polynucleotide and for determining the gender of a fetus in a pregnant female. In one aspect, the kits are for performance of the assays described herein. These kits contain at least one composition of this invention and instructions for correlating the presence or absence of a centromeric alphoid repeat sequence of the human Y chromosome (for example, SEQ ID NO. 1 or SEQ ID NO. 2) to the gender of the fetus. In another aspect, the Applicants provide kits for collection and isolation of a human maternal blood sample comprising a medium to preserve the sample and instructions for applying the sample to the medium. In yet another aspect, the Applicants provide a system for determining the gender of a fetus in a maternal whole blood sample comprising the kit for collecting and isolating a human maternal blood sample and the kit for detecting the target polynucleotide for determining the gender of the fetus.

As set forth herein, the invention provides methods for determining and identifying the presence or absence of a centromeric alphoid repeat sequence of a human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2) or a portion thereof in a maternal whole blood sample isolated from a pregnant female. In some embodiments, the methods use probes or primers comprising or alternatively consisting essentially of or yet further consisting of, nucleotide sequences which are complementary to the target polynucleotide. Accordingly, the invention provides kits for performing these methods.

The kit can comprise or alternatively consists essentially of or yet further consists of, at least one probe or primer which is capable of specifically hybridizing to a centromeric alphoid repeat sequence of the human Y chromosome (see, for example SEQ ID NO. 1 or SEQ ID NO. 2) and instructions for use. The kits preferably comprise or alternatively consist essentially of or yet further consist of, at least one of the above described oligonucleotides. Kits for amplifying at least a portion of the sequence of interest comprise or alternatively consist essentially of or yet further consists of, two primers. Such kits are suitable for detection of the presence or absence of the repeat sequence in the sample, for example, fluorescence detection, by electrochemical detection, or by other detection.

Oligonucleotides, whether used as probes or primers, contained in a kit can be detectably labeled and may alternatively be conjugated or attached to a solid support. Labels can be detected either directly, for example for fluorescent labels, or indirectly. Indirect detection can include any detection method known to one of skill in the art, including biotin-avidin interactions, antibody binding and the like. Fluorescently labeled oligonucleotides also can contain a quenching molecule. Oligonucleotides can be bound to a surface. In one embodiment, the preferred surface is silica or glass. In another embodiment, the surface is a metal electrode. Yet other kits of the invention comprise or alternatively consist essentially of or yet further consist of, at least one reagent necessary to perform the assay. For example, the kit can further comprise an enzyme for use in the amplification step of the method. Alternatively or yet further, the kit can comprise a buffer or any other necessary reagent.

Conditions for incubating a oligonucleotide probe with a test sample depend on the format employed in the assay, the detection methods used, and the type and nature of the nucleic acid probe used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification or immunological assay formats can readily be adapted to employ the nucleic acid probes for use in the present invention. Examples of such assays can be found in Chard, T. (1986) "An Introduction to Radioimmunoassay and Related Techniques" Elsevier Science Publishers, Amsterdam, The Netherlands; Bullock et al., "Techniques in Immunocytochemistry" Academic Press, Orlando, FL Vol. 1 (1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen (1985) "Practice and Theory of Immunoassays: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publishers, Amsterdam, The Netherlands.

The test samples used in the detection kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, plasma, or urine. The test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.

The kits can include all or some of the positive controls, negative controls, reagents, primers, sequencing markers, probes and antibodies described herein.

Additionally, as set forth herein, the invention provides methods for determining the gender of a fetus using a maternal whole blood sample. In some embodiments, the sample is dried or is contained in a medium that serves to preserve the sample. Accordingly, the invention provides kits for properly collecting and isolating the sample for use in performing the detection methods described herein. The kit can comprise or alternatively consists essentially of or yet further consists of, at least one form of medium for collecting and preserving the maternal whole blood sample and instructions for use. In a further aspect, the medium is suitable for use at home in the absence of an individual specially trained to draw blood such as a phlebotomist. In some embodiments, the kit can comprise or alternatively consists essentially of or yet further consists of means for opening a small wound on the subject for obtaining the whole blood sample. Examples of such means include, but are not limited to, gloves, an alcohol preparation swab, and/or a lancet. The instructions provided in the kit comprise or alternatively consists essentially of or yet further consists of steps for obtaining the sample, steps for applying the sample to the medium, steps for drying the sample, suggested locations in the home where the sample should be take and/or suggested presence or absence of other individuals during the sampling procedure.

In yet another aspect, the Applicants provide a system for determining the gender of a fetus in a maternal whole blood sample that comprises or alternatively consists essentially of or yet further consists of a kit for collecting and isolating a human maternal blood sample and a kit for detecting the target polynucleotide for determining the gender of the fetus.

As amenable, these suggested kit components may be packaged in a manner customary for use by those of skill in the art. For example, these suggested kit components may be provided in solution or as a liquid dispersion or the like.

For the invention now being generally described, it will be more readily understood by reference to the following examples which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

EXPERIMENTAL EXAMPLES

In these examples and elsewhere, abbreviations have the following meanings: μL or μl or ul = MICROLITER nL or nl = NANOLITER

DMSO DIMETHYLSULFOXIDE g GRAM h HOUR

Hz HERTZ

M MOLAR mg MILLIGRAM min = MINUTE mL = MILLILITER mM = MILLIMOLAR μM or uM = MICROMOLAR mm = MILLIMETER mmol = MILLIMOLAR mol MOLES

N NORMAL cm CENTIMETER nm NANOMETER bp BASE PAIR kb KILO BASE

PCR POLYMERASE CHAIN REACTION

CAH CONGENITAL ADRENAL HYPERPLASIA

DNA DEOXYNUCLEIC ACID

C CELSIUS

A ADENINE

C CYTOSINE

G GUANINE

T THYMINE

R GUANINE OR ADENINE

U URACIL

UNG URACIL-N-GLYCOSYLASE

RNA RIBODEOXYNUCLEIC ACID

GFP GREEN FLUORESCENT PROTEIN

SNP SINGLE NUCLEOTIDE POLYMORPHISM

PCA POLYMERASE CYCLING ASSEMBLY

LCR LIGASE CHAIN REACTION

MSP METHYLATION-SPECIFIC LIGATION

ISSR INTERSEQUENCE-SPECIFIC

MLPA MULTIPLEX LIGATION-DEPENDENT PROBE

AMPLIFICATION

SEQ SEQUENCE

TAIL THERMAL ASYMMETRIC INTERLACED

RFLP RESTRICTION FRAGMENT LENGTH

POLYMORPHISM

Tm MELTING TEMPERATURE

ID IDENTIFICATION

NO. NUMBER

RACE RAPID AMPLIFICATION OF cDNA ENDS

EST EXPRESSED SEQUENCE TAG

SAGE SERIAL ANALYSIS OF GENE EXPRESSION mRNA MESSENGER RNA cDNA COMPLEMENTARY DNA

SSC SALINE SODIUM CITRATE

EXAMPLE 1

Early Stage Detection of Male Fetal DNA in the Maternal Blood Stream

This method utilizes detection of repeat polynucleotide sequences found around the centromere of each Y chromosome. Wolfe et al. (1985) J MoI. Biol. 182(4):477-485. These repetitive "alphoid sequences" have been used for the detection of Y chromosomal DNA from dried blood samples from male subjects and was described to have applications in newborn screening and in forensic science. Witt and Erickson (1989) Hum. Genet. 82:271- 274. The sensitivity of the assay described herein is such that the presence of the centromeric alphoid repeat sequence of the human Y chromosome can be detected with a minimal amount of sample such as dried blood collected by a finger prick of a mother carrying a male fetus, at least 5 weeks post conception. Accuracy of the method will improve the greater the time since conception. Thus, in one aspect, the fetus is at least 7 weeks post conception. In the absence of amplification and/or detection of the centromeric alphoid repeat sequence of the human Y chromosome, it is assumed the pregnant woman is carrying a female fetus.

Materials and Methods

Whole blood samples from pregnant women carrying a fetus were obtained by finger prick onto filter paper. The filter paper was treated with chemicals that bound DNA, but lysed cells and killed pathogens making the blood on the paper safe to send through the mail. The samples were extracted from the medium using Recovery Solutions (Genvault, San Diego, CA). The samples were isolated using a standard DNA purification kit such as those made by Qiagen (QIAamp DNA Kit) or Sigma (GenElute Blood Genomic DNA Elute Kit).

Primer pairs of two oligonucleotides as described for SEQ ID NOS: 3 through 13 (Table 1), were combined as described in Table 22 for the PCR amplification. Optionally, detection of amplified product was by a third oligonucleotide probe as described in Table 1 having the sequences of SEQ ID NOS: 14 through 17, which were labeled with either 6- carboxyfiuorescein (6-FAM) and minor groove binder (MGB). Probes can be labeled with similar fluorescence or alternatively with different florescence for multiplexing PCR detection. Purified DNA from a dried blood sample was incubated with 10 μM, or alternatively 5 μM each of the primer pair and in some experiments with 10 μM, or alternatively 5 μM of either one or the other or both probes. In a typical reaction, mixtures were first incubated at 50 ⁰ C for about 2 minutes, then 95°C for 15 minutes followed by 40 thermal cycles. Each thermal cycle consisted of a melting step at 95°C for 15 seconds followed by annealing and extension step at about 61 ⁰ C for 1 minute. Those skilled in the art are aware that the amplification reaction is stable at different temperatures and elongation times, which can vary slightly from the optimum temperature described above. For example, comparable results can be achieved at an annealing and extension temperature of about 6O ⁰ C. Alternately, comparable results can be achieved at an annealing and extension temperature of about 59 ⁰ C. The PCR reactions were performed with IX Applied Biosystem TaqMan Genotyping master mix (P/N: 4371355) in a Perkin-Elmer model 9600 thermal cycler or by fluorescence detection using the optional probes in an ABI model 7000 thermal cycler.

Because contamination with male DNA can affect results, a number of quality control standards were implemented. Only female lab members handled processing of the samples. Each sample reaction was run in triplicate. In addition, each sample was run with the addition of male DNA to detect inhibition of the reaction. A housekeeping gene was detected for each sample to ensure the amount of total DNA (fetal and non-fetal) collected was sufficient. Uracil-DNA N-Glycosylase (UNG) was present in each reaction to ensure that no carryover PCR product from previous reactions was present. Laboratory equipment was routinely bleached and/or treated with ultraviolet light. Data analysis was done with ABI Prism 7000 Sequence Detection System software.

Results

A serial dilution of female and male DNA was assayed using the primer and probes of SEQ ID NOS. 3, 4, 14, and 15 in the method described above. The female DNA at a concentration of 100 μg/ml, which is equivalent to approximately 100,000 genome equivalents (GE), showed no amplification (Figure 1). Conversely, the male DNA serial dilution showed a detectable amplification signal at less than 1 GE per PCR reaction (Figure 1). In addition to this experiment, a serial dilution of male DNA was assayed using the primer and probes of SEQ ID NOS. 3, 4, 14, and 15 which are specific to the centromeric alphoid repeat sequence and compared to detection of a single copy gene, RNAse P, in the same reaction (Figure 2). These results show that approximately 31.9 times more centromeric alphoid repeat sequence than the single copy RNAse P gene can be detected using the above method (calculation based on the 5.8 average change in cycle threshold (Ct) value between the two PCR reactions). These results demonstrates the herein described method is highly sensitive and highly specific for detecting the centromeric alphoid repeat sequence of the human Y chromosome.

The gender of a fetus in a maternal whole blood sample was determined using primers and probes of SEQ ID NOS. 3, 4, 14, and 15 in the method described above. Two maternal whole blood samples isolated at about 7 weeks gestation of the fetus (gender determination of the fetuses was subsequently confirmed upon birth). The identification of a male fetus was determined when the fluorescence of an amplification reaction increased above a standard threshold, which was therein defined as a positive reaction (Figure 3). A positive reaction identified the mother as carrying a male fetus while a negative reaction identified the mother has carrying a female fetus (Figure 3). Multiple assays using both maternal whole blood samples from mothers carrying a male fetus or purified male genomic DNA were assayed using primer oligonucleotides of SEQ ID NOS. 3-13 in various combinations as described in Table 22. These primer combinations result in the amplification of different size amplicons ranging in size from 96 bp to 194 bp.

Table 22 - Primer Combinations for Application of Centromeric Alphoid Repeat Sequence of the Human Y Chromosome

EXAMPLE 2

In an extension of the methods described in Example 1, Applicant provides the following Example 2.

Using the methods described in Example 1 , except provided that the PCR reactions were performed with 2X Applied Biosystem TaqMan Genotyping master mix (P/N: 4371355), multiple assays using both maternal whole blood samples from mothers carrying a male fetus or purified male genomic DNA were assayed using primer oligonucleotides of SEQ ID NOS. 4, 10, 13, 18, 21 and 24 and probe oligonucleotides of SEQ ID NOS. 14-17 in various combinations as described in Table 23. These primer combinations result in the amplification of different size amplicons ranging in size from 108 bp to 184 bp.

Table 23 - Primer Combinations for Application of Centromeric Alphoid Repeat Sequence of the Human Y Chromosome

EXAMPLE 3

Early Stage Detection of Male Fetal DNA in the Maternal Blood Stream Using Nested

PCR

Materials and Methods

Whole blood samples from pregnant women carrying a fetus were obtained and treated as described in Example 1.

Primer pairs of two oligonucleotides as described in Table 1, were combined as described in Table 24 for the first PCR amplification. In a typical reaction, mixtures were first incubated at 95°C for 10 minutes followed by 30 thermal cycles. Each thermal cycle consisted of a melting step at 95°C for 30 seconds followed by an annealing step at 55°C for 30 seconds followed by an extension step at 72°C for 30 seconds. Those skilled in the art are aware that the amplification reaction is stable at different temperatures and elongation times, which can vary slightly from the optimum temperature described above. The PCR reactions were performed with Applied Biosystem Taqman Universal PCR Master Mix (P/N: 4324018) in a Perkin-Elmer model 9600 thermal cycler. This was followed by a second PCR amplification. Primer pairs of two oligonucleotides as described in Table 1 , were combined as described in Table 24 for the second PCR amplification. Detection of amplified product was by a third oligonucleotide probe as described in Table 24 having the sequences of SEQ ID NOS: 14 or 15, which were labeled with either 6-carboxyfluorescein (6-FAM) and minor groove binder (MGB). Probes can be labeled with similar fluorescence or alternatively with different florescence for multiplexing PCR detection. Purified DNA from the first PCR reaction was incubated with 10 μM, or alternatively 5 μM each of the primer pair and in some experiments with 10 μM, or alternatively 5 μM of either one or the other or both probes. In a typical reaction, mixtures were first incubated at 50 ⁰ C for about 2 minutes, then 95°C for 15 minutes followed by 40 thermal cycles. Each thermal cycle consisted of a melting step at 95°C for 15 seconds followed by annealing and extension step at about 61 ⁰ C for 1 minute. Those skilled in the art are aware that the amplification reaction is stable at different temperatures and elongation times, which can vary slightly from the optimum temperature described above. For example, comparable results can be achieved at an annealing and extension temperature of about 6O ⁰ C. Alternately, comparable results can be achieved at an annealing and extension temperature of about 59 ⁰ C. The PCR reactions were performed with 2X Applied Biosystem TaqMan Genotyping master mix (P/N: 4371355) in an ABI model 7000 thermal cycler.

As described in Example 1 , the same quality control standards were implemented for the above reactions.

Results

Multiple assays using both maternal whole blood samples from mothers carrying a male fetus or purified male genomic DNA were assayed using primer oligonucleotides of SEQ ID NOS. 4, 5, 8, 12, 18, 20, 21, 25, 26 and 27 and probe oligonucleotides of SEQ ID NOS. 14 or 15 in various combinations as described in Table 24. These primer combinations in the first PCR amplification result in different size amplicons ranging in size from 163 bp to 319 bp, whereas the second PCR amplification results in a 108 bp amplicon. Table 24 - Primer Combinations for First and Second Application of Centromeric Alphoid Repeat Sequence of the Human Y Chromosome for Nested PCR

It is to be understood that while the invention has been described in conjunction with the above embodiments, that the foregoing description and examples are intended to illustrate and not limit the scope of the invention. Other aspects, advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.

Table 2 - Alternative Sequences for SEQ ID NO. 3

Table 3 - Alternative Sequences for SEQ ID NO. 4

OO

Table 4 - Alternative Sequences for SEQ ID NO. 5

ON O

Table 5 - Alternative Sequences for SEQ ID NO. 6

Table 6 - Alternative Sequences for SEQ ID NO. 7

ON K)

ON

Table 7 - Alternative Sequences for SEQ ID NO.8

SEQ ID NO. Primary Sequence Percent Sequence Homology

96.0% 92 .0% 88.0% 84 .0%

GATAGAAACGGAAATATGTT

ON

Table 8 - Alternative Sequences for SEQ ID NO. 9

ON

ON ON

Table 9 - Alternative Sequences for SEQ ID NO. 10

ON

Table 10 - Alternative Sequences for SEQ ID NO. 11

ON OO

Table 11 - Alternative Sequences for SEQ ID NO. 12

O

Table 12 - Alternative Sequences for SEQ ID NO. 18

-J

K ⁾

Table 13 - Alternative Sequences for SEQ ID NO. 19

Table 14 - Alternative Sequences for SEQ ID NO. 20

Table 15 - Alternative Sequences for SEQ ID NO. 21

ON

Table 16 - Alternative Sequences for SEQ ID NO. 22

-j -j

Table 17 - Alternative Sequences for SEQ ID NO. 23

OO

¹ VO

Table 18 - Alternative Sequences for SEQ ID NO. 24

OO o

OO

OO K ⁾

Table 20 - Alternative Sequences for SEQ ID NO.26

SEQ ID NO. Primary Percent Sequence Homology Sequence

96.0% 92.0% 88 .0% 84.0%

AGAAGT T TCT CAGAATGCT

OO

OO

Table 21 - Alternative Sequences for SEQ ID NO. 27

OO

OO ON