Concurrent sequencing of hetero n-mer polynucleotides

Field of the Invention

The invention relates to methods for use in nucleic acid sequencing, in particular methods for use in concurrent sequencing.

Background of the Invention

In some types of next-generation sequencing (NGS) technologies, a nucleic acid cluster is created on a flow cell by amplifying an original template nucleic acid strand. Sequencing cycles may be performed as complementary strands of the template nucleic acids are being synthesized, i.e., using sequencing-by-synthesis (SBS) processes.

In each sequencing cycle, deoxyribonucleic acid analogs conjugated to fluorescent labels are hybridized to the template nucleic acids, and excitation light sources are used to excite the fluorescent labels on the deoxyribonucleic acid analogs. Detectors capture fluorescent emissions from the fluorescent labels and identify the deoxyribonucleic acid analogs. As a result, the sequence of the template nucleic acids may be determined by repeatedly performing such sequencing cycles.

NGS allows for the sequencing of a number of different template nucleic acids simultaneously, which has significantly reduced the cost of sequencing in the last twenty years. However, there remains a desire for further improvements in sequencing throughput and speed.

Summary of the Invention

According to an aspect of the present invention, there is provided a method of preparing at least one polynucleotide sequence for identification, comprising: selectively processing at least one polynucleotide sequence comprising n portions, such that a proportion of each of the n portions are each capable of generating a respective n ^th signal, wherein n is 2 or more, and wherein the selective processing causes an intensity of an i ^th signal to be different compared to an intensity of a j ^th signal, for all i between 1 to n, and for all j between 1 to n, and where i is not equal to j. In one embodiment, a concentration of each of the i ^th portions capable of generating the i ^th signal is different compared to a concentration of each of the j ^th portions capable of generating the j ^th signal.

In one embodiment, a ratio between a concentration of one of the n portions capable of generating the (m-1) ^th most intense signal and a concentration of another of the n portions capable of generating the m ^th most intense signal is between 1.25:1 to 5:1 , between 1.5:1 to 3:1 , or about 2:1 , wherein m is between 2 to n.

In another embodiment, a ratio between each concentration of one of the n portions capable of generating the (m-1) ^th most intense signal and each concentration of another of the n portions capable of generating the m ^th most intense signal is between 1.25:1 to 5:1 , between 1.5:1 to 3:1 , or about 2:1 , for all m between 2 to n.

In one example, each of the n ^th signals are spatially unresolved.

In one embodiment, selectively processing comprises preparing for selective sequencing or conducting selective sequencing.

In one embodiment, selectively processing comprises contacting n ^th sequencing primer binding sites located after a 3’-end of each of the respective n portions with respective n ^th primers, wherein at least one of the n ^th primers comprises a mixture of blocked n ^th primers and unblocked n ^th primers, and of the n ^th primers that do comprise a mixture of blocked n ^th primers and unblocked n ^th primers, a ratio of blocked n ^th primers to unblocked n ^th primers is different compared to a ratio of blocked primers and unblocked primers of all other primers comprising a mixture of respective blocked and unblocked primers.

In one embodiment, all but one of the n ^th primers comprises a mixture of blocked n ^th primers and unblocked n ^th primers.

In one embodiment, the blocked n ^th primer comprises a blocking group at a 3’ end of the blocked n ^th primer. In one example, the blocking group is selected from the group consisting of: a hairpin loop, a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3’-OH group, a phosphate group, a phosphorothioate group, a propyl spacer, a modification blocking the 3’-hydroxyl group, or an inverted nucleobase.

In one embodiment, one of the blocked n ^th primers comprises a sequence as defined in SEQ ID NO. 11 to 16 or a variant or fragment thereof and/or the corresponding unblocked n ^th primer comprises a sequence as defined in SEQ ID NO. 11 to 14 or a variant or fragment thereof.

In one embodiment, n is between 2 to 6, or between 2 to 4.

In another embodiment, n is 3 or more, or between 3 to 6, or 3 or 4.

In one aspect, one of the n portions has a different polynucleotide sequence compared to another of the n portions, wherein the respective sequences may be genetically unrelated and/or obtained from different sources.

In one embodiment, each of the n portions has a different polynucleotide sequence compared to each of the other n portions, wherein the respective sequences may be genetically unrelated and/or obtained from different sources.

In one embodiment, the at least one polynucleotide sequence comprising the n portions is/are attached to a solid support, wherein the solid support may be a flow cell.

In one embodiment, the at least one polynucleotide sequence comprising the n portions forms a cluster on the solid support.

In one embodiment, the cluster is formed by bridge amplification.

In one embodiment, the at least one polynucleotide sequence comprising the n portions forms a monoclonal cluster.

In one embodiment, the solid support comprises at least one first immobilised primer and at least one second immobilised primer. In one embodiment, the first immobilised primer comprises a sequence as defined in SEQ ID NO. 1 or 5, or a variant or fragment thereof; and the second immobilised primer comprises a sequence as defined in SEQ ID NO. 2, or a variant or fragment thereof.

In one embodiment, each polynucleotide sequence comprising the n portions is attached to a first immobilised primer.

In another embodiment, each polynucleotide sequence comprising the n portions further comprises a second adaptor sequence, wherein the second adaptor sequence is substantially complementary to the second immobilised primer.

In one embodiment, the method further comprises: providing a solid support comprising a plurality of first immobilised primers and a plurality of second immobilised primers, wherein an initial proportion of the first immobilised primers have each been extended to form the polynucleotide sequence comprising n portions and substantially all of the second immobilised primers have not been extended, wherein each polynucleotide sequence comprising n portions comprises a second adaptor sequence which is substantially complementary to the second immobilised primer, selectively blocking a proportion of second immobilised primers that have not been extended using a primer blocking agent, wherein the primer blocking agent is configured to limit or prevent synthesis of a strand extending from the second immobilised primer, and conducting at least two amplification cycles in order provide a new proportion of first immobilised primers that have been extended to form the polynucleotide sequence comprising n portions and a proportion of second immobilised primers that have been extended to form polynucleotide complement sequences comprising n complement portions, wherein the new proportion of first immobilised primers is greater than the initial proportion of first immobilised primers.

In one embodiment, the method further comprises a step of cleaving substantially all of the polynucleotide complement sequences comprising n complement portions. In one embodiment, between 60% to 95% of second immobilised primers that have not been extended are blocked using the primer blocking agent; between 75% to 90%, between 80% to 90%, or between 85% to 90%.

In one embodiment, the method comprises contacting some of the second immobilised primers with an extended primer sequence, wherein the extended primer sequence is substantially complementary to the second immobilised primer and further comprises a 5’ additional nucleotide; and adding the primer blocking agent, wherein the primer blocking agent is complementary to the 5’ additional nucleotide.

In one embodiment, the primer blocking agent is a blocked nucleotide.

In one embodiment, the blocked nucleotide comprises a blocking group at a 3’ end of the blocked nucleotide.

In one example, the blocking group is selected from the group consisting of: a hairpin loop, a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3’-OH group, a phosphate group, a phosphorothioate group, a propyl spacer, a modification blocking the 3’-hydroxyl group, or an inverted nucleobase.

In one aspect, the blocked nucleotide is A or G.

In one embodiment, the extended primer sequence comprises a first extended primer sequence which is substantially complementary to the second immobilised primer and comprises a first 5’ additional nucleotide, and a second extended primer sequence which is substantially complementary to the second immobilised primer and comprises a second 5’ additional nucleotide, wherein the first 5’ additional nucleotide and the second 5’ additional nucleotide are configured to base pair with different nucleotides, and the primer blocking agent is complementary to the first 5’ additional nucleotide.

In one embodiment, the first extended primer sequence forms between 60% to 95% of the total population of extended primer sequences; between 75% to 90%, 80% to 90%, or between 85% to 90%. In one embodiment, the primer blocking agent is provided as a mixture of blocked nucleotides and unblocked nucleotides, wherein the blocked nucleotide and the unblocked nucleotide comprise the same base.

In one embodiment, the blocked nucleotide forms between 60% to 95% of the total population of the mixture; between 75% to 90%, between 80% to 90%, or between 85% to 90%.

In one embodiment, each of the n portions comprises a sequence derived from a nucleic acid sample (e.g. an insert).

In one embodiment, each of the n portions is at least 25 base pairs.

According to another aspect of the present invention, there is provided a method of sequencing at least one polynucleotide sequence, comprising: preparing at least one polynucleotide sequence for identification using a method as described herein; and concurrently sequencing nucleobases in each of the n portions based on the intensity of each of the n ^th signals.

In one embodiment, the step of concurrently sequencing nucleobases comprises performing sequencing-by-synthesis or sequencing-by-ligation.

In one embodiment, the method further comprises a step of conducting paired-end reads.

In one embodiment, the step of concurrently sequencing nucleobases comprises:

(a) obtaining first intensity data comprising a combined intensity of respective first signal components generated by each of the n portions obtained based upon respective n ^th nucleobases in each of the n portions, wherein each of the respective first signal components are obtained simultaneously;

(b) obtaining second intensity data comprising a combined intensity of respective second signal components generated by each of the n portions obtained based upon respective n ^th nucleobases in each of the n portions, wherein each of the respective second signal components are obtained simultaneously; (c) selecting one of a plurality of classifications based on the first and the second intensity data, wherein each classification represents a possible combination of respective n ^th nucleobases; and

(d) based on the selected classification, base calling the respective n ^th nucleobases for all n portions.

In one example, selecting the classification based on the first and second intensity data comprises selecting the classification based on the combined intensity of respective first signal components and second signal components.

In one embodiment, the plurality of classifications comprises 4 ⁿ classifications, each classification representing one of 4 ⁿ unique combinations of n ^th nucleobases.

In one embodiment, the first signal components and the second signal components are generated based on light emissions associated with the respective nucleobase.

In one aspect, the light emissions are detected by a sensor, wherein the sensor is configured to provide a single output based upon the n signals.

In one example, the sensor comprises a single sensing element.

In one embodiment, the method further comprises repeating steps (a) to (d) for each of a plurality of base calling cycles.

According to another aspect of the present invention, there is provided a method of synthesising template polynucleotides, comprising: providing a solid support comprising a plurality of first immobilised primers and a plurality of second immobilised primers, wherein an initial proportion of the first immobilised primers have each been extended to form a template polynucleotide and substantially all of the second immobilised primers have not been extended, wherein each template polynucleotide comprises a second adaptor sequence which is substantially complementary to the second immobilised primer, selectively blocking a proportion of second immobilised primers that have not been extended using a primer blocking agent, wherein the primer blocking agent is configured to limit or prevent synthesis of a strand extending from the second immobilised primer, and conducting at least two amplification cycles in order provide a new proportion of first immobilised primers that have been extended to form template polynucleotides and a proportion of second immobilised primers that have been extended to form template complement polynucleotides, wherein the new proportion of first immobilised primers is greater than the initial proportion of first immobilised primers.

In one embodiment, the method further comprises a step of cleaving substantially all of the polynucleotide complement sequences comprising n complement portions.

In one embodiment, between 60% to 95% of second immobilised primers that have not been extended are blocked using the primer blocking agent; or between 75% to 90%, or between 80% to 90%, or between 85% to 90%.

In one embodiment, the method comprises contacting some of the second immobilised primers with an extended primer sequence, wherein the extended primer sequence is substantially complementary to the second immobilised primer and further comprises a 5’ additional nucleotide; and adding the primer blocking agent, wherein the primer blocking agent is complementary to the 5’ additional nucleotide.

In one embodiment, the primer blocking agent is a blocked nucleotide.

In one embodiment, the blocked nucleotide comprises a blocking group at a 3’ end of the blocked nucleotide.

In one embodiment, the blocking group is selected from the group consisting of: a hairpin loop, a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3’-OH group, a phosphate group, a phosphorothioate group, a propyl spacer, a modification blocking the 3’-hydroxyl group, or an inverted nucleobase.

In one embodiment, the blocked nucleotide is A or G.

In one embodiment, the extended primer sequence comprises a first extended primer sequence which is substantially complementary to the second immobilised primer and comprises a first 5’ additional nucleotide, and a second extended primer sequence which is substantially complementary to the second immobilised primer and comprises a second 5’ additional nucleotide, wherein the first 5’ additional nucleotide and the second 5’ additional nucleotide are configured to base pair with different nucleotides, and the primer blocking agent is complementary to the first 5’ additional nucleotide.

In one embodiment, the first extended primer sequence forms between 60% to 95% of the total population of extended primer sequences; between 75% to 90%, between 80% to 90%, or between 85% to 90%.

In one embodiment, the primer blocking agent is provided as a mixture of blocked nucleotides and unblocked nucleotides, wherein the blocked nucleotide and the unblocked nucleotide comprise the same base.

In one embodiment, the blocked nucleotide forms between 60% to 95% of the total population of the mixture; between 75% to 90%, between 80% to 90%, or between 85% to 90%.

According to another aspect of the present invention, there is provided a kit comprising instructions for preparing at least one polynucleotide sequence for identification as described herein; and/or sequencing at least one polynucleotide sequence as described herein.

According to another aspect of the present invention, there is provided a data processing device comprising means for carrying out a method as described herein.

In one aspect, the data processing device is a polynucleotide sequencer.

According to another aspect of the present invention, there is provided a computer program product comprising instructions which, when the program is executed by a processor, cause the processor to carry out a method as described herein.

According to another aspect of the present invention, there is provided a computer- readable storage medium comprising instructions which, when executed by a processor, cause the processor to carry out a method as described herein. According to another aspect of the present invention, there is provided a computer- readable data carrier having stored thereon a computer program product as described herein.

According to another aspect of the present invention, there is provided a data carrier signal carrying a computer program product as described herein.

Description of the Drawings

Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.

Figure 1 shows a forward strand, reverse strand, forward complement strand, and reverse complement strand of a polynucleotide molecule.

Figure 2 shows an example of PCR stitching. Here, two sequences - a strand of a human library and a strand of a phiX library are joined together to create a single polynucleotide strand comprising both a first portion (comprising the strand of the human sequence) and a second portion (comprising the strand of the phiX sequence), as well as terminal and internal adaptor sequences.

Figure 3 shows an example of a concatenated polynucleotide sequence comprising a first portion and a second portion, as well as terminal and internal adaptor sequences.

Figure 4 shows an example of a concatenated polynucleotide sequence comprising a first portion and a second portion, as well as terminal and internal adaptor sequences.

Figure 5 shows a typical solid support.

Figure 6 shows the stages of bridge amplification for concatenated polynucleotide templates and the generation of an amplified cluster, comprising (A) a concatenated library strand hybridising to a immobilised primer; (B) generation of a template strand from the library strand; (C) dehybridisation and washing away the library strand; (D) generation of a template complement strand from the template strand via bridge amplification and dehybridisation of the sequence bridge; (E) further amplification to provide a plurality of template and template complement strands; and (F) cleavage of one set of the template and template complement strands.

Figure 7 shows the detection of nucleobases using 4-channel, 2-channel and 1 -channel chemistry.

Figure 8 shows a method of selective sequencing.

Figure 9 is a plot showing graphical representations of sixteen distributions of signals generated by polynucleotide sequences according to one embodiment.

Figure 10 is a flow diagram showing a method for base calling according to one embodiment.

Figure 11 shows (A) that by plotting relative intensities of light signals obtained from a first channel (ch1) and a second channel (ch2), a constellation of 16 clouds is obtained; (B) alignment of R1 and R2 (minor and major reads respectively) with the known human and PhiX sequence.

Detailed Description of the Invention

All patents, patent applications, and other publications referred to herein, including all sequences disclosed within these references, are expressly incorporated herein by reference, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. All documents cited are, in relevant part, incorporated herein by reference in their entireties for the purposes indicated by the context of their citation herein. However, the citation of any document is not to be construed as an admission that it is prior art with respect to the present disclosure.

The present invention can be used in sequencing, in particular concurrent sequencing. Methodologies applicable to the present invention have been described in WO 08/041002, WO 07/052006, WO 98/44151 , WO 00/18957, WO 02/06456, WO 07/107710, WO05/068656, US 13/661 ,524 and US 2012/0316086, the contents of which are herein incorporated by reference. Further information can be found in US 20060024681 , US 20060292611 , WO 06/110855, WO 06/135342, WO 03/074734, W007/010252, WO 07/091077, WO 00/179553, WO 98/44152 and WO 2022/087150, the contents of which are herein incorporated by reference.

As used herein, the term “variant” refers to a variant polypeptide sequence or part of the polypeptide sequence that retains desired function of the full non-variant sequence. For example, a desired function of the immobilised primer retains the ability to bind (i.e. hybridise) to a target sequence.

As used in any aspect described herein, a “variant” has at least 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%,

44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%,

59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%,

74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%,

89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity to the non-variant nucleic acid sequence. The sequence identity of a variant can be determined using any number of sequence alignment programs known in the art. As an example, Emboss Stretcher from the EMBL-EBI may be used: https://www.ebi.ac.uk/Tools/psa/emboss stretcher/ (using default parameters: pair output format, Matrix = BLOSUM62, Gap open = 1 , Gap extend = 1 for proteins; pair output format, Matrix = DNAfull, Gap open = 16, Gap extend = 4 for nucleotides).

As used herein, the term “fragment” refers to a functionally active series of consecutive nucleic acids from a longer nucleic acid sequence. The fragment may be at least 99%, at least 95%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 30% the length of the longer nucleic acid sequence. A fragment as used herein may also retain the ability to bind (i.e. hybridise) to a target sequence.

Sequencing generally comprises four fundamental steps: 1) library preparation to form a plurality of target polynucleotides for identification; 2) cluster generation to form an array of amplified template polynucleotides; 3) sequencing the cluster array of amplified template polynucleotides; and 4) data analysis to identify characteristics of the target polynucleotides from the amplified template polynucleotide sequences. These steps are described in greater detail below. Library strands and template terminology

For a given double-stranded polynucleotide sequence 100 to be identified, the polynucleotide sequence 100 comprises a forward strand of the sequence 101 and a reverse strand of the sequence 102. See Figure 1.

When the polynucleotide sequence 100 is replicated (e.g. using a DNA/RNA polymerase), complementary versions of the forward strand 101 of the sequence 100 and the reverse strand 102 of the sequence 100 are generated. Thus, replication of the polynucleotide sequence 100 provides a double-stranded polynucleotide sequence 100a that comprises a forward strand of the sequence 101 and a forward complement strand of the sequence 10T, and a double-stranded polynucleotide sequence 100b that comprises a reverse strand of the sequence 102 and a reverse complement strand of the sequence 102’.

The term “template” may be used to describe a complementary version of the doublestranded polynucleotide sequence 100. As such, the “template” comprises a forward complement strand of the sequence 10T and a reverse complement strand of the sequence 102’. Thus, by using the forward complement strand of the sequence 10T as a template for complementary base pairing, a sequencing process (e.g. a sequencing- by-synthesis or a sequencing-by-ligation process) reproduces information that was present in the original forward strand of the sequence 101 . Similarly, by using the reverse complement strand of the sequence 102’ as a template for complementary base pairing, a sequencing process (e.g. a sequencing-by-synthesis or a sequencing-by-ligation process) reproduces information that was present in the original reverse strand of the sequence 102.

The two strands in the template may also be referred to as a forward strand of the template 10T and a reverse strand of the template 102’. The complement of the forward strand of the template 10T is termed the forward complement strand of the template 101 , whilst the complement of the reverse strand of the template 102’ is termed the reverse complement strand of the template 102.

Generally, where forward strand, reverse strand, forward complement strand, and reverse complement strand are used herein without qualifying whether they are with respect to the original polynucleotide sequence 100 or with respect to the “template”, these terms may be interpreted as referring to the “template”.

Library preparation

Library preparation is the first step in any high-throughput sequencing platform. These libraries allow templates to be generated via complementary base pairing that can subsequently be clustered and amplified. During library preparation, nucleic acid sequences, for example genomic DNA sample, or cDNA or RNA sample, is converted into a sequencing library, which can then be sequenced. By way of example with a DNA sample, the first step in library preparation is random fragmentation of the DNA sample. Sample DNA is first fragmented and the fragments of a specific size (typically 200-500 bp, but can be larger) are ligated, sub-cloned or “inserted” in-between two oligo adaptors (adaptor sequences). The original sample DNA fragments are referred to as “inserts”. The target polynucleotides may advantageously also be size-fractionated prior to modification with the adaptor sequences.

As described herein, typically the templates to be generated from the libraries may include a concatenated polynucleotide sequence comprising n portions (e.g. a concatenated polynucleotide sequence comprising a first portion and a second portion). Generating these templates from particular libraries may be performed according to methods known to persons of skill in the art. However, some example approaches of preparing libraries suitable for generation of such templates are described below.

In some embodiments, the library may be prepared using PCR stitching methods, such as (splicing by) overlap extension PCR (also known as OE-PCR or SOE-PCR), as described in more detail in e.g. Higuchi et al. (Nucleic Acids Res., 1988, vol. 16, pp. 7351-7367), which is incorporated herein by reference. This procedure may be used, for example, for preparing templates including concatenated polynucleotide sequences comprising n portions (e.g. a concatenated polynucleotide sequence comprising a first portion and a second portion), wherein each of the n portions are different polynucleotide sequences (e.g. genetically unrelated, and/or obtained from different sources). A representative process for conducting PCR stitching for a human and PhiX library is shown in Figure 2.

As used herein, the term “genetically unrelated” refers to portions which are not related in the sense of being any two of the group consisting of: forward strands, reverse strands, forward complement strands, and reverse complement strands. However, the “genetically unrelated” sequences could be different fragment sequences which are derived from the same source, but are different fragments from that source (e.g. from the same fragmented library preparation process). This includes sequences that can be overlapping in sequence (but not identical in sequence).

The processes described above in relation to PCR stitching methods generate libraries that have concatenated polynucleotides.

Thus, in an illustrative example where n is 2, one strand of a concatenated polynucleotide within a polynucleotide library may comprise, in a 5’ to 3’ direction, a second primerbinding complement sequence 302 (e.g. P7), a first terminal sequencing primer binding site complement 303’ (e.g. B15-ME; or if ME is not present, then B15), a first insert sequence 401 , a hybridisation complement sequence 403 (e.g. ME’-HYB2-ME; or if ME’ and ME are not present, then HYB2), a second insert sequence 402, a second terminal sequencing primer binding site 304 (e.g. ME’-A14’; or if ME’ is not present, then A14’), and a first primer-binding sequence 30T (e.g. P5’) (Figures 3 and 4 - bottom strand). Although not shown in Figures 3 and 4, the strand may further comprise one or more index sequences. As such, a first index sequence (e.g. i7) may be provided between the second primer-binding complement sequence 302 (e.g. P7) and the first terminal sequencing primer binding site complement 303’ (e.g. B15-ME; or if ME is not present, then B15). Separately, or in addition, a second index complement sequence (e.g. i5’) may be provided between the second terminal sequencing primer binding site 304 (e.g. ME’-A14’) and the first primer-binding sequence 30T (e.g. P5’). Thus, in some embodiments, one strand of a polynucleotide within a polynucleotide library may comprise, in a 5’ to 3’ direction, a second primer-binding complement sequence 302 (e.g. P7), a first index sequence (e.g. i7), a first terminal sequencing primer binding site complement 303’ (e.g. B15-ME; or if ME is not present, then B15), a first insert sequence 401 , a hybridisation complement sequence 403 (e.g. ME’-HYB2-ME; or if ME’ and ME are not present, then HYB2), a second insert sequence 402, a second terminal sequencing primer binding site 304 (e.g. ME’-A14’; or if ME’ is not present, then A14’), a second index complement sequence (e.g. i5’), and a first primer-binding sequence 30T (e.g. P5’)

Another strand of a concatenated polynucleotide within a polynucleotide library may comprise, in a 5’ to 3’ direction, a first primer-binding complement sequence 301 (e.g. P5), a second terminal sequencing primer binding site complement 304’ (e.g. A14-ME; or if ME is not present, then A14), a second insert complement sequence 402’, a hybridisation sequence 403’ (e.g. ME’-HYB2’-ME; or if ME’ and ME are not present, then HYB2’), a first insert complement sequence 40T, a first terminal sequencing primer binding site 303 (e.g. ME’-B15’; or if ME’ is not present, then B15’), and a second primerbinding sequence 302’ (e.g. P7’) (Figures 3 and 4 - top strand).

Although not shown in Figures 3 and 4, the another strand may further comprise one or more index sequences. As such, a second index sequence (e.g. i5) may be provided between the first primer-binding complement sequence 301 (e.g. P5) and the second terminal sequencing primer binding site complement 304’ (e.g. A14-ME; or if ME is not present, then A14). Separately, or in addition, a first index complement sequence (e.g. i7’) may be provided between the first terminal sequencing primer binding site 303 (e.g. ME’-B15’; or if ME’ is not present, then B15’) and the second primer-binding sequence 302’ (e.g. P7’). Thus, in some embodiments, another strand of a polynucleotide within a polynucleotide library may comprise, in a 5’ to 3’ direction, a first primer-binding complement sequence 301 (e.g. P5), a second index sequence (e.g. i5), a second terminal sequencing primer binding site complement 304’ (e.g. A14-ME; or if ME is not present, then A14).), a second insert complement sequence 402’, a hybridisation sequence 403’ (e.g. ME’-HYB2’-ME; or if ME’ and ME are not present, then HYB2’), a first insert complement sequence 401’, a first terminal sequencing primer binding site 303 (e.g. ME’-B15’; or if ME’ is not present, then B15’), a first index complement sequence (e.g. i7’), and a second primer-binding sequence 302’ (e.g. P7’).

As described herein, the first insert sequence 401 and the second insert sequence 402 may comprise different types of library sequences.

In one embodiment, the first insert sequence 401 may be different to the second insert sequence 402 (e.g. genetically unrelated, and/or obtained from different sources), for example where the library is prepared using PCR stitching.

As will be understood by the skilled person, a double-stranded nucleic acid will typically be formed from two complementary polynucleotide strands comprised of deoxyribonucleotides or ribonucleotides joined by phosphodiester bonds, but may additionally include one or more ribonucleotides and/or non-nucleotide chemical moieties and/or non-naturally occurring nucleotides and/or non-naturally occurring backbone linkages. In particular, the double-stranded nucleic acid may include non- nucleotide chemical moieties, e.g. linkers or spacers, at the 5' end of one or both strands. By way of non-limiting example, the double-stranded nucleic acid may include methylated nucleotides, uracil bases, phosphorothioate groups, peptide conjugates etc. Such non-DNA or non-natural modifications may be included in order to confer some desirable property to the nucleic acid, for example to enable covalent, non-covalent or metal-coordination attachment to a solid support, or to act as spacers to position the site of cleavage an optimal distance from the solid support. A single stranded nucleic acid consists of one such polynucleotide strand. Where a polynucleotide strand is only partially hybridised to a complementary strand - for example, a long polynucleotide strand hybridised to a short nucleotide primer - it may still be referred to herein as a single stranded nucleic acid.

A sequence comprising at least a primer-binding sequence (a primer-binding sequence and a sequencing primer binding site, or a combination of a primer-binding sequence, an index sequence and a sequencing primer binding site) may be referred to herein as an adaptor sequence, and an insert (or inserts in concatenated strands) is flanked by a 5’ adaptor sequence and a 3’ adaptor sequence. The primer-binding sequence may also comprise a sequencing primer for the index read.

As used herein, an “adaptor” refers to a sequence that comprises a short sequencespecific oligonucleotide that is ligated to the 5' and 3' ends of each DNA (or RNA) fragment in a sequencing library as part of library preparation. The adaptor sequence may further comprise non-peptide linkers.

In a further embodiment, the P5’ and P7’ primer-binding sequences are complementary to short primer sequences (or lawn primers) present on the surface of a flow cell. Binding of P5’ and P7’ to their complements (P5 and P7) on - for example - the surface of the flow cell, permits nucleic acid amplification. As used herein denotes the complementary strand.

The primer-binding sequences in the adaptor which permit hybridisation to amplification primers (e.g. lawn primers) will typically be around 20-40 nucleotides in length, although the invention is not limited to sequences of this length. The precise identity of the amplification primers (e.g. lawn primers), and hence the cognate sequences in the adaptors, are generally not material to the invention, as long as the primer-binding sequences are able to interact with the amplification primers in order to direct PCR amplification. The sequence of the amplification primers may be specific for a particular target nucleic acid that it is desired to amplify, but in other embodiments these sequences may be "universal" primer sequences which enable amplification of any target nucleic acid of known or unknown sequence which has been modified to enable amplification with the universal primers. The criteria for design of PCR primers are generally well known to those of ordinary skill in the art.

The index sequences (also known as a barcode or tag sequence) are unique short DNA (or RNA) sequences that are added to each DNA (or RNA) fragment during library preparation. The unique sequences allow many libraries to be pooled together and sequenced simultaneously. Sequencing reads from pooled libraries are identified and sorted computationally, based on their barcodes, before final data analysis. Library multiplexing is also a useful technique when working with small genomes or targeting genomic regions of interest. Multiplexing with barcodes can exponentially increase the number of samples analysed in a single run, without drastically increasing run cost or run time. Examples of tag sequences are found in WO05/068656, whose contents are incorporated herein by reference in their entirety. The tag can be read at the end of the first read, or equally at the end of the second read, for example using a sequencing primer complementary to the strand marked P7. The invention is not limited by the number of reads per cluster, for example two reads per cluster: three or more reads per cluster are obtainable simply by dehybridising a first extended sequencing primer, and rehybridising a second primer before or after a cluster repopulation/strand resynthesis step. Methods of preparing suitable samples for indexing are described in, for example WO 2008/093098, which is incorporated herein by reference. Single or dual indexing may also be used. With single indexing, up to 48 unique 6-base indexes can be used to generate up to 48 uniquely tagged libraries. With dual indexing, up to 24 unique 8-base Index 1 sequences and up to 16 unique 8-base Index 2 sequences can be used in combination to generate up to 384 uniquely tagged libraries. Pairs of indexes can also be used such that every i5 index and every i7 index are used only one time. With these unique dual indexes, it is possible to identify and filter indexed hopped reads, providing even higher confidence in multiplexed samples.

The sequencing primer binding sites are sequencing and/or index primer binding sites and indicate the starting point of the sequencing read. During the sequencing process, a sequencing primer anneals (i.e. hybridises) to at least a portion of the sequencing primer binding site on the template strand. The polymerase enzyme binds to this site and incorporates complementary nucleotides base by base into the growing opposite strand.

In concatenated strands, the hybridisation sequence (or the hybridisation sequence complement) may comprise an internal sequencing primer binding site. In other words, an internal sequencing primer binding site may form part of the hybridisation sequence. For example, ME’-HYB2 (or ME’-HYB2’) may act as an internal sequencing primer binding site to which a sequencing primer can bind. Alternatively, the hybridisation sequence may be an internal sequencing primer binding site. For example, HYB2 (or HYB2’) may act as an internal sequencing primer binding site to which a sequencing primer can bind. Accordingly, we may refer to the hybridisation site herein as comprising a sequencing primer binding site (e.g. a second sequencing primer binding site), or as a sequencing primer binding site (e.g. a second sequencing primer binding site).

Cluster generation and amplification Once a double stranded nucleic acid library is formed, typically, the library has previously been subjected to denaturing conditions to provide single stranded nucleic acids. Suitable denaturing conditions will be apparent to the skilled reader with reference to standard molecular biology protocols (Sambrook et al., 2001 , Molecular Cloning, A Laboratory Manual, 4th Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds Ausubel et al). In one embodiment, chemical denaturation may be used.

Following denaturation, a single-stranded library may be contacted in free solution onto a solid support comprising surface capture moieties (for example P5 and P7 lawn primers).

Thus, embodiments of the present invention may be performed on a solid support 200, such as a flowcell. However, in alternative embodiments, seeding and clustering can be conducted off-flowcell using other types of solid support.

The solid support 200 may comprise a substrate 204. See Figure 5. The substrate 204 comprises at least one well 203 (e.g. a nanowell), and typically comprises a plurality of wells 203 (e.g. a plurality of nanowells).

In one embodiment, the solid support comprises at least one first immobilised primer and at least one second immobilised primer.

Thus, each well 203 may comprise at least one first immobilised primer 201 , and typically may comprise a plurality of first immobilised primers 201. In addition, each well 203 may comprise at least one second immobilised primer 202, and typically may comprise a plurality of second immobilised primers 202. Thus, each well 203 may comprise at least one first immobilised primer 201 and at least one second immobilised primer 202, and typically may comprise a plurality of first immobilised primers 201 and a plurality of second immobilised primers 202.

The first immobilised primer 201 may be attached via a 5’-end of its polynucleotide chain to the solid support 200. When extension occurs from first immobilised primer 201 , the extension may be in a direction away from the solid support 200. The second immobilised primer 202 may be attached via a 5’-end of its polynucleotide chain to the solid support 200. When extension occurs from second immobilised primer 202, the extension may be in a direction away from the solid support 200.

The first immobilised primer 201 may be different to the second immobilised primer 202 and/or a complement of the second immobilised primer 202. The second immobilised primer 202 may be different to the first immobilised primer 201 and/or a complement of the first immobilised primer 201.

The (or each of the) first immobilised primer(s) 201 may comprise a sequence as defined in SEQ ID NO. 1 or 5, or a variant or fragment thereof. The second immobilised primer(s) 202 may comprise a sequence as defined in SEQ ID NO. 2, or a variant or fragment thereof.

By way of brief example, following attachment of the P5 and P7 primers to the solid support, the solid support may be contacted with the template to be amplified under conditions which permit hybridisation (or annealing - such terms may be used interchangeably) between the template and the immobilised primers. The template is usually added in free solution under suitable hybridisation conditions, which will be apparent to the skilled reader. Typically, hybridisation conditions are, for example, 5xSSC at 40°C. However, other temperatures may be used during hybridisation, for example about 50°C to about 75°C, about 55°C to about 70°C, or about 60°C to about 65°C. Solid-phase amplification can then proceed. The first step of the amplification is a primer extension step in which nucleotides are added to the 3' end of the immobilised primer using the template to produce a fully extended complementary strand. The template is then typically washed off the solid support. The complementary strand will include at its 3' end a primer-binding sequence (i.e. either P5’ or P7’) which is capable of bridging to the second primer molecule immobilised on the solid support and binding. Further rounds of amplification (analogous to a standard PCR reaction) leads to the formation of clusters or colonies of template molecules bound to the solid support. This is called clustering.

Thus, solid-phase amplification by either a method analogous to that of WO 98/44151 or that of WO 00/18957 (the contents of which are incorporated herein in their entirety by reference) will result in production of a clustered array comprised of colonies of "bridged" amplification products. This process is known as bridge amplification. Both strands of the amplification products will be immobilised on the solid support at or near the 5' end, this attachment being derived from the original attachment of the amplification primers. Typically, the amplification products within each colony will be derived from amplification of a single template molecule. Other amplification procedures may be used, and will be known to the skilled person. For example, amplification may be isothermal amplification using a strand displacement polymerase; or may be exclusion amplification as described in WO 2013/188582. Further information on amplification can be found in WO 02/06456 and WO 07/107710, the contents of which are incorporated herein in their entirety by reference.

Through such approaches, a cluster of template molecules is formed, comprising copies of a template strand and copies of the complement of the template strand.

In some cases, to facilitate sequencing, one set of strands (either the original template strands or the complement strands thereof) may be removed from the solid support leaving either the original template strands or the complement strands. Suitable methods for removing such strands are described in more detail in application number WO 07/010251 , the contents of which are incorporated herein by reference in their entirety.

The steps of cluster generation and amplification for templates including a concatenated polynucleotide sequence comprising n portions (e.g. a concatenated polynucleotide sequence comprising a first portion and a second portion) are illustrated below and in Figure 6.

In cases where single (concatenated) polynucleotide strands are used, each polynucleotide sequence may be attached (via the 5’-end of the (concatenated) polynucleotide sequence) to a first immobilised primer. Each polynucleotide sequence may comprise a second adaptor sequence, wherein the second adaptor comprises a portion which is substantially complementary to the second immobilised primer (or is substantially complementary to the second immobilised primer). The second adaptor sequence may be at a 3’-end of the (concatenated) polynucleotide sequence.

In an embodiment, a solution comprising a polynucleotide library prepared by a PCR stitching method as described above may be flowed across a flowcell. In an illustrative case where n is 2, a particular concatenated polynucleotide strand from the polynucleotide library to be sequenced comprising, in a 5’ to 3’ direction, a second primer-binding complement sequence 302 (e.g. P7), a first terminal sequencing primer binding site complement 303’ (e.g. B15-ME), a first insert sequence 401 , a hybridisation complement sequence 403 (e.g. ME’-HYB2-ME), a second insert sequence 402, a second terminal sequencing primer binding site 304 (e.g. ME’-A14’), and a first primerbinding sequence 30T (e.g. P5’), may anneal (via the first primer-binding sequence 301’) to the first immobilised primer 201 (e.g. P5 lawn primer) located within a particular well 203 (Figure 6A).

The polynucleotide library may comprise other concatenated polynucleotide strands with different first insert sequences 401 and second insert sequences 402. Such other polynucleotide strands may anneal to corresponding first immobilised primers 201 (e.g. P5 lawn primers) in different wells 203, thus enabling parallel processing of the various different concatenated strands within the polynucleotide library.

A new polynucleotide strand may then be synthesised, extending from the first immobilised primer 201 (e.g. P5 lawn primer) in a direction away from the substrate 204. By using complementary base-pairing, this generates a template strand comprising, in a 5’ to 3’ direction, the first immobilised primer 201 (e.g. P5 lawn primer) which is attached to the solid support 200, a second terminal sequencing primer binding site complement 304’ (e.g. A14-ME; or if ME is not present, then A14), a second insert complement sequence 402’ (which represents a type of “second portion”), a hybridisation sequence 403’ (which comprises a type of “second sequencing primer binding site”) (e.g. ME’- HYB2’-ME; or if ME’ and ME are not present, then HYB2’), a first insert complement sequence 40T (which represents a type of “first portion”), a first terminal sequencing primer binding site 303 (which represents a type of “first sequencing primer binding site”) (e.g. ME’-B15’; or if ME’ is not present, then B15’), and a second primer-binding sequence 302’ (e.g. P7’) (Figure 6B). Such a process may utilise a polymerase, such as a DNA or RNA polymerase.

If the polynucleotides in the library comprise index sequences, then corresponding index sequences are also produced in the template. The concatenated polynucleotide strand from the polynucleotide library may then be dehybridised and washed away, leaving a template strand attached to the first immobilised primer 201 (e.g. P5 lawn primer) (Figure 6C).

The second primer-binding sequence 302’ (e.g. P7’) on the template strand may then anneal to a second immobilised primer 202 (e.g. P7 lawn primer) located within the well 203. This forms a “bridge”.

A new polynucleotide strand may then be synthesised by bridge amplification, extending from the second immobilised primer 202 (e.g. P7 lawn primer) (initially) in a direction away from the substrate 204. By using complementary base-pairing, this generates a template strand comprising, in a 5’ to 3’ direction, the second immobilised primer 202 (e.g. P7 lawn primer) which is attached to the solid support 200, a first terminal sequencing primer binding site complement 303’ (e.g. B15-ME; or if ME is not present, then B15), a first insert sequence 401 , a hybridisation complement sequence 403 (e.g. ME’-HYB2-ME; or if ME’ and ME are not present, then HYB2), a second insert sequence 402, a second terminal sequencing primer binding site 304 (e.g. ME’-A14’; or if ME’ is not present, then A14’), and a first primer-binding sequence 30T (e.g. P5’). Again, such a process may utilise a polymerase, such as a DNA or RNA polymerase.

The strand attached to the second immobilised primer 202 (e.g. P7 lawn primer) may then be dehybridised from the strand attached to the first immobilised primer 201 (e.g. P5 lawn primer) (Figure 6D).

A subsequent bridge amplification cycle can then lead to amplification of the strand attached to the first immobilised primer 201 (e.g. P5 lawn primer) and the strand attached to the second immobilised primer 202 (e.g. P7 lawn primer). The second primer-binding sequence 302’ (e.g. P7’) on the template strand attached to the first immobilised primer 201 (e.g. P5 lawn primer) may then anneal to another second immobilised primer 202 (e.g. P7 lawn primer) located within the well 203. In a similar fashion, the first primerbinding sequence 30T (e.g. P5’) on the template strand attached to the second immobilised primer 202 (e.g. P7 lawn primer) may then anneal to another first immobilised primer 201 (e.g. P5 lawn primer) located within the well 203.

Completion of bridge amplification and dehybridisation may then provide an amplified cluster, thus providing a plurality of concatenated polynucleotide sequences comprising a first insert complement sequence 401’ (i.e. “first portions”) and a second insert complement sequence 402’ (i.e. second portions”), as well as a plurality of concatenated polynucleotide sequences comprising a first insert sequence 401 and a second insert sequence 402 (Figure 6E).

If desired, further bridge amplification cycles may be conducted to increase the number of polynucleotide sequences within the well 203.

In one example, before sequencing, one group of strands (either the group of template polynucleotides, or the group of template complement polynucleotides thereof) is removed from the solid support to form a (monoclonal) cluster, leaving either the templates or the template complements (Figure 6F).

Sequencing

As described herein, the template provides information (e.g. identification of the genetic sequence, identification of epigenetic modifications) on the original target polynucleotide sequence. For example, a sequencing process (e.g. a sequencing-by-synthesis or sequencing-by-ligation process) may reproduce information that was present in the original target polynucleotide sequence, by using complementary base pairing.

In one embodiment, sequencing may be carried out using any suitable "sequencing-by- synthesis" technique, wherein nucleotides are added successively in cycles to the free 3' hydroxyl group, resulting in synthesis of a polynucleotide chain in the 5' to 3' direction. The nature of the nucleotide added may be determined after each addition. One particular sequencing method relies on the use of modified nucleotides that can act as reversible chain terminators. Such reversible chain terminators comprise removable 3' blocking groups. Once such a modified nucleotide has been incorporated into the growing polynucleotide chain complementary to the region of the template being sequenced there is no free 3'-OH group available to direct further sequence extension and therefore the polymerase cannot add further nucleotides. Once the nature of the base incorporated into the growing chain has been determined, the 3' block may be removed to allow addition of the next successive nucleotide. By ordering the products derived using these modified nucleotides it is possible to deduce the DNA sequence of the DNA template. Such reactions can be done in a single experiment if each of the modified nucleotides has attached thereto a different label, known to correspond to the particular base, to facilitate discrimination between the bases added at each incorporation step. Suitable labels are described in PCT application PCT/GB2007/001770, the contents of which are incorporated herein by reference in their entirety. Alternatively, a separate reaction may be carried out containing each of the modified nucleotides added individually.

The modified nucleotides may carry a label to facilitate their detection. Such a label may be configured to emit a signal, such as an electromagnetic signal, or a (visible) light signal.

In a particular embodiment, the label is a fluorescent label (e.g. a dye). Thus, such a label may be configured to emit an electromagnetic signal, or a (visible) light signal. One method for detecting the fluorescently labelled nucleotides comprises using laser light of a wavelength specific for the labelled nucleotides, or the use of other suitable sources of illumination. The fluorescence from the label on an incorporated nucleotide may be detected by a CCD camera or other suitable detection means. Suitable detection means are described in PCT/US2007/007991 , the contents of which are incorporated herein by reference in their entirety.

However, the detectable label need not be a fluorescent label. Any label can be used which allows the detection of the incorporation of the nucleotide into the DNA sequence.

Each cycle may involve simultaneous delivery of four different nucleotide types to the array of template molecules. Alternatively, different nucleotide types can be added sequentially and an image of the array of template molecules can be obtained between each addition step.

In some embodiments, each nucleotide type may have a (spectrally) distinct label. In other words, four channels may be used to detect four nucleobases (also known as 4- channel chemistry) (Figure 7 - left). For example, a first nucleotide type (e.g. A) may include a first label (e.g. configured to emit a first wavelength, such as red light), a second nucleotide type (e.g. G) may include a second label (e.g. configured to emit a second wavelength, such as blue light), a third nucleotide type (e.g. T) may include a third label (e.g. configured to emit a third wavelength, such as green light), and a fourth nucleotide type (e.g. C) may include a fourth label (e.g. configured to emit a fourth wavelength, such as yellow light). Four images can then be obtained, each using a detection channel that is selective for one of the four different labels. For example, the first nucleotide type (e.g. A) may be detected in a first channel (e.g. configured to detect the first wavelength, such as red light), the second nucleotide type (e.g. G) may be detected in a second channel (e.g. configured to detect the second wavelength, such as blue light), the third nucleotide type (e.g. T) may be detected in a third channel (e.g. configured to detect the third wavelength, such as green light), and the fourth nucleotide type (e.g. C) may be detected in a fourth channel (e.g. configured to detect the fourth wavelength, such as yellow light). Although specific pairings of bases to signal types (e.g. wavelengths) are described above, different signal types (e.g. wavelengths) and/or permutations may also be used.

In some embodiments, detection of each nucleotide type may be conducted using fewer than four different labels. For example, sequencing-by-synthesis may be performed using methods and systems described in US 2013/0079232, which is incorporated herein by reference.

Thus, in some embodiments, two channels may be used to detect four nucleobases (also known as 2-channel chemistry) (Figure 7 - middle). For example, a first nucleotide type (e.g. A) may include a first label (e.g. configured to emit a first wavelength, such as green light) and a second label (e.g. configured to emit a second wavelength, such as red light), a second nucleotide type (e.g. G) may not include the first label and may not include the second label, a third nucleotide type (e.g. T) may include the first label (e.g. configured to emit the first wavelength, such as green light) and may not include the second label, and a fourth nucleotide type (e.g. C) may not include the first label and may include the second label (e.g. configured to emit the second wavelength, such as red light). Two images can then be obtained, using detection channels for the first label and the second label. For example, the first nucleotide type (e.g. A) may be detected in both a first channel (e.g. configured to detect the first wavelength, such as red light) and a second channel (e.g. configured to detect the second wavelength, such as green light), the second nucleotide type (e.g. G) may not be detected in the first channel and may not be detected in the second channel, the third nucleotide type (e.g. T) may be detected in the first channel (e.g. configured to detect the first wavelength, such as red light) and may not be detected in the second channel, and the fourth nucleotide type (e.g. C) may not be detected in the first channel and may be detected in the second channel (e.g. configured to detect the second wavelength, such as green light). Although specific pairings of bases to signal types (e.g. wavelengths) and/or combinations of channels are described above, different signal types (e.g. wavelengths) and/or permutations may also be used.

In some embodiments, one channel may be used to detect four nucleobases (also known as 1 -channel chemistry) (Figure 7 - right). For example, a first nucleotide type (e.g. A) may include a cleavable label (e.g. configured to emit a wavelength, such as green light), a second nucleotide type (e.g. G) may not include a label, a third nucleotide type (e.g. T) may include a non-cleavable label (e.g. configured to emit the wavelength, such as green light), and a fourth nucleotide type (e.g. C) may include a label-accepting site which does not include the label. A first image can then be obtained, and a subsequent treatment carried out to cleave the label attached to the first nucleotide type, and to attach the label to the label-accepting site on the fourth nucleotide type. A second image may then be obtained. For example, the first nucleotide type (e.g. A) may be detected in a channel (e.g. configured to detect the wavelength, such as green light) in the first image and not detected in the channel in the second image, the second nucleotide type (e.g. G) may not be detected in the channel in the first image and may not be detected in the channel in the second image, the third nucleotide type (e.g. T) may be detected in the channel (e.g. configured to detect the wavelength, such as green light) in the first image and may be detected in the channel (e.g. configured to detect the wavelength, such as green light) in the second image, and the fourth nucleotide type (e.g. C) may not be detected in the channel in the first image and may be detected in the channel in the second image (e.g. configured to detect the wavelength, such as green light). Although specific pairings of bases to signal types (e.g. wavelengths) and/or combinations of images are described above, different signal types (e.g. wavelengths), images and/or permutations may also be used.

In one embodiment, for example in an illustrative case where n is 2, the sequencing process comprises a first sequencing read and second sequencing read. The first sequencing read and the second sequencing read may be conducted concurrently. In other words, the first sequencing read and the second sequencing read may be conducted at the same time. Similar considerations apply when n is more than 2, where n sequencing reads are conducted.

The first sequencing read may comprise the binding of a first sequencing primer (also known as a read 1 sequencing primer) to the first sequencing primer binding site (e.g. first terminal sequencing primer binding site 303 in templates including a concatenated polynucleotide sequence comprising a first portion and a second portion). The second sequencing read may comprise the binding of a second sequencing primer (also known as a read 2 sequencing primer) to the second sequencing primer binding site (e.g. a portion of hybridisation sequence 403’ in templates including a concatenated polynucleotide sequence comprising a first portion and a second portion). Similar considerations apply when n is more than 2, where n sequencing primers are used.

This leads to sequencing of the first portion (e.g. first insert complement sequence 40T in templates including a concatenated polynucleotide sequence comprising a first portion and a second portion) and the second portion (e.g. second insert complement sequence 402’ in templates including a concatenated polynucleotide sequence comprising a first portion and a second portion). Similar considerations apply when n is more than 2, where sequencing of the n portions is conducted.

Alternative methods of sequencing include sequencing by ligation, for example as described in US 6,306,597 or WO 06/084132, the contents of which are incorporated herein by reference.

The methods for sequencing described above generally relate to conducting non- selective sequencing. However, methods of the present invention relating to selective processing may comprise conducting selective sequencing, which is described in further detail below under selective processing.

Selective processing methods

In some embodiments, selective processing methods may be used to generate signals of different intensities. Accordingly, in some embodiments, the method may comprise selectively processing at least one polynucleotide sequence comprising n portions, such that a proportion of each of the n portions are each capable of generating a respective n ^th signal, wherein n is 2 or more, and wherein the selective processing causes an intensity of an i ^th signal to be different compared to an intensity of a j ^th signal, for all i between 1 to n, and for all j between 1 to n, and where i is not equal to j (e.g. selectively processing at least one polynucleotide sequence comprising a first portion and a second portion, such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal, wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal).

The method may comprise selectively processing a plurality of polynucleotide sequences each comprising n portions, such that a proportion of each of the n portions are each capable of generating a respective n ^th signal, wherein n is 2 or more, and wherein the selective processing causes an intensity of an i ^th signal to be different compared to an intensity of a j ^th signal, for all i between 1 to n, and for all j between 1 to n, and where i is not equal to j (e.g. selectively processing a plurality of polynucleotide sequences each comprising a first portion and a second portion, such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal, wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal).

By “selective processing” is meant here performing an action that changes relative properties of the n portions in the at least one polynucleotide sequence comprising n portions (or the plurality of polynucleotide sequences each comprising n portions), so that an intensity of an i ^th signal is different compared to an intensity of a j ^th signal, for all i between 1 to n, and for all j between 1 to n, and where i is not equal to j (e.g. performing an action that changes relative properties of a first portion and a second portion in a at least one polynucleotide sequence comprising a first portion and a second portion (or a plurality of polynucleotide sequences each comprising a first portion and a second portion), so that the intensity of the first signal is greater than the intensity of the second signal). The property may be, for example, a concentration of each of the i ^th portions capable of generating the i ^th signal may be different compared to a concentration of each of the j ^th portions capable of generating the j ^th signal (e.g. a concentration of first portions capable of generating the first signal relative to a concentration of second portions capable of generating the second signal). The action may include, for example, conducting selective sequencing, or preparing for selective sequencing.

Selective processing may refer to conducting selective sequencing. Alternatively, selective processing may refer to preparing for selective sequencing. As shown in Figure 8, in one example, selective sequencing may be achieved using a mixture of unblocked and blocked sequencing primers. For the purposes of illustration, the disclosure below describes a case where n is 2. However, as will be described in further detail herein, the methods of selective processing are generalisable to cases where n is 2 or more.

Where the method of the invention involves a single (concatenated) polynucleotide strand with a first and second portion, the single (concatenated) polynucleotide strand may comprise a first sequencing primer binding site and a second sequencing primer binding site, where the first sequencing primer binding site and second sequencing primer binding site are of a different sequence to each other and bind different sequencing primers.

In one embodiment, binding of first sequencing primers to the first sequencing primer site generates a first signal and binding of second sequencing primers to the second sequencing primer site generates a second signal, where the intensity of the first signal is greater than the intensity of the second signal. This may be applied to embodiments where the single (concatenated) polynucleotide strand comprises a first sequencing primer binding site and a second sequencing primer binding site. This is achieved using a mixed population of blocked and unblocked second sequencing primers that bind the second sequencing primer site. Any ratio of blocked:unblocked second primers can be used that generates a second signal that is of a lower intensity than the first signal, for example, the ratio of blocked:unblocked primers may be: 20:80 to 80:20, or 1 :2 to 2:1.

In one embodiment, a ratio of 50:50 of blocked: unblocked second primers is used, which in turn generates a second signal that is around 50% of the intensity of the first signal.

The first and second sequencing primers may be added to the flow cell at the same time, or separately but sequentially.

By “blocked” is meant that the sequencing primer comprises a blocking group at a 3’ end of the sequencing primer. Suitable blocking groups include a hairpin loop (e.g. a polynucleotide attached to the 3’-end, comprising in a 5’ to 3’ direction, a cleavable site such as a nucleotide comprising uracil, a loop portion, and a complement portion, wherein the complement portion is substantially complementary to all or a portion of the immobilised primer), a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3’-OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g. - O-(CH ₂ ) ₃ -OH instead of a 3’-OH group), a modification blocking the 3’-hydroxyl group (e.g. hydroxyl protecting groups, such as silyl ether groups (e.g. trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), ether groups (e.g. benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or acyl groups (e.g. acetyl, benzoyl)), or an inverted nucleobase. However, the blocking group may be any modification that prevents extension (i.e. elongation) of the primer by a polymerase.

The sequence of the sequencing primers and the sequence primer binding sites are not material to the methods of the invention, as long as the sequencing primers are able to bind to the sequence primer binding site to enable amplification and sequencing of the regions to be identified.

In one embodiment, the first sequencing primer binding site may be selected from ME’- A14’ (as defined in SEQ ID NO. 17 or a variant or fragment thereof), A14’ (as defined in SEQ ID NO. 18 or a variant or fragment thereof), ME’-B15’ (as defined in SEQ ID NO.

19 or a variant or fragment thereof) and B15’ (as defined in SEQ ID NO. 20 or a variant or fragment thereof); and the second sequencing primer binding site may be selected from ME’-HYB2 (as defined in SEQ ID NO. 21 or a variant or fragment thereof), HYB2 (as defined in SEQ ID NO. 11 or a variant or fragment thereof), ME’-HYB2’ (as defined in SEQ ID NO. 22 or a variant or fragment thereof) and HYB2’ (as defined in SEQ ID NO. 13 or a variant or fragment thereof).

In another embodiment, the first sequencing primer binding site is ME’-B15’ (as defined in SEQ ID NO. 19 or a variant or fragment thereof), and the second sequencing primer binding site is ME’-HYB2’ (as defined in SEQ ID NO. 22 or a variant or fragment thereof). Alternatively, the first sequencing primer binding site is B15’ (as defined in SEQ ID NO.

20 or a variant or fragment thereof), and the second sequencing primer binding site is HYB2’ (as defined in SEQ ID NO. 13 or a variant or fragment thereof). The first and second sequencing primer sites may be located after (e.g. immediately after) a 3’-end of the first and second portions to be identified.

In another embodiment, the first sequencing primer binding site is ME’-A14’ (as defined in SEQ ID NO. 17 or a variant or fragment thereof), and the second sequencing primer binding site is ME’-HYB2 (as defined in SEQ ID NO. 21 or a variant or fragment thereof). Alternatively, the first sequencing primer binding site may be A14’ (as defined in SEQ ID NO. 18 or a variant or fragment thereof) and the second sequencing primer binding site may be HYB2 (as defined in SEQ ID NO. 11 or a variant or fragment thereof). The first and second sequencing primer sites may be located after (e.g. immediately after) a 3’- end of the first and second portions to be identified.

In one example, the sequencing primer (which may be referred to herein as the second sequencing primer) comprises or consists of a sequence as defined in SEQ ID NO. 11 to 16, or a variant or fragment thereof. The sequencing primer may further comprise a 3’ blocking group as described above to create a blocked sequencing primer. Alternatively, the primer comprises a 3’-OH group. Such a primer is unblocked and can be elongated with a polymerase.

In one embodiment, the unblocked and blocked second sequencing primers are present in the sequencing composition in equal concentrations. That is, the ratio of blocked:unblocked second sequencing primers is around 50:50. The sequencing composition may further comprise at least one additional (first) sequencing primer. This additional sequencing primer may be selected from A14-ME (as defined in SEQ ID NO. 9 or a variant or fragment thereof), A14 (as defined in SEQ ID NO. 7 or a variant or fragment thereof), B15-ME (as defined in SEQ ID NO. 10 or a variant or fragment thereof) and B15 (as defined in SEQ ID NO. 8 or a variant or fragment thereof). In one embodiment, the sequencing composition comprises blocked second sequencing primers, unblocked second sequencing primers and at least one first sequencing primer, wherein the first sequencing primer is A14, or B15, or is both A14 and B15.

As shown in Figure 8, selective sequencing may be conducted on the amplified (monoclonal) cluster shown in Figure 6F. A plurality of first sequencing primers 501 are added. These first sequencing primers 501 (e.g. B15-ME; or if ME is not present, then B15) anneal to the first terminal sequencing primer binding site 303 (which represents a type of “first sequencing primer binding site”) (e.g. ME’-B15’; or if ME’ is not present, then B15’). A plurality of second unblocked sequencing primers 502a and a plurality of second blocked sequencing primers 502b are added, either at the same time as the first sequencing primers 501 , or sequentially (e.g. prior to or after addition of first sequencing primers 501). These second unblocked sequencing primers 502a (e.g. HYB2-ME; or if ME is not present, then HYB2) and second blocked sequencing primers 502b (e.g. blocked HYB2-ME; or if ME is not present, then blocked HYB2) anneal to an internal sequencing primer binding site in the hybridisation sequence 403’ (which represents a type of “second sequencing primer binding site”) (e.g. ME’-HYB2’; or if ME’ is not present, then HYB2’). This then allows the first insert complement sequences 40T (i.e. “first portions”) to be sequenced and the second insert complement sequences 402’ (i.e. “second portions”) to be sequenced, wherein a greater proportion of first insert complement sequences 40T are sequenced (grey arrow) compared to a proportion of second insert complement sequences 402’ (black arrow).

Although Figure 8 shows selective sequencing being conducted on a template strand attached to first immobilised primer 201 , in some embodiments the (monoclonal) cluster may instead have template strands attached to second immobilised primer 202. In such a case, the first sequencing primers may instead correspond to A14-ME (or if ME is not present, then A14), and the second unblocked sequencing primers may instead correspond to HYB2’-ME (or if ME is not present, then HYB2’) and second blocked sequencing primers may instead correspond to blocked HYB2’-ME (or if ME is not present, then blocked HYB2’).

In yet other embodiments, the positioning of first sequencing primers and second sequencing primers may be swapped. In other words, the first sequencing binding primers may anneal instead to the internal sequencing primer binding site, and the second sequencing binding primers may anneal instead to the terminal sequencing primer binding site.

Figure 8 shows concurrent sequencing of a concatenated strand according to the above method. As shown in Figure 8, a polynucleotide strand with a first portion (insert) and second portion (insert) can be accurately and simultaneously sequenced by a selective sequencing method that uses a mixture of unblocked and blocked sequencing primers as described above.

Data analysis

Figure 9 is a scatter plot showing an example of sixteen distributions of signals generated by polynucleotide sequences disclosed herein.

The scatter plot of Figure 9 shows sixteen distributions (or bins) of intensity values from the combination of a brighter signal (i.e. a first signal as described herein) and a dimmer signal (i.e. a second signal as described herein); the two signals may be co-localized and may not be optically resolved as described above. The intensity values shown in Figure 9 may be up to a scale or normalisation factor; the units of the intensity values may be arbitrary or relative (i.e., representing the ratio of the actual intensity to a reference intensity). The sum of the brighter signal generated by the first portions and the dimmer signal generated by the second portions results in a combined signal. The combined signal may be captured by a first optical channel and a second optical channel. Since the brighter signal may be A, T, C or G, and the dimmer signal may be A, T, C or G, there are sixteen possibilities for the combined signal, corresponding to sixteen distinguishable patterns when optically captured. That is, each of the sixteen possibilities corresponds to a bin shown in Figure 9. The computer system can map the combined signal generated into one of the sixteen bins, and thus determine the added nucleobase at the first portion and the added nucleobase at the second portion, respectively.

For example, when the combined signal is mapped to bin 1612 for a base calling cycle, the computer processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1614 for the base calling cycle, the processor base calls the added nucleobase at the first portion as C and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1616 for the base calling cycle, the processor base calls the added nucleobase at the first portion as C and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1618 for the base calling cycle, the processor base calls the added nucleobase at the first portion as C and the added nucleobase at the second portion as A.

When the combined signal is mapped to bin 1622 for the base calling cycle, the processor base calls the added nucleobase at the first portion as T and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1624 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1626 for the base calling cycle, the processor base calls the added nucleobase at the first portion as T and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1628 for the base calling cycle, the processor base calls the added nucleobase at the first portion as T and the added nucleobase at the second portion as A.

When the combined signal is mapped to bin 1632 for the base calling cycle, the processor base calls the added nucleobase at the first portion as G and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1634 for the base calling cycle, the processor base calls the added nucleobase at the first portion as G and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1636 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1638 for the base calling cycle, the processor base calls the added nucleobase at the first portion as G and the added nucleobase at the second portion as A.

When the combined signal is mapped to bin 1642 for the base calling cycle, the processor base calls the added nucleobase at the first portion as A and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1644 for the base calling cycle, the processor base calls the added nucleobase at the first portion as A and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1646 for the base calling cycle, the processor base calls the added nucleobase at the first portion as A and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1648 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as A.

In this particular example, T is configured to emit a signal in both the IMAGE 1 channel and the IMAGE 2 channel, A is configured to emit a signal in the IMAGE 1 channel only, C is configured to emit a signal in the IMAGE 2 channel only, and G does not emit a signal in either channel. However, different permutations of nucleobases can be used to achieve the same effect by performing dye swaps. For example, A may be configured to emit a signal in both the IMAGE 1 channel and the IMAGE 2 channel, T may be configured to emit a signal in the IMAGE 1 channel only, C may be configured to emit a signal in the IMAGE 2 channel only, and G may be configured to not emit a signal in either channel.

Further details regarding performing base-calling based on a scatter plot having sixteen bins may be found in U.S. Patent Application Publication No. 2019/0212294, the disclosure of which is incorporated herein by reference.

Figure 10 is a flow diagram showing a method 1700 of base calling according to the present disclosure. The described method allows for simultaneous sequencing of two (or more) portions (e.g. the first portion and the second portion) in a single sequencing run from a single combined signal obtained from the first portion and the second portion, thus requiring less sequencing reagent consumption and faster generation of data from both the first portion and the second portion. Further, the simplified method may reduce the number of workflow steps while producing the same yield as compared to existing next-generation sequencing methods. Thus, the simplified method may result in reduced sequencing runtime.

As shown in Figure 10, the disclosed method 1700 may start from block 1701. The method may then move to block 1710.

At block 1710, intensity data is obtained. The intensity data includes first intensity data and second intensity data. The first intensity data comprises a combined intensity of a first signal component generated by the first portion obtained based upon a respective first nucleobase of the first portion and a first signal component generated by the second portion obtained based upon a respective second nucleobase of the second portion. Similarly, the second intensity data comprises a combined intensity of a second signal component generated by the first portion obtained based upon the respective first nucleobase of the first portion and a second signal component generated by the second portion obtained based upon the respective second nucleobase of the second portion.

As such, the first portion is capable of generating a first signal comprising a first signal component generated by the first portion and a second signal component generated by the first portion. The second portion is capable of generating a second signal comprising a first signal component generated by the second portion and a second signal component generated by the second portion. More generally, the n ^th portion is capable of generating an n ^th signal comprising a first signal component generated by the n ^th portion and a second signal component generated by the n ^th portion.

As described above, the first portion and the second portion may be arranged on the solid support such that signals from the first portion and the second portion are detected by a single sensing portion and/or may comprise a single cluster such that first signals and second signals from each of the respective first portions and second portions cannot be spatially resolved. In one example, obtaining the intensity data comprises selecting intensity data that corresponds to two (or more) different portions (e.g. the first portion and the second portion). In one example, intensity data is selected based upon a chastity score. A chastity score may be calculated as the ratio of the brightest base intensity divided by the sum of the brightest and second brightest base intensities. The desired chastity score may be different depending upon the expected intensity ratio of the light emissions associated with the different portions. As described above, it may be desired to produce clusters comprising the first portion and the second portion, which give rise to signals in a ratio of 2:1. In one example, high-quality data corresponding to two portions with an intensity ratio of 2:1 may have a chastity score of around 0.8 to 0.9.

After the intensity data has been obtained, the method may proceed to block 1720. In this step, one of a plurality of classifications is selected based on the intensity data. Each classification represents a possible combination of respective first and second nucleobases. In one example, the plurality of classifications comprises sixteen classifications as shown in Figure 9, each representing a unique combination of first and second nucleobases. Where there are two portions, there are sixteen possible combinations of first and second nucleobases. Selecting the classification based on the first and second intensity data comprises selecting the classification based on the combined intensity of the first signal component generated by the first portion and the first signal component generated by the second portion, and the combined intensity of the second signal component generated by the first portion and the second signal component generated by the second portion.

More generally, when there are n portions, there are 4 ⁿ possible combinations of n nucleobases. Each combination can be attributed to a particular classification as each of the n portions generates a different intensity signal.

The method may then proceed to block 1730, where the respective first and second nucleobases are base called based on the classification selected in block 1720. The signals generated during a cycle of a sequencing are indicative of the identity of the nucleobase(s) added during sequencing (e.g. using sequencing-by-synthesis). It will be appreciated that there is a direct correspondence between the identity of the nucleobases that are incorporated and the identity of the complementary base at the corresponding position of the template sequence bound to the solid support. Therefore, any references herein to the base calling of respective nucleobases at the two portions encompasses the base calling of nucleobases hybridised to the template sequences and, alternatively or additionally, the identification of the corresponding nucleobases of the template sequences. The method may then end at block 1740.

Generalisation to n-mer polynucleotides

The disclosure has described a specific case of (concatenated) polynucleotide sequences comprising two portions (i.e. a first portion and a second portion). However, the present invention is not limited to two portions. In particular, methods described herein may also be applied to (concatenated) polynucleotide sequences, comprising not just two portions to be identified, but rather n portions to be identified.

As such, each of the concepts above relating to at least one polynucleotide sequence comprising a first portion and a second portion may instead refer to at least one polynucleotide sequence comprising n portions.

Such polynucleotide sequences can also be prepared by methods described herein, for example using PCR stitching.

Accordingly, we describe a method of preparing at least one polynucleotide sequence for identification, comprising: selectively processing at least one polynucleotide sequence comprising n portions, such that a proportion of each of the n portions are each capable of generating a respective n ^th signal, wherein n is 2 or more, and wherein the selective processing causes an intensity of an i ^th signal to be different compared to an intensity of a j ^th signal, for all i between 1 to n, and for all j between 1 to n, and where i is not equal to j.

In other words, the selective processing causes an intensity of each n ^th signal to be different compared to an intensity of each other n ^th signal.

Advantageously, it is this selective processing that primes the n portions to be ready for concurrent sequencing. This therefore allows each of the n portions to be identified simultaneously, which leads to an increase in sequencing efficiency and throughput. This means that massively parallel sequencing is enabled in a third dimension (z-axis), and not just over two dimensions.

For the purposes of labelling, the n portions in the at least one polynucleotide sequence may be ordered sequentially. In other words, from one end of the at least one polynucleotide sequence to the other end of the at least one polynucleotide sequence, the at least one polynucleotide sequence comprises a first portion, a second portion, etc., up to the n ^th portion. This may be from the 5’-end to the 3’-end of the at least one polynucleotide sequence; alternatively, this may be from the 3’-end to the 5’-end of the at least one polynucleotide sequence.

The order of intensities for each n ^th signal may not necessarily follow the sequential order of the n portions within the at least one polynucleotide sequence. Different permutations of signal intensities are possible, and all of these permutations represent ways of achieving the present invention. As an illustrative example, if the at least one polynucleotide sequence comprises a first portion, a second portion, a third portion and a fourth portion, it may be the third portion that gives rise to the most intense signal, followed by the first portion giving rise to the second most intense signal, followed by the fourth portion giving rise to the third most intense signal, followed by the second portion giving rise to the fourth most intense signal; alternatively again for the purposes of illustration, it may be the second portion that gives rise to the most intense signal, followed by the fourth portion that gives rise to the second most intense signal, followed by the third portion that gives rise to the third most intense signal, followed by the first portion that gives rise to the fourth most intense signal.

The at least one polynucleotide sequence may be a plurality of polynucleotide sequences each comprising their respective n portions.

Accordingly, the method may comprise: selectively processing a plurality of polynucleotide sequences each comprising n portions, such that a proportion of each of the n portions are each capable of generating a respective n ^th signal, wherein n is 2 or more, and wherein the selective processing causes an intensity of an i ^th signal to be different compared to an intensity of a j ^th signal, for all i between 1 to n, and for all j between 1 to n, and where i is not equal to j. As mentioned above, selective processing refers to performing an action that changes relative properties of each n portions within the at least one polynucleotide sequence. This property may be, for example, a concentration of each of the n portions.

In some embodiments, a concentration of each of the i ^th portions capable of generating the i ^th signal may be different compared to a concentration of each of the j ^th portions capable of generating the j ^th signal. In other words, a concentration of each of the n portions capable of generating the n ^th signal may be different compared to a concentration of each of the other n portions capable of generating the n ^th signal.

In one embodiment, a ratio between a concentration of one of the n portions capable of generating the (m-1) ^th most intense signal and a concentration of another of the n portions capable of generating the m ^th most intense signal may be between 1.25:1 to 5:1 , or between 1.5:1 to 3:1 , or about 2:1 , wherein m is between 2 to n. In other words, when comparing an n ^th signal of a particular intensity with an n ^th signal of the next highest intensity (i.e. having an intensity less than the n ^th signal of the particular intensity), the ratio between the concentration of one of the n portions capable of generating the nth signal of the particular intensity and the concentration of one of the n portions capable of generating the nth signal of the next highest intensity may be between 1.25:1 to 5:1 , or between 1 .5: 1 to 3: 1 , or about 2: 1.

In one aspect, a ratio between each concentration of one of the n portions capable of generating the (m-1) ^th most intense signal and each concentration of another of the n portions capable of generating the m ^th most intense signal may be between 1.25:1 to 5:1 , or between 1.5:1 to 3:1 , or about 2:1 , for all m between 2 to n. In other words, when comparing an n ^th signal of a particular intensity with an n ^th signal of the next highest intensity (i.e. having an intensity less than the n ^th signal of the particular intensity), the ratio between the concentration of each of the n portions capable of generating the nth signal of the particular intensity and the concentration of each of the n portions capable of generating the nth signal of the next highest intensity may be between 1.25:1 to 5:1 , or between 1.5:1 to 3:1 , or about 2:1.

In some embodiments, each of the n ^th signals may be spatially unresolved. In some embodiments, selectively processing may comprise conducting selective sequencing. Alternatively, selective processing may refer to preparing for selective sequencing.

In some embodiments, selectively processing may comprise: contacting n ^th sequencing primer binding sites located after a 3’-end of each of the respective n portions with respective n ^th primers, wherein at least one of the n ^th primers comprises a mixture of blocked n ^th primers and unblocked n ^th primers, and of the n ^th primers that do comprise a mixture of blocked n ^th primers and unblocked n ^th primers, a ratio of blocked n ^th primers to unblocked n ^th primers is different compared to a ratio of blocked primers and unblocked primers of all other primers comprising a mixture of respective blocked and unblocked primers.

Each of the n ^th sequencing primer binding sites are of a different sequence to each other and bind different sequencing primers.

In some embodiments, all but one of the n ^th primers may comprise a mixture of blocked n ^th primers and unblocked n ^th primers. In other words, one of the n ^th primers may comprise only unblocked n ^th primers, and no blocked n ^th primers. For all of the other n ^th primers, each of these may comprise a mixture of blocked n ^th primers and unblocked n ^th primers, and for each of these types of n ^th primers, a ratio of blocked n ^th primers to unblocked n ^th primers is different compared to a ratio of blocked primers and unblocked primers of all other primers comprising a mixture of respective blocked and unblocked primers.

Again, by “blocked” is meant that the n ^th sequencing primer comprises a blocking group at a 3’ end of the sequencing primer. In particular, each blocked n ^th primer may comprise a blocking group at a 3’ end of the blocked n ^th primer. Suitable blocking groups include a hairpin loop (e.g. a polynucleotide attached to the 3’-end, comprising in a 5’ to 3’ direction, a cleavable site such as a nucleotide comprising uracil, a loop portion, and a complement portion, wherein the complement portion is substantially complementary to all or a portion of the sequencing primer), a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3’-OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g. -O-(CH2)s-OH instead of a 3’-OH group)), a modification blocking the 3’-hydroxyl group (e.g. hydroxyl protecting groups, such as silyl ether groups (e.g. trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), ether groups (e.g. benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or acyl groups (e.g. acetyl, benzoyl)), or an inverted nucleobase. However, the blocking group may be any modification that prevents extension (i.e. elongation) of the primer by a polymerase.

In one embodiment, one of the blocked n ^th primers may comprise a sequence as defined in SEQ ID NO. 11 to 16 or a variant or fragment thereof and/or the corresponding unblocked n ^th primer may comprise a sequence as defined in SEQ ID NO. 11 to 14 or a variant or fragment thereof.

The number “n” may be chosen by balancing the accuracy of reads and the overall throughput. As n decreases, the signal-to-noise ratio may increase and as such the accuracy of reads may also increase. As n increases, the overall throughput may increase. In some embodiments, n may be between 2 to 6, or between 2 to 4. In an alternative embodiment, n may be 3 or more, or between 3 to 6, or 3 or 4. Such values of n can achieve a balance between accuracy of reads and overall throughput.

In general, the present invention can be applied to the sequencing of multiple different sequences on the same strand simultaneously. Accordingly, one of the n portions may have a different polynucleotide sequence compared to another of the n portions, wherein the respective sequences may be genetically unrelated and/or obtained from different sources. As mentioned above, genetically unrelated sequences may be different fragment sequences which are derived from the same source, but are different fragments from that source (e.g. from the same fragmented library preparation process). Genetically unrelated sequences may also include sequences that can be overlapping in sequence (but not identical in sequence). In one embodiment, each of the n portions has a different polynucleotide sequence compared to each of the other n portions, wherein the respective sequences may be genetically unrelated and/or obtained from different sources.

In one embodiment, each of the n portions comprises or consists of a sequence derived from a nucleic acid sample (e.g. an insert).

In one embodiment, each of the n portions is at least 25 base pairs or at least 50 base pairs. As mentioned above, methods of the present invention may be conducted on a solid support. Accordingly, in some embodiments, the at least one polynucleotide sequence comprising the n portions is/are attached (e.g. via a 5’-end of the polynucleotide sequence comprising the n portions) to a solid support, wherein the solid support may be a flow cell. In one embodiment, the polynucleotide comprising the n portions is attached to the solid support in a single well of the solid support.

In one embodiment, the at least one polynucleotide sequence comprising the n portions forms a cluster on the solid support.

In one embodiment, the cluster may be formed by bridge amplification.

In one embodiment, the at least one polynucleotide sequence comprising the n portions may form a monoclonal cluster.

In one embodiment, the solid support comprises at least one first immobilised primer and at least one second immobilised primer. In on aspect, the first immobilised primer comprises a sequence as defined in SEQ ID NO. 1 or 5, or a variant or fragment thereof; and the second immobilised primer comprises a sequence as defined in SEQ ID NO. 2, or a variant or fragment thereof.

In one embodiment, each polynucleotide sequence comprising the n portions may be attached (via the 5’-end of the polynucleotide sequence comprising the n portions) to a first immobilised primer. Each polynucleotide sequence comprising the n portions may comprise a second adaptor sequence, wherein the second adaptor comprises a portion which is substantially complementary to the second immobilised primer (or is substantially complementary to the second immobilised primer). The second adaptor sequence may be at a 3’-end of the polynucleotide sequence comprising the n portions.

It may be advantageous to conduct amplification techniques that increase signal strength for (concatenated) n-mer polynucleotides. This can be done, for example, by increasing the number of (concatenated) n-mer polynucleotides that are present within a given cluster. As mentioned above, a typical amplification process to form a monoclonal cluster involves amplifying both the template strand and the template complement strand, and then selectively cleaving either the template complement strands, or the template strands. During amplification, the presence of both the template strands and the template complement strands cause saturation of the well (e.g. due to steric hindrance), and thus some first immobilised primers and second immobilised primers on the solid support may not actually be used. When both the template strands and the template complement strands are present, close to 100% strand density (or saturation) is obtained. Nevertheless, after cleavage of either the template complement strands, or the template strands, further space for amplification is possible because the well has only 50% strand density (with only either the remaining of the template strands or template complement strands).

As such, in one embodiment, the method comprises: providing a solid support comprising a plurality of first immobilised primers and a plurality of second immobilised primers, wherein an initial proportion of the first immobilised primers have each been extended to form the polynucleotide sequence comprising n portions and substantially all of the second immobilised primers have not been extended, wherein each polynucleotide sequence comprising n portions comprises a second adaptor sequence which is substantially complementary to the second immobilised primer, selectively blocking a proportion of second immobilised primers that have not been extended using a primer blocking agent, wherein the primer blocking agent is configured to limit or prevent synthesis of a strand extending from the second immobilised primer, and conducting at least two amplification cycles in order provide a new proportion of first immobilised primers that have been extended to form the polynucleotide sequence comprising n portions and a proportion of second immobilised primers that have been extended to form polynucleotide complement sequences comprising n complement portions, wherein the new proportion of first immobilised primers is greater than the initial proportion of first immobilised primers.

Such a method step advantageously allows more polynucleotide sequences comprising n portions to be produced. This allows greater than 50% strand density of solely the polynucleotide sequences comprising n portions to be achieved, thus increasing signal strength for the polynucleotide sequences comprising n portions.

In one aspect, for the step conducting at least two amplification cycles, the number of amplification cycles is chosen such that a saturation point is reached (e.g. between 5 to 20 cycles, between 7 to 15 cycles, or between 8 to 10 cycles). In other words, amplification may be conducted until there is no further change in the number of polynucleotide sequences comprising n portions (or polynucleotide complement sequences comprising n complement portions), for example where close to total 100% strand density is obtained. This advantageously leads to even higher strand densities to be obtained of solely the polynucleotide sequences comprising n portions, which can approach strand densities of around 90% (or higher).

It may be desirable to regenerate the monoclonal cluster for the purposes of conducting sequencing. Accordingly, the method may further comprise a step of cleaving substantially all of the polynucleotide complement sequences comprising n complement portions.

In one embodiment, between 60% to 95% of second immobilised primers that have not been extended (relative to a total number of second immobilised primers that have not been extended) are blocked using the primer blocking agent; between 75% to 90%, between 80% to 90%, or between 85% to 90%.

One way of selectively blocking a proportion of second immobilised primers is to use extended primer sequences, wherein such sequences can bind (e.g. hybridise) free immobilised primers (e.g. P5 or P7), and wherein the extended primer sequences further comprise at least one 5’ additional nucleotide. By using the extended primer sequence as a template, it is possible to add a primer blocking agent, where the primer blocking agent is complementary to the 5’ additional nucleotide.

As such, the method may comprise contacting some of the second immobilised primers with an extended primer sequence, wherein the extended primer sequence is substantially complementary to the second immobilised primer and further comprises a 5’ additional nucleotide; and adding the primer blocking agent, wherein the primer blocking agent is complementary to the 5’ additional nucleotide. In one embodiment, the extended primer sequences are substantially complementary to the first or second immobilised primers (e.g. P5 or P7), or substantially complementary to a portion of the first or second immobilised primer.

The 5’ additional nucleotide may be selected from A, T, C or G, but may be T (or II) or C. In one embodiment, the 5’ additional nucleotide is not a complement of the 3’ nucleotide of the second immobilised primer (where the extended primer sequence binds the first immobilised primer) or is not a complement of the 3’ nucleotide of the first immobilised primer (where the extended primer sequence binds the second immobilised primer). For example, where the first immobilised primer is P5 (for example as defined in SEQ ID NO. 1 or 5) and the second immobilised primer is P7 for example as defined in SEQ ID NO. 2), and where the extended primer sequence binds the first immobilised primer, the 5’ additional nucleotide is not A. Similarly, where the extended primer sequence binds the second immobilised primer, the 5’ additional nucleotide is not G.

In one embodiment, the primer-blocking agent is a blocked nucleotide. As such, the blocked nucleotide may comprise a blocking group. Suitable blocking groups include a hairpin loop, a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3’- OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g. -O- (CH ₂ )3-OH instead of a 3’-OH group), a modification blocking the 3’-hydroxyl group (e.g. hydroxyl protecting groups, such as silyl ether groups (e.g. trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), ether groups (e.g. benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or acyl groups (e.g. acetyl, benzoyl)), or an inverted nucleobase. However, the blocking group may be any modification that prevents extension (i.e. elongation) of the primer by a polymerase. In one embodiment, the blocked nucleotide may be A, C, T or G, but may be selected from A or G. Accordingly, where the 5’ additional nucleotide is T or II, the primer-blocking agent is A, and where the 5’ additional nucleotide is C, the primerblocking agent is G.

In one embodiment, the extended primer sequence is selected from SEQ ID NO. 23 to 34 or a variant or fragment thereof.

There are different ways available for achieving the blocking of the proportion of second immobilised primers using a primer blocking agent by use of the extended primer sequence. In one embodiment, the extended primer sequence may comprise a first extended primer sequence which is substantially complementary to the second immobilised primer and comprises a first 5’ additional nucleotide, and a second extended primer sequence which is substantially complementary to the second immobilised primer and comprises a second 5’ additional nucleotide, wherein the first 5’ additional nucleotide and the second 5’ additional nucleotide are configured to base pair with different nucleotides, and the primer blocking agent is complementary to the first 5’ additional nucleotide. Flowing a primer blocking agent that is complementary to the first 5’ additional nucleotide (and not complementary to the second 5’ additional nucleotide) allows first immobilised primers that are annealed to the first extended primer sequence to be selectively blocked.

In one embodiment, the first extended primer sequence may form between 60% to 95% of the total population of extended primer sequences (wherein the total population may refer to a combined population of first extended primer sequences and second extended primer sequences); between 75% to 90%, between 80% to 90%, or between 85% to 90%. The second extended primer sequence may form between 5% to 40% of the total population of extended primer sequences; between 10% to 25%, between 10% to 20%, or between 10% to 15% (for example, the first extended primer sequence may form between 60% to 95% of the total population of extended primer sequences and the second extended primer sequence may form between 5% to 40% of the total population of extended primer sequences; in one embodiment, the first extended primer sequence may form between 75% to 90% of the total population of extended primer sequences and the second extended primer sequence may form between 10% to 25% of the total population of extended primer sequences; in another embodiment, the first extended primer sequence may form between 80% to 90% of the total population of extended primer sequences and the second extended primer sequence may form between 10% to 20% of the total population of extended primer sequences; in another embodiment, the first extended primer sequence may form between 85% to 90% of the total population of extended primer sequences and the second extended primer sequence may form between 10% to 15% of the total population of extended primer sequences).

Alternatively (or in addition to using the first extended primer sequence and the second extended primer sequence) the primer blocking agent may be provided as a mixture of blocked nucleotides (e.g. as described above) and unblocked nucleotides, wherein the blocked nucleotide and the unblocked nucleotide comprise the same base. In one embodiment, both the blocked nucleotide and unblocked nucleotide are selected from A, C, T or G, but may be selected from A or G. Here, it is not strictly necessary to use the different first extended primer sequences and second extended primer sequences, and instead all of the extended primer sequences may be the same.

In one embodiment, the blocked nucleotide may form between 60% to 95% of the total population of the mixture (wherein the total population may refer to a combined population of blocked nucleotides and unblocked nucleotides); between 75% to 90%, between 80% to 90%, or between 85% to 90%. The unblocked nucleotide may form between 5% to 40% of the total population of the mixture; between 10% to 25%, between 10% to 20%, or between 10% to 15% (for example, the blocked nucleotide may form between 60% to 95% of the total population of the mixture and the unblocked nucleotide may form between 5% to 40% of the total population of the mixture; in one embodiment, the blocked nucleotide may form between 75% to 90% of the total population of the mixture and the unblocked nucleotide may form between 10% to 25% of the total population of the mixture; in another embodiment, the blocked nucleotide may form between 80% to 90% of the total population of the mixture and the unblocked nucleotide may form between 10% to 20% of the total population of the mixture; in another embodiment, the blocked nucleotide may form between 85% to 90% of the total population of the mixture and the unblocked nucleotide may form between 10% to 15% of the total population of the mixture).

In one embodiment, the step of providing the solid support comprising the plurality of first immobilised primers and a plurality of second immobilised primers (where a proportion of first immobilised primers have each been extended to form the polynucleotide sequence comprising n portions, and substantially all of the second immobilised primers have not been extended) involves: providing a solid support comprising a plurality of first immobilised primers and a plurality of second immobilised primers, wherein substantially all of the first immobilised primers have not been extended and substantially all of the second immobilised primers have not been extended, annealing a target polynucleotide comprising n complement portions, a first adaptor sequence at one end of the target polynucleotide and a second adaptor complement sequence at another end of the target polynucleotide, wherein the first adaptor sequence is substantially complementary to the first immobilised primer, and wherein the second adaptor complement sequence is substantially identical to the second immobilised primer, synthesising the polynucleotide sequence comprising n portions and the second adaptor sequence by extending the first immobilised primer, forming a plurality of first immobilised primers that have each been extended to form a polynucleotide sequence comprising n portions and a plurality of second immobilised primers that have each been extended to form a polynucleotide complement sequence comprising n complement portions, and selectively cleaving substantially all of the polynucleotide complement sequences comprising n complement portions from the second immobilised primers.

Such a method is also applicable more generally to advantageously increasing signal strength for any monoclonal cluster.

Accordingly, in another aspect of the invention, there is provided a method of synthesising template polynucleotides, comprising: providing a solid support comprising a plurality of first immobilised primers and a plurality of second immobilised primers, wherein an initial proportion of the first immobilised primers have each been extended to form a template polynucleotide and substantially all of the second immobilised primers have not been extended, wherein each template polynucleotide comprises a second adaptor sequence which is substantially complementary to the second immobilised primer, selectively blocking a proportion of second immobilised primers that have not been extended using a primer blocking agent, wherein the primer blocking agent is configured to limit or prevent synthesis of a strand extending from the second immobilised primer, and conducting at least two amplification cycles in order provide a new proportion of first immobilised primers that have been extended to form template polynucleotides and a proportion of second immobilised primers that have been extended to form template complement polynucleotides, wherein the new proportion of first immobilised primers is greater than the initial proportion of first immobilised primers.

The template polynucleotides are typically attached via a 5’-end of the template polynucleotide to the first immobilised primer. The second adaptor sequence is typically attached to a 3’-end of the template polynucleotide. In one embodiment, for the step conducting at least two amplification cycles, the number of amplification cycles is chosen such that a saturation point is reached (e.g. between 5 to 20 cycles, between 7 to 15 cycles, or between 8 to 10 cycles). In other words, amplification may be conducted until there is no further change in the number of template polynucleotides (or template complement polynucleotides).

In one embodiment, the method may further comprise a step of cleaving substantially all of the template complement polynucleotides.

In one embodiment, between 60% to 95% of second immobilised primers that have not been extended (relative to a total number of second immobilised primers that have not been extended) are blocked using the primer blocking agent; between 75% to 90%, between 80% to 90%, or between 85% to 90%.

In one embodiment, the method may comprise contacting some of the second immobilised primers with an extended primer sequence, wherein the extended primer sequence is substantially complementary to the second immobilised primer and further comprises a 5’ additional nucleotide; and adding the primer blocking agent, wherein the primer blocking agent is complementary to the 5’ additional nucleotide.

In one embodiment, the extended primer sequences, primer blocking agents and the 5’ additional nucleotides are as described herein.

In one embodiment, the step of providing the solid support comprising the plurality of first immobilised primers and a plurality of second immobilised primers (where a proportion of first immobilised primers have each been extended to form the template polynucleotide, and substantially all of the second immobilised primers have not been extended) involves: providing a solid support comprising a plurality of first immobilised primers and a plurality of second immobilised primers, wherein substantially all of the first immobilised primers have not been extended and substantially all of the second immobilised primers have not been extended, annealing a target polynucleotide comprising a first adaptor sequence at one end of the target polynucleotide and a second adaptor complement sequence at another end of the target polynucleotide, wherein the first adaptor sequence is substantially complementary to the first immobilised primer, and wherein the second adaptor complement sequence is substantially identical to the second immobilised primer, synthesising the template polynucleotide comprising the second adaptor sequence by extending the first immobilised primer, forming a plurality of first immobilised primers that have each been extended to form a template polynucleotide and a plurality of second immobilised primers that have each been extended to form a template complement polynucleotide, and selectively cleaving substantially all of the template complement polynucleotides from the second immobilised primers.

Methods of sequencing

Also described herein is a method of sequencing at least one polynucleotide sequence, comprising: preparing at least one polynucleotide sequence for identification using a method as described herein; and concurrently sequencing nucleobases in each of the n portions based on the intensity of each of the n ^th signals.

In one embodiment, sequencing is performed by sequencing-by-synthesis or sequencing-by-ligation.

In one embodiment, the method may further comprise a step of conducting paired-end reads.

In some embodiments, the step of concurrently sequencing nucleobases may comprise:

(a) obtaining first intensity data comprising a combined intensity of respective first signal components generated by each of the n portions obtained based upon respective n ^th nucleobases in each of the n portions, wherein each of the respective first signal components are obtained simultaneously;

(b) obtaining second intensity data comprising a combined intensity of respective second signal components generated by each of the n portions obtained based upon respective n ^th nucleobases in each of the n portions, wherein each of the respective second signal components are obtained simultaneously; (c) selecting one of a plurality of classifications based on the first and the second intensity data, wherein each classification represents a possible combination of respective n ^th nucleobases; and

(d) based on the selected classification, base calling the respective n ^th nucleobases for all n portions.

In one embodiment, selecting the classification based on the first and second intensity data may comprise selecting the classification based on the combined intensity of respective first signal components and second signal components.

In one embodiment, the plurality of classifications may comprise 4 ⁿ classifications, each classification representing one of 4 ⁿ unique combinations of n ^th nucleobases.

In one embodiment, the first signal components and the second signal components may be generated based on light emissions associated with the respective nucleobase.

In one embodiment, the light emissions may be detected by a sensor, wherein the sensor is configured to provide a single output based upon the n signals.

In one example, the sensor may comprise a single sensing element.

In one embodiment, the method may further comprise repeating steps (a) to (d) for each of a plurality of base calling cycles.

Kits

Methods as described herein may be performed by a user physically. In other words, a user may themselves conduct the methods of preparing at least one polynucleotide sequence for identification as described herein, and as such the methods as described herein may not need to be computer-implemented.

In another aspect of the invention, there is provided a kit comprising instructions for preparing at least one polynucleotide sequence for identification as described herein, and/or for sequencing at least one polynucleotide sequence as described herein. In one embodiment, the kit may further comprise a sequencing primer comprising or consisting of a sequence selected from SEQ ID NO. 7 to 16 or a variant or fragment thereof.

In one embodiment, the kit may comprise a sequencing composition comprising a sequencing primer selected from SEQ ID NO. 7 to 10 or a variant or fragment thereof, and a sequencing primer selected from SEQ ID NO. 11 to 16 or a variant or fragment thereof.

Computer programs and products

In other embodiments, methods as described herein may be performed by a computer. In other words, a computer may contain instructions to conduct the methods of preparing at least one polynucleotide sequence for identification as described herein, and as such the methods as described herein may be computer-implemented.

Accordingly, in another aspect of the invention, there is provided a data processing device comprising means for carrying out the methods as described herein.

The data processing device may be a polynucleotide sequencer.

The data processing device may comprise reagents used for synthesis methods as described herein.

The data processing device may comprise a solid support, such as a flow cell.

In another aspect of the invention, there is provided a computer program product comprising instructions which, when the program is executed by a processor, cause the processor to carry out the methods as described herein.

In another aspect of the invention, there is provided a computer-readable storage medium comprising instructions which, when executed by a processor, cause the processor to carry out the methods as described herein.

In another aspect of the invention, there is provided a computer-readable data carrier having stored thereon the computer program product as described herein. In another aspect of the invention, there is provided a data carrier signal carrying the computer program product as described herein.

The various illustrative imaging or data processing techniques described in connection with the embodiments disclosed herein can be implemented as electronic hardware, computer software, or combinations of both. To illustrate this interchangeability of hardware and software, various illustrative components, blocks, modules, and steps have been described above generally in terms of their functionality. Whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system. The described functionality can be implemented in varying ways for each particular application, but such implementation decisions should not be interpreted as causing a departure from the scope of the disclosure.

The various illustrative detection systems described in connection with the embodiments disclosed herein can be implemented or performed by a machine, such as a processor configured with specific instructions, a digital signal processor (DSP), an application specific integrated circuit (ASIC), a field programmable gate array (FPGA) or other programmable logic device, discrete gate or transistor logic, discrete hardware components, or any combination thereof designed to perform the functions described herein. A processor can be a microprocessor, but in the alternative, the processor can be a controller, microcontroller, or state machine, combinations of the same, or the like. A processor can also be implemented as a combination of computing devices, e.g., a combination of a DSP and a microprocessor, a plurality of microprocessors, one or more microprocessors in conjunction with a DSP core, or any other such configuration. For example, systems described herein may be implemented using a discrete memory chip, a portion of memory in a microprocessor, flash, EPROM, or other types of memory.

The elements of a method, process, or algorithm described in connection with the embodiments disclosed herein can be embodied directly in hardware, in a software module executed by a processor, or in a combination of the two. A software module can reside in RAM memory, flash memory, ROM memory, EPROM memory, EEPROM memory, registers, hard disk, a removable disk, a CD-ROM, or any other form of computer-readable storage medium known in the art. An exemplary storage medium can be coupled to the processor such that the processor can read information from, and write information to, the storage medium. In the alternative, the storage medium can be integral to the processor. The processor and the storage medium can reside in an ASIC. A software module can comprise computer-executable instructions which cause a hardware processor to execute the computer-executable instructions.

Computer-executable instructions may be stored in a (transitory or non-transitory) computer readable storage medium (e.g., memory, storage system, etc.) storing code, or computer readable instructions.

Additional Notes

The embodiments described herein are exemplary. Modifications, rearrangements, substitute processes, etc. may be made to these embodiments and still be encompassed within the teachings set forth herein. One or more of the steps, processes, or methods described herein may be carried out by one or more processing and/or digital devices, suitably programmed.

Conditional language used herein, such as, among others, “can,” “might,” “may,” “e.g.,” and the like, unless specifically stated otherwise, or otherwise understood within the context as used, is generally intended to convey that certain embodiments include, while other embodiments do not include, certain features, elements and/or states. Thus, such conditional language is not generally intended to imply that features, elements and/or states are in any way required for one or more embodiments or that one or more embodiments necessarily include logic for deciding, with or without author input or prompting, whether these features, elements and/or states are included or are to be performed in any particular embodiment. The terms “comprising,” “including,” “having,” “involving,” and the like are synonymous and are used inclusively, in an open-ended fashion, and do not exclude additional elements, features, acts, operations, and so forth. Also, the term “or” is used in its inclusive sense (and not in its exclusive sense) so that when used, for example, to connect a list of elements, the term “or” means one, some, or all of the elements in the list. The term “comprising” may be considered to encompass “consisting”.

Disjunctive language such as the phrase “at least one of X, Y or Z,” unless specifically stated otherwise, is otherwise understood with the context as used in general to present that an item, term, etc., may be either X, Y or Z, or any combination thereof (e.g., X, Y and/or Z). Thus, such disjunctive language is not generally intended to, and should not, imply that certain embodiments require at least one of X, at least one of Y or at least one of Z to each be present.

The terms “about” or “approximate” and the like are synonymous and are used to indicate that the value modified by the term has an understood range associated with it, where the range can be ±20%, ±15%, ±10%, ±5%, or ±1%. The term “substantially” is used to indicate that a result (e.g., measurement value) is close to a targeted value, where close can mean, for example, the result is within 80% of the value, within 90% of the value, within 95% of the value, or within 99% of the value. The term “partially” is used to indicate that an effect is only in part or to a limited extent.

Unless otherwise explicitly stated, articles such as “a” or “an” should generally be interpreted to include one or more described items. Accordingly, phrases such as “a device configured to” or “a device to” are intended to include one or more recited devices. Such one or more recited devices can also be collectively configured to carry out the stated recitations. For example, “a processor to carry out recitations A, B and C” can include a first processor configured to carry out recitation A working in conjunction with a second processor configured to carry out recitations B and C.

While the above detailed description has shown, described, and pointed out novel features as applied to illustrative embodiments, it will be understood that various omissions, substitutions, and changes in the form and details of the devices or algorithms illustrated can be made without departing from the spirit of the disclosure. As will be recognized, certain embodiments described herein can be embodied within a form that does not provide all of the features and benefits set forth herein, as some features can be used or practiced separately from others. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.

It should be appreciated that all combinations of the foregoing concepts (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. The present invention will now be described by way of the following non-limiting examples.

Examples

Example 1 : Concurrent sequencing of a concatenated strand (different inserts, human and PhiX)

1.1 Oligo sequences for stitch PCR method:

HYB2-ME - SEQ ID NO. 12; HYB2’-ME - SEQ ID NO. 14

ME sequences are underlined. These were to be used with P5-UDI-A14 and P7-UDI- B15 oligos to PCR up different genomic DNA libraries, making the libraries P5-insert- HYB2’ or P7-insert-HYB2. These libraries were then combined using SOE (splicing by overhang extension) PCR to combine them together. In this experiment the following two oligos were used as partners as examples:

Dual-Biotin 6T-P5-nonlin

5’Dual-biotin-TTTTTTAATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO. 35)

Dual-Biotin 6T-P7-nonlin

5’Dual-biotin-TTTTTTCAAGCAGAAGACGGCATACGAGAT (SEQ ID NO. 36)

The 5’ dual biotin is nonetheless, irrelevant for this experiment.

1.2 Method

1. Illumina DNA Flex libraries containing human or PhiX (bacteriophage) inserts were prepared following the standard Illumina protocol: https://emea.illumina.com/products/by-type/sequencing-kits/l ibrary-prep-kits/nextera- dna-flex.html

2. Two initial PCRs were set up containing:

• 25ul 2x Phusion Mastermix (New England Biolabs)

• 0.25ul 100uM dual-biotin 6T-P5-nonlin

• 0.25ul 100uM HYB2-ME

• 1 ul Human Flex library (~1 Ong)

• 23.5ul H20 The other PCR used the dual-biotin 6T-P7-nonlin and HYB2’-ME primer pair on the PhiX Flex library.

3. PCRs were cycled:

98C for 30s, followed by 10 cycles of 98C for 10s, 50C for 30s and 72C for 30s, then a 5min extension step at 72C and then held at 4C

4. After checking that material had been made in the initial PCRs via gel electrophoresis, “Splice Overlap Extension” (SOE) PCRs were assembled by combining 20ul of each of the initial PCRs.

5. SOE PCRs were cycled:

98C for 30s, followed by 8 cycles of 98C for 10s, 50C for 60s and 72C for 60s, then a 5min extension step at 72C and then held at 4C.

6. SOE PCRs were cleaned up via a 1x SPRI bead clean-up and quantified using the Qubit Broad Range dsDNA assay (Thermofisher), prior to use in sequencing experiments.

1.3 iSeq100 sequencing details:

An iSeq100 cartridge was cracked open, and premixed HCX (90ul ECX1 + 45ul of EXC2 + 90ul HCXE3 - ExAmp mix for iSeq100) added to the HCX Mixing well. The standard HP10 read 1 primer mix was removed from its well, washed with 200ul water 5x and then replaced with 150ul of the 16QAM sequencing primer mix.

16QAM sequencing primer mix - addition of equal concentrations of HYB2’-ME and HYB2’-ME-block in the standard HP10 read 1 sequencing primer mix from Illumina. The standard sequencing primers are at 0.3uM each within HP10, and we mix the HYB2’-ME (SEQ ID NO. 14) and HYB2’-ME-block (SEQ ID NO. 16) primers into this to give 0.5uM of each of these primers. The 50:50 ratio of blocked/unblocked primers for HYB2’-ME gives us the “50%” signal required at this primer site during 16QAM sequencing.

As shown in Figure 11 A, by plotting relative intensities of light signals obtained from a first channel (ch1) and a second channel (ch2), a constellation of 16 clouds is obtained. Each of these clouds allows sequence information to be identified on both the human insert and the PhiX insert, where the top left corner of four clouds corresponds with base calls corresponding to C, the top right corner of four clouds corresponds with base calls corresponding to T, the bottom left corner of four clouds corresponds with base calls corresponding to G, and the bottom right corner of four clouds corresponds with base calls corresponding to A. The basecall read out (R1 and R2) of both the human insert and the PhiX insert is also shown.

As shown in Figure 11 B, alignment of R1 and R2 (minor and major reads respectively) with the known human and PhiX sequence confirmed that the method accurately sequenced the inserts. In particular the sequence identity of R1 and R2 with the known sequences was 99% (150 out of 151 correct base calls for R1 and 148 out of 149 correct base calls for R2).

SEQUENCE LISTING

(Underlined sequences are ME or ME’ sequences)

SEQ ID NO. 1 : P5 sequence

AATGATACGGCGACCACCGAGATCTACAC

SEQ ID NO. 2: P7 sequence

CAAGCAGAAGACGGCATACGAGAT

SEQ ID NO. 3: P5’ sequence (complementary to P5)

GTGTAGATCTCGGTGGTCGCCGTATCATT

SEQ ID NO. 4: P7’ sequence (complementary to P7)

ATCTCGTATGCCGTCTTCTGCTTG

SEQ ID NO. 5: Alternative P5 sequence

AATGATACGGCGACCGA

SEQ ID NO. 6: Alternative P5’ sequence (complementary to alternative P5 sequence)

TCGGTCGCCGTATCATT

SEQ ID NO. 7: A14

TCGTCGGCAGCGTC

SEQ ID NO. 8: B15

GTCTCGTGGGCTCGG

SEQ ID NO. 9: A14-ME

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

SEQ ID NO. 10: B15-ME

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

SEQ ID NO. 11 : HYB2

GAGTAAGTGGAAGAGATAGGAAGG

SEQ ID NO. 12: HYB2-ME

GAGTAAGTGGAAGAGATAGGAAGGAGATGTGTATAAGAGACAG

SEQ ID NO. 13: HYB2’ CCTTCCTATCTCTTCCACTTACTC

SEQ ID NO. 14: HYB2 -ME

CCTTCCTATCTCTTCCACTTACTCAGATGTGTATAAGAGACAG

SEQ ID NO. 15: HYB2’-block

CCTTCCTATCTCTTCCACTTACT-3 ' propanol

SEQ ID NO. 16: HYB2’-ME-block

CCTTCCTATCTCTTCCACTTACTCAGATGTGTATAAGAGACAG-3 ' propanol

SEQ ID NO. 17: ME -A14’

CTGTCTCTTATACACATCTGACGCTGCCGACGA

SEQ ID NO. 18: A14’

GACGCTGCCGACGA

SEQ ID NO. 19: ME -B15’

CTGTCTCTTATACACATCTC C G AGC C C AC G AG AC

SEQ ID NO. 20: B15’

CCGAGCCCACGAGAC

SEQ ID NO. 21 : ME -HYB2

CTGTCTCTTATACACATCTGAGTAAGTGGAAGAGATAGGAAGG

SEQ ID NO. 22: ME -HYB2’

CTGTCTCTTATACACATCTCCTTCCTATCTCTTCCACTTACTC

SEQ ID NO. 23: Extended primer sequence with A as 5’ additional nucleotide and P5’ sequence (complementary to P5)

AGTGTAGATCTCGGTGGTCGCCGTATCATT

SEQ ID NO. 24: Extended primer sequence with T as 5’ additional nucleotide and P5’ sequence (complementary to P5)

TGTGTAGATCTCGGTGGTCGCCGTATCATT

SEQ ID NO. 25: Extended primer sequence with C as 5’ additional nucleotide and P5’ sequence (complementary to P5)

CGTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO. 26: Extended primer sequence with G as 5’ additional nucleotide and P5’ sequence (complementary to P5)

GGTGTAGATCTCGGTGGTCGCCGTATCATT

SEQ ID NO. 27: Extended primer sequence with A as 5’ additional nucleotide and P7’ sequence (complementary to P7)

AATCTCGTATGCCGTCTTCTGCTTG

SEQ ID NO. 28: Extended primer sequence with T as 5’ additional nucleotide and P7’ sequence (complementary to P7)

TATCTCGTATGCCGTCTTCTGCTTG

SEQ ID NO. 29: Extended primer sequence with C as 5’ additional nucleotide and P7’ sequence (complementary to P7)

GATCTCGTATGCCGTCTTCTGCTTG

SEQ ID NO. 30: Extended primer sequence with G as 5’ additional nucleotide and P7’ sequence (complementary to P7)

GATCTCGTATGCCGTCTTCTGCTTG

SEQ ID NO. 31 : Extended primer sequence with as 5’ additional nucleotide and alternative P5’ sequence (complementary to alternative P5)

ATCGGTCGCCGTATCATT

SEQ ID NO. 32: Extended primer sequence with T as 5’ additional nucleotide and alternative P5’ sequence (complementary to alternative P5)

TTCGGTCGCCGTATCATT

SEQ ID NO. 33: Extended primer sequence with C as 5’ additional nucleotide and alternative P5’ sequence (complementary to alternative P5)

CTCGGTCGCCGTATCATT

SEQ ID NO. 34: Extended primer sequence with G as 5’ additional nucleotide and alternative P5’ sequence (complementary to alternative P5)

GTCGGTCGCCGTATCATT

SEQ ID NO. 35: 6T-P5-nonlin

SEQ ID NO. 36: 6T-P7-nonlin

T T T T T T C AAGC AG AAGACGGC AT AC GAGAT