TECHNICAL FIELD The present invention relates to a constitutive expression promoter for transformi ng a monocot plant, a recombinant plant expression vector comprising said promoter, a method of producing a target protein by using said recombinant ^' plant expression vecto r, a method of producing a transgenic plant by using said recombinant plant expression vector, a transgenic plant produced by said method and a seed of said transgenic plant.

BACKGROUND ART

A promoter is a part of genome which is located upstream of a structural gene an d regulates transcription of the structural gene into mRNA. A promoter is activated by binding of various general transcription factors, and it typically comprises a base seque nee such as TATA box, CAT box, etc. which regulates gene expression. Since the prot eins that are required for basic metabolism of a living body need to be maintained at co nstant cellular concentration, a promoter that is associated with genes of such proteins i s constantly activated even by general transcription factors only. On the other hand, fo r the proteins of which function is not required during normal time but required only und er specific circumstances, an inducible promoter which can induce expression of a corr esponding structural gene is linked to the corresponding genes. In other words, an ind ucible promoter is activated by binding of specific transcription factors that are activated during a developmental process of an organism or by external stimulation caused by e nvironmental factors. With respect to the production of a crop plant having a new characteristic that is i useful for achieving a progress in agriculture, expression of a foreign gene introduced t

0 a plant (i.e., 'transgene') is greatly affected by transcriptional and post-transcriptional f actors as well as translational and post-translational factors. Among such factors, a pr omoter belonging to transcription factors is the most important factor as it can change n ot only the expression level by having direct effect on transcription of a transgene but al so the stage at which a transgene is expressed and tissue or cell specificity. Although until now many promoters have been isolated from various plants for expression of a tra nsgene, only few of them are actually used for plant transformation.

At the present moment, CaMV (cauliflower mosaic virus) 35S promoter and its de rivatives are the mostly widely used promoter. They can induce expression of a broad range of gene in every plant tissue, but have the highest activity in a vascular tissue an d most cells of a root and a leaf, in particular. However, CaMV 35S promoter has a Io wer activity in a monocot plant such rice, etc. than in a dicot plant, and it has no activity in a certain cell such as pollen, etc. Other than CaMV 35S, there are also many promoters originating from a dicot pi ant that have been used for transformation of a monocot plant. However, they have a I ower activity compared to the promoter originating from a monocot plant. In this regar d, RbcS (ribulose bisphosphate carboxylase/oxygenase small subunit) promoter from ri ce, Act1(actin1) promoter from rice and UbM promoter from corn have been suggested as a promoter that is useful for transformation of a monocot plant. Since Act1 and Ubi

1 promoters have a higher activity than CaMV 35S promoter in a monocot plant, they ar e generally used for transformation of a monocot plant.

However, although Ubi1 promoter is active in many different cell types, it cannot cover the entire tissue of a plant. In particular, although it is highly active in a young ro ot, its activity dramatically decreases as the root becomes mature. Meanwhile, Act1 pr omoter is active mainly in a growing tissue and a reproductive tissue, and therefore is n ot effective for obtaining expression of a ubiquitous gene which is localized in a monoco t plant.

Under the circumstances, there has been a constant need for developing a prom oter which is potent, stable and active specifically for transformation of a monocot plant.

US Patent No. 6,958,434 discloses OsCd promoter and a method of transformi ng a monocot plant using the promoter. However, OsCd promoter is different from th e promoter of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

Technical Goal of the Invention

The present invention was devised in view of above-described needs. Specific ally, as a result of intensive studies to develop a promoter which is effective for transfor mation of a monocot plant, inventors of the present invention found that a certain promo ter isolated from rice is suitable for constitutive expression of a monocot plant gene, an d therefore completed the present invention.

Disclosure of the Invention

In view of the above, object of the present invention is to provide a constitutive ex pression promoter for transformation of a monocot plant.

Further, object of the present invention is to provide a recombinant plant expressi on vector comprising said promoter.

Further, object of the present invention is to provide a method of producing a targ et protein by using said recombinant plant expression vector. Further, object of the present invention is to provide a method of producing a tran sgenic plant by using said recombinant plant expression vector and a transgenic plant p roduced by said method.

Still further, object of the present invention is to provide a seed of said transgeni c plant.

Effect of the Invention

According to the present invention, the promoters of the present invention can be advantageously used as a constitutive expression promoter for the study of a gene whi ch is generally expressed in a plant, in particular in a monocot plant including rice, and f or the production of a transgenic plant.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows the expression of constitutively-expressed genes in various rice tiss ues. Fig. 2(A) is a schematic diagram of a vector for rice transformation and Fig. 2(B) i s a schematic diagram of a promoter for rice transformation.

Fig. 3 shows the result of the observation of GFP expression amount in the seed s and the leaf and root tissues of transgenic rice, wherein the leaf and root tissues are 5 -day-, 20-day-, 30-day- or 60-day-old, respectively. The determination was made base d on RT (reverse transcription) PCR.

Fig. 4 shows a result of the observation of GFP expression amount in the leaf an d root tissues of transgenic rice, wherein the leaf and root tissues are 5-day-, 20-day-, 3

0-day- or 60-day-old, respectively. The determination was made based on Real Time- qPCR. Fig. 5 shows the difference in quantitative amount of GFP expression in the seed s and the flowers of transgenic rice. The determination was made based on Real Time -qPCR.

Fig. 6 demonstrates the relative activity of the promoter based on quantitative co mparison of GFP expression in various events. Fig. 7 shows the GFP fluorescence emission in the leaves and roots of transgeni c rice.

Fig. 8 shows the GFP fluorescence emission in the seeds and flowers of transg enic rice.

BEST MODE FOR CARRYING OUT THE INVENTION

In order to achieve the object of the invention described above, the present inv ention provides a constitutive expression vector for transformation of a monocot plant. More specifically, the present invention provides a constitutive expression vector for tra nsformation of a monocot plant, which comprises a nucleotide sequence that is selecte d from the group consisting of nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3. The present invention is related to a specific promoter originating from rice, and more specifically, the promoter is suitable for the transformation of a monocot plant and the constitutive expression of a plant gene. Preferably, the promoter can promote the gene expression in every organ or tissue of a plant. The promoter encompasses the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3, as well as the nucleotide seq uences that are complementary to each of said nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3. Specifically, the promoter is ascorbate peroxidase (APX ascorbate p eroxidase) promoter of SEQ ID NO: 1 , AP2 domain containing putative gene (SCP1 AP 2 domain containing putative gene) promoter of SEQ ID NO: 2, or cytosolic phosphoglu conate dehydrogenase 1 (PGD1 cytosolic phosphogluconate dehydrogenase) promoter of SEQ ID NO: 3.

The above-descried promoters were able to promote the gene expression in ever y organ and tissue of the plant at the equal level. Among them, APX, SCP1 and PGD1 promoters were as potent as intrinsic OsCcI promoter and ZmUbil promoter, which is the constitutive expression promoter found in corn.

Further, the variants of the said promoter sequences also fall within the scope of the present invention. The variants have a different nucleotide sequence but have sim ilar functional characteristics to those of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3. A functional fragment is included in said equivalent with similar functio nal characteristics, and a variant in which at least one nucleotide base is substituted, de leted or inserted or modified by their combination is also included. Specifically, the pro moter of the present invention may comprise a nucleotide sequence with at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% homology with the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3. The "sequence homology %" for a certain polynucleotide is identified by compari ng a comparative region with two sequences that are optimally aligned. In this regard, a part of the polynucleotide in comparative region may comprise an addition or a deletio n (i.e., a gap) compared to a reference sequence (without any addition or deletion) relat ive to the optimized alignment of the two sequences. Substantial homology in polynucleotide sequences indicates that a polynucleotid e comprises a nucleotide sequence having at least 70%, preferably at least 80%, more preferably at least 90%, and still more preferably at least 95% sequence homology with the other polynucleotide. Further, it also indicates that the nucleotide sequence is su bstantially the same when the two molecules are specifically hybridized to each other u nder stringent condition. The stringent condition is sequence-dependent and may vary depending on situation. In general, the stringent condition is selected so as to have t he temperature that is about 10 ^° C lower than melting temperature (Tm) of a specific seq uence at certain ionic strength and pH. The Tm is defined as the temperature at which

50% of the target sequences are hybridized to the probe which is fully complementary to the target sequence (at certain ionic strength and pH). Typically, the stringent condit ion for a Southern blot process includes washing with 0.2 X SSC at 65 °C . For a preferr ed oligonucleotide probe, washing is typically carried out at about 42 ^° C by using 6 X SS C.

According to the promoter of one embodiment of the present invention, the abov e-described monocot plant can be rice, barley, corn, wheat, millet or African millet, but n ot limiter thereto.

In order to achieve other object of the present invention, a recombinant plant exp ression vector comprising the promoter of the present invention is provided. As an exa mple of the recombinant plant expression vector, the vector shown in Fig. 2(A) can be e xemplified, but not limited thereto. Specifically, the vector comprises the promoter of th e present invention to which a modified green fluorescence protein gene (GFP), proteas e inhibitor Il terminator gene (TPINII), OsCd promoter (Pcytc), he oicide resistant Bar g ene (phosphinotricine acetyltransferase gene) and nopalin synthase terminator (TNOS) are operatively linked. In addition, by introducing MAR sequence at the terminal regio n of the right-border sequence, fluctuation in expression amount caused by different intr oduction site in chromosome can be minimized so that only the intrinsic activity of the pr omoter of the present can be measured according to the present invention.

The term "recombinant" indicates a cell which replicates a heterogeneous nucleo tide or expresses the nucleotide, a peptide, a heterogeneous peptide, or a protein enco ded by a heterogeneous nucleotide. Recombinant cell can express a gene or a gene f ragment that are not found in natural state of cell, in a form of a sense or an antisense.

The term "vector" is used herein to refer DNA fragment (s) and nucleotide molec ules that are delivered to a cell. Vector can be used for the replication of DNA and be i ndependently reproduced in a host cell. The terms "delivery system" and "vector" are often interchangeably used. The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and other appropriate nucleotide sequ ences that are essential for the expression of the operatively-linked coding sequence in a specific host organism. Promoter, enhancer, termination codon and polyadenylation signal that can be used for an eukaryotic cell are well known in the pertinent art. A preferred example of plant expression vector is Ti-plasmid vector which can tra nsfer a part of itself, i.e., so called T-region, to a plant cell when the vector is present in an appropriate host such as Agrobactehum tumefaciens. Other types of Ti-plasmid ve ctor (see, EP 0 116 718 B1) are currently used for transferring a hybrid gene to protopla sts that can produce a new plant by appropriately inserting a plant cell or hybrid DNA to a genome of a plant. Especially preferred form of Ti-plasmid vector is a so-called binar y vector which has been disclosed in EP 0 120 516 B1 and USP No. 4,940,838. Other vector that can be used for introducing the DNA of the present invention to a host plant can be selected from a double-stranded plant virus (e.g., CaMV), a single-stranded pla nt virus, and a viral vector which can be originated from Gemini virus, etc., for example a non-complete plant viral vector. Use of said vector can be advantageous especially when a plant host cannot be appropriately transformed.

Expression vector would comprise at least one selective marker. Said selective marker is a nucleotide sequence having a property that can make a target gene get sel ected by a common chemical method. Every gene which can be used for the differenti ation of transformed cells from non-transformed cell can be a selective marker. Exam pie includes, a gene resistant to herbicide such as glyphosate and phosphinotricine, an d a gene resistant to antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, but not limited thereto.

According to the plant expression vector of one embodiment of the present inven tion, the promoter can be CaMV 35S promoter, actin promoter, ubiquitin promoter, pEM U promoter, MAS promoter, or histone promoter, but not limited thereto. The term "pro moter" indicates a region of DNA located upstream of a structure gene, and it correspon ds to a DNA molecule to which an RNA polymerase binds to initiate transcription. The term "plant promoter" indicates the promoter that can initiate transcription in a plant cell. The term "constitutive promoter" indicates the promoter that is active under most envi ronmental conditions and cell growth or differentiation state. Since selection of a trans formant can be made for various tissues at various stages, the constitutive promoter ma y be preferred for the present invention. Thus, selection property is not limited by a co nstitutive promoter. As for the above-described terminator, any kind of a typical terminator can be us ed. Example includes, nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, p haseoline terminator, and a terminator for Octopine gene of Agrobacterium tumefaciens , etc., but are not limited thereto. Regarding the necessity of terminator, it is generally known that such region can increase a reliability and an efficiency of transcription in pla nt cells. Therefore, the use of terminator is highly preferable in view of the context of t he present invention.

With respect to the recombinant plant expression vector according to one embod iment of the present invention, it can be the one which is constructed by operatively linki ng a gene encoding a target protein to a downstream region of the promoter of the pres ent invention. In the present specification, the term "operatively-linked" is related to a component of an expression cassette, which functions as a unit for expressing a hetero geneous protein. For example, a promoter which is operatively-linked to a heterogene ous DNA encoding a protein stimulates production of functional mRNA which correspon ds to the heterogeneous DNA. The above-described target protein can be any kind of protein, and examples the reof include a protein which is therapeutically useful, i.e., an enzyme, a hormone, an an tibody, a cytokine, etc., and a protein which can accumulate a great amount of nutrition al components useful for health enhancement in an animal including a human, but not Ii mited thereto. Specific examples of a target protein includes interieukin, interferon, pla telet-derived growth factor, hemoglobin, elastin, collagen, insulin, fibroblast growth facto r, human growth factor, human serum albumin, erythropoietin, and the like.

Further, the present invention provides a method of producing a target protein in a plant by transforming a plant with the above-described recombinant plant expression vector to constitutively express the target protein. Further, the present invention provid es the target protein that is produced by said method. The target protein which can be obtained according to this method is the same as those described above.

Plant transformation means any method by which DNA is delivered to a plant. S uch transformation method does not necessarily need a period for regeneration and/or t issue culture. Transformation of plant species is now quite general not only for dicot pi ants but also for monocot plants. In principle, any transformation method can be used for introducing a hybrid DNA of the present invention to appropriate progenitor cells. T he method can be appropriately selected from a calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987,

Plant MoI. Biol. 8, 363-373), an electroporation method for protoplasts (Shillito R. D. et al., 1985 Bio/Technol. 3, 1099-1102), a microscopic injection method for plant compone nts (Crossway A. et al., 1986, MoI. Gen. Genet. 202, 179-185), a particle bombardment method for various plant components (DNA or RNA-coated) (Klein T.M. et al., 1987, Nat ure 327, 70), or a (non-complete) viral infection method in Agrobactehum tumefaciens mediated gene transfer by plant invasion or transformation of fully ripened pollen or mic rospore (EP 0 301 316), etc. A method preferred in the present invention includes Agr obacterium mediated DNA transfer. In particular, so-called binary vector technique as disclosed in EP A 120 516 and USP No. 4,940,838 can be preferably adopted for the pr esent invention.

The "plant cell" that can be used for the plant transformation in the present invent ion can be any type of plant cell. It includes a cultured cell, a cultured tissue, a culture d organ or a whole plant. Preferably, it is a cultured cell, a cultured tissue, or a culture d organ. More preferably, it is a cultured cell in any form.

The term "plant tissue" can be either differentiated or undifferentiated plant tissue

, including root, stem, leaf, pollen, seed, cancerous tissue and cells having various shap e that are used for culture, i.e., single cell, protoplast, bud and callus tissue, but not limit ed thereto. Plant tissue can be in planta or in a state of organ culture, tissue culture or cell culture.

Further, the present invention provides a method of producing a transgenic plant comprising: - transforming a plant cell with the recombinant plant expression vector of t he present invention, and regenerating the above-described transformed plant cell into a transgenic plant.

The method of the present invention comprises a step of transforming a plant eel I with the recombinant plant expression vector of the present invention, and such transf ormation may be mediated by Agrobacterium tumefaciens. In addition, the method of t he present invention comprises a step of regenerating a transformed plant cell to a tran sgenic plant. A method of regenerating a transformed plant cell to a transgenic plant c an be any method that is well known in the pertinent art. Further, the present invention provides a transgenic plant that is produced by the method of producing a transgenic plant described in the above. Preferably, the plant is a monocot plant. More preferably, it is rice, barley, corn, wheat, millet or African millet

, but not limiter thereto.

Still further, the present invention provides a seed obtained from the transgenic pi ant that is described in the above. Preferably, the seed originates from a monocot pla nt. More preferably, it originates from rice, barley, corn, wheat, millet or African millet, but not limiter thereto.

The present invention will now be described in greater detail with reference to th e following examples. However, it is only to specifically exemplify the present inventio n and in no case the scope of the present invention is construed to be limited by these examples.

EXAMPLES Materials and Methods

1. Prediction and extraction of a promoter sequence By using the sequence obtained from IRGSP (international rice genome sequenc ing project), by which full genome sequencing of rice was completed in December 2004 since it had been first established in 1997, and the DNA annotation data from TIGR (T he Institute for Genomic Research) that has been carried out based on said full genom e sequencing, the promoter region was predicted and then used for constructing a vect or for rice transformation. Fully-annotated BAC was selected. The DNA sequence fro m the ATG site of the coding sequence (CDS) to the site that is about 2 kbp upstream o f the ATG site was presumed to be the promoter region. After being extracted separat ely, the sequence was used as a template for preparing a PCR primer which can be use d for isolating the promoter having about 1.7-2kb size from the above-described 2kbp s equence.

2. Analysis of a constitutively-expressed gene based on RT-PCR (reverse trans criptase-PCR) For the analysis of a constitutively-expressed gene, samples were obtained from the tissues of leaves, roots and flowers of the young rice plants that are 5-day-, 20-day-, 30-day- or 60-day-old. Specifically, to prepare the sample, the rice seeds were steriliz ed with 70% ethanol and 20% Chlorox solution. After being cultured for 5 days under dark condition, they are propagated in a greenhouse. To extract the whole RNA, RNea sy plant mini kit (Qiagen, Cat. No. 74904) was used. By using 400 ng of the extracted whole RNA ₁ the first strand cDNA was synthesized (Invitrogen, Cat. No. 18080-051). I n addition, by using 1 μ£ of this cDNA synthesis product as a template, PCR was carried out. The primers that were used for the PCR are as follows. For the comparison of t he cDNA amount used (i.e., loading control), ubiquitin primer (Ubi) was used and its seq uence is also given below: forward primer APX: 5 ¹ - GACCTCTAGACCGCCGTATT-S ¹ (SEQ ID NO: 4) reverse primer APX: 5 ¹ - GCCAACCACTCGCAATCCAA-3" (SEQ ID NO: 5) forward primer SCP1: 5 ¹ - TCGCTGCCTACGCCAACATC-S ¹ (SEQ ID NO: 6) reverse primer SCP1 : 5'- TCGCCGAACTAGCAGGTGAG-S ¹ (SEQ ID NO: 7) forward primer PGD1 : 5 ¹ - CCGTGAGCTAGCGAGGATCT-3' (SEQ ID NO: 8) reverse primer PGD1 : 5'- CCGGTAGGAGTCGAAGTACG -3' (SEQ ID NO: 9) forward primer OsCd : 5'- ACTCTACGGCCAACAAGAAC-S' (SEQ ID NO: 10) reverse primer OsCcI : 5 ¹ - CTCCTGTGGCTTCTTCAACC-3' (SEQ ID NO: 11) forward primer Act1 : 5 ¹ - ATGGTGTCAGCCACACTGTC-3' (SEQ ID NO: 12) reverse primer Act1 : 5'- TAACCACGCTCCGTCAGGAT-S' (SEQ ID NO: 13) forward primer Ubi: 5 ¹ - ATGGAGCTGCTGCTGTTCTA-S' (SEQ ID NO: 14) reverse primer Ubi: 5'- πcπCCATGCTGCTCTACC-3 ¹ (SEQ ID NO: 15). PCR condition is as follows: PTC200 PCR machine (MJ research), cDNA 1 /d, 2X Taq premix (Solgent. Co. Cat. No. EP051020-T2B6-1), template-specific primer 4 pmol each. Total reaction volume was 20 jd, and the reaction included 32 cycles in which each cycle consists of 30 seconds at 95 ^° C, 30 seconds at 55 ^° C, and 1 minute at 72 ⁰ C.

3. Amplification and isolation of the promoter

By using the presumed promoter sequence of 2kbp as a template and primer de signer 4 program (ver.4.20, Scientific & Educational software), a PCR primer was desig ned for isolation of the promoter with full length of about 1.8-2kb. For the designing, th e PCR condition includes the primer with GC% of 40 to 60%, Tm of 55-65 ⁰ C , salt conce ntration of 0 mM and free Mg ion concentration of 0.15 mM. The primer (PCR primer) was designed to have a template-specific region of 20 bp and 5' adaptor sequence of 1 2bp. This adapter sequence is a sequence that is inserted for site-specific recombinati on instead of a typical cloning which uses restriction enzymes and DNA ligases. For o btaining the DNA to be used as a template for the PCR reaction, Japonica type rice pla nt seeds (Nipponbare cultivar) were sown, cultivated for three weeks in a greenhouse, a nd only the leaves were cut to extract the genomic DNA. Specifically, the leaves were first rapidly frozen in liquid nitrogen, finely ground in a mortar and pestle, and then isolat ed by using DNAzol solution (Molecular Research Center, Cat. No. DN 128). PCR reac tion was then carried out according to two separate steps. The first step is to isolate a certain promoter from the rice genome, and a template-specific sequence primer having whole size of 32bp, that is ligated by 12bp adapter sequence, is used. The primer se quences are as follows: forward template-specific primer: δ'-AAAAAGCAGGCT-template-specific sequen ce-3 ¹ reverse template-specific primer: δ'-AGAAAGCTGGGT-template-specific sequen ce-3 ¹

Specific sequences of the gene-specific primers are as follows: a. APX promoter primer forward primer: 5'-AAAAAGCAGGCTgtaaggtgacatggcatatc-3' (SEQ ID NO: 16) forward primer: 5'-AGAAAGCTGGGTccaatccgaatcaatcaatc-3' (SEQ ID NO: 17) b. SCP1 promoter primer forward primer: S'-AAAAAGCAGGCTttgactttttctgcgaagaa-S' (SEQ ID NO: 18) forward primer: 5'-AGAAAGCTGGGTtaactcttgccggaaaagaa-3' (SEQ ID NO: 19) c. PGD1 promoter primer forward primer: 5'-AAAAAGCAGGCTtagatatgccgaacatgacc-3' (SEQ ID NO: 20) forward primer: 5'-AGAAAGCTGGGTgcagatagatgcaccaaatg-3' (SEQ ID NO: 21).

First PCR was run by using 50ng of genomic DNA, 2X Taq premix (Solgent. Co. Cat. No. EP051020-T2B6-1), and 10 pmol of each of the template-specific primer with t otal reaction volume of 50 μl and 30 cycles in which each cycle consists of 1 minute at

951 , 1 minute at 55 "C , 2 minutes at 68 ⁰ C . Second PCR was carried out to insert and amplify a certain adapter sequence (i. e., att site) that is required for inserting the promoter to a transformation vector. The s equence which needs to be additionally inserted to the promoter is about 29bp long. H owever, to improve the efficiency of the PCR, only part of this sequence (i.e., 12bp) is at tached as an overhang to the template-specific sequence. After carrying out the first P CR, 1/50 of the resulting PCR solution (i.e., 1μ£) is taken and then subjected to the sec ond PCR using a primer having the full recombinant sequence (i.e., adapter sequence primer). As a result, the resultant will have both the rice promoter and the att sequenc e for recombination. Sequences of the adapter primers are as follows: attB1 adapter primer: 5'-GGGGACAAGnTGTACAAAAAAGCAGGCT-S ¹ (SEQ I D NO: 22) attB2 adapter primer: S'-GGGGACCACTTTGTACAAGAAAGCTGGGT-a' (SEQ I D NO: 23).

Second PCR was run by using \μ!L of the first PCR product, 2X Taq premix (SoIg ent. Co. Cat. No. EP051020-T2B6-1), and 2 pmol of each of the adapter primer with tot al reaction volume of 50 μl and 5 cycles in which each cycle consists of 30 seconds at

95"C, 30 seconds at 45 ¹ C and 2 minutes at 68 ^° C, followed by 20 cycles in which each c ycle consists of 30 seconds at 95 ⁰ C, 30 seconds at 55 ⁰ C, and 2 minutes at 68 ⁰ C .

The above-described PCR was carried out according to the method recommend ed by Invitrogen to use the Gateway system which is available from the same company (Invitrogen, Cat. No.12535-029).

4. Cloning of amplified promoter

By using the Gateway system (Invitrogen, Cat. No.12535-029), the promoter was inserted to the vector for rice transformation. First, the amplified promoter was subjec ted to electrophoresis (1% agarose gel). The band was isolated from the gel and purifi ed by using Mega-spin agarose gel extraction kit (Intron, Cat. No.17183). Reaction sol ution (total volume of 20 μl) comprising purified promoter 5 μl, BP clonase enzyme mixture 4 μl, 5X BP reaction buffer solution 4 μl, pDONR vector 300 ngf2μl, and TE b uffer solution (10 mM Tris/pH 8.0, 1 mM EDTA) was subjected to BP reaction for 16 hou rs at 25"C. Thereafter, LR clonase enzyme mixture 6μl, 0.75 M NaCI 1μ£ and transfer mation vector 450 ngl3μl were added for the LR reaction for 8 hours at 25 "C (total volu me of 30 μi). Proteinase K 3 μl was further added for the reaction for 1 hour at 371C

. 2 μl of the resulting product was used for the transformation of DH5α competent eel Is. The transformed DH5α cells were spread to LB agar medium comprising spectino mycin (antibiotics; 50 //g/ml). After culturing the cells for 12 hours in an incubator at 3

7 ^° C , DNA was extracted from the selected cells. Promoter insertion was confirmed by running PCR. Then, DNA sequencing and BLASTN were carried out to finally confirm the complete insertion of the promoter. The vector for rice transformation (pMJ401 ) is as follows. A cassette which is fir st placed between the right-border sequence and the left-border sequence and then rep laced with the promoter is linked at its 3'end to GFP and PINII (protease inhibitor II) as a visible marker gene. This cassette has att sequence for carrying out the BP and LR reactions. The selection gene (selective marker gene) was prepared so as to have the herbi cide-resistant bar gene (i.e., phosphinotricine acetyl transferase gene) controlled by Os Cd promoter that had been developed by the inventors of the present invention to achi eve constitutive expression, and it is linked to NOS (nopalin synthase) terminator. Furt her, by introducing the MAR sequence at the terminal region of the right-border sequen ce, it is aimed to minimize fluctuation in expression amount caused by different introduc tion site in chromosome so that only the intrinsic activity of the promoter of the present can be measured according to the present invention.

5. Agrobacterium-mediated transformation of rice

Outer glumes were removed from the rice seeds (Oryza sativa L. cv Nakdong). 70% (v/v) ethanol was added to the seeds, which were then briefly washed by shaking t hem for 1 minute. Thus-washed seeds were sterilized by adding to 20% Chlorox and s haking for 1 hour, followed by washing several times with sterilized water. The resultin g washed rice seeds were incubated on callus-inducing medium (2N6) for 1 month to in duce germ callus, as shown by Jang et. al. (Jang, I-C. et al., MoI breeding, 5:453-461 , 1 999). After that, based on co-cultivation with the Agrobacterium which has been obtain ed by Agrobacterium triple mating method, the transformant vector in which the promot er of the present invention has been introduced was inserted to the genome of the rice. Cultivation was carried out for 1 month using a medium for selecting the transfer med callus (i.e., 2N6-CP). Then, the grown cells were selected and further cultivated from one month to two months in a medium for differentiation (i.e., MS-CP) and the res ulting regenerated plants were adapted in a greenhouse. The adapted TO rice plants were treated with Basta, which is non-selective herbicide, and only the plants exhibiting resistance to the herbicide were selected and subjected to the progeny analysis.

6. Observation of GFP expression and analysis of promoter activity in various ric e organs

Fluorescence emission of GFP ₁ which is a marker gene used for the analysis of p romoter activity, was determined for the rice seeds, and the leaves, roots and flower org ans of the rice seedlings that had been grown for one month after the germination. Ge ne expression was determined starting from the T2 generation from which gene insertio n and isolation can be clearly observed. Specifically, glumes were removed from the s eeds and the GFP expression was observed for the germ and endosperm of the seeds by using LAS3000 system (Fuji photo film, co.) and stereo microscope SZX9-3122 (Oly mpus, Tokyo, Japan). With respect to the one-month old seedlings after germination, t he seeds with verified GFP expression were sterilized with ethanol and 20% Chlorox. Then, to confirm the activity of bar gene as a selection marker, the seeds were cultured in MS-P medium comprising PPT component (PPT 4 mg/l) for three days under dark co ndition followed by two days under light condition. The etiolated seedlings were cultiv ated in soil for 25 days and gene expression was determined for the leaf and root tissue s of the plant. LAS3000 condition includes precision, standard, exposure time for 1 se cond (excitation filter 460 nm, barrier filter 510 nm). Meanwhile, flowers were harveste d right before the heading and were observed under stereo microscope SZX9-3122 (Ol ympus, Tokyo, Japan), before and after removing the glumes from the flower, and theref ore the GFP fluorescence from various organs was obtained.

7. Analysis of promoter activity based on RT-PCR (reverse transcriptase PCR) an d Real time qRT-PCR (real time quantitative reverse transcriptase-PCR) Whole RNA extraction for the analysis of the promoter activity was carried out for seeds of the transformant and the tissues of the leaves, roots and flowers of the seedli ngs that are 5-day-, 20-day-, 30-day- or 60-day-old, respectively. In order to extract wh ole RNA from each tissue, RNeasy plant mini kit (Qiagen, Cat. No. 74904) was used. By using 400 ng of the extracted whole RNA ₁ first cDNA strand was synthesized (Invitro gen, Cat. No. 18080-051). Further, by using \μi of this cDNA synthesis product as a t emplate, PCR was carried out. For the PCR, two kinds of primer were used. First pri mer is a primer to be used for relative comparison of GFP that is inserted behind the pr omoter (primer GFP). Second primer is a primer to be used for comparison of the amo unt of cDNA used (primer Ubi) (i.e., loading control). Sequences of the primers are as follows. forward primer GFP: 5 ¹ -CAGCACGACTTCTTCAAGTCC-3 ¹ (SEQ ID NO: 24) reverse primer GFP: S'-CπCAGCTCGATGCGGTTCAC-S ¹ (SEQ ID NO: 25) forward primer Ubi: δ'-ATGGAGCTGCTGCTGTTCTA-a ¹ (SEQ ID NO: 14) reverse primer Ubi: δ'-πcπCCATGCTGCTCTACC-S ¹ (SEQ ID NO: 15) RT-PCR condition was as follows: PTC200 PCR machine (MJ research), cDNA 1

≠, 2X Taq premix (Solgent. Co. Cat. No. EP051020-T2B6-1), template-specific primer

2 pmol each. Total reaction volume was 20 id, and the reaction included 31 cycles in which each cycle consists of 30 seconds at 95 ^° C, 30 seconds at 55 ^° C, and 30 seconds at 72 °C (for the seeds, the reaction includes 33 cycles). Real time qRT-PCR condition was as follows: Mx3000P (Stratagene), cDNA 1 id

, 2X Cybergreen qRT-PCR premix (Invitrogen. Cat. No. 11765-100), template-specific pr imer 2 pmol each. Total reaction volume was 20 id, and the reaction included 40 cycl es in which each cycle consists of 15 seconds at 95 ^° C and 30 seconds at 60 ^° C. Upon the completion of the reaction, by using Mx3000P program provided by the manufactur er (Stratagene), quantitative analysis of the promoter activity was carried out.

Example 1 : Analysis of the expression of constitutively-expressed gene in variou s rice tissues

In order to determine the tissue-specific activity of the constitutively-expressing p romoters APX, SCP1 and PGD1 , samples were taken from the rice seeds and the tissu es of rice leaves, roots and flowers that are 5-day-, 20-day-, 30-day- or 60-day-old, resp ectively. Whole RNA was extracted from each sample. Having this RNA as a templat e, cDNAwas synthesized and amplified by PCR, followed by electrophoresis (2% agaro se gel). Fig. 1 shows the expression pattern of three constitutively-expressed genes in various rice tissues, in which the patterns are obtained by RT-PCR and then compared to each other. As it is shown in Fig. 1 , it was found that APX, SCP1 and PGD1 of the present invention are homogeneously expressed in each rice tissue tested. Further, c onsidering that their expression pattern is similar to that of OsCd and Act1 genes, whic h are a well known constitutive expression promoter, it was verified that APX, SCP 1 and

PGD 1 are a constitutively-expressed gene.

Example 2: Construction of vector for rice transformation and structure of the pro moter A vector for rice transformation was constructed to analyze promoter activity. Fi g. 2(A) is a diagrammatic view of the pMJ401 vector, which is a parent vector for cloning the promoter that has been isolated by PCR. attR1 and attR2 sites are the regions at which recombination with attl_1 and attl_2 sequences contained in the promoter occurs after BP reaction (i.e., site-specific recombination). After LR reaction, the promoter is replaced by the cassette and also the attR1 and attR2 sequences are replaced by the a ttB1 and attB2 sequences, respectively. Description of each gene is as follows. MAR

, matrix attachment region (1.3kb), X98408; cassette B, conversion cassette B (1.7kb), I nvitrogen, Cat. No. 11828-019; GFP, modified green fluorescence protein gene (0.74kb)

, U84737; TPINII ₁ protease inhibitor Il terminator (1.0kb), X04118; OsCd , cytochrome c promoter (0.92kb), Af399666; BAR, phosphinotricine acetyltransferase gene (0.59kb), X17220; TNOS, nopalin synthase terminator (0.28kb).

Fig. 2(B) is a schematic diagram showing the structure of the promoter of the pre sent invention included in rice genome.

Example 3: Analysis of the promoter activity in various tissues of transgenic rice using RT-PCR (GFP expression level analysis)

Whole RNA was extracted from the seeds of a transgenic plant, and from the tiss ues of leaves, roots and flowers of rice seedlings that are 5-day-, 20-day-, 30-day- or 60

-day-old, respectively. Having this RNA as a template, cDNA was synthesized and am plified by PCR, followed by electrophoresis (2% agarose gel). Each PCR product was loaded in an amount of 5 μJl. Fig. 3 shows the result of the semi-quantitative analysis of the amount of GFP expressed in the seeds and the tissues of the leaves, roots and fl owers of transgenic rice seedlings that are 5-day-, 20-day-, 30-day- or 60-day-old, resp ectively. The determination was made based on RT (reverse transcription) PCR. GF P is a PCR product amplified by GFP primer and used for relative comparison of expres sion amount of GFP gene that has been inserted behind the promoter. Size of the pro duct was 141 bp. Considering the difference in gene expression caused by variation in each individual, three separate events having different insertion sites were employed for the analysis of the transformant having each promoter. From the comparison of the o btained activity with that of ZmUbi promoter, which is well-known Ubi1 promoter, it was f ound that APX, SCP1 and PGD1 promoters have a relatively strong activity and are eve nly distributed over the entire tissues of the transgenic rice plant.

Example 4: Analysis of the promoter activity in various tissues of transgenic rice using Real time q RT-PCR Fig. 4 and Fig. 5 show a result of the quantitative analysis of GFP expression patt ern in various tissues of transgenic rice, depending on specific activity of each promoter . In the same manner as Fig. 3, whole RNA was extracted from the seeds of a transge nic plant, and from the tissues of leaves, roots and flowers of rice seedlings that are 5-d ay-, 20-day-, 30-day- or 60-day-old, respectively. Having this RNA as a template, cDN A was synthesized and amplified by PCR. Then, by using a primer which is specific to GFP gene that is employed as a target gene, real time qRT-PCR analysis was performe d. Considering the difference in gene expression caused by variation in each individua I ₁ three separate events having different insertion sites were employed for the analysis o f the transformant having each the promoter.

Fig. 4 quantitatively shows the activity of constitutive expression promoter in the I eaf and root tissues of transgenic rice seedlings that are 5-day-, 20-day-, 30-day- or 60- day-old, respectively. Fig. 5 also quantitatively shows the activity of constitutive expres sion promoter in the seeds, which are a reproductive organ as well as a storage organ, and in the flower, which is the other reproductive organ of a plant.

Example 5: Comparison of promoter activity in various transformants having diffe rent insertion site

Since the degree of promoter activity may vary greatly depending on its insertion position in rice genome, by measuring and analyzing a change in promoter activity for v arious transformants having different insertion site, the presumed activity range when th e promoter is actually employed for expression of a target gene can be defined. Sever al transformants having different insertion site for each promoter (5 to 14 events for eac h promoter) were allowed to germinate first, and then cultivated for 20 days in a greenh ouse. Whole RNA was extracted from the leaf and root tissues. Having this RNA as a template, cDNAwas synthesized and amplified by PCR. Then, using a primer which is specific to GFP gene that is employed as a target gene, real time qRT-PCR analysis was performed. Fig. 6 shows the result of quantitative analysis of GFP gene expressi on pattern in transgenic rice under control of different promoters. The resulting promot er activity chart obtained from each transgenic event can be a good index to predict bef orehand the minimum and maximum level of expression when the corresponding prom oter is used for transgene expression.

Example 6: Observation of GFP fluorescence emission in the leaf and root tissue s of transgenic rice having various promoters

In order to analyze the activity of the promoters that are used in the present inve ntion, one month after the germination, the leaf and root tissues were obtained from the transgenic rice plant which had been transformed with the promoters of the present inv ention, and then GFP fluorescence emission was observed under stereo microscope S ZX9-3122 (Olympus, Tokyo, Japan).

Fig. 7 shows the GFP fluorescence emission from the leaf and root tissues of tra nsgenic rice that had been transformed with various promoters. Specific description fo r the each gene shown in Fig. 7 is as follows. NC, Nakdong cultivar rice as a negative control (non-transgenic rice); ZmUbi, corn Ubi1 promoter; Actin, rice Actini promoter; O sCc1 , rice cytochrome c promoter.

In the leaf and root tissues of the negative control, no GFP fluorescence emissio n was observed. On the other hand, in the leaf and root tissues of the transgenic plant transformed with the promoters of the present invention, GFP fluorescence emission w as clearly observed all over the entire plant tissues. This result visually indicates that, similar to the transgenic rice plant transformed with ZmUbi, Actin 1 or OsCd as a positiv e control, activity of the constitutive expression promoters of the present invention is ev enly distributed over the entire leaf and root tissues.

Example 7: Observation of GFP fluorescence emission in the reproductive organ s of the transgenic rice having various promoters

In order to analyze the activity of the promoters of the present invention in a repr oductive organ of a plant, seeds of the transgenic rice plant from which glumes had bee n removed were selected, and then GFP fluorescence emission was observed under st ereo microscope SZX9-3122 (Olympus, Tokyo, Japan). T2 generation seeds exhibiting homozygous GFP expression were sown in a gre enhouse. Thereafter, flowers were harvested right before the heading and were obser ved under stereo microscope SZX9-3122 (Olympus, Tokyo, Japan), before and after re moving the glumes from the flower, and therefore the GFP fluorescence was determine d. Fig. 8 shows the GFP fluorescence emission in the seeds and flowers of transgenic rice. Specific description for the each gene shown in Fig. 8 is as follows. NC, Nakdo ng cultivar rice as a negative control (non-transgenic rice); ZmUbi, com Ubi1 promoter; Actin, rice Actini promoter; OsCd , rice cytochrome c promoter.

GFP fluorescence emission was found in the seeds and the leaf and root tissues of the transgenic rice seedlings transformed with OsCcI promoter. However, almost n o expression was found in the flowers. With respect to the transgenic rice seedlings tr ansformed with Act1 promoter, GFP fluorescence emission was found in the anther, as well as the leaves and roots. With respect to the transgenic rice seedlings transforme d with ZmUbi promoter, GFP fluorescence emission was found evenly in all flower orga ns including lemma, palea, pistil and anther, etc. With respect to the APX, SCP1 and PGD1 promoters that are isolated according to the present invention, GFP fluorescence emission was found evenly in all of the plant tissues, similar to ZmUbi promoter.

However, GFP fluorescence result found from various tissues of the transgenic r ice transformed with each promoter is particularly different from the real time-qPCR res ult. This appears to be due to very different sensitivity among different types of analysi s. Thus, it is believed that GFP fluorescence result should be used only as a qualitativ e data indicating the promoter activity.