Technical field The present invention relates generally to methods and materials for use in the control of plant pod shattering to optimize efficiency in harvest of commercially valuable seed.

Background art The fruit of Arabidopsis, rapeseed and other Brassicaceae is a silique constituted of two valves, protecting the seeds, fused to a central replum by a specific tissue called valve margin {Ostergaard, 2009 #30} (Figure 1A). Valve margins differentiate into narrow stripes of cells consisting of a lignification layer (LL) and a separation layer (SL). This specialised structure facilitates fruit opening and the efficient release of the seeds: the SL secretes polygalacturonase enzymes to degrade cell walls and allow cell separation, while the LL is believed to provide tension to facilitate the opening mechanism {Petersen, 1996 #31KSpence, 1996 #67} {Mitsuda, 2008 #68}.

Shedding of seed (also referred to as "seed shatter" or "pod shatter") by mature pods before or during crop harvest is a universal phenomenon with crops that develop dry dehiscent fruits. Premature seed shatter results in a reduced seed recovery, which represents a problem in crops that are grown primarily for the seeds, such as oil- producing Brassica plants, particularly oilseed rape (Brassica napus). Such

unsynchronised pod shattering each year can lead to significant seed losses {Price, 1996 #49}.

It has been demonstrated that elucidation of genetic interactions in Arabidopsis can be exploited to manipulate seed dispersal in Brassica species {Ostergaard, 2006

#33}{Purugganan, 2009 #29} (Girin er a/., 2010, doi: 10.1 1 1 1/j.1365- 3 3X.2010.04244.x). These and other studies show that careful fine-tuning of the seed dispersal process is required in order to reduce losses.

The valve margin identity factors SHATTERPROOF (SHP1/2) and INDEHISCENT (IND) are involved in the differentiation of both LL and SL {Liljegren, 2004 #37} {Liljegren, 2000 #42}, whereas ALCATRAZ (ALC) is required for SL specification {Rajani, 2001 #43}.

FRUITFULL {FUL) and REPLUMLESS (RPL) genes, expressed respectively in the valves and in the replum, restrict the expression of valve margin identity genes to the valve margins {Ferrandiz, 2000 #41 ; Roeder, 2003 #39}.

WO2001/079517 relates to the control of fruit dehiscence using IND genes.

WO2009/068313 relates to Brassica plants comprising mutant IND alleles.

Despite the identification of these molecular factors, the precise role of valve margin identity genes, and therefore the set of genes that they control, remains to be elucidated.

Thus it can be seen that the characterisation of further genes or factors involved in the manipulation of plant pod shattering would provide a contribution to the art.

A poster describing a part of the work included in the present application was presented at the 20* International Conference on Arabidopsis Research in Edinburgh (United Kingdom) on 30 ^th June - 4 ^th July 2009.

Disclosure of the invention The present inventors have shown that IND transcriptionally activates the GA3ox-1 gene. In conjunction with the other findings described herein this suggests an important and hitherto unsuspected role for gibberellins in valve margin development.

In light of this disclosure there are provided novel methods and materials for the manipulation of plant pod shattering based around the manipulation of gibberellin levels.

Briefly, to investigate the role of IND in the patterning of valve margins, the inventors used a Dexamethasone (DEX) - inducible version of the IND gene translationally fused to the Glucocorticoid Receptor (GR) under the control of the CaMV35S promoter (35S::IND:GR) {Sorefan, 2009 #32}. Global transcriptomic profiling analysis comparing DEX-induced and non-induced plants was used to reveal putative targets of IND. The inventors observed that the gene GA3ox-1 was induced after 6h of DEX treatment compared with the internal control UBQ10 (Figure 1 B). This result was confirmed using quantitative PCR analysis (Figure 6A). The inventors then used cycloheximide to prevent de novo protein synthesis and therefore reveal immediate IND targets {Sablowski, 1998 #21}. The DEX treatment was still able to trigger the accumulation of GA3ox-1 mRNA without active translational machinery suggesting that GA3ox-1 is an immediate target of IND (Figure 6B).

To investigate whether this regulation is direct, the inventors performed a chromatin immunoprecipitation (ChIP) assay using the GR antibody followed by quantitative PCR analysis. GA3ox-1 was significantly enriched in DEX-induced 35S::IND:GR plants compared with no DEX control (Figure 1 C). This latter experiment shows that IND can directly bind the promoter of GA3ox-1 indicating that GA3ox-1 is a direct target of IND.

The expression of GA3ox-1 has been previously reported in flowers {Mitchum, 2006 #45} {Hu, 2008 #44}. In light of the findings described above Arabidopsis plants expressing the GUS reporter gene under the control of the promoter of GA3ox-1 were used to analyse this expression pattern in the fruit.

Examination of stage-15 gynoecia showed expression of GA3ox-1 in valve margins and septum (Figure 1 D-E). In light of the findings described above this expression pattern can be seen as consistent with previous observation that IND, which is expressed in valve margins {Liljegren, 2004 #37}, can directly bind the promoter of GA3ox-1.

To confirm that IND regulates the expression of GA3ox-1, the inventors analysed GA3ox- 1 expression in the ind-1 mutant background. As expected, the level of GA3ox-1 expression was significantly reduced in ind-1 but the expression remained comparable in the gynophore indicating that IND activates specifically the expression of GA3ox-1 in valve margins and septum (Figure 1 D). Taken together, these results show that IND is directly responsible for the expression of GA3ox-1 in medial tissues of the fruit, which include valve margins. Further evidence of the significance of gibberellins (GA) during fruit patterning and valve margin morphology is described hereinafter. These findings represent the first disclosure of a specific role of GA3ox-1 in fruit development and hence of GA in valve margin formation.

In summary, synthesis of the phytohormone gibberellin is a direct and necessary target of INDEHISCENT (IND), which specifies tissues required for fruit opening and seed dispersal. One of these tissues is the separation layer, whose development also requires the bHLH protein ALCATRAZ (ALC). In further experiments the inventors have also showed that ALC interacts directly with the DELLA transcriptional repressors, which are destabilised by gibberellin. Thus the gibberellin/DELLA pathway is a key component of the regulatory network that promotes fruit opening and seed dispersal.

Furthermore, the results suggest that the interaction between DELLA and bHLH proteins, previously shown to connect gibberellin and light responses, is a versatile regulatory module also used in tissue patterning.

This greater understanding of the differentiation of the tissues involved in mediating seed dispersal provides for novel methods of fine-tuning of the seed dispersal process in order to reduce losses. Thus the invention relates to improved methods and means for reducing seed shattering, or delaying seed shattering until after harvest, in plants grown for seed production. In certain aspects the release of plant seeds in such plants is achieved by manipulating the expression of GAs in said plant. In other aspects there are provided methods of controlling the release of plant seeds by manipulating the stability of the DELLA complexes in said plant, and in particular the binding (and inhibition) of ALC by DELLA.

Thus in one aspect there is provided a method of modifying tissue dehiscence in a plant such as to modify seed release therefrom,

which method comprises modifying the plant by either:

(i) altering the expression of a nucleic acid encoding an enzyme which is responsible for either biosynthesis or degradation or inactivation of gibberellins (GAs) in the tissue such as to alter the level of GAs in the tissue, or

(ii) altering expression of a gene encoding DELLA or an analog thereof in the tissue such as to alter the amount of said DELLA or DELLA analog in the tissue

While not wishing to be bound by theory, in the practice of the invention it is believed that in each case the altered level of GAs or DELLA or DELLA analog in the tissue causes a change in the interaction between DELLA and ALC, thereby altering the level of local active ALC, which thereby modifies the dehiscence characteristics of the tissue.

In the methods of the invention, the modification is preferably not one which alters the local auxin levels in the valve margin, as may occur in interventions based on the IND gene itself.

Preferably the tissue is a fruit. The method may be for controlling fruit opening or the susceptibility of a plant seed pod to release seeds contained therein, for example by reducing local expression of GAs in said plant's seed pods.

The method may also be used to modify fruit patterning. "Altered expression" in this context is compared with a reference plant and will generally be achieved by either:

(i) the introduction of a locally expressed heterologous nucleic acid into the plant, or an ancestor thereof, where the heterologous nucleic acid encodes said enzyme or DELLA or DELLA analog, or

(ii) the local production or introduction of a silencing agent capable of silencing expression of said enzyme or DELLA.

Examples of suitable enzymes responsible for either biosynthesis or degradation or inactivation of gibberellins (GAs) are described in more detail hereinafter. Purely for brevity these enzymes may be referred to herein as "target GA enzymes" and nucleic acids or genes encoding these enzymes may be referred to as "target GA nucleic acids".

DELLA proteins are GA signalling repressors whose functions are conserved in different plant species. Typically GA causes degradation of DELLA in order to exert its effects, in the present case in respect of fruit opening and seed dispersal. "DELLA" and "DELLA analogs" are described in more detail hereinafter. Example analogs may be those which are substantially degradation resistant.

Typically local expression or production can be achieved by a tissue specific promoter. In the methods described herein a preferred promoter is a dehiscence zone-selective regulatory element e.g. the IND promoter.

In the methods of the invention, the reference plant is one which lacks the respective modification or modifications. The altered level or amount of the recited compound in the tissue is likewise measured by reference to a plant which lacks the respective modification or modifications.

The "dehiscence characteristics of the tissue" can be measured and compared by use of the Random Impact Test, as exemplified by quantifying shatter-resistance in Arabidopsis fruits (see Material & methods for details in the Examples hereinafter). See also {Morgan, 1998 #71}, {Bruce, 2002 #72}. Both publications are hereby incorporated by reference. Briefly, a sample of intact mature pods is placed in a closed drum together with steel balls and the drum is then vigorously agitated for increasing periods of times (e.g. 10 s, 20 s, 40 s, 80 s). After each period, the drum is opened and the number of broken and damaged pods is counted. The most accurate estimation of the level of shattering resistance for each line is calculated by fitting a linear x linear curve to all the available data and estimating the time taken for half of the pods within a sample to be broken ("pod sample half-life" or "LD50"). It is important however that pods open mainly along the dehiscence zone, and are not simply pulverized, as may occur with indehiscent pods.

In one embodiment the modification of the tissue dehiscence characteristics is caused by altering the ability of the valve cells to separate from the replum. Preferably the method has the effect of changing the valve margin differentiation in the tissue and hence the formation of the lignification layer (LL) and\or 'separation layer ¹ (SL). Thus in some embodiments, the plant of the invention has reduced lignification in valve margin cells or a reduced SL. In these embodiments the change in the level of gibberellins or DELLA or DELLA analog takes place locally in the valve margin, and more preferably in the SL of the valve margin. The inventors have shown that local production of GA in valve margins is critical for the differentiation of this specialised tissue, and in particular to promote the differentiation of SL cells.

More specifically, prior to SL specification, it is believed that ALC is bound to DELLA proteins preventing activation of ALC's targets. When GAs are locally produced in valve margins, the DELLA proteins become degraded, thereby releasing ALC to modulate the expression of its targets and trigger the differentiation of the SL. ln this model, activation of ALC by GA biosynthesis occurs post-transcriptionally and not through regulation of ALC gene expression.

Thus the invention provides methods for generating plants in which seed shattering is reduced, or in which seed shattering is delayed until after harvest, while an agronomically relevant threshability of the pods is preferably maintained. The invention further provides seed pods and seeds obtainable from such plants.

The methods described herein can be used in conjunction with other methods in the art for modifying dehiscence or premature dehiscence.

Various aspects and embodiments of the invention are discussed in more detail hereinafter. Brief description of figures

Figure 1: GA3ox-1 is a direct target of IND

A. Structure of the silique of Arabidopsis.

B. Transcript profiling assay using 7 day-old 35::IND::GR seedlings before (-DEX) and after 6 hours of Dexamethasone treatment (+DEX) showing an increase of GA3ox-1 mRNA accumulation in response of DEX treatment compared with UBQ10 mRNA as internal control (n=3). Error bars represent standard deviation (SD).

C. Chromatin Immunoprecipitation showing the direct binding of IND::GR to GA3ox-1 gene. DNA obtained from pull-down with the GR antibody has been analysed by quantitative PCR using specific primers for the GA3ox-1 gene. Values correspond to the ratios between pull-down and input DNA, both initially normalised by Mu-like transposon. Values for four biological repeats are represented.

D-E. β-Glucuronidase expression of GA3ox-1 in young fruit (stage 15) in both whole amount and cross-section in wild type (WT) and ind-1 mutant background (ind-1). Figure 2 : Low GAs level plants have valve margin defects

A. Scanning Electronic Microscopy (SEM) images showing the base of Arabidopsis fruit (stage 17b) of WT, ind-1, ga4-1 and plND»GA2ox. Scale bar = 50pm.

B. Scanning Electronic Microscopy (SEM) images showing a close-up of valve margin and replum tissues. Pictures were taken in the middle of Arabidopsis fruit (stage 17b) of WT, ind-1, ga4-1 and plND»GA2ox. Scale bar = 50pm. C. Dehiscence quantification of WT, ind-1, ga4-1 and plND»GA2ox fruits. Values represent the mean of three biological repeat (n=3). Error bars represent standard deviation (SD) Figure 3 : Separation layer is specifically altered in low GAs level plants

A. Transmission Electronic Microscopy (TEM) images showing valve margin tissues (cross-section) of the WT and ga4-1 mutant. Left panel represents a scheme showing the different cell layer constituting wild type valve margins: separation layer (orange) and lignification layer (red). Scheme based on mPS-PI/Confocal picture. Scale bar = 10pm. B. Confocal microscopy images showing valve margin tissues (cross-section) after

Pseudo-Schiff propidium iodide (mPS-PI) staining of Arabidopsis fruit (stage 17b) of WT, alc-1, ga4-1, plND»GA2ox and alc-1 ga4-1 double mutant. Scale bar = 10μιτι.

C. Quantification of separation layer cell size of WT (n=38), alc-1 (n=46), ga4-1 (n=41), plND»GA2ox (n=34) and alc-1 ga4-1 double mutant (n=49). Error bars represent standard deviation (SD).

Figure 4 : Interaction between ALC and DELLA proteins

A. Yeast two-hybrid interaction using ALC as a bait and GAI, RGA and RGL2 as preys. To visualise the interaction, yeast were plated onto a selective medium SD-LWHA (-Leu Trp His Ade). SD-LW (-Leu Trp) medium was used as growth control. Dilution series were performed.

B. Quantification of the interaction between ALC and DELLA proteins. The β- Galacturonase activity calculated from yeast two-hybrid assay (n=4). Error bars represent standard deviation (SD).

Figure 5 : Model of DELLA-mediated control of ALC by IND to differentiate the separation layer in the valve margin formation.

IND controls the biosynthesis of GAs via the direct transcriptional activation of GA3ox-1 leading to GA biosynthesis. In the separation layer, without GAs, ALC interacts with DELLA proteins. Local production of GA, triggered by IND, leads to the proteasome dependent degradation of DELLA proteins. ALC is released and able to activate his own targets to specify the differentiation of the separation layer.

Figure 6: Ga3ox-1 is an immediate target of IND

A. Quantitative PCR analysis of GA3ox-1 mRNA accumulation using 7 day-old

35::IND::GR seedlings before (-DEX) and after 6 hours of Dexamethasone treatment (+DEX) showing an increase of GA3ox-1 mRNA accumulation in response of DEX treatment compared with UBQ10 mRNA as internal control (n=3). Error bars represent standard deviation (SD).

B. Quantitative PCR analysis of GA3ox-1 mRNA accumulation using 7 day-old

35::IND::GR seedlings before (-DEX) and after 2 hours of Dexamethasone treatment (+DEX) in presence of cycloheximide showing an increase of GA3ox-1 mRNA

accumulation in response of DEX treatment compared with UBQ10 mRNA as internal control (n=3). Error bars represent standard deviation (SD). Figure 7: Dehiscence quantification in WT ecotype Columbia (Col) and ga4-3 mutant

Values represent the mean of three biological repeat (n=3). Error bars represent standard deviation (SD). Figure 8: ALC expression is not altered in the ga4-1 mutant.

β-Glucuronidase expression of ALC at the base of Arabidopsis fruit (stage 17b) in WT and ga4-1.

Figure 9: The major GA Biosynthetic and Catabolic Pathways in Higher Plants. (From "Gibberellin Signaling" The Plant Cell (2002) Vol. 14, S61-S80, Neil Olszewski, Tai- ping Sun and Frank Gubler).

Detailed description of the preferred embodiments of the invention The methods described herein may preferably be used to "fine tune" seed release, which in a given plant or species may involve increasing or decreasing susceptibility to dehiscence or premature dehiscence. Valve margins patterning was recently shown to require formation of an IND-mediated auxin minimum {Sorefan, 2009 #32}. Here we show, that IND-promoted biosynthesis of GA is necessary for seed dispersal in

Arabidopsis and appears to function by releasing ALC from DELLA repression. The results reveal IND as a central coordinator of different hormonal pathways by directly regulating genes involved in both auxin and gibberellin homeostasis. Examination of the auxin response reporter, DR5rev::GFP in wild type and the IND»GA2ox GA-deficient background suggests that establishment of the auxin minimum is independent of GA biosynthesis (data not shown). Thus IND seemingly controls the specification of tissues required for seed dispersal in Arabidopsis by regulating at least two hormone-related pathways (auxin and GA).

The methods of the present invention may be applied to manipulate only one of these pathways i.e. the GA effected one. GA levels may themselves be manipulated through a number of target GA enzymes, allowing for a high degree of fine tuning to achieve optimum seed release, for example in crop plants. The use of degradation-resistant DELLA further enhances the degree of manipulation possible. Thus in one embodiment the method of the invention is employed to reduce the level of GAs or increase the level of DELLA or a DELLA analog which is degradation-resistant. This can inhibit ALC-mediated dehiscence of the tissue.

In certain embodiments the methods described herein are employed to delay seed dispersal. The term "delayed" as used herein in reference to the timing of seed dispersal in a fruit produced by a modified plant of the invention, means a significantly later time of seed dispersal as compared to the time seeds normally are dispersed from a reference plant which has not been so modified. The delay may be indefinitely. The delay is preferably measured by use of a population of plants in each case to allow for the natural variation of the time of seed dispersal within a plant species or variety.

Those skilled in the art will appreciate that, in principle, the level of GAs may be reduced by:

(i) increasing expression of a nucleic acid encoding an enzyme which is responsible for biosynthesis of GAs e.g. by introduction of a heterologous nucleic acid, and\or

(ii) decreasing expression of a nucleic acid encoding an enzyme which is responsible for degradation or inactivation of GAs e.g. by introduction of an appropriate silencing agent. Clearly the level of GAs may be increased by the opposite intervention(s).

Those skilled in the art will appreciate that increasing the level of DELLA or a DELLA analog which is degradation-resistant may be achieved by increasing expression of a nucleic acid encoding said DELLA or analog e.g. by introduction of a heterologous nucleic acid, Thus in this embodiment the method may be used to reduce pod shattering or premature dehiscence or increase shatter resistance.

Gibberellins and related enzymes

As is well known "gibberellins" are plant phytohormones. As described herein, GAs are necessary for valve margin formation and the separation layer is specifically affected in plants with low GAs level. The biosynthesis and catabolism of GAs have been well established in the art, and are reviewed, for example in "Gibberellin Signaling" The Plant Cell (2002) Vol. 14, S61 -S80, Neil Olszewski, Tai-ping Sun and Frank Gubler the entire content of which is explicitly incorporated herein by reference. Figure 9 is reproduced from Olszewski et al and shows the major GA Biosynthetic and Catabolic Pathways in Higher Plants. The enzyme names are shown in boldface below or to the right of each arrow. GA9 and GA20 also can be converted to GA51 and GA29 by GA2ox. GA4 and GA1 are the bioactive GAs, and GA34 and GA8 are their inactive catabolites.

Here, we show that IND can transcriptionally activate the GA3ox-1 gene suggesting a new role for gibberellins in valve margin development.

GA3ox-1 is a member of Gibberellin 3 Oxidase family that encode the last enzymes in the biosynthetic pathway of bioactive gibberellins (GAi and GA ₄ ) {Talon, 1990 #46}. GA is an important regulator of growth and development (review in {Hedden, 2000 #58}. {Sun, 2004 #57} {Yamaguchi, 2008 #59}). GA-deficient mutants are well characterised and result in dwarf, dark-green plants with short floral organs {Goto, 1999 #60} strongly suggesting that GAs have a role in floral organ development. Furthermore, GA3ox-1 has also been identified as a direct target of AGAMOUS (AG), a MADS-Box TF required for floral differentiation. Activation of GA3ox-1 by AG suggests that AG can induce GA biosynthesis during organogenesis and underlie its important role in flower development {Gomez-Mena, 2005 #12}. To investigate the precise role of GA during fruit patterning, we analysed valve margin morphology and functionality in the ga4-1 mutant. This mutant contains an E S-induced mutation in the coding sequence of GA3ox-1 {Koornneef, 1980 #61} {Chiang, 1995 #69} and has reduced levels of bioactive GAs in both shoot and rosette {Talon, 1990 #46}. Scanning Electron Microscopy (SEM) images showed that valve margins were not properly defined in the ga4-1 mutant compared with the wild type (Figure 2A-B). Wild-type valve margins are composed of narrow cells defining the border between the replum and the valve. In the ga4-1 mutant, this invagination was not visible and the limit between the replum and the valve was not clearly defined. This phenotype resembles the defect observed in ind-1 mutant where valve margins are absent {Liljegren, 2004 #37}. One caveat of using GA-deficient mutants to infer the role of GA in fruit patterning is that even the most severe GA-biosynthesis mutants still produce low level of GA {Hedden, 2000 #55}. For this reason, we locally depleted GAs in valve margins by expressing GA2ox-2, an enzyme which inactivates bioactive GAs, under the control of the IND promoter (plND»GA2ox). Consistent with the results observed previously with ga4-1, we also observed valve margin defects in these plants (Figure 2A-B) indicating that the local production of GA in valve margins is critical for the differentiation of this specialised tissue.

To investigate whether the observed valve margin defects affects opening of the fruits, we developed a Random Impact Test for quantifying shatter-resistance in Arabidopsis fruits. Shattering measurements of fruits revealed that both the ga4-1 mutant and the plND»GA2ox transgenic line were more resistant to dehiscence than the Landsberg erecta wild-type which is too sensitive for the assay to obtain a value above zero. These lines were still less resistant than the ind-1 mutant where fruits never opened during the analysis (Figure 2C). The shatter-resistant phenotype was confirmed using another mutant allele for GA3ox-1, the ga4-3 mutant in a Columbia background (Figure 7).

Interestingly, plND»GA2ox transgenic line where GAs were depleted from valve margin, showed a stronger shattering resistance than the ga4-1 mutant, indicating that other enzymes producing GA might be involved in this process and that local GA levels at the valve margin is important for proper tissue specification. Taken together, these results show that local production of gibberellins promoted by IND is required for the

differentiation of functional valve margins.

To further understand the role of GAs at the cellular level in valve margin formation, we performed cross sections of fruits and used Transmission Electron Microscopy (TEM) to examine valve margin tissue. ln wild-type fruits, lignification layer (LL) and separation layer (SL) were clearly recognisable: LL cells exhibited thick cell walls, whereas SL cells were small and non- lignified (Figure 3A) as previously described {Rajani, 2001 #43} {Wu, 2006 #47}. Small SL cells were located underneath the constriction point responsible for the valve margin invagination and were found directly adjacent to the lignification layer.

In the ga4-1 mutant, cells forming the SL could not be identified. Instead, big cells resembling replum cells were found adjacent to the LL. The valve margin defect observed in the ga4-1 mutant background is thus due to the lack of a proper SL, whereas the LL appears to be unaffected compared to wild type (Figure3A). Since IND is involved in the formation of both SL and LL {Liljegren, 2004 #37}, this result may explain why ga4-1 fruits were less affected in fruit dehiscence than ind-1 fruits. This ability to "fine tune" the fruit dehiscence is potentially of great utility, where it is desired to optimize the timing of this event in the context of harvesting and storage.

Thus the method may involve locally expressing or down-regulating any of these enzymes which are responsible for biosynthesis or degradation or inactivation of gibberellins (GAs).

Preferred enzymes responsible for biosynthesis of GAs include the following, and their orthologues or homologues from other plant species, especially Brassicaceae. Where it is desired to reduce GAs, these enzymes may be down-regulated.

1) Enzymes with gibberellin 3 β-hydroxylase activity. These enzymes catalyse the hydroxylation of both GA9 and GA20. Examples include (with encoding Arabidopsis gene): GA3ox1 : AT1 G15550

GA3ox2: AT1G80340

GA3ox3: AT4G21690

2) Enzymes with GA 20-oxidase activity. These enzymes convert GA12 inter alia into GA9. Examples include (with encoding Arabidopsis gene): GA20ox1 : AT4G25420

GA20ox2: AT5G51810

YAP169 (GA 20-oxidase): AT5G07200

GA20ox4: AT1G60980

GA20ox5: AT1G44090

3) Enzymes which catalyse the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of GA biosynthesis. An example includes (with encoding Arabidopsis gene):

GA1 (ent-copalyl diphosphate synthase): AT4G02780

4) Enzymes which have ent-kaurene synthase B activity which catalyse the second step in the cyclization of GGPP to ent-kaurene in the GA biosynthetic pathway. An example includes (with encoding Arabidopsis gene):

GA2 (ent-kaurene synthase): AT1G79460

5) Enzymes are members of the CYP701A cytochrome p450 family that is involved in later steps of the GA biosynthetic pathway. An example includes (with encoding

Arabidopsis gene):

GA3 (ent-kaurene oxidase): AT5G25900 Preferred enzymes responsible for inactivation of GAs include the following, and their orthologues or homologues from other plant species, especially Brassicaceae. Where it is desired to reduce the level of active GAs, these enzymes may be expressed or up- regulated. 1) Enzyme which have GA-inactivating GA2-oxidase activity. Examples include (with encoding Arabidopsis gene):

GA20X1: AT1G78440

GA20X2: AT1G30040

GA20X3: AT2G34555

GA20X4: AT1G47990 GA20X6: AT1 G02400

Preferred embodiments include: · Inhibiting local expression of GA3ox-1 or GA1 , for example by use of a silencing agent. This will reduce local biosynthesis of gibberellins.

• Increasing local expression of GA20X2. This will lead to local degradation, or inactivation of bioactive gibberellins

General methods for causing or increasing local expression of a gene, or the local production or introduction of a silencing agent, are described below.

In the investigation described herein it was noted that the valve margin phenotype of ga4- 1 resembles the alc-1 phenotype described by Rajani et al. (2001 ) and accordingly alc-1 was included in the analysis. We then used a modified Pseudo-Schiff propidium iodide (mPS-PI) staining technique combined with confocal laser scanning microscopy {Truernit, 2008 #51} to perform optical cross-section of Arabidopsis fruits. Using this technique, the SL is visible as a layer of small thin-walled cells in wild type adjacent to the LL (Figure 3B). In contrast, SL in the alc-1 mutant is not differentiated and big cells are located close to the lignified tissue as previously described {Rajani, 2001 #43}. Furthermore, towards the inner valve margin a bridge of lignified cells between the valves and the replum is formed which likely provides additional resistance to fruit opening {Rajani, 2001 #43}. The images in Figure 3B also show that the invagination formed at the surface of wild-type fruits is much reduced in the alc-1 mutant as well as in the ga4-1 mutant and

plND»GA2ox trangenic line (Figure3B), thereby confirming the valve margin defect observed by SE . In both genotypes, cells of the presumptive SL were bigger in size than wild-type SL cells, which is in agreement with the result obtained by TEM. Using this mPS-PI technique, we measured the size of the cells directly adjacent to the lignification layer in wild type, alc-1, ga4-1 and the plND»GA2ox transgenic line. This analysis showed that alc-1, ga4-1 and plND»GA2ox have significantly bigger cells at the site of separation than wild type (Figure 3C).

Taken together, these results show that the size of SL cells is altered in plants with reduced GA biosynthesis similar to the defect in alc-1 mutants {Rajani, 2001 #43} and represent a novel role for GAs in the control of fruit patterning. GAs have been hypothesised to play a crucial role in regulating cell expansion and promoting cell division in carpels after fertilisation {Vivian-Smith, 1999 #52}. Here, we show that local GA production in the valve margins are required to promote the differentiation of SL cells. Therefore we hypothesise that GA is controlling cell division in the developing valve margin. Furthermore, the size of SL cells in ga4-1 and

plND»GA2ox transgenic line resembles the size of SL cells in alc-1 (Figure 3B). The similar phenotypes observed in the ga4-1 and alc-1 mutants suggest an epistatic relationship in which ALC and GA3ox-1 would act in the same pathway to control SL differentiation. This was confirmed by generating the double alc-1 ga4-1 mutant. The size of SL cells in alc-1 ga4-1 double mutant is not significantly different from SL cell size of alc-1 and ga4-1 single mutants (Figure 3B). These data indicate that ALC and GA3ox-1 are involved in the same pathway to control the differentiation of SL cells. DELLA and analogs thereof

ALC is a bHLH transcription factor belonging to group VII according to the bHLH classification described by Heim ef a/., 2003. This group also contains the

PHOTOCHROME INTERACTING FACTORS (PIF) 3 and PIF 4. In the absence of GA, PIF transcription factors are prevented from activating their targets through interaction via their DNA-interaction domain with the growth-repressing DELLA proteins, whereas the presence of GA will relieve this inhibition {de Lucas, 2008 #53} {Feng, 2008 #54}.

Interestingly, ALC, PIF3 and PIF4 share the same H-E-R motif in their DNA-interaction domain {Heim, 2003 #70}. To test if ALC could be regulated in a similar manner, we analysed the potential interaction of ALC with DELLA proteins. Using yeast 2-hybrid, we demonstrated that ALC can interact with the Arabidopsis DELLA proteins GAI, RGA and RGL2 (Figure 4A-B). Furthermore, GAI, RGA and RGL2 are expressed in flowers and siliques {Lee, 2002 #74}. Taken together, these observations support the following model for GA-mediated specification of SL in Arabidopsis (Figure 5) where IND directly activates the expression of GA3ox-1 in valve margins and subsequently the production of bioactive GAs in this tissue. Prior to SL specification, we believe that ALC is bound to DELLA proteins preventing activation of its targets. When GAs are locally produced in valve margins, the DELLA proteins become degraded, thereby releasing ALC to modulate the expression of its targets and trigger the differentiation of the SL. In this model, activation of ALC by GA biosynthesis occurs post-transcriptionally and not through regulation of ALC gene expression. To test if this is the case, we analysed the ALC expression pattern in the ga4- 1 mutant (Figure 8). No alterations in ALC expression was observed in the ga4-1 mutant background consistent with our hypothesis that GAs control ALC at a post-transcriptional level.

The results herein suggest that a GA DELLA pathway is an important component of the regulatory network controlling fruit opening and seed dispersal. Feng et al., 2008 and de Lucas et al., 2008 demonstrated that the interaction between DELLA and PIF3/PIF4 transcription factors coordinated light and gibberellins responses. These authors hypothesised that interactions between DELLA and bHLH transcription factors might constitute a broader way of control of the activity of the latter. Indeed, two other bHLH TF, PIL5 and SPT, have been involved in light and GA signalling {Oh, 2007 #66} {Penfield, 2005 #65} making them potential targets for DELLA repressors. Here we suggest that this DELLA/bHLH pathway is involved in fruit patterning as well. This system could therefore represent a general mode of repression/activation for plant bHLH transcription factors

The system described above thus has implications for the use of DELLA protein or analogs in manipulating ALC activity in valve margins, and hence the triggering of differentiation of the SL.

Examples of DELLA proteins (with encoding Arabidopsis gene) include:

GAI: AT1 G14920

RGA: AT2G01570

RGL1 : AT1G66350

RGL2: AT3G03450

RGL3. AT5G 17490

GA-resistant forms of DELLA proteins are known that function as dominant repressors of GA mediated processes. These have been used, for example, as dwarfing alleles in wheat (Triticum aestivum; e.g. Rht-B1 b and Rht-D1 b).

Most dominant DELLA repressors contain N-terminal mutations which prevent their degradation such that they retain their repressor functions while accumulating to relatively (compared to wild-type) high levels, even in the presence of GA. Other DELLA variants are known which contain changes at the C-terminal domain of the DELLA protein (Brrga1-d; see Muangprom et al, Plant Physiology, March 2005, Vol. 137, pp. 931-938) which also resist degradation.

For brevity all of these DELLA analogs may be referred to herein as "degradation resistant".

Thus in preferred embodiments, the invention comprises causing or increasing local expression of a DELLA analog which is degradation resistant. General methods for causing or increasing local expression of a gene, for example encoding DELLA or a DELLA analog, are described below.

General methods & transformation As described above in various aspects of embodiments of the invention, it may be desired to introduce into a plant a heterologous nucleic acid, or to produce a transgenic plant encoding that nucleic acid.

For example the invention provides a method for modifying tissue dehiscence in a plant such as to modify seed release therefrom, by causing or allowing expression of a heterologous nucleic acid sequence as discussed above.

The step may be preceded by the earlier step of introduction of the nucleic acid into a cell of the plant or an ancestor thereof i.e. transforming at least one plant cell with a recombinant DNA construct comprising a nucleic acid sequence encoding the relevant protein and regenerating a transgenic plant from the transformed cell. The pods or fruits of such a plant may demonstrate reduced pod shattering or premature dehiscence, or increased shatter resistance. Those skilled in the art will appreciate that nucleic acid can be transformed into plant cells, which can be regenerated, using any suitable technology. Transformation of Arabidopsis, which is paradigmatic of many other plant species, is demonstrated in more detail in the Examples hereinafter, and employs an Agrobacterium strain and suitable vectors, such as are well known to those skilled in the art - see, for example Horsch et al. Science 233: 496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80: 4803 (1983). The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practising the invention with a particular methodology of choice. It will be apparent to the skilled person that the particular choice of a transformation system to introduce nucleic acid into plant cells is not essential to or a limitation of the invention, nor is the choice of technique for plant regeneration.

Nucleic acids

A nucleic acid of the present invention may include one of the nucleotide sequences described herein (e.g. encoding a target GA enzyme which causes inactivation of bioactive GAs or DELLA analog which is degradation resistant) within the cells of the plants.

Nucleic acid molecules according to the present invention may be provided, isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free, or substantially free, of other nucleic acids of the species of origin. Where used herein, the term "isolated" encompasses all of these possibilities.

The nucleic acid molecules may be wholly or partially synthetic. In particular they may be recombinant in that nucleic acid sequences which are not found together in nature (do not run contiguously) have been ligated or otherwise combined artificially. Preferred nucleic acids consist essentially of the gene in question, optionally in an expression vector as described in more detail below.

Nucleic acid according to the present invention may include cDNA, RNA, genomic DNA and modified nucleic acids or nucleic acid analogs. Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed. Where a nucleic acid of the invention is referred to herein, the complement of that nucleic acid will also be embraced by the invention. The 'complement' of a given nucleic acid (sequence) is the same length as that nucleic acid (sequence), but is 00% complementary thereto. Where genomic nucleic acid sequences of the invention are disclosed or referred to, nucleic acids comprising any one or more (e.g. 2) introns or exons from any of those sequences are also embraced. A nucleic acid of the present invention may encode one of the amino acid sequences described or referred to herein e.g. be degeneratively equivalent to the corresponding nucleotide sequences.

Nucleic acids may be variants of any particular sequence referred to, provided they share the biological activity thereof e.g. encoding an enzyme having the required activity, or encoding a promoter with the appropriate specificity.

Variants of the present invention can be artificial nucleic acids (i.e. containing sequences which have not originated naturally) which can be prepared by the skilled person in the light of the present disclosure. Alternatively they may be novel, naturally occurring, nucleic acids from species, which may be isolatable using the sequences of the present invention.

Thus a variant may be a distinctive part or fragment (however produced) corresponding to a portion of the sequence provided. The fragments may encode particular functional parts of the polypeptide.

Also included are nucleic acids which have been extended at the 3' or 5' terminus. Artificial variants (derivatives) may be prepared by those skilled in the art, for instance by site-directed or random mutagenesis, or by direct synthesis. Preferably the variant nucleic acid is generated either directly or indirectly (e.g. via one or amplification or replication steps) from an original nucleic acid having all or part of the sequences of the first aspect. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis (see above discussion in respect of variants), sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992. The term "variant" nucleic acid as used herein encompasses all of these possibilities. When used in the context of polypeptides or proteins it indicates the encoded expression product of the variant nucleic acid. Some of the aspects of the present invention relating to variants will now be discussed in more detail.

"Percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i. e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 25% sequence identity. Alternatively, percent identity can be any integer from 25% to 100%. More preferred embodiments include at least: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters (in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wl), or by inspection.

In a further aspect of this part of the invention there is disclosed a method of producing a derivative nucleic acid comprising the step of modifying the coding sequence of a nucleic acid of the present invention described above.

Changes to a sequence, to produce a derivative, may be by one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more amino acids in the encoded polypeptide. Changes may be desirable for a number of reasons, including introducing or removing the following features: restriction endonuclease sequences; codon usage; other sites which are required for post translation modification; cleavage sites in the encoded polypeptide; motifs in the encoded polypeptide (e.g. binding sites). Leader or other targeting sequences may be added or removed from the expressed protein to determine its location following expression. All of these may assist in efficiently cloning and expressing an active polypeptide in recombinant form.

Other desirable mutations may be generated by random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide. Changes may be by way of conservative variation, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine. As is well known to those skilled in the art, altering the primary structure of a polypeptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides conformation.

Also included are variants having non-conservative substitutions. As is well known to those skilled in the art, substitutions to regions of a peptide which are not critical in determining its conformation may not greatly affect its activity because they do not greatly alter the peptide's three dimensional structure.

Vectors In one aspect of the present invention, the nucleic acid described above is in the form of a recombinant and preferably replicable vector. "Vector" is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic hosts either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication). Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eucaryotic (e.g. higher plant, yeast or fungal cells). A vector including nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome. Generally speaking, those skilled in the art are well able to construct vectors and design protocols for recombinant gene expression. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al, 1989, Cold Spring Harbor Laboratory Press (or later editions of this work). For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosluforon or Basta.

Of particular interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148).

Promoters and regulatory elements

Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. bacterial, or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.

By "promoter" is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA). "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.

The term "inducible" as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on" or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. "Tissue specific" promoters are those which are active only in certain tissues (or parts of tissues) of the plant.

A preferred promoter is a "dehiscence zone-selective regulatory element". Examples of such promoters are known in the art and are described, for example, in WO2001/079517. As described therein, such nucleotide sequences, when operatively linked to a nucleic acid molecule, confer selective expression upon the operatively linked nucleic acid molecule in a limited number of plant tissues, including the valve margin or dehiscence zone. The valve margin is the future site of the dehiscence zone and encompasses the margins of the outer replum as well as valve cells adjacent to the outer replum. The dehiscence zone, which develops in the region of the valve margin, refers to the group of cells that separate during the process of dehiscence, allowing valves to come apart from the replum and the enclosed seeds to be released. Thus, a dehiscence zone-selective regulatory element, as defined herein, confers selective expression in the mature dehiscence zone, or confers selective expression in the valve margin, which marks the future site of the dehiscence zone.

A dehiscence zone-selective regulatory element can confer specific expression exclusively in cells of the valve margin or dehiscence zone or can confer selective expression in a limited number of plant cell types including cells of the valve margin or dehiscence zone.

Examples include promoters of SHP1 and SHP2 promoters, and the IND promoter. As noted above, variants of the natural sequences may be used provided the promoters remain dehiscence zone-selective. The Arabidopsis INDEHISCENT gene promoter locus is found at At4g00120.1 and is described on the Arabidopsis Information Resource (TAIR) database.

Sequence Annex 1 describes a 2805 bp sequence of the IND promoter is known to contain the necessary information for valve margin specificity (Girin et al. (2010) Plant Journal, doi: 10.1111/j.1365-313X.2010.04244.x).

Thus this aspect of the invention provides a gene construct, preferably a replicable vector, comprising a promoter, for example the IND promoter or other suitable specific promoter described herein, operatively linked to a nucleotide sequence described herein such as one encoding an enzyme which inactivates bioactive GAs, or which encoded degradation-resistant DELLA.

Host cells and plants

The present invention also provides methods comprising introduction of such a construct into a host cell, particularly a plant cell.

In a further aspect of the invention, there is disclosed a host cell containing a

heterologous construct according to the present invention, especially a plant or a microbial cell. The term "heterologous" is used broadly in this aspect to indicate that the gene/sequence of nucleotides in question (e.g. encoding a GA target enzyme, or DELLA analog) have been introduced into said cells of the plant or an ancestor thereof, using genetic engineering, i.e. by human intervention. A heterologous gene may replace an endogenous equivalent gene, i.e. one which normally performs the same or a similar function, or the inserted sequence may be additional to the endogenous gene or other sequence.

Nucleic acid heterologous to a plant cell may be non-naturally occurring in cells of that type, variety or species. Thus the heterologous nucleic acid may comprise a coding sequence of or derived from a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant. A further possibility is for a nucleic acid sequence to be placed within a cell in which it or a homolog is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression.

The host cell (e.g. plant cell) is preferably transformed by the construct, which is to say that the construct becomes established within the cell, altering one or more of the cell's characteristics and hence genotype.

Thus a further aspect of the present invention provides a method of transforming a plant cell involving introduction of a construct as described above into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the present invention into the genome.

The invention further encompasses a host cell transformed with nucleic acid or a vector according to the present invention especially a plant or a microbial cell. In the transgenic plant cell (i.e. transgenic for the nucleic acid in question) the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.

Plants which include a plant cell according to the inventions described above are also provided.

In addition to the regenerated plant, the present invention embraces all of the following: a clone of such a plant, selfed or hybrid progeny and descendants (e.g. F1 and F2 descendants) and any part of any of these. The invention also provides parts of such plants e.g. any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed, fruit, ovules, pollen, pistols, flowers, or any embryonic tissue. Any of these may be a commodity per se. As used herein, "plant part" includes seed pods, seed meal, seed cake, seed fats or oils. Plants of the invention may be dehiscent seed plants characterized by having

modifying tissue dehiscence and modified (preferably delayed) seed release. Methods of reducing expression

In certain embodiments of the invention, it may be desired to reduce expression of a gene e.g. by inhibiting transcription or translation. This may be the case, for example, where it is desired to locally reduce the activity of a gene involved in GA biosynthesis.

This can be achieved, for example, by use of RNAi specific for the (by way of non-limiting example) GA target gene. In summary, as exemplified above, and without limitation, the invention provides in various aspects:

• A method of locally inhibiting GA production in the valve margin region of a plant such as to inhibit valve margin differentiation and hence the formation of the Hgnification layer (LL) and\or 'separation layer' (SL). This may be achieved by use of a nucleic acid sequence capable of silencing or down-regulating a gene which encodes an enzyme responsible for GA biosynthesis.

• Methods, materials and processes for achieving the same, optionally in

conjunction with other modifications affecting tissue dehiscence.

· Isogenic or transgenic plants obtained by said processes.

Without limitation, the nucleic acid sequence capable of silencing or downregulating the gene, may be selected as follows: In using anti-sense genes or partial gene sequences to down-regulate gene expression, a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene. See, for example, Rothstein et al, 1987; Smith et a/,(1988) Nature 334, 724-726; Zhang et a/,(1992) The Plant Cell 4, 1575-1588, English et al., (1996) The Plant Cell 8, 179-188. Antisense technology is also reviewed in Bourque, (1995), Plant Science 105, 125-149, and Flavell, (1994) PNAS USA 91 , 3490- 3496.

An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same, orientation as the target gene, to achieve reduction in expression of the target gene by co-suppression. See, for example, van der Krol et al., (1990) The Plant Cell 2, 291-299; Napoli ef a/., (1990) The Plant Cell 2, 279-289; Zhang ef a/., (1992) The Plant Cell 4, 1575-1588, and US-A-5,231 ,020. Further refinements of the gene silencing or co-suppression technology may be found in W095/34668 (Biosource); Angell & Baulcombe (1997) The EMBO Journal 16,12:3675-3684; and Voinnet & Baulcombe (1997) Nature 389: pg 553.

Anti-sense or sense regulation may itself be regulated by employing an inducible promoter in an appropriate construct. In the present context this is preferably the IND promoter.

Double stranded RNA (dsRNA) has been found to be even more effective in gene silencing than both sense or antisense strands alone (Fire A. et al Nature, Vol 391 , (1998)). dsRNA mediated silencing is gene specific and is often termed RNA interference (RNAi) (See also Fire (1999) Trends Genet. 15: 358-363, Sharp (2001) Genes Dev. 15: 485-490, Hammond et al. (2001 ) Nature Rev. Genes 2: 11 10-1 119 and Tuschl (2001 ) Chem. Biochem. 2: 239-245).

RNA interference is a two step process. First, dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23nt length with 5' terminal phosphate and 3' short overhangs (~2nt) The siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001 )

Thus one embodiment of the invention utilises double stranded RNA comprising a sequence from part of the target gene, which may for example be a "long" double stranded RNA (which will be processed to siRNA, e.g., as described above). These RNA products may be synthesised in vitro, e.g., by conventional chemical synthesis methods.

RNAi may be also be efficiently induced using chemically synthesized siRNA duplexes of the same structure with 3'-overhang ends (Zamore PD et al Cell, 101 , 25-33, (2000)). Synthetic siRNA duplexes have been shown to specifically suppress expression of endogenous and heterologeous genes in a wide range of mammalian cell lines (Elbashir SM. et al. Nature, 41 1 , 494-498, (2001 )).

In one embodiment, the vector may comprise a nucleic acid sequence in both the sense and antisense orientation, such that when expressed as RNA the sense and antisense sections will associate to form a double stranded RNA. This may for example be a long double stranded RNA (e.g. , more than 23nts) which may be processed in the cell to produce siRNAs (see for example Myers (2003) Nature Biotechnology 21:324-328).

Alternatively, the double stranded RNA may directly encode the sequences which form the siRNA duplex, as described above. In another embodiment, the sense and antisense sequences are provided on different vectors.

Another methodology known in the art for down-regulation of target sequences is the use of "microRNA" (miRNA) e.g. as described by Schwab et al 2006, Plant Cell 18, 1 121- 1133. This technology employs artificial miRNAs, which may be encoded by stem loop precursors incorporating suitable oligonucleotide sequences, which sequences can be generated using well defined rules in the light of the disclosure herein. Thus, for example, in one aspect there is provided a nucleic acid encoding a stem loop structure including a sequence portion of the target gene of around 20-25 nucleotides, optionally including one or more mismatches such as to generate miRNAs (see e.g.

http://wmd.weigelworld.org/bin/mirnatools.pl). Such constructs may be used to generate transgenic plants using conventional techniques.

These vectors and RNA products may be useful for example to inhibit de novo production of the target enzyme. They may be used analogously to the expression vectors in the various embodiments of the invention discussed herein.

Another means of inhibiting enzyme function in a plant is by creation of dominant negative mutations. In this approach, non-functional, mutant target GA enzyme polypeptides, are introduced into a plant. A dominant negative construct also can be used to suppress target GA enzyme expression in a plant.

Non-GM aspects Much of the foregoing discussed has been concerned with the genetic modification of plants by use of artificial recombinant nucleic acids. However the disclosure of the relevance of target GA enzymes and genes to tissue dehiscence also provides novel methods of plant breeding and selection, for instance to manipulate tissue dehiscence and seed release. A further aspect of the present invention provides a method for assessing the tissue dehiscence phenotype of a plant, the method comprising the step of determining the presence and/or identity of a GA-biosynthesis modifying allele therein. The method will employ a nucleic acid as described herein e.g. encoding all or part of a GA target enzymes. Such a diagnostic test may be used with transgenic or wild-type plants, and such plants may or may not be mutant lines e.g. obtained by mutagenesis.

As used herein, the term "allele(s)" means any of one or more alternative forms of a gene at a particular locus. Alleles of a given gene are located at a specific location or locus. As used herein, the term "locus" means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found.

"Mutagenesis", as used herein, refers to the process in which plant cells are subjected to a technique which induces mutations in the DNA of the cells. Such methods are well known to those skilled in the art, and their use per se does not form part of the present invention. Examples of mutagenic techniques are described in WO2009/068313 and include contact with a mutagenic agent, such as a chemical substance (such as ethylmethylsulfonate (EMS), ethylnitrosourea (ENU), etc.) or ionizing radiation (neutrons (such as in fast neutron mutagenesis, etc.), alpha rays, gamma rays (such as that supplied by a Cobalt 60 source), X-rays, UV-radiation, etc.), or a combination of two or more of these.

Following mutagenesis, plants are regenerated from the treated cells using known techniques (see e.g. Coventry et al. (1988, Manual for Microspore Culture Technique for Brassica napus. Dep. Crop Sci. Techn. Bull. OAC Publication 0489. Univ. of Guelph, Guelph, Ontario, Canada). Additional seed that is formed as a result of such self- pollination in the present or a subsequent generation may be harvested and screened for the presence of mutant GA target gene alleles. Several techniques are known to screen for specific mutant alleles, e.g., Deleteagene™ (Delete-a-gene; Li et al, 2001 , Plant J 27: 235-242) uses polymerase chain reaction (PCR) assays to screen for deletion mutants generated by fast neutron mutagenesis (reviewed by Li and Zhang, 2002, Funct Integr Genomics 2:254-258), TILLING (targeted induced local lesions in genomes; McCallum et al., 2000, Nat Biotechnol 18:455-457) identifies EMS-induced point mutations, etc. More specifically TILLING combines chemical mutagenesis with mutation screens of pooled PCR products, resulting in the isolation of missense and nonsense mutant alleles of the targeted genes (here: GA targer genes). TILLING has two significant advantages over existing plant gene knock-out tools: first, it is applicable to any plant since it does not require transgenic or cell culture manipulations. Second, it produces an allelic series of mutations including hypomorphic alleles that are useful for genetic analysis. The TILLING technology can also be used to discover and survey natural variation (known as

Ecotilling; see Henikoff et al. 2004, Plant Physiology 135(2):630-6).

GA target gene mutants obtained and identified in this fashion may have modified tissue dehiscence and modified (preferably delayed) seed release.

The use of diagnostic tests for alleles allows the researcher or plant breeder to establish, with full confidence and independent from time consuming biochemical tests, whether or not a desired allele is present in the plant of interest (or a cell thereof), whether the plant is a representative of a collection of other genetically identical plants (e.g. an inbred variety or cultivar) or one individual in a sample of related (e.g. breeders' selection) or unrelated plants.

The present disclosure provides sufficient information for a person skilled in the art to obtain genomic DNA sequence for any given new or existing allele (e.g. the various homologues discussed above) and devise a suitable nucleic acid- and/or polypeptide- based diagnostic assay. DNA genomically linked to the alleles may also be sequenced for flanking markers associated with the allele. The sequencing polymorphisms that may be used as genetic markers may, for example, be single nucleotide polymorphisms, multiple nucleotide polymorphisms or sequence length polymorphisms. The

polymorphisms could be detected directly from sequencing the homologous genomic sequence from the different parents or from indirect methods of indiscriminately screening for visualizable differences such as CAPs markers or DNA HPLC.

In designing a nucleic acid assay account is taken of the distinctive variation in sequence that characterises the particular variant allele.

For example GA target genes can be used in marker assisted selection programmes to generate plants in which seed shattering is reduced, or in which seed shattering is delayed until after harvest. Thus in one embodiment of the present invention, a method is described which employs the use of DNA markers derived from or associated with GA target genes as described herein that segregate with delayed tissue dehiscence phenotypes. In one embodiment of this method, the use of the DNA markers, or more specifically markers known as flanking QTLs (quantitative trait loci) are used to select the genetic combination in plants such as Brassicas that leads to optimized seed release.

Thus aspects of the invention embrace the selective delay in tissue dehiscence in relevant (e.g. cruciferous) crop species.

In a breeding scheme based on selection and selfing of desirable individuals, nucleic acid or polypeptide diagnostics for the desirable allele or alleles in high throughput, low cost assays, reliable selection for the preferred genotype can be made at early generations and on more material than would otherwise be possible. This gain in reliability of selection plus the time saving by being able to test material earlier and without costly phenotype screening is of considerable value in plant breeding.

Nucleic acid-based determination of the presence or absence of one or more desirable alleles may be combined with determination of the genotype of the flanking linked genomic DNA and other unlinked genomic DNA using established sets of markers such as RFLPs, microsatellites or SSRs, AFLPs, RAPDs etc. This enables the researcher or plant breeder to select for not only the presence of the desirable allele but also for individual plant or families of plants which have the most desirable combinations of linked and unlinked genetic background. Such recombinations of desirable material may occur only rarely within a given segregating breeding population or backcross progeny. Direct assay of the locus as afforded by the present invention allows the researcher to make a stepwise approach to fixing (making homozygous) the desired combination of flanking markers and alleles, by first identifying individuals fixed for one flanking marker and then identifying progeny fixed on the other side of the locus all the time knowing with confidence that the desirable allele is still present.

The tools developed to identify a specific mutant GA target gene allele or the plant or plant material comprising said allele, or products which comprise plant material comprising said allele are based on the specific genomic characteristics of said allele as compared to the genomic characteristics of the corresponding wild type allele, such as, a specific restriction map of the genomic region comprising the mutation region, molecular markers or the sequence of the flanking and/or mutation regions.

Once a specific mutant allele has been sequenced, primers and probes can be developed which specifically recognize a sequence within the 5' flanking, 3' flanking and/or mutation regions of the mutant allele in the nucleic acid (DNA or RNA) of a sample by way of a molecular biological technique. For instance a PCR method can be developed to identify the mutant allele in biological samples. Such a PCR is based on at least two specific "primers": one recognizing a sequence within the 5' or 3' flanking region of the mutant allele and the other recognizing a sequence within the 3' or 5' flanking region of the mutant allele, respectively; or one recognizing a sequence within the 5' or 3' flanking region of the mutant allele and the other recognizing a sequence within the mutation region of the mutant allele; or one recognizing a sequence within the 5' or 3' flanking region of the mutant allele and the other recognizing a sequence spanning the joining region between the 3' or 5' flanking region and the mutation region of the mutant allele, respectively.

An oligonucleotide for use in probing or amplification reactions comprise or consist of about 30 or fewer nucleotides in length (e.g. 18, 21 or 24) of a GA target gene. Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16-24 nucleotides in length may be preferred. Those skilled in the art are well versed in the design of primers for use processes such as PCR. If required, probing can be done with entire restriction fragments of the gene disclosed herein which may be 100's or even 1000's of nucleotides in length.

Preferably, the amplified fragment has a length of between 50 and 1000 nucleotides, such as a length between 50 and 500 nucleotides, or a length between 100 and 350 nucleotides. The specific primers may have a sequence which is between 80 and 100% identical to a sequence within the 5' or 3' flanking region, to a sequence within the mutation region, or to a sequence spanning the joining region between the 3' or 5' flanking and mutation regions of the mutant allele, provided the mismatches still allow specific identification of the specific mutant allele with these primers under optimized PCR conditions. Standard PCR protocols are described in the art, such as in 'PCR Applications Manual" (Roche Molecular Biochemicals, 2nd Edition, 1999) and other references. Accordingly in this embodiment of the present invention one potential method to produce a dehiscent seed plant characterized by having modified tissue dehiscence and modified (preferably delayed) seed release which comprises: I.) Preparing F1 hybrid plants;

II. ) Analyzing F1 hybrids by screening with DNA markers derived from or associated with GA target genes, and selecting hybrids for backcrossing with one parental line;

III. ) Analysis of DNA markers derived from or associated with GA target genes of the present invention (or homologues thereof) in individual plants of the B1 (Backcross 1) generation and selection of lines with the optimum dehiscence genotype as related to the DNA markers derived from or associated with GA target genes of the present invention;

IV. ) One or two further rounds of DNA marker assisted backcrossing with selection of plants as per II to generate production quality germplasm.) The F1 hybrid plants may be prepared by any method described above. For example: (I.I.) Generating and/or identifying two or more plants each comprising one or more selected mutant GA target gene alleles, as described above,

(I.ii.) Crossing a first plant comprising one or more selected mutant GA target gene alleles with a second plant (which may or may not also comprises one or more other selected mutant GA target gene alleles) and collecting F1 seeds from the cross.

The second plant may be a "breeding line".

The invention further provides kits. By kit is meant a set of reagents for the purpose of performing the method of the invention, more particularly, the identification of a specific mutant GA target gene allele in biological samples. More particularly, a preferred embodiment of the kit of the invention comprises at least two specific primers, as described above, for identification of a specific GA target gene allele. Optionally, the kit can further comprise any other reagent for use in a PC identification protocol.

Alternatively, according to another embodiment of this invention, the kit can comprise at least one specific probe, which specifically hybridizes with nucleic acid of biological samples to identify the presence of a specific mutant allele therein, as described above, for identification of a specific mutant allele. Further aspects and embodiments

In summary, as exemplified above, and without limitation, the invention provides in various aspects:

• Use of a gene encoding a GA inactivating enzyme or degradation resistant DELLA protein to locally inhibiting GA-mediated DELLA degradation in the valve margin region of a plant such as to inhibit valve margin differentiation and hence the formation of the lignification layer (LL) and\or 'separation layer ¹ (SL).

• Methods, materials and processes for achieving the same, optionally in

conjunction with other modifications affecting tissue dehiscence.

• Isogenic or transgenic plants obtained by said processes.

The invention has use over a broad range of plants, including species from the genera Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linurn, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and, Zea.

Preferred plants to which the present invention may be applied are crop plants in which it is desired to modulate fruit dehiscence properties.

A useful plant of the invention can be a dehiscent seed plant, and a particularly useful plant of the invention can be a member of the Brassicaceae, such as rapeseed, or a member of the Fabaceae, such as a soybean, pea, lentil or bean plant.

As used herein, the term "dehiscent seed plant" means a plant that produces a dry dehiscent fruit, which has fruit walls that open to permit escape of the seeds contained therein. Dehiscent fruits commonly contain several seeds and include the fruits known for example, as legumes, capsules and siliques.

The Fabaceae encompass both grain legumes and forage legumes. Grain legumes include, for example, soybean (glycine), pea, chickpea, moth bean, broad bean, kidney bean, lima bean, lentil, cowpea, dry bean and peanut. Forage legumes include alfalfa, lucerne, birdsfoot trefoil, clover, stylosanthes species, lotononis bainessii and sainfoin. The skilled artisan will recognize that any member of the Fabaceae can be modified as disclosed herein to produce a non-naturally occurring plant of the invention characterized by delayed seed dispersal. Preferred crop plants are those of the Brassicaceae family, in particular Brassica species.

There are six major Brassica species of economic importance, each containing a range of plant forms. Brassica napus includes plants such as the oilseed rapes and rutabaga. Brassica oleracea are the cole crops such as cabbage, cauliflower, kale, kohlrabi and Brussels sprouts. Brassica campestris (Brassica rapa) includes plants such as Chinese cabbage, turnip and pak choi. Brassica juncea includes a variety of mustards; Brassica nigra is the black mustard ; and Brassica carinata is Ethiopian mustard. The skilled artisan understands that any member of the Brassicaceae can be modified as disclosed herein to produce a non-naturally occurring Brassica plant characterized by delayed seed dispersal.

By use of the present invention the dehiscence properties of the seed pods can be modified, more specifically pod shatter resistance can be increased and seed shattering can be reduced, or seed shattering can be delayed until after harvest, while maintaining at the same time an agronomically relevant threshability of the pods, such that the pods may still be opened along the dehiscence zone by applying limited physical forces.

Any sub-titles herein are included for convenience only, and are not to be construed as limiting the disclosure in any way.

Having generally described this invention, with respect to various aspects and preferred embodiments thereof, the following examples are provided to extend the written description and to ensure that those skilled in the art are enabled to practice all aspects of this invention, including its best mode. However, those skilled in the art should not take the specifics of the examples which follow as limiting on the scope of this invention, for which reference rather should be made to the appended claims and equivalents thereof.

The disclosure of all references cited herein, inasmuch as it may be used by those skilled in the art to carry out the invention, is hereby specifically incorporated herein by cross- reference. EXA PLE 1

Plant material and growth conditions Plants used to image fruits were grown on soil in long days (16 h light/8 h dark). The mutant lines ind-1 {Liljegren, 2004 #37}, ga4-1 {Koomneef, 1980 #61}, alc-1 {Rajani, 2001 #43} were in a Landsberg erecta background and the ga4-3 mutant in a Columbia background {Mitchum, 2006 #45}. GA4:GUS plants used was in a Columbia background {Mitchum, 2006 #45}. The 35S:IND-GR line was obtained as previously described {Sorefan, 2009 #32}. To generate plND»GA2ox line, first, a DNA fragment of 1053bp corresponding to the GA2ox-2 gene (At1g30040) was PCR amplified from Landsberg cDNA using primers 5'-GATAAAGATCATCTAGACTACTCTCATACAA-3' and 5'- TACAGGATCCAAACATGGTGGTTTTGC-3', sequenced and cloned in the PZP200 vector, downstream an operator sequence {Moore, 1998 #73}. The resulting plasmid was transferred to GV3 01 Agrobacterium strain and introduced in wild type Arabidopsis ecotype Landsberg erecta using floral dip procedure {Clough, 1998 #63} to generate pOp:GA2ox line. The functionality of the GA2ox transgene was assess by crossing it with a AP1.Driver line resulting in plants with short floral organs (data not shown). Then, a DNA fragment of 2.7 kb was PCR amplified from Landsberg genomic DNA using primers 5'-TTTTGGTACCCCTTATGTTAATATCACCGTAGG-3' and 5 -

TTTTGGTACCGCTTCTTTTGGGGCTGTGGTTGG-3' introducing Kpnl sites and subsequently cloned in the pBIN:LhG4 vector upstream a driver sequence (LhG4) {Moore, 1998 #73}. The resulting plasmid was directly transformed into the pOp:GA2ox line as previously described. Correct expression of IND driver was assess by crossing with pOp GFP line and monitoring that the GFP signal is present in valve margins (data not shown).

EXAMPLE 2 EXPRESSION ASSAYS

For expression assays, 35S::IND:GR seeds (~20) were germinated in 5 ml of 0.5% glucose (w/v) 0.5 % Murashige and Skoog medium with constant shaking. After 7 days of growth under constant light, seedlings were treated with Dexamethasone (DEX) and tissue collected after 6hrs and then snap froze in liquid nitrogen. When cycloheximide was used, DEX treatment was reduced to 2hrs. Dexamethasone (Sigma, D1756) was dissolved in DMSO and used at a final concentration of 10μΜ. Cycloheximide (Sigma, C4859) was dissolved in ethanol and used at a final concentration of 100μΜ. The no- treatment controls had the equivalent concentrations of solvents. EXAMPLE 3

Array hybridisation and analysis of expression data

For Microarray analysis, total RNA were first isolated using RNAeasy Kit (Qiagen) then hybridized to Affymetrix ATH1 array according to the manufacturer's instruction. Three biological repeats were analysed. The microarray results were visualised and normalised using GenespringGX 7.3 software (Agilent). Normalisation was performed by RMA (Robust ultichip Average). EXAMPLE 4

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation experiments were performed using a GR antibody (as previously described {Sorefan, 2009 #32}. Quantitative PCR was performed using

SYBR® Green JumpStart™ Taq ReadyMix™ in a Biorad Chromo4 Q-PCR machine and the following primers :

GA30X1F : 5'-AGTGGACCCCTAAAGACGATCTCC-3'

GA30X1R : 5'-GACTTAAGCTTGCGTTGGACAGGT-3'

Mu-likeF : 5'-GATTTACAAGGAATCTGTTGGTGGT-3' Mu-likeR . 5'-CATAACATAGGTTTAGAGCATCTGC-3"

The values correspond to the ratios between input DNA and pull-down with the GR antibody, both initially normalised by Mu-like transposon. EXAMPLE 5

Expression analysis For expression analysis, Q-PCR were was performed using SYBR® Green JumpStart™ Taq ReadyMix™ in a Biorad Chromo4 Q-PCR machine and the following primers :

GA30X1 F: 5'-AGTGGACCCCTAAAGACGATCTCC-3' GA30X1 R: 5'-GACTTAAGCTTGCGTTGGACAGGT-3'

UBQ1 OF: 5'-AGAACTCTTGCTGACTACAATATCCAG-3'

UBQ1 OR: 5'-ATAGTTTTCCCAGTCAACGTCTTAAC-3'

The AC _t values were calculated as follows: C _t of constitutive control gene (UBQ10) - C _t of target gene {GA3ox-1). The AC _t values represent the mean values of three independent experiments. Relative transcript levels (RTL) were calculated as follows: RTL = 100*2 ^iCt . GUS assays were performed according to the protocol described by {Rodrigues-

Pousada, 1993 #64}. Plants were fixed in acetone 90% on ice for 20 min, then rinsed with a rinse buffer containing 0.5 mM of K-ferrocyanide (Sigma, P-8131) and from 0 to 0.2 mM of K-ferricyanide (Sigma, P-9387) in 50 mM of sodium phosphate buffer, pH 7.2. Samples are then incubated for 24 to 48 hr at 37% in this rinse buffer containing 2 mM of 5-bromo- 4-chloro-3-indolyl p-D-glucuronide (Melford, MB1121).

EXAMPLE 6

Scanning Electron Microscopy (SEM)

Plants were fixed in FAA (3.7% of formaldehyde, 5% acetic acid and 50% ethanol) at 4°C overnight then dehydrated in ethanol series. Tissues were critical point dried in liquid C0 ₂ , sputter-coated with gold, analysed and photographed with a Philips XL 30 FEG SEM. EXAMPLE 7

Transmission Electronic Microscopy (TEM) Stage 17b fruits were fixed in 2.5% vol/vol glutaraldehyde/0.05 M Na cacodylate, pH 7.2; vacuum-infiltrated; and left overnight at room temperature. Samples were post-fixed in 1 % osmium tetroxide/0.05 M Na cacodylate for 1 h; briefly washed with water; and dehydrated in ethanol 30%, 50%, 70%, 90%, and 100% (v/v). Samples were then infiltrated in London Resin White resin (London Resin Co., Ltd.) and sectioned for TEM imaging with an FEI Technai G2 20 Twin TEM.

EXAMPLE 8

Modified Pseudo-Schiff propidium iodide (mPS-PI) staining, confocal microscopy and cell size quantification

Stage 17b fruits were cut in small pieces (=0.5mm) with a sharp razor blade prior the fixation in 50% methanol and 10% acetic acid overnight at 4°C. Samples were then dehydrated in ethanol 40%, 60% and 80%(v/v) for 20 min each step then incubated in ethanol 80% at 80°C for 5 min. Samples were then re-hydrated in ethanol 80%, 60% and 40% then finally wash for 10 min twice with water. An a-amylase (=30υ/πιΙ) (Sigma, A4551) treatment is performed to remove starch granules in a buffer containing 20mM Phosphate buffer, pH7 , 2 mM NaCI, 0.25 mM CaCI ₂ . Samples are incubated overnight at 37°C. The next day, samples were washed extensively with water then incubated in periodic acid 1% (w/v) for 1 hour. After a brief wash with water, Schiff reagent (20mg/mL of Na ₂ S ₂ 05 Na2SH03 mixture, 150 mM HCI) containing 50 g/mL of propidium iodide (PI) is added and samples were incubated at room temperature for 5 hours. Samples were washed with water, placed onto a microscopic slide, and cleared overnight in a solution of chloral hydrate:water:glycerol (8:2:1 , by weight). The chloral hydrate solution was removed, samples were mount on slides in Hoyer's medium (chloral

hydrate:water:glycerol:arabic gum (8:2:1 :1 , by weight)), and let dry for a minimum of four days before analysis. Confocal microscopy was performed using a Zeiss Axo Imager M1 upright microscope. PI was excited using the 488-nm argon ion laser and collected between 600 and 656 nm. Images were processed and analyzed using the Zeiss LSM 510 software. SL cell size quantification was achieved by measuring the size (μητι ² ) of cells adjacent to the lignification of the valve. For each genotype analysed, a total of 6 different images were used and SL cells were measured from both side of the central replum using ImageJ.

EXAMPLE 9

Assessment of dehiscence using an Arabidopsis Random Impact Test (A.R.I.T.) An assay, enabling accurate measurement of the strength required to initiate dehiscence in oilseed rape pods, has been previously described {Morgan, 1998 #71}, {Bruce, 2002 #72}. This Random Impact Test (R.I.T.) has been modified to enable fruit from different ecotypes of Arabidopsis thaliana to be assessed for variation in their ability to shatter. 20 silique samples (17b+) were selected randomly from throughout the main inflorescent stem and secondary branches of senesced WT and mutant plants. Fruit was placed in an equilibration chamber, at 25°C and 50% RH, for a minimum of three days. After conditioning, three replicate samples of 20 siliques were subjected to the Arabidopsis Random Impact Test (A.R.I.T.). Siliques were placed together with five, 2mm steel balls (weighing approx. 275mg) in a 60mm diameter glass petri, attached to an eppendorf shaker. The Petri dish was agitated for five second intervals from 0 to 60 sec and ten second intervals from 60 to 150 sec, until all fruit had dehisced or 150 sec shaking had elapsed. After each interval, the frequency of intact/dehisced siliques was recorded. Dehisced fruit were counted when both valves had been shed. The time point at which 50% of siliques had dehisced was used as a comparative measure of shattering between different lines.

EXAMPLE 10

Yeast Two-Hybrid

The pGAD424 and pGBT9 vectors from Clontech Laboratories Inc. were used as the activation domain vector and binding domain vector respectively. The GAI, RGA, RGL2 and ALC coding regions were amplified by PCR with primers containing Smal and Pstl restriction sites (Table 1 ). The ampiicons corresponding to GAI, RGA, RGL2 were cloned in frame between Smal and Pstl sites of pGAD424 and ALC was cloned in frame between Smal and Pstl sites of pGBT9 to form both preys and bait respectively. After confirming the plasmid quality by sequencing, prey plasmids were transformed into yeast Y187 (-Leu) and bait plasmids into AH 109 (-Trp).

For each plasmid of interest to be tested, a single yeast transformant colony was resuspended in 500μΙ_ of YPD (2% peptone, 1% yeast extract, 2% glucose). For each mating combination, a 20μΙ- aliquot of each plasmid was mixed into 160pL of YPD medium and incubated overnight at 30°C shaking at 200rpm. In order to confirm mating efficiency and protein-protein interactions, 100μί of each mating culture was plated on SD-LW (-Leu Trp) (growth confirms mating) and SD-LWHA (-Leu Trp His Ade) plates (growth confirms interaction) and incubated at 30°C until colonies grew (3-5 days).

For each of the protein-protein interactions to be quantified, a single colony from the SD- LW plates was resuspended in 5mL of liquid SD-LW medium and grown overnight at 30°C with shaking at 200rpm. Next day, 2mL of each culture was resuspended in 8mL of YPD and incubated at 30°C for 3-5hr with shaking until the cells reached mid-log phase (OD _B oo=0.5-0.8). At this point, the OD ₆ ooS were recorded. 1.5mL of each culture was placed in five eppendorf tubes and centrifuged at 14,000rpm for 30sec. Supernatants were carefully removed and cell pellets were resuspended in 1.5mL of Z buffer (Na ₂ HP0 x 7H ₂ 0 (16.1g/L), NaH ₂ P0 ₄ x H ₂ 0 (5.5g/L), KCI (0.75g/L), MgS0 ₄ (0.246g/l), pH 7). Cell pellets were resuspended in 300μί of Z buffer (concentration factor= 5). 0.1 mL of each cell suspension was transferred to a new eppendorf tube. The tubes were subsequently frozen in liquid nitrogen for 1min and subsequently thawed in a water bath at 37°C. The freeze/thaw cycle was repeated once more. At the same time, a blank tube was set up with 100μί of Z buffer. 0.7mL of Z buffer + β-mercaptoethanol (0.27 mL of (3- mercaptoethanol in 100ml Z buffer) was added to each of the tubes including the blank tube. Immediately, 160μί of ONPG solution (4mg/ml o-nitrophenyl β-D-galactopyranoside in Z buffer) was added and the tubes were incubated at 30°C until yellow colour developed. The time of incubation was carefully recorded in minutes. After the yellow colour developed, 0.4ml of 1M Na ₂ C0 ₃ was added to stop the reaction and the tubes were centrifuged for 0min at 14,000rpm to pellet cell debris. The OD ₄₂₀ of the samples relative to the blank was measured and used to calculate the (J-galactosidase units: β-galactosidase units= 1000 x OD ₄₂₀ (t x V x OD ₆ oo) t=minutes of incubation for colour to develop

V= 0.1ml x concentration factor Table 1

EXAMPLE 11

PREVENTING LOSS OF SEED IN OILSEED RAPE

In order to produce oilseed rape plants with reduced GA synthesis in dehiscence zone region, nucleic acid fragments of one or more genes involved in GA biosynthesis are provided and expressed at the valve margin under control of the IND promoter to silence or partly silence the target genes via the phenomenon of RNAi interference.

In an alternative approach, a heterologous GA 2-oxidase gene is expressed in the same tissue using the same promoter, which would result in tissue-specific inactivation of GAs.

In each case the r3esulting plants are shown to have a reduction in pod shattering.

EXAMPLE 12

PREVENTING LOSS OF SEED IN SOYBEANS

The strategy described in Example 11 for reducing seed loss in oilseed rape is used correspondingly to prevent seed loss in soybean. REFERENCES

Bruce DM, Farrent JW, Morgan CL, Child RD. 2002. Determining the oilseed rape pod strength needed to reduce seed loss due to pod shatter. Biosyst Eng 81: 179-184.

Chiang HH, Hwang I, Goodman HM. 1995. Isolation of the Arabidopsis GA4 locus. Plant Cell 7: 195-201.

Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 6: 735-743.

de Lucas M, Daviere JM, Rodriguez-Falcon M, Pontin M, Iglesias-Pedraz JM, Lorrain S, Fankhauser C, Blazquez MA, Titarenko E, Prat S. 2008. A molecular framework for light and gibberellin control of cell elongation. Nature 451 : 480-484.

Feng S, Martinez C, Gusmaroli G, Wang Y, Zhou J, Wang F, Chen L, Yu L, Iglesias- Pedraz JM, Kircher S et al. 2008. Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 451: 475-479.

Ferrandiz C, Liljegren SJ, Yanofsky MF. 2000. Negative regulation of the SHATTERPROOF genes by FRUITFULL during Arabidopsis fruit development. Science 289: 436-438.

Girin T, Stephenson P, Goldsack CMP, Perez A, Pires N, Sparrow PA, Wood TA, 0stergaard L. 2010. Brassicaceae INDEHISCENT genes specify valve margin cell fate and repress replum formation. Plant J doY. 10.1111/j.1365-313X.2010.04244.x

Gomez-Mena C, de Folter S, Costa MM, Angenent GC, Sablowski R. 2005. Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis. Development 132: 429-438.

Goto N, Pharis RP 1999. Role of gibberellins in the development of floral organs of gibberellin-deficient mutant, ga1-1, of Arabidopsis thaliana. Can J Bot 77: 944-954.

Hedden P, Phillips AL. 2000. Gibberellin metabolism: new insights revealed by the genes. Trends Plant Sci 5: 523-530.

Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC. 2003. The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. Mol Biol Evol 20: 735-747.

Hu J, Mitchum MG, Barnaby N, Ayele BT, Ogawa M, Nam E, Lai WC, Hanada A, Alonso JM, Ecker JR et al. 2008. Potential sites of bioactive gibberellin production during reproductive growth in Arabidopsis. Plant Cell 20: 320-336.

Koornneef M, Van der Veen JH. 1980. Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) heynh. Theoretical and Applied Genetics 58: 257- 263.

Lee S, Cheng H, King KE, Wang W, He Y, Hussain A, Lo J, Harberd NP, Peng J. 2002. Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev 16: 646-658.

Liljegren SJ, Ditta GS, Eshed Y, Savidge B, Bowman JL, Yanofsky MF. 2000. SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404: 766-770.

Liljegren SJ, Roeder AH, Kempin SA, Gremski K, 0stergaard L, Guimil S, Reyes DK, Yanofsky MF. 2004. Control of fruit patterning in Arabidopsis by INDEHISCENT. Cell 116: 843-853. Mitchum MG, Yamaguchi S, Hanada A, Kuwahara A, Yoshioka Y, Kato T, Tabata S, Kamiya Y, Sun TP. 2006. Distinct and overlapping roles of two gibberellin 3-oxidases in Arabidopsis development. Plant J 45: 804-818.

Mitsuda N, Ohme-Takagi M. 2008. NAC transcription factors NST1 and NST3 regulate pod shattering in a partially redundant manner by promoting secondary wall formation after the establishment of tissue identity. Plant J 56: 768-778.

Moore I, Galweiler L, Grosskopf D, Schell J, Palme K. 1998. A transcription activation system for regulated gene expression in transgenic plants. Proc. Natl. Acad. Sci. USA 95: 376-381.

Morgan CL, Bruce DM, Child R, Z.L. L, Arthur AE. 1998. Genetic variation for pod shatter resistance among lines of oilseed rape developed from synthetic B-Napus. Field Crop Research 58: 153-165.

Oh E, Yamaguchi S, Hu J, Yusuke J, Jung B, Paik I, Lee HS, Sun TP, Kamiya Y, Choi G. 2007. PIL5, a phytochrome-interacting bHLH protein, regulates gibberellin responsiveness by binding directly to the GAI and RGA promoters in Arabidopsis seeds. Plant Ce// 19: 1192-1208.

0stergaard L, Kempin SA, Bies D, Klee HJ, Yanofsky MF. 2006. Pod shatter-resistant Brassica fruit produced by ectopic expression of the FRUITFULL gene. Plant Biotech J A, 45-51

0stergaard L. 2009. Don't 'leaf now. The making of a fruit. Curr Opin Plant Biol 12: 36-41.

Penfield S, Josse EM, Kannangara R, Gilday AD, Halliday KJ, Graham IA. 2005. Cold and light control seed germination through the bHLH transcription factor SPATULA. Curr β/ο/ 15: 1998-2006.

Petersen M, Sander L, Child R, van Onckelen H, Ulvskov P, Borkhardt B. 1996. Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus. Plant Mol Biol 31: 517-527.

Price JS, Neale MA, Hobson RN, Bruce DM. 1996. Seed losses in commercial harvesting of oilseed rape. J Agric Engng Res 80, 343-350.

Purugganan MD, Fuller DQ. 2009. The nature of selection during plant domestication. Nature 457. 843-848.

Rajani S, Sundaresan V. 2001. The Arabidopsis myc/bHLH gene ALCATRAZ enables cell separation in fruit dehiscence. Curr Biol 11: 1914-1922.

Rodrigues-Pousada RA, De Rycke R, Dedonder A, Van Caeneghem W, Engler G, Van Montagu M, Van Der Straeten D. 1993. The Arabidopsis 1-Aminocyclopropane-1- Carboxylate Synthase Gene 1 Is Expressed during Early Development. Plant Cell 5: 897- 911.

Roeder AH, Ferrandiz C, Yanofsky MF. 2003. The role of the REPLUMLESS homeodomain protein in patterning the Arabidopsis fruit. Cun Biol 13: 1630-1635.

Sablowski RW, Meyerowitz EM. 1998. A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PI STI LLATA. Cell 92: 93-103.

Sorefan K, Girin T, Liljegren SJ, Ljung K, Robles P, Galvan-Ampudia CS, Offringa R, FrimI J, Yanofsky MF, 0stergaard L. 2009. A regulated auxin minimum is required for seed dispersal in Arabidopsis. Nature 459: 583-586.

Spence J, Vercher Y, Gates P, Harris N. 1996. 'Pod shatter' in Arabidopsis thaliana, Brassica napus and B. juncea. Journal of microscopy 181: 195-203. Talon M, Koomneef M, Zeevaart JA. 1990. Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. Proc Natl Acad Sci U S A S7: 7983-7987.

Truernit E, Bauby H, Dubreucq B, Grandjean O, Runions J, Barthelemy J, Palauqui JC. 2008. High-resolution whole-mount imaging of three-dimensional tissue organization and gene expression enables the study of Phloem development and structure in Arabidopsis. Plant Cell 20: 1494-1503.

Vivian-Smith A, Koltunow AM. 1999. Genetic analysis of growth-regulator-induced parthenocarpy in Arabidopsis. Plant Physiol. 121 : 437-451.

Wu H, Mori A, Jiang X, Wang Y, Yang M. 2006. The INDEHISCENT protein regulates unequal cell divisions in Arabidopsis fruit. Planta 224: 971-979.

Yamaguchi S. 2008. Gibberellin metabolism and its regulation. Annu Rev Plant Biol 59: 225-251.

SEQUENCE ANNEX I - >IND PROMOTER (At4g00120 ) The ATG of the coding region is bolded and underlined.

TTATAAGTTTACTTATCCACTTGAGAATTTAAACAATGGGCAATACCTTAATGTCGA AAGAAGCCG TCCCCACTTCGTGTAATGAGTTATGGGGGAGAGATCCTGTTAAATCGTCAAATAAAACAA CTTAAG AACTAGAAATTGACACCAAAAATCATAAAGAGAACGTTGAAGAAGTCATTTATCGTATCC AGCTCA TATTTCCTAGCTAAGATCAAATCAAGGCCGTTGAAAGGGCTTGTAAGAAAATGTCGAAGA AACCGT GGGGTTTAGAAGAAAGACAAGAAATAGAAGAACAATGATGTTAAATTGCCTATTTTGGTG TATAGG AGTTGTCAAAAGAGGAGAGAGAGAAGAAAATTAGGTCAAAATAATGAGCACTAAAAATGG AGACAT GTGTTGAGTAACTATTACAAGAGCGACTTATGCTTCCTTATGGCAATGATATCCAAACCA AAGTGC AACGCTCCTTTTTTGCCCTAATTTCGTAAAGTCTCTCTCCTTCTTCGTCCTTAGGAAAAA CCCTAG AAATTTAATCCCTTGTTCTTGATCTTGCTTTTTGAGTAACCATGATTTTGACCACACACT ATTTCT TCTATCTTTTGTGGTCTATAGGATTTTGCTTTATATGTGTTTCTTGTATTGCTCCGTACG TACGTA TACGAATTTAAATGGTTATAACAAGGTTTATATAAACTAGCACAAATGAGTCCATGAAAT TTGTTA GCGAAAAAGGTAGAAATATATTGAGTCTTTAAACGGCAATATATATAATTTTGCTGCAAA ACTTAG CTTTAATCATGATCTAATGATATTTTCTTTAATTTCCTTTGCCAAATTAATCACATGCAC GGATTT TTGGCAAGTTATGTGTCGAATTCTTCCATTCACACAACACTAAACTTAATTAGAACTCTA GGAAAT ATTTTAAAATGACAACTTTATCGAAAAAAATTTAGTTATGAAAACAATTCCAGAATTAAA CATGAG CTATATAATTTAAGATAAAATGAAGTAATATTGATATGTATGTAATAACATATCTGATTG CGGTAA AAAAAAACATATCTGATTAAATTGTTCATGCAGGCCCATGTCACTATGATGTCATCACGT TTTTAT TTTGACAATAACTAATATATATTCAAAAAAATAGTTTTGTCAGATTAAATTTTTTTTGGT GGTCAG CTTTCTCCAACCTACTAAACTAGTTTGGAATGTTCTCTTCTTTATTTTTCTTTTTCTTGA TTTCTT ATGTTTTTTATTTATGGAATTTTAAGACGGATTGTTTAGGTCGTTTCTCTCTTTTCTTGT TTTCTA AAGTTACTTTTGTAAACTCATCTCCTCCCAATTAGACAGTCAATCATATAGTTATCTTTT AATATA TGTCTAGTTGATAAAAAAAATGAAAAAATACTGGTGGTAGTTCTACTAATGTTTGTGTAA AAAATC TGATATTATGAATCTAATCAATTTCTTTGATCGTATAATGTGGGTTAAATTTAGTAATTT TTTACA TAAATAAGAACTGTAATGTTGATGTATATTGGGGAATCAGTATATTAGCTTGGGTAACTA TACTTC TGGAAATACTTGAAGATTTAACTATTTGCAAAATTATAATTTAGTCCCGAAAAATACAGA CGACGG GACACGACAACATATAAGCAGGTTTGAATCTTGGAAAATTTTGTATACATAACCTATATA AATACT AATGTTCTGGTTGGGTTCAAAAGCCTTTTCAAAAGTTCCATTTTTTAAATTCAAGGACAT TTTACA TAGGAAATAAGTTGAGTCATAAAAAATAATGGTTATTTTGTAAGGTTTTTTTTTTGATTA AAACGC ACATATTAAGAAGTTAGTTTTTTTTCACTACCAAATATCAATTAATTTAAAACCATGCAA CCATTC ATAAAAC^TACTATTAAAGAATATAAATAATCACAAAATATTAAATACACTTAAAATTTA CATAT AAATTTACAAAACATCTAATTAATTGAAACAGAAAGGAAAAGGTAAAATATATCATAAAA TGAGAC ATATATCCTATAAAAAAAAAATGAGGCATATGAAGTAAATAATAAGAGACATGCATGTAA GCATTC GGTTAATTAATCGAGTCAAAGATATATATCAGTAAATACATATGTGTATATTTCTGGAAA AAGAAT ATATATATTGAGAAATAAGAAAAGATGAAAATGGAAAATGGTATGTATAAAAAGAAAGGA GTGTGC GACTCTTGTGTCTCGTCCAAAAGCAGATCCAACCACAGCCCCAAAAGAAGCATGATGGAG CCTCAG CCTCACCATCTCCTCATGGATTGGAACAAAGCTAATGATCTTCTCACACAAGAACACGCA GCTTTT CTCAATGATCCTCACCATCTCATGTTAGATCCACCTCCCGAAACCCTAATTCACTTGGAC GAAGAC GAAGAGTACGATGAAGACATGGATGCGATGAAGGAGATGCAGTACATGATCGCCGTCATG CAGCCC GTAGACATCGACCCTGCCACGGTCCCTAAGCCGAACCGCCGTAACGTAAGGATAAGCGAC GATCCT CAGACGGTGGTTGCTCGTCGGCGTCGGGAAAGGATCAGCGAGAAGATCCGAATTCTCAAG AGGATC GTGCCTGGTGGTGCGAAGATGGACACAGCTTCCATGCTCGACGAAGCCATACGTTACACC AAGTTC TTGAAACGGCAGGTGAGGATTCTTCAGCCTCACTCTCAGATTGGAGCTCCTATGGCTAAC CCCTCT TACCTTTGTTATTACCACAACTCCCAACCCTGA