DEP2, A DENSE AND ERECT PANICLE GENE AND USES THEREOF

TECHNICAL FIELD OF THE INVENTION

[0001] The invention relates generally to compositions and methods for imparting a dense and erect panicle phenotype to plants, including polynucleotides, polypeptides, vectors and host cells. This phenotype is associated with improving plant traits, such as improving plant yield. The present invention also relates generally to plants transformed by the aforementioned compositions and methods. BACKGROUND OF THE INVENTION

[0002] Rice (Oryza sativd) is one of mankind's major food staples. Given continuing population growth and increasing competition for arable land between food and energy crops, food security is becoming an ever more serious global problem. Improving crop productivity by selection for the components of grain yield and for optimal plant architecture has been the key focus of national and international rice breeding programs.

[0003] In the 1960s, a high-yield semi-dwarf variety of rice known as IR8 was developed, which profoundly revolutionized rice breeding. However, limitations in IR8 and related varieties caused plant breeders and physiologists at the International Rice Research Institute (IRRI) to postulate that a new plant type (or ideotype) needed to be developed to meet future needs. Accordingly, in 1989 the IRRI issued a strategic plan to develop a new plant type with a yield potential 20-25% higher than that of existing semi-dwarf varieties of rice. The proposed new plant type possessed an increased height, a low tillering capacity with fewer unproductive tillers, an earbearing tiller percentage increase, larger panicles with more grains per panicle, a vigorous root system, and improvement in both biomass and economic coefficient.

[0004] In the late 1980s, different, but similarly advantageous, ideotypes were proposed in China. These ideotypes were based upon erect panicle rice varieties that first appeared in the 1930s, developed in the 1960s, and popularized in the 1980s. The erect panicle varieties present in China are derived from the main cultural variety "Balilla" of Italy, and some important varieties include "Liaojing 5#", "Qianchonglang", "Shennong 265", and

"Shennong 606". Erect panicle rice varieties are currently dominant in northeastern China, and are significant contributors to overall rice production and research in that nation.

[0005] These ideotypes were proposed because, as compared to a curved panicle, an erect or semi-erect panicle has many advantages. Erect panicles are more efficient in utilizing light energy and are superior to curved panicles with respect to environmental conditions required to produce the same yield (e.g., illumination, temperature, humidity, gas diffusion). Plants with erect panicles also have a higher growth rate and produce greater amounts of dry matter, both of which increase yield.

[0006] The dense and erect panicle phenotype is usually associated with dwarfism, which improves plant shape and the balance of yield-associated factors - in particular, both panicle number and grain number per panicle. The dense and erect panicle phenotype is also significantly superior to the curved panicle phenotype in lodging resistance, because an erect panicle has a significantly lower acting force of panicle to stalk than that of a curved panicle. The dense and erect panicle phenotype also has short and thick basal internodes, a leaf sheath with a high bearing capacity, greater matter production, and a decreased transfer amount to grains after earing.

[0007] At present, few studies have been directed to the gene(s) responsible for the erect panicle phenotype. It was speculated that this phenotype was controlled by a single recessive nuclear gene. Others postulated that this phenotype was controlled by a pair of nuclear genes or a pair of additive genes. Still others reported that the gene responsible for the erect panicle phenotype was located on chromosome 9 between two SSR (simple-sequence repeat) markers, RM5833-11 and RM5686-23, at a genetic distance of 1.5 and 0.9 cM, respectively.

[0008] It was also reported that a major QTL controlling the erect panicle gene, qEP9-l, was located on chromosome 9 between STS marker H90 and SSR marker RM5652. This gene (a.k.a. DEP1) was recently cloned and it encodes a phosphatidylethanolamine-binding protein (PEBP)-like domain protein. Most recently, another two erect panicle genes, EP2 and EPS have been reported. EP2 was mapped to chromosome 4, and EPS encodes a putative F- box protein.

[0009] In view of the aforementioned advantages demonstrated in plants having dense and erect panicle in addressing the continuing unmet need to produce higher-yield rice and other crops, the identification and isolation of additional genes that confer this phenotype is of great importance.

BRIEF SUMMARY OF THE INVENTION [0010] The present invention relates to isolated dense and erect panicle 2 (DEP2) polynucleotides, polypeptides, vectors and host cells expressing isolated DEP2

polynucleotides capable of imparting the dense and erect panicle phenotype to plants, including rice. The related polynucleotides, polypeptides, vectors and cells of the present invention are also capable of imparting specific traits to plants, and in particular crop plants. These traits include increased yield, increased lodging resistance, increased panicle number, increased grain number per panicle, dwarf or semi-dwarf stature, increased photosynthetic efficiency, increased population growth rate during grain filling period, increased water transport capacity, increased mechanical strength of the stem, and increased dry matter production.

[0011] The isolated DEP2 polynucleotides provided herein include nucleic acids comprising (a) a nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence at least 70% identical to (a); (c) those that specifically hybridize to the complement of (a) under stringent hybridization conditions; (d) an open reading frame encoding a DEP2 protein comprising a polypeptide sequence of SEQ ID NO: 2; (e) an open reading frame encoding a DEP2 protein comprising a polypeptide sequence at least 70% identical to (d); and (f) a nucleotide sequence that is the complement of any one of (a)-(e).

[0012] The isolated DEP2 polypeptides provided herein include (a) an amino acid sequence of SEQ ID NO: 2; and (b) an amino acid sequence at least 70% identical to (a).

[0013] The host cells provided herein include those comprising the isolated

polynucleotides and vectors of the present invention. Host cells also include those comprising different alleles of the DEP2 gene and those in which the function of a DEP2 polypeptide is altered. The host cell can be from an animal, plant, or microorganism, such as E. coli. Plant cells are particularly contemplated. The host cell can be isolated, excised, or cultivated. The host cell may also be part of a plant.

[0014] The present invention further relates to a plant or a part of a plant that comprises a host cell of the present invention. Monocots such as such as wheat, barley, rice, maize, sorghum, oats, and rye are particularly contemplated. The present invention also relates to the transgenic seeds of the plants.

[0015] The present invention further relates to a method for producing a plant comprising regenerating a transgenic plant from a host cell of the present invention, or hybridizing a transgenic plant of the present invention to another non-transgenic plant. Plants produced by these methods are also encompassed by the present invention, and plants having a dense and erect panicle phenotype are particularly contemplated, as are crop plants, such as wheat, barley, rice, maize, sorghum, oats, and rye.

[0016] The present invention further relates to methods of altering a trait in a plant or part of a plant using the isolated polynucleotides, polypeptides, constructs and vectors of the present invention. These traits include yield, lodging resistance, panicle number, grain number per panicle, dwarf or semi-dwarf stature, photo synthetic efficiency, population growth rate during grain filling period, water transport capacity, mechanical strength of the stem, and dry matter production. Preferably the aforementioned traits are altered so that they are increased or otherwise improved. In one embodiment, one or more traits of a plant are altered by expressing in a plant an isolated nucleic acid such as (a) a nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence at least 70% identical to (a); (c) a nucleic acid that specifically hybridizes to the complement of (a) under stringent hybridization conditions; (d) an open reading frame encoding a DEP2 protein comprising a polypeptide sequence of SEQ ID NO: 2; (e) an open reading frame encoding a DEP2 protein comprising a polypeptide sequence at least 70% identical to (d); or (f) a nucleotide sequence that is the complement of any one of (a)-(e). In another embodiment, one or more traits of a plant are altered by expressing in a plant an isolated hypermorphic DEP2 allele. In another embodiment, one or more traits of a plant are altered by disrupting a DEP2 locus in the plant. In another embodiment, one or more traits of a plant are altered by expressing in a plant an isolated hypomorphic, amorphic or antimorphic DEP2 allele. In another embodiment, one or more traits of a plant are altered by increasing the expression of a DEP2 nucleic acid or polypeptide in the plant. In another embodiment, one or more traits of a plant are altered by partially or completely reducing the expression of a DEP2 nucleic acid or polypeptide in the plant. In another embodiment, one or more traits of a plant are altered by altering the function of a DEP2 polypeptide in the plant.

[0017] The present invention further relates to plants, plant parts and transgenic seeds created through the described methods of altering a trait in a plant. Such contemplated plants, plant parts and transgenic seeds may be created directly from the aforementioned methods. Alternatively, the contemplated plants, plant parts and transgenic seeds may be derived from a host cell (e.g., regenerated from a host cell) or produced by crossing a transgenic plant with one or more altered traits with a non-transgenic plant.

[0018] The present invention further relates to methods of identifying DEP2 binding agents and inhibitors. In one embodiment, the method comprises (a) providing an isolated DEP2 protein; (b) contacting the isolated DEP2 protein with an agent under conditions sufficient for binding; (c) assaying binding of the agent to the isolated DEP2 protein; and (d) selecting an agent that demonstrates specific binding to the isolated DEP2 protein.

[0019] In another embodiment, the method comprises (a) providing a host cell expressing a DEP2 protein; (b) contacting the host cell with an agent; (c) assaying expression of DEP2 protein; and (d) selecting an agent that induces altered expression of DEP2 protein. In certain embodiments, e.g., when the host cell expresses a full-length DEP2, such as SEQ ID NO: 2, an agent is selected that reduces expression of the protein. In other embodiments, e.g., when the host cell expresses a truncated DEP2 protein, an agent is selected that increases

expression of the protein.

[0020] In another embodiment, the method comprises (a) providing a plant or part of a plant expressing a DEP2 protein; (b) contacting the plant or the part of the plant with an agent; (c) assaying for alteration of a trait of the plant or the part of the plant; and (d) selecting an agent that alters the trait. The traits to be assayed are those known to be affected by DEP2 expression (e.g., yield, lodging resistance, panicle number, grain number per panicle, dwarf or semi-dwarf stature, photo synthetic efficiency, population growth rate during grain filling period, water transport capacity, mechanical strength of the stem, and dry matter production). Preferably agents that increase or otherwise improve these traits are selected. However, agents that negatively impact a trait are contemplated as well.

[0021] The present invention also relates to methods of inhibiting DEP2 in a plant using the binding agents and inhibitors identified by the methods herein.

BRIEF SUMMARY OF THE SEVERAL VIEWS OF THE DRAWINGS

[0022] Figure 1 shows the phenotype of the dep2 mutant. Gross morphology (A) and panicle morphology (B) of wild type (left) dep2-l(righi) is shown at the mature stage. Bar = 10 cm. (C) Comparison of the mature grains between the wild type (left) and dep2-l (right). Bar = 5 mm. (D) Comparison of the panicle branching between the wild type and dep2-l. Bar = 10 cm.

[0023] Figure 2 shows the dep2 morphology in a paddy field. The dep2 mutant (left) and the wild type (right) were planted in a paddy field in Beijing, and the overall appearance of the dep2 mutant is more compact than the wild type.

[0024] Figure 3 is a comparison of the panicle development between the wild type and dep2-l. (A, E) Scanning electron microscope (SEM) images showing the formation of first bract and second bract of the wild type (A) and dep2-l (E) plants. Bar = 100 μπι. (B, F) SEM images showing the formation of primary branches of the wild type (B) and dep2-l (F) plants. Bar = 100 μιη. (C, G) SEM images showing the formation of secondary branches of the wild type (C) and dep2-l (G) plants. Bar = 100 μιη. (D, H) SEM images showing the differentiation of flower organs in the wild type (D) and dep2-l (H). Bar = 100 μιη. (I-M) Panicles of the wild type (left) of 1 cm (I), 5 cm (J), 10 cm (K), 15 cm (L) and 20 cm (M) and dep2-l (right) at the same stage. I, J, K, L Bar = 1 cm; M Bar=5 cm. (N-R) Florets of the wild type (left) panicle of 3 cm (N), 5 cm (O), 10 cm (P), 15 cm (Q) and 20 cm (R) and dep2-l (right) at the same stage. I, J, K, L Bar = 100 μιη; M Bar = 2 cm Abbreviations: Bl, first bract; B2, second bract; P, pistil; PB, primary branch; S, stamen; SB, secondary branch.

[0025] Figure 4 is a histological comparison of mutant and wild type plants. (A, D) Comparison of the longitudinal section of the uppermost internodes between the wild type and dep2-l. Bar = 100 μπι. (B, E) Comparison of the longitudinal section of the rachis axis between the wild type and dep2-l. Bar = 100 μπι. (C, F) Comparison of the longitudinal section of the florets between the wild type and dep2-l. Bar = 100 μπι.

[0026] Figure 5 shows the map-based cloning of the DEP2 gene. (A) The DEP2 locus was mapped to the long arm of rice chromosome 7 between markers Ml and M5. The gene was further delimited to a 27-kb genomic region between the markers M2 and Ml 5 within the BAC clone P016D06 and B1056G08. The number of recombinants is marked

corresponding to the molecular markers. (B) Within this 27-kb interval, there were five predicted ORFs; DEP2 is marked in red. (C) Schematic representation of the DEP2 gene structure. Black boxes indicate the coding sequence, white boxes indicate the 5' and 3' untranslated regions, and lines between boxes indicate introns. The mutations identified in dep2-l and dep2-2 are indicated by arrows. (D, E) Complementation analysis of the dep2-2 mutant. (D) Gross morphology at the heading stage and (E) the panicle morphology at mature stage. D Bar = 10 cm; E Bar = 4 cm. (F, G) RNAi analysis of the DEP2 gene. Gross morphology (F) and panicle morphology (G) at mature stage. F Bar = 10 cm; G Bar =4 cm. (H) Comparison of DEP2 transcription level in 2-week old wild type and dep2-l plants in dark or normal condition.

[0027] Figure 6 shows the DEP2 expression pattern. (A-G) DEP2 expression pattern was revealed by the transformants with DEP2 promoter-GUS. GUS staining is found in young panicle (A-C), root (D-E), stem (F) and leaf blade (G). A Bar = 1 cm; B-D, F Bar = 1 mm; E Bar =100 μιη. (H) Quantitative RT-PCR analysis of DEP2 expression in various organs, including root, stem, shoot, leaf blade, leaf sheath, young panicle of 1 cm (YP1) to 20 cm (YP20).

[0028] Figure 7 shows the subcellular localization of DEP2. (A) Localization in onion epidermal cells of 35S-GFP (left) and 35S-DEP2-GFP (right). Bar = 50 μιη. (B) Localization in Nicotiana benthamiana leaves epidermal cells of 35S-GFP (left) and 35S-DEP2-GFP (right). Bar = 25 μιη.

[0029] Figure 8 is a phylogenetic analysis of putative homologues of DEP2 using MEGA with neighbor-joining method, bootstrap analysis was performed with 1,000 replicates and excluding positions with gaps. Numbers in branches indicate bootstrap values (percent). The following homologues identified by accession number are shown: Oryza sativa

(LOC_Os03g212701, LOC_Os07g264401, LOC_Os03g643201 and LOC_Os07g424101); Arabidopsis thaliana (AT 1 G611001 , AT4G274301 , AT 1 Gl 73601 , AT 1 G724101,

AT3G141721 and AT5G433101); Populus trichocarpa (Pop_44671, Pop C LG VIIIOOO, Pop_C_l 070077, Pop_C_LG_XI 1000 and Pop_002304238); Vitis vinifera

(GSVIVP0002029200, GSVIVP0002763000, GSVIVP0002923800 and

GSVIVP0003403200); Zea mays (AC1955993_FGT020, AC2100023_FGT017,

AC2114432_FGT009, AC1778344_FGT011 and AC1961623_FGT017); Sorghum bicolor (Sb01g000280, Sb01g036410 and Sb02g039210).

DETAILED DESCRIPTION OF THE INVENTION

[0030] DEP2 Nucleic Acids and Proteins

[0031] As used herein, the terms "nucleic acid", "polynucleotide", "polynucleotide molecule", "polynucleotide sequence" and plural variants are used interchangeably to refer to a wide variety of molecules, including single strand and double strand DNA and RNA molecules, cDNA sequences, genomic DNA sequences of exons and introns, chemically synthesized DNA and RNA sequences, and sense strands and corresponding antisense strands. Polynucleotides of the invention may also comprise known analogs of natural nucleotides that have similar properties as the reference natural nucleic acid.

[0032] As used herein, the terms "polypeptide", "protein" and plural variants are used interchangeably and refer to a compound made up of a single chain of amino acids joined by peptide bonds. Polypeptides of the invention may comprise naturally occurring amino acids, synthetic amino acids, genetically encoded amino acids, non-genetically encoded amino acids, and combinations thereof. Polypeptides may include both L-form and D-form amino acids.

[0033] Representative non-genetically encoded amino acids include but are not limited to 2-aminoadipic acid; 3-aminoadipic acid; β-aminopropionic acid; 2-aminobutyric acid; 4- aminobutyric acid (piperidinic acid); 6-aminocaproic acid; 2-aminoheptanoic acid; 2- aminoisobutyric acid; 3-aminoisobutyric acid; 2-aminopimelic acid; 2,4-diaminobutyric acid; desmosine; 2,2'-diaminopimelic acid; 2,3-diaminopropionic acid; N-ethylglycine; N- ethylasparagine; hydroxylysine; allo-hydroxylysine; 3-hydroxyproline; 4-hydroxyproline; isodesmosine; allo-isoleucine; N-methylglycine (sarcosine); N-methylisoleucine; N- methylvaline; norvaline; norleucine; and ornithine.

[0034] Representative derivatized amino acids include, for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine.

[0035] As used herein, the term "isolated" refers to polynucleotides and polypeptides that, but for at least one act of man, do not exist in whatever form or amount they are found.

Exemplary embodiments include polynucleotides and polypeptides that are partially, substantially or wholly purified from other molecular species; polynucleotides and

polypeptides that are heterologous to a particular cell, organism, or part of an organism;

polynucleotides and polypeptides that are not heterologous to a particular cell, organism, or part of an organism, but are expressed at an altered level as a result of the at least one act of man; and polynucleotides and polypeptides that are expressed in the progeny or other downstream products (e.g., fruit) of a cell, organism, or part of an organism subject to the at least one act of man.

[0036] Exemplary DEP2 polynucleotides of the invention are set forth as SEQ ID NO: 1 and substantially identical sequences encoding DEP2 proteins capable of altering a trait of a plant, for example, improving yield, improving lodging resistance, improving panicle number, improving grain number per panicle, dwarf or semi-dwarf stature, improving photosynthetic efficiency, improving population growth rate during grain filling period, improving water transport capacity, improving mechanical strength of the stem, and improving dry matter production.

[0037] Exemplary DEP2 polypeptides of the invention are set forth as SEQ ID NO: 2 and substantially identical proteins capable of altering a trait of a plant, for example, improving yield, improving lodging resistance, improving panicle number, improving grain number per panicle, dwarf or semi-dwarf stature, improving photosynthetic efficiency, improving population growth rate during grain filling period, improving water transport capacity, improving mechanical strength of the stem, and improving dry matter production.

[0038] Substantially identical sequences are those that have at least 60%, preferably at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%), and most preferably at least 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence using a sequence comparison algorithm or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In an especially preferred embodiment, the sequences are substantially identical over the entire length of the coding regions. Furthermore, substantially identical nucleic acids or proteins perform substantially the same function. Substantially identical sequences may be polymorphic sequences, i.e., alternative sequences or alleles in a population. An allelic difference may be as small as one base pair. Substantially identical sequences may also comprise mutagenized sequences, including sequences comprising silent mutations. A mutation may comprise one or more residue changes, a deletion of one or more residues, or an insertion of one or more additional residues. Substantially identical nucleic acids are also identified as nucleic acids that hybridize specifically to or hybridize substantially to a reference sequence (e.g., SEQ ID NO: 1).

[0039] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0040] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math, 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol, 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA, 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr. , Madison, WI), or by visual inspection (see, Ausubel et al., infra).

[0041] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al, J. Mol. Biol, 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information

(http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative- scoring residue alignments, or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA, 89: 10915 (1989)).

[0042] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

[0043] Substantially identical sequences may be polymorphic sequences, i.e., alternative sequences or alleles in a population. An allelic difference may be as small as one base pair. Substantially identical sequences may also comprise mutagenized sequences, including sequences comprising silent mutations. A mutation may comprise one or more residue changes, a deletion of one or more residues, or an insertion of one or more additional residues.

[0044] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are those under which a nucleic acid probe will typically hybridize to its target sequence but to no other sequences when that sequence is present in a complex nucleic acid mixture (e.g., total cellular DNA or RNA). Stringent hybridization conditions and stringent hybridization wash conditions in the context of nucleic acid hybridization experiments such as Southern and Northern blot analyses are both sequence- and environment-dependent. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory

Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, part I chapter 2, Elsevier, New York (1993). Generally, highly stringent hybridization and wash conditions are selected to be about 5 °C lower than the thermal melting point (T _m ) for the specific sequence at a defined ionic strength and pH.

[0045] The T _m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the T _m for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide with 1 mg of heparin at 42 °C, with the hybridization being carried out overnight. An example of highly stringent wash conditions is 0.15 M NaCl at 72 °C for about 15 minutes. Another example of stringent wash conditions is a 0.2X SSC wash at 65 °C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An exemplary medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is IX SSC at 45 °C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4X - 6X SSC at 40 °C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.0 M sodium ions, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30 °C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.

[0046] The following are examples of hybridization and wash conditions that may be used to identify nucleotide sequences that are substantially identical to reference nucleotide sequences of the present invention. A substantially identical nucleotide sequence preferably hybridizes to a reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 ₄ , 1 mM EDTA at 50 °C with washing in 2X SSC, 0.1% SDS at 50 °C, more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 ₄ , 1 mM EDTA at 50 °C with washing in IX SSC, 0.1% SDS at 50 °C, still more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 ₄ , 1 mM EDTA at 50 °C with washing in 0.5X SSC, 0.1% SDS at 50 °C, even more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 ₄ , 1 mM EDTA at 50 °C with washing in 0.1X SSC, 0.1% SDS at 50 °C, and most preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 ₄ , 1 mM EDTA at 50 °C with washing in 0. IX SSC, 0.1% SDS at 65 °C.

[0047] A further indication that two nucleic acid sequences or proteins are substantially identical is that the that proteins encoded by the nucleic acids are substantially identical, share an overall three-dimensional structure, are biologically functional equivalents, or are immunologically cross-reactive with, or specifically bind to, each other. Nucleic acid molecules that do not hybridize to each other under stringent conditions are still substantially identical if the corresponding proteins are substantially identical. This may occur, for example, when two nucleotide sequences comprise conservatively substituted variants as permitted by the genetic code. This also includes degenerate codon substitutions wherein the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (see Batzer et al, Nucleic Acids Res., 19:5081(1991); Ohtsuka et al, J. Biol. Chem., 260:2605-2608 (1985); and Rossolini et al. Mol. Cell Probes, 8:91-98 (1994)). However, both the polynucleotides and the polypeptides of the present invention may be conservatively substituted at one or more residues. Examples of conservative amino acid substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another; the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine; the substitution of one basic residue such as lysine, arginine or histidine for another; or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another.

[0048] Nucleic acids of the invention also comprise nucleic acids complementary to SEQ ID NO: 1 and subsequences and elongated sequences of SEQ ID NO: 1 and complementary sequences thereof. Complementary sequences are two nucleotide sequences that comprise antiparallel nucleotide sequences capable of pairing with one another upon formation of hydrogen bonds between base pairs. Like other polynucleotides in accordance with the present invention, complementary sequences maybe substantially similar to one another as described previously. A particular example of a complementary nucleic acid segment is an antisense oligonucleotide.

[0049] A subsequence is a sequence of nucleic acids that comprises a part of a longer nucleic acid sequence. An exemplary subsequence is a probe or a primer. An elongated sequence is one in which nucleotides (or other analogous molecules) are added to a nucleic acid sequence. For example, a polymerase (e.g., a DNA polymerase) may add sequences at the 3' terminus of the nucleic acid molecule. In addition, the nucleotide sequence may be combined with other DNA sequences, such as promoters, promoter regions, enhancers, polyadenylation signals, introns, additional restriction enzyme sites, multiple cloning sites, and other coding segments. Thus, the present invention also provides vectors comprising the disclosed nucleic acids, including vectors for recombinant expression, wherein a nucleic acid of the invention is operatively linked to a functional promoter. When operatively linked to a nucleic acid, a promoter is in functional combination with the nucleic acid such that the transcription of the nucleic acid is controlled and regulated by the promoter region. Vectors refer to nucleic acids capable of replication in a host cell, such as plasmids, cosmids, and viral vectors.

[0050] Polynucleotides of the present invention may be cloned, synthesized, altered, mutagenized, or combinations thereof. Standard recombinant DNA and molecular cloning techniques used to isolate nucleic acids are known in the art. Site-specific mutagenesis to create base pair changes, deletions, or small insertions is also known in the art (see e.g.,

Sambrook et al. (eds.) Molecular Cloning: A Laboratory Manual 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Silhavy et al, Experiments with Gene Fusions. 1984, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Glover & Hames, DNA Cloning: A Practical Approach. 2nd ed., 1995, IRL Press at Oxford University Press, Oxford/New York; Ausubel (ed.) Short Protocols in Molecular Biology. 3rd ed., 1995, Wiley, New York).

[0051] Isolated polypeptides of the invention may be purified and characterized using a variety of standard techniques that are known to the skilled artisan (see e.g., Schroder et al, The Peptides. 1965, Academic Press, New York; Bodanszky, Principles of Peptide Synthesis. 2nd rev. ed. 1993, Springer- Verlag, Berlin/ New York; Ausubel (ed.), Short Protocols in Molecular Biology. 3rd ed., 1995, Wiley, New York).

[0052] The present invention also encompasses methods for detecting a nucleic acid molecule that encodes a DEP2 protein. Such methods may be used to detect DEP2 gene variants or altered gene expression. Sequences detected by methods of the invention may detected, subcloned, sequenced, and further evaluated by any measure well known in the art using any method usually applied to the detection of a specific DNA sequence. Thus, the nucleic acids of the present invention may be used to clone genes and genomic DNA comprising the disclosed sequences. Alternatively, the nucleic acids of the present invention may be used to clone genes and genomic DNA of related sequences. Levels of a DEP2 nucleic acid molecule may be measured, for example, using an RT-PCR assay (see e.g., Chiang, J. Chromatogr. A., 806:209-218 (1998) and references cited therein).

[0053] The present invention also encompasses genetic assays using DEP2 nucleic acids for quantitative trait loci (QTL) analysis and to screen for genetic variants, for example by allele-specific oligonucleotide (ASO) probe analysis (Conner et al, Proc. Natl. Acad. Sci.

USA, 80(l):278-282 (1983)), oligonucleotide ligation assays (OLAs) (Nickerson et al, Proc. Natl. Acad. Sci. USA, 87(22):8923-8927 (1990)), single-strand conformation polymorphism (SSCP) analysis (Orita et al, Proc. Natl. Acad. Sci. USA, 86(8):2766-2770 (1989)),

SSCP/heteroduplex analysis, enzyme mismatch cleavage, direct sequence analysis of amplified exons (Kestila et al, Mol. Cell, l(4):575-582 (1998); Yuan et al, Hum. Mutat., 14(5):440-446 (1999)), allele-specific hybridization (Stoneking et al, Am. J. Hum. Genet., 48(2): 370-382 (1991)), and restriction analysis of amplified genomic DNA containing the specific mutation. Automated methods may also be applied to large-scale characterization of single nucleotide polymorphisms (Wang et al, Am. J. Physiol, 1998, 274(4 Pt 2):H1132- 1140 (1992); Brookes, Gene, 234(2): 177-186 (1999)). Preferred detection methods are non- electrophoretic, including, for example, the TAQMAN™ allelic discrimination assay, PCR- OLA, molecular beacons, padlock probes, and well fluorescence (see Landegren et al, Genome Res., 8:769-776 (1998) and references cited therein). [0054] The present invention also encompasses functional fragments of a DEP2 polypeptide, for example, fragments that have the ability to alter a plant trait similar to that of SEQ ID NO: 2. Functional polypeptide sequences that are longer than the disclosed sequences are also encompassed. For example, one or more amino acids may be added to the N-terminus or C-terminus of an antibody polypeptide. Such additional amino acids may be employed in a variety of applications, including but not limited to purification applications. Methods of preparing elongated proteins are known in the art.

[0055] The present invention also encompasses methods for detecting a DEP2 polypeptide. Such methods can be used, for example, to determine levels of DEP2 protein expression and correlate the level of expression with the presence or change in phenotype, trait, or level of expression in a different gene or gene product. In certain embodiments, the method involves an immunochemical reaction with an antibody that specifically recognizes a DEP2 protein. Techniques for detecting such antibody-antigen conjugates or complexes are known in the art and include but are not limited to centrifugation, affinity chromatography and other immunochemical methods (see e.g., Ishikawa Ultrasensitive and Rapid Enzyme Immunoassay. 1999, Elsevier, Amsterdam/New York, United States of America; Law,

Immunoassay: A Practical Guide. 1996, Taylor & Francis, London/Bristol, Pennsylvania, United States of America; Liddell et al, Antibody Technology. 1995, Bios Scientific

Publishers, Oxford, United Kingdom; and references cited therein).

[0056] DEP2 Expression Systems

[0057] An expression system refers to a host cell comprising a heterologous nucleic acid and the protein encoded by the heterologous nucleic acid. For example, a heterologous expression system may comprise a host cell transfected with a construct comprising a DEP2 nucleic acid encoding a DEP2 protein operatively linked to a promoter, or a cell line produced by introduction of DEP2 nucleic acids into a host cell genome. The expression system may further comprise one or more additional heterologous nucleic acids relevant to DEP2 function, such as targets of DEP2 transcriptional activation or repression activity. These additional nucleic acids may be expressed as a single construct or multiple constructs.

[0058] A construct for expressing a DEP2 protein may include a vector sequence and a DEP2 nucleotide sequence, wherein the DEP2 nucleotide sequence is operatively linked to a promoter sequence. A construct for recombinant DEP2 expression may also comprise transcription termination signals and sequences required for proper translation of the nucleotide sequence. Preparation of an expression construct, including addition of translation and termination signal sequences, is known to one skilled in the art.

[0059] The promoter may be any polynucleotide sequence which shows transcriptional activity in the chosen plant cells, plant parts, or plants. The promoter may be native or analogous, or foreign or heterologous, to the plant host and/or to the DNA sequence of the invention. Where the promoter is native or endogenous to the plant host, it is intended that the promoter is found in the native plant into which the promoter is introduced. Where the promoter is foreign or heterologous to the DNA sequence of the invention, the promoter is not the native or naturally occurring promoter for the operably linked DNA sequence of the invention. The promoter may be inducible or constitutive. It may be naturally-occurring, may be composed of portions of various naturally-occurring promoters, or may be partially or totally synthetic. Guidance for the design of promoters is provided by studies of promoter structure, such as that of Harley et al, Nucleic Acids Res., 15:2343-61 (1987). Also, the location of the promoter relative to the transcription start may be optimized (see e.g., Roberts et al, Proc. Natl. Acad. Sci. USA, 76:760-4 (1979)). Many suitable promoters for use in plants are well known in the art.

[0060] For example, suitable constitutive promoters for use in plants include the promoters from plant viruses, such as the peanut chlorotic streak caulimovirus (PC1SV) promoter (U.S. Patent No. 5,850,019); the 35S and 19S promoters from cauliflower mosaic virus (CaMV) (Odell et al, Nature, 313 :810-812 (1985) and U.S. Patent No. 5,352,605); the promoters of Chlorella virus methyltransferase genes (U.S. Patent No. 5,563,328) and the full-length transcript promoter from figwort mosaic virus (FMV) (U.S. Patent No. 5,378,619); the promoters from such genes as rice actin (McElroy et al, Plant Cell, 2: 163-171 (1990)); ubiquitin (Binet et al, Plant Science, 79:87-94 (1991)), maize (Christensen et al, Plant Molec. Biol, 12: 619-632 (1989)), and arabidopsis (Norris et al, Plant Molec. Biol, 21 :895- 906 (1993); and Christensen et al, Plant Mol. Biol, 18:675-689 (1982)); pEMU (Last et al, Theor. Appl. Genet., 81 :581-588 (1991)); MAS (Velten et al, EMBO J., 3 :2723-2730 (1984)); maize H3 histone (Lepetit et al, Mol. Gen. Genet, 1992, 231 :276-285 (1992); and

Atanassova et al, Plant J., 2(3):291-300 (1992)); Brassica napus ALS3 (PCT International Publication No. WO 97/41228); and promoters of various Agrobacterium genes (e.g., U.S. Patent Nos. 4,771,002; 5, 102,796; 5, 182,200; and 5,428, 147).

[0061] Suitable inducible promoters for use in plants include the promoter from the ACE1 system which responds to copper (Mett et al., Proc. Natl. Acad. Sci. USA, 90:4567- 4571 (1993)); the promoter of the maize In2 gene which responds to benzenesulfonamide herbicide safeners (Hershey et al, Mol. Gen. Genetics, 227:229-237 (1991); and Gatz et al, Mol. Gen. Genetics, 243 :32-38 (1994)); and the promoter of the Tet repressor from TnlO (Gatz et al, Mol. Gen. Genet, 227:229-237 (1991)). Another inducible promoter for use in plants is one that responds to an inducing agent to which plants do not normally respond. An exemplary inducible promoter of this type is the inducible promoter from a steroid hormone gene, the transcriptional activity of which is induced by a glucocorticosteroid hormone (Schena et al, Proc. Natl. Acad. Sci. USA, 88: 10421 (1991)) or the recent application of a chimeric transcription activator, XVE, for use in an estrogen receptor-based inducible plant expression system activated by estradiol (Zuo et al., Plant J., 24:265-273 (2000)). Other inducible promoters for use in plants are described in EP 332104, PCT International

Publication Nos. WO 93/21334 and WO 97/06269. Promoters composed of portions of other promoters and partially or totally synthetic promoters can also be used (see e.g., Ni et al, Plant J., 7:661-676 (1995) and PCT International Publication No. WO 95/14098 describing such promoters for use in plants).

[0062] Tissue-specific or tissue-preferential promoters useful for the expression of the novel dense and erect panicle genes of the invention in plants, particularly maize, are those that direct expression in root, pith, leaf or pollen. Such promoters are disclosed in WO 93/07278. Other tissue specific promoters useful in the present invention include the cotton rubisco promoter disclosed in U.S. Patent No. 6,040,504; the rice sucrose synthase promoter disclosed in U.S. Patent No. 5,604, 121; and the cestrum yellow leaf curling virus promoter disclosed in PCT International Publication No. WO 01/73087. Chemically inducible promoters useful for directing the expression of the novel dense and erect panicle gene in plants are disclosed in U.S. Patent No. 5,614,395.

[0063] The promoter may include, or be modified to include, one or more enhancer elements to thereby provide for higher levels of transcription. Suitable enhancer elements for use in plants include the PC1SV enhancer element (U.S. Patent No. 5,850,019), the CaMV 35S enhancer element (U.S. Patent Nos. 5, 106,739 and 5, 164,316) and the FMV enhancer element (Maiti et al, Transgenic Res., 6: 143-156 (1997)). See also PCT International Publication No. WO 96/23898.

[0064] Such constructs can contain a 'signal sequence' or 'leader sequence' to facilitate co-translational or post-translational transport of the peptide of interest to certain intracellular structures such as the chloroplast (or other plastid), endoplasmic reticulum, or Golgi apparatus, or to be secreted. For example, the construct can be engineered to contain a signal peptide to facilitate transfer of the peptide to the endoplasmic reticulum. A signal sequence is known or suspected to result in cotranslational or post-translational peptide transport across the cell membrane. In eukaryotes, this typically involves secretion into the Golgi apparatus, with some resulting glycosylation. A leader sequence refers to any sequence that, when translated, results in an amino acid sequence sufficient to trigger co-translational transport of the peptide chain to a sub-cellular organelle. Thus, this includes leader sequences targeting transport and/or glycosylation by passage into the endoplasmic reticulum, passage to vacuoles, plastids including chloroplasts, mitochondria, and the like. Plant expression cassettes may also contain an intron, such that mRNA processing of the intron is required for expression.

[0065] Such constructs can also contain 5' and 3' untranslated regions. A 3 ' untranslated region is a polynucleotide located downstream of a coding sequence. Polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor are 3' untranslated regions. A 5' untranslated region is a polynucleotide located upstream of a coding sequence.

[0066] The termination region may be native with the transcriptional initiation region, may be native with the sequence of the present invention, or may be derived from another source. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions (see e.g., Guerineau et al, Mol. Gen. Genet, 262: 141-144 (1991); Proudfoot, Cell, 64:671-674 (1991); Sanfacon et al, Genes Dev., 5: 141-149 (1991); Mogen et al, Plant Cell, 2: 1261-1272 (1990); Munroe et al, Gene, 91 : 151-158 (1990); Ballas et al, Nucleic Acids Res., 17:7891-7903 (1989); and Joshi et al, Nucleic Acid Res., 15:9627-9639 (1987)).

[0067] Where appropriate, the vector and DEP2 sequences may be optimized for increased expression in the transformed host cell. That is, the sequences can be synthesized using host cell-preferred codons for improving expression, or may be synthesized using codons at a host-preferred codon usage frequency. Generally, the GC content of the polynucleotide will be increased (see e.g., Campbell et al, Plant Physiol. , 92: 1-11 (1990) for a discussion of host-preferred codon usage). Methods are known in the art for synthesizing host-preferred polynucleotides (see e.g., U.S. Patent Nos. 6,320, 100; 6,075, 185; 5,380,831; and 5,436,391, U.S. Application Publication Nos. 20040005600 and 20010003849, and Murray et al, Nucleic Acids Res., 17:477-498 (1989).

[0068] In certain embodiments, polynucleotides of interest are targeted to the chloroplast for expression. In this manner, where the polynucleotide of interest is not directly inserted into the chloroplast, the expression cassette may additionally contain a polynucleotide encoding a transit peptide to direct the nucleotide of interest to the chloroplasts. Such transit peptides are known in the art (see e.g., Von Heijne et al, Plant Mol. Biol. Rep., 9: 104-126 (1991); Clark et al, J. Biol. Chem., 264: 17544-17550 (1989); Della-Cioppa et al, Plant Physiol, 84:965-968 (1987); Romer et al, Biochem. Biophys. Res. Commun., 196: 1414-1421 (1993); and Shah et al, Science, 233 :478-481 (1986)). The polynucleotides of interest to be targeted to the chloroplast may be optimized for expression in the chloroplast to account for differences in codon usage between the plant nucleus and this organelle. In this manner, the polynucleotides of interest may be synthesized using chloroplast-preferred codons (see e.g., U.S. Patent No. 5,380,831).

[0069] A plant expression cassette (i.e., a DEP2 open reading frame operatively linked to a promoter) can be inserted into a plant transformation vector, which allows for the

transformation of DNA into a cell. Such a molecule may consist of one or more expression cassettes, and may be organized into more than one vector DNA molecule. For example, binary vectors are plant transformation vectors that utilize two non-contiguous DNA vectors to encode all requisite cis- and trans-acting functions for transformation of plant cells

(Hellens et al, Trends in Plant Science, 5:446-451 (2000)).

[0070] A plant transformation vector comprises one or more DNA vectors for achieving plant transformation. For example, it is a common practice in the art to utilize plant transformation vectors that comprise more than one contiguous DNA segment. These vectors are often referred to in the art as binary vectors. Binary vectors as well as vectors with helper plasmids are most often used for Agrobacterium-mediated transformation, where the size and complexity of DNA segments needed to achieve efficient transformation is quite large, and it is advantageous to separate functions onto separate DNA molecules. Binary vectors typically contain a plasmid vector that contains the cis-acting sequences required for T-DNA transfer (such as left border and right border), a selectable marker that is engineered to be capable of expression in a plant cell, and a polynucleotide of interest (i.e., a polynucleotide engineered to be capable of expression in a plant cell for which generation of transgenic plants is desired).

[0071] For certain target species, different antibiotic or herbicide selectable markers may be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra, Gene, 19:259-268 (1982); and Bevan et al, Nature, 304: 184-187 (1983)), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al, Nucl. Acids Res., 18: 1062 (1990), and Spencer et al, Theor. Appl. Genet., 79: 625-631 (1990)), the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. Cell. Biol, 4:2929-2931 (1984)), the dhfr gene, which confers resistance to methotrexate (Bourouis et al, EMBO J, 2(7): 1099-1104 (1983)), the EPSPS gene, which confers resistance to glyphosate (U.S. Patent Nos. 4,940,935 and 5, 188,642), and the mannose-6-phosphate isomerase gene, which provides the ability to metabolize mannose (U.S. Patent Nos. 5,767,378 and

5,994,629).

[0072] Also present on this plasmid vector are sequences required for bacterial

replication. The cis-acting sequences are arranged in a fashion to allow efficient transfer into plant cells and expression therein. For example, the selectable marker sequence and the sequence of interest are located between the left and right borders. Often a second plasmid vector contains the trans-acting factors that mediate T-DNA transfer from Agrobacterium to plant cells. This plasmid often contains the virulence functions (Vir genes) that allow infection of plant cells by Agrobacterium, and transfer of DNA by cleavage at border sequences and vir-mediated DNA transfer, as in understood in the art (Hellens et al, 2000). Several types of Agrobacterium strains (e.g., LBA4404, GV3101, EHA101, EHA105, etc.) can be used for plant transformation. The second plasmid vector is not necessary for introduction of polynucleotides into plants by other methods such as, e.g., microprojection, microinjection, electroporation, and polyethylene glycol.

[0073] In another embodiment, a nucleotide sequence of the present invention is directly transformed into a plastid genome. A major advantage of plastid transformation is that plastids are generally capable of expressing bacterial genes without substantial modification, and plastids are capable of expressing multiple open reading frames under control of a single promoter. Plastid transformation technology is extensively described in U.S. Patent Nos. 5,451,513, 5,545,817 and 5,545,818, in PCT International Application Publication WO 95/16783, and in McBride et al, Proc. Natl. Acad. Sci. USA, 91 :7301-7305 (1994). The basic technique for chloroplast transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the gene of interest into a suitable target tissue, e.g., using biolistics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation). The 1 to 1.5 kb flanking regions, termed targeting sequences, facilitate homologous recombination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome. Initially, point mutations in the chloroplast 16S rRNA and rpsl2 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab et al, Proc. Natl. Acad. Sci. USA, 87:8526-8530 (1990); Staub et al, Plant Cell, 4:39-45 (1992)). This results in stable homoplasmic transformants at a frequency of approximately one per 100 bombardments of target leaves. The presence of cloning sites between these markers allows creation of a plastid targeting vector for introduction of foreign genes (Staub et al, EMBO J, 12:601-606 (1993)). Substantial increases in transformation frequency are obtained by replacement of the recessive rRNA or r-protein antibiotic resistance genes with a dominant selectable marker, the bacterial aadA gene encoding the spectinomycin-detoxifying enzyme aminoglycoside-3'-adenyltransferase (Svab et al, Proc. Natl. Acad. Sci. USA, 90:913-917 (1993)). Previously, this marker had been used successfully for high-frequency

transformation of the plastid genome of the green alga Chlamydomonas reinhardtii

(Goldschmidt-Clermont, Nucl. Acids Res., 19:4083-4089 (1991)). Other selectable markers useful for plastid transformation are known in the art. Typically, approximately 15-20 cell division cycles following transformation are required to reach a homoplastidic state. Plastid expression, in which genes are inserted by homologous recombination into all of the several thousand copies of the circular plastid genome present in each plant cell, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readily exceed 10% of the total soluble plant protein. In a preferred embodiment, a nucleotide sequence of the present invention is inserted into a plastid- targeting vector and transformed into the plastid genome of a desired plant host. Plants homoplastic for plastid genomes containing a nucleotide sequence of the present invention are obtained, and are preferentially capable of high expression of the nucleotide sequence.

[0074] Host Cells

[0075] Host cells are cells into which a heterologous nucleic acid molecule of the invention may be introduced. Representative eukaryotic host cells include yeast and plant cells, as well as prokaryotic hosts such as E.coli and Bacillus subtilis. Preferred host cells for functional assays substantially or completely lack endogenous expression of a DEP2 protein.

[0076] A host cell strain may be chosen which modulates the expression of the recombinant sequence, or modifies and processes the gene product in a specific manner. For example, different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, phosphorylation of proteins). Appropriate cell lines or host cells may be chosen to ensure the desired

modification and processing of the foreign protein expressed. For example, expression in a bacterial system may be used to produce a non-glycosylated core protein product, and expression in yeast will produce a glycosylated product. The present invention further encompasses recombinant expression of a DEP2 protein in a stable cell line. Methods for generating a stable cell line following transformation of a heterologous construct into a host cell are known in the art (see e.g., Joyner, Gene Targeting: A Practical Approach. 1993, Oxford University Press, Oxford/New York). Thus,

transformed cells, tissues, and plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny or propagated forms thereof.

[0077] DEP2 Knockout Plants

[0078] The present invention also provides DEP2 knockout plants comprising a disruption of a DEP2 locus. A disrupted gene may result in expression of an altered level of full-length DEP2 protein or expression of a mutated variant DEP2 protein. Plants with complete or partial functional inactivation of the DEP2 gene may be generated, e.g., by expressing an amorphic (i.e., null mutation) or hypomorphic DEP2 allele in the plant. For example, an expression vector based on the genomic dep2-l (SEQ ID NO: 4) or dep2-2 (SEQ ID NO: 5) sequences may be generated and expressed in a plant or host cell (which is subsequently regenerated into a plant).

[0079] A knockout plant in accordance with the present invention may also be prepared using anti-sense, double-stranded RNA, or ribozyme DEP2 constructs, driven by a universal or tissue-specific promoter to reduce levels of DEP2 gene expression in somatic cells, thus achieving a "knock-down" phenotype. The present invention also provides the generation of plants with conditional or inducible inactivation of DEP2.

[0080] The present invention also encompasses transgenic plants with specific "knocked- in" modifications in the disclosed DEP2 gene. In certain embodiments, a "knocked-in" transgenic plant expresses an antimorphic (i.e., dominant negative) allele. In other embodiments, "knocked-in" transgenic plant expresses a hypermorphic (i.e., a gain of function) allele.

[0081] DEP2 knockout plants may be prepared in monocot or dicot plants, such as maize, wheat, barley, rye, sweet potato, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, squash, pumpkin, hemp, zucchini, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tomato, sorghum, sugarcane, sugar beet, sunflower, rapeseed, clover, tobacco, carrot, cotton, alfalfa, rice, potato, eggplant, cucumber, Arabidopsis, and woody plants such as coniferous and deciduous trees. Rice, wheat, barley, oat, soybean and rye are particularly contemplated. As used herein, a plant refers to a whole plant, a plant organ (e.g., root, stem, leaf, flower bud, or embryo), a seed, a plant cell, a propagule, an embryo, other plant parts (e.g., protoplasts, pollen, pollen tubes, ovules, embryo sacs, zygotes) and progeny of the same. Plant cells can be differentiated or undifferentiated (e.g., callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells, pollen).

[0082] For preparation of a DEP2 knockout plant, introduction of a polynucleotide into plant cells is accomplished by one of several techniques known in the art, including but not limited to electroporation or chemical transformation (see e.g., Ausubel, ed. (1994) Current Protocols in Molecular Biology. John Wiley and Sons, Inc., Indianapolis, Indiana). Markers conferring resistance to toxic substances are useful in identifying transformed cells (having taken up and expressed the test polynucleotide sequence) from non-transformed cells (those not containing or not expressing the test polynucleotide sequence). In one aspect of the invention, genes are useful as a marker to assess introduction of DNA into plant cells.

Transgenic plants, transformed plants, or stably transformed plants, or cells, tissues or seed of any of the foregoing, refer to plants that have incorporated or integrated exogenous polynucleotides into the plant cell. Stable transformation refers to introduction of a polynucleotide construct into a plant such that it integrates into the genome of the plant and is capable of being inherited by progeny thereof.

[0083] In general, plant transformation methods involve transferring heterologous DNA into target plant cells (e.g., immature or mature embryos, suspension cultures,

undifferentiated callus, protoplasts, etc), followed by applying a maximum threshold level of appropriate selection (depending on the selectable marker gene) to recover the transformed plant cells from a group of untransformed cell mass. Explants are typically transferred to a fresh supply of the same medium and cultured routinely. Subsequently, the transformed cells are differentiated into shoots after placing on regeneration medium supplemented with a maximum threshold level of selecting agent (i.e., temperature and/or herbicide). The shoots are then transferred to a selective rooting medium for recovering rooted shoot or plantlet. The transgenic plantlet then grow into mature plant and produce fertile seeds (see e.g., Hiei et al, Plant J., 6:271-282 (1994); and Ishida et al, Nat. Biotechnol., 14:745-750 (1996)). A general description of the techniques and methods for generating transgenic plants are found in Ayres et al, CRC Crit. Rev. Plant Sci, 13 :219-239 (1994); and Bommineni et al, Maydica, 42: 107-120 (1997). Since the transformed material contains many cells, both transformed and non-transformed cells are present in any piece of subjected target callus or tissue or group of cells. The ability to kill non-transformed cells and allow transformed cells to proliferate results in transformed plant cultures. Often, the ability to remove non-transformed cells is a limitation to rapid recovery of transformed plant cells and successful generation of transgenic plants. Then molecular and biochemical methods can be used for confirming the presence of the integrated nucleotide(s) of interest in the genome of transgenic plant.

[0084] Generation of transgenic plants may be performed by one of several methods, including but not limited to introduction of heterologous DNA by Agrobacterium into plant cells (Agrobacterium-mediated transformation), bombardment of plant cells with

heterologous foreign DNA adhered to particles, and various other non-particle direct- mediated methods to transfer DNA (see e.g., Hiei et al, Plant J.„ 6:271-282 (1994); Ishida et al, Nat. Biotechnol., 14:745-750 (1996); Ayres et al, CRC Crit. Rev. Plant Set, 13 :219-239 (1994); and Bommineni et al, Maydica, 1997, 42: 107-120 (1997)).

[0085] There are three common methods to transform plant cells with Agrobacterium. The first method is co-cultivation of Agrobacterium with cultured isolated protoplasts. This method requires an established culture system that allows culturing protoplasts and plant regeneration from cultured protoplasts. The second method is transformation of cells or tissues with Agrobacterium. This method requires (a) that the plant cells or tissues can be transformed by Agrobacterium and (b) that the transformed cells or tissues can be induced to regenerate into whole plants. The third method is transformation of seeds, apices or meristems with Agrobacterium. This method requires micropropagation.

[0086] The efficiency of transformation by Agrobacterium may be enhanced by using a number of methods known in the art. For example, the inclusion of a natural wound response molecule such as acetosyringone (AS) to the Agrobacterium culture has been shown to enhance transformation efficiency with Agrobacterium tumefaciens (Shahla et al, Plant Molec. Biol, 8:291-298 (1987)). Alternatively, transformation efficiency may be enhanced by wounding the target tissue to be transformed. Wounding of plant tissue may be achieved, for example, by punching, maceration, bombardment with microprojectiles (see e.g., Bidney et al, Plant Molec. Biol, 18:301-313 (1992).

[0087] In one embodiment, the plant cells are transfected with vectors via particle bombardment (i.e., with a gene gun). Particle mediated gene transfer methods are known in the art, are commercially available, and include, but are not limited to, the gas driven gene delivery instrument described in U.S. Patent No. 5,584,807. This method involves coating the polynucleotide sequence of interest onto heavy metal particles, and accelerating the coated particles under the pressure of compressed gas for delivery to the target tissue. [0088] Other particle bombardment methods are also available for the introduction of heterologous polynucleotide sequences into plant cells. Generally, these methods involve depositing the polynucleotide sequence of interest upon the surface of small, dense particles of a material such as gold, platinum, or tungsten. The coated particles are themselves then coated onto either a rigid surface, such as a metal plate, or onto a carrier sheet made of a fragile material such as mylar. The coated sheet is then accelerated toward the target biological tissue. The use of the flat sheet generates a uniform spread of accelerated particles that maximizes the number of cells receiving particles under uniform conditions, resulting in the introduction of the polynucleotide sample into the target tissue.

[0089] Specific initiation signals may also be used to achieve more efficient translation of sequences encoding the polypeptide of interest. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding the polypeptide of interest, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a portion thereof, is inserted, exogenous translational control signals including the ATG initiation codon should be provided. Furthermore, the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons may be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers that are appropriate for the particular cell system that is used, such as those described in the literature (Scharf et al, Results Probl. Cell Differ., 20: 125 (1994)).

[0090] The cells that have been transformed may be grown into plants in accordance with conventional ways (see e.g., McCormick et al, Plant Cell Rep., 5:81-84 (1986)). These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as transgenic seed) having a polynucleotide of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.

[0091] Transgenic plants of the invention can be homozygous for the added

polynucleotides; i.e., a transgenic plant that contains two added sequences, one sequence at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains the added sequences according to the invention, germinating some of the seed produced and analyzing the resulting plants produced for enhanced enzyme activity (i.e., herbicide resistance) and/or increased plant yield relative to a control (native, non-transgenic) or an independent segregant transgenic plant.

[0092] It is to be understood that two different transgenic plants can also be mated to produce offspring that contain two independently segregating added, exogenous

polynucleotides. Selfing of appropriate progeny can produce plants that are homozygous for all added exogenous polynucleotides that encode a polypeptide of the present invention. Back-crossing to a parental plant and outcrossing with a non-transgenic plant are also contemplated.

[0093] Following introduction of DNA into plant cells, the transformation or integration of the polynucleotide into the plant genome is confirmed by various methods such as analysis of polynucleotides, polypeptides and metabolites associated with the integrated sequence.

[0094] DEP2 Inhibitors

[0095] The present invention further discloses assays to identify DEP2 binding partners and DEP2 inhibitors. DEP2 antagonists/inhibitors are agents that alter the function of a DEP2 protein e.g., by altering chemical and biological activities or properties. Methods of identifying inhibitors involve assaying a reduced level or quality of DEP2 function in the presence of one or more agents. Exemplary DEP2 inhibitors include small molecules as well as biological inhibitors as described herein below.

[0096] As used herein, the term "agent" refers to any substance that potentially interacts with a DEP2 nucleic acid or protein, including any of synthetic, recombinant, or natural origin. An agent suspected to interact with a protein may be evaluated for such an interaction using the methods disclosed herein.

[0097] Exemplary agents include but are not limited to peptides, proteins, nucleic acids, small molecules (e.g., chemical compounds), antibodies or fragments thereof, nucleic acid- protein fusions, any other affinity agent, and combinations thereof. An agent to be tested may be a purified molecule, a homogenous sample, or a mixture of molecules or compounds.

[0098] A small molecule refers to a compound, for example an organic compound, with a molecular weight of less than about 1,000 daltons, more preferably less than about 750 daltons, still more preferably less than about 600 daltons, and still more preferably less than about 500 daltons. A small molecule also preferably has a computed log octanol-water partition coefficient in the range of about -4 to about +14, more preferably in the range of about -2 to about +7.5.

[0099] Exemplary nucleic acids that may be used to disrupt DEP2 function include antisense RNA and small interfering RNAs (siRNAs) (see e.g., U.S. Application Publication No. 20060095987. These inhibitory molecules may be prepared based upon the DEP2 gene sequence and known features of inhibitory nucleic acids (see e.g., Van der Krol et al, Plant

Cell, 2:291-299 (1990); Napoli et al, Plant Cell, 2:279-289 (1990); English et al, Plant Cell,

8: 179-188 (1996); and Waterhouse et al, Nature Rev. Genet, 2003, 4:29-38 (2003).

[00100] Agents may be obtained or prepared as a library or collection of molecules. A library may contain a few or a large number of different molecules, varying from about ten molecules to several billion molecules or more. A molecule may comprise a naturally occurring molecule, a recombinant molecule, or a synthetic molecule. A plurality of agents in a library may be assayed simultaneously. Optionally, agents derived from different libraries may be pooled for simultaneous evaluation.

[00101] Representative libraries include but are not limited to a peptide library (U.S.

Patent Nos. 6, 156,511, 6, 107,059, 5,922,545, and 5,223,409), an oligomer library (U.S.

Patent Nos. 5,650,489 and 5,858,670), an aptamer library (U.S. Patent Nos. 7,338,762;

7,329,742; 6,949,379; 6, 180,348; and 5,756,291), a small molecule library (U.S. Patent Nos.

6, 168,912 and 5,738,996), a library of antibodies or antibody fragments (U.S. Patent Nos. 6, 174,708, 6,057,098, 5,922,254, 5,840,479, 5,780,225, 5,702,892, and 5,667988), a library of nucleic acid-protein fusions (U.S. Patent No. 6,214,553), and a library of any other affinity agent that may potentially bind to a DEP2 protein.

[00102] A library may comprise a random collection of molecules. Alternatively, a library may comprise a collection of molecules having a bias for a particular sequence, structure, or conformation, for example, as for inhibitory nucleic acids (see e.g., U.S. Patent Nos.

5,264,563 and 5,824,483). Methods for preparing libraries containing diverse populations of various types of molecules are known in the art, for example as described in U.S. patents cited herein above. Numerous libraries are also commercially available.

[00103] A control level or quality of DEP2 activity refers to a level or quality of wild type DEP2 activity, for example, when using a recombinant expression system comprising expression of SEQ ID NO: 2. When evaluating the inhibiting capacity of an agent, a control level or quality of DEP2 activity comprises a level or quality of activity in the absence of the agent. A control level may also be established by a phenotype or other measureable trait. [00104] Methods of identifying DEP2 inhibitors also require that the inhibiting capacity of an agent be assayed. Assaying the inhibiting capacity of an agent may comprise determining a level of DEP2 gene expression; determining DNA binding activity of a recombinantly expressed DEP2 protein; determining an active conformation of a DEP2 protein; or determining a change in a trait in response to binding of a DEP2 inhibitor (e.g., yield, lodging resistance, panicle number, grain number per panicle, dwarf or semi-dwarf stature, photo synthetic efficiency, population growth rate during grain filling period, water transport capacity, mechanical strength of the stem, and dry matter production). In particular embodiments, a method of identifying a DEP2 inhibitor may comprise (a) providing a cell, plant, or plant part expressing a DEP2 protein; (b) contacting the cell, plant, or plant part with an agent; (c) examining the cell, plant, or plant part for a change in a trait as compared to a control; and (d) selecting an agent that induces a change in the trait as compared to a control. Any of the agents so identified in the disclosed inhibitory or binding assays (see hereinafter) may be subsequently applied to a cell, plant or plant part as desired to effectuate a change in that cell, plant or plant part. For example, disruption of a DEP2 gene (e.g., SEQ ID NO: 1) or inhibition of a DEP2 polynucleotide or polypeptide (e.g., SEQ ID NO: 2) would alter one or more plant traits in a desirable way (e.g., increase grain yield).

[00105] The present invention also encompasses a rapid and high throughput screening method that relies on the methods described herein. This screening method comprises separately contacting a DEP2 protein with a plurality of agents. In such a screening method the plurality of agents may comprise more than about 10 ⁴ samples, or more than about 10 ⁵ samples, or more than about 10 ⁶ samples.

[00106] The in vitro and cellular assays of the invention may comprise soluble assays, or may further comprise a solid phase substrate for immobilizing one or more components of the assay. For example, a DEP2 protein, or a cell expressing a DEP2 protein, may be bound directly to a solid state component via a covalent or non-covalent linkage. Optionally, the binding may include a linker molecule or tag that mediates indirect binding of a DEP2 protein to a substrate. [00107] DEP2 Binding Assays

[00108] The present invention also encompasses methods of identifying of a DEP2 inhibitor by determining specific binding of a substance (e.g., an agent described previously) to a DEP2 protein. For example, a method of identifying a DEP2 binding partner may comprise: (a) providing a DEP2 protein of SEQ ID NO: 2; (b) contacting the DEP2 protein with one or more agents under conditions sufficient for binding; (c) assaying binding of the agent to the isolated DEP2 protein; and (d) selecting an agent that demonstrates specific binding to the DEP2 protein. Specific binding may also encompass a quality or state of mutual action such that binding of an agent to a DEP2 protein is inhibitory.

[00109] Specific binding refers to a binding reaction which is determinative of the presence of the protein in a heterogeneous population of proteins and other biological materials. The binding of an agent to a DEP2 protein may be considered specific if the binding affinity is about lxl0 ⁴ M ^_1 to about lxl0 ⁶ M ^_1 or greater. Specific binding also refers to saturable binding. To demonstrate saturable binding of an agent to a DEP2 protein, Scatchard analysis may be carried out as described, for example, by Mak et al, J. Biol. Chem., 264:21613-21618 (1989).

[00110] Several techniques may be used to detect interactions between a DEP2 protein and an agent without employing a known competitive inhibitor. Representative methods include, but are not limited to, Fluorescence Correlation Spectroscopy, Surface-Enhanced Laser Desorption/Ionization Time-Of- flight Spectroscopy, and BIACORE® technology, each technique described herein below. These methods are amenable to automated, high- throughput screening.

[00111] Fluorescence Correlation Spectroscopy (FCS) measures the average diffusion rate of a fluorescent molecule within a small sample volume. The sample size may be as low as 10 ³ fluorescent molecules and the sample volume as low as the cytoplasm of a single bacterium. The diffusion rate is a function of the mass of the molecule and decreases as the mass increases. FCS may therefore be applied to protein-ligand interaction analysis by measuring the change in mass and therefore in diffusion rate of a molecule upon binding. In a typical experiment, the target to be analyzed (e.g., a DEP2 protein) is expressed as a recombinant protein with a sequence tag, such as a poly-histidine sequence, inserted at the N- terminus or C-terminus. The expression is mediated in a host cell, such as E.coh, yeast, Xenopus oocytes, or mammalian cells. The protein is purified using chromatographic methods. For example, the poly-histidine tag may be used to bind the expressed protein to a metal chelate column such as Ni ²⁺ chelated on iminodiacetic acid agarose. The protein is then labeled with a fluorescent tag such as carboxytetramethylrhodamine or BODIPY™ reagent (available from Molecular Probes of Eugene, Oregon). The protein is then exposed in solution to the potential ligand, and its diffusion rate is determined by FCS using

instrumentation available from Carl Zeiss, Inc. (Thornwood of New York, New York).

Ligand binding is determined by changes in the diffusion rate of the protein. [00112] Surface-Enhanced Laser Desorption/Ionization (SELDI) was developed by Hutchens & Yip, Rapid Commun. Mass Spectrom., 1993, 7:576-580. When coupled to a time-of-flight mass spectrometer (TOF), SELDI provides a technique to rapidly analyze molecules retained on a chip. It may be applied to ligand-protein interaction analysis by covalently binding the target protein, or portion thereof, on the chip and analyzing by mass spectrometry the small molecules that bind to this protein (Worrall et al, Anal Chem., 1998, 70(4):750-756 (1998)). In a typical experiment, a target protein (e.g., a DEP2 protein) is recombinantly expressed and purified. The target protein is bound to a SELDI chip either by utilizing a poly-histidine tag or by other interaction such as ion exchange or hydrophobic interaction. A chip thus prepared is then exposed to the potential ligand via, for example, a delivery system able to pipet the ligands in a sequential manner (autosampler). The chip is then washed in solutions of increasing stringency, for example a series of washes with buffer solutions containing an increasing ionic strength. After each wash, the bound material is analyzed by submitting the chip to SELDI-TOF. Ligands that specifically bind a target protein are identified by the stringency of the wash needed to elute them.

[00113] BIACORE® relies on changes in the refractive index at the surface layer upon binding of a ligand to a target protein (e.g., a DEP2 protein) immobilized on the layer. In this system, a collection of small ligands is injected sequentially in a 2-5 microliter cell, wherein the target protein is immobilized within the cell. Binding is detected by surface plasmon resonance (SPR) by recording laser light refracting from the surface. In general, the refractive index change for a given change of mass concentration at the surface layer is practically the same for all proteins and peptides, allowing a single method to be applicable for any protein. In a typical experiment, a target protein is recombinantly expressed, purified, and bound to a BIACORE® chip. Binding may be facilitated by utilizing a poly-histidine tag or by other interaction such as ion exchange or hydrophobic interaction. A chip thus prepared is then exposed to one or more potential ligands via the delivery system

incorporated in the instruments sold by Biacore (Uppsala, Sweden) to pipet the ligands in a sequential manner (autosampler). The SPR signal on the chip is recorded and changes in the refractive index indicate an interaction between the immobilized target and the ligand.

Analysis of the signal kinetics of on rate and off rate allows the discrimination between nonspecific and specific interaction (see also Homola et al, Sensors and Actuators, 54:3-15 (1999) and references therein). [00114] Conformational Assays

[00115] The present invention also encompasses methods of identifying DEP2 binding partners and inhibitors that rely on a conformational change of a DEP2 protein when bound by or otherwise interacting with a substance (e.g., an agent described previously). For example, application of circular dichroism to solutions of macromolecules reveals the conformational states of these macromolecules. The technique may distinguish random coil, alpha helix, and beta chain conformational states.

[00116] To identify inhibitors of a DEP2 protein, circular dichroism analysis may be performed using a recombinantly expressed DEP2 protein. A DEP2 protein is purified, for example by ion exchange and size exclusion chromatography, and mixed with an agent. The mixture is subjected to circular dichroism. The conformation of a DEP2 protein in the presence of an agent is compared to a conformation of a DEP2 protein in the absence of the agent. A change in conformational state of a DEP2 protein in the presence of an agent identifies a DEP2 binding partner or inhibitor. Representative methods are described in U.S. Patent Nos. 5,776,859 and 5,780,242. Antagonistic activity of the inhibitor may be assessed using functional assays, such assaying nitrate content, nitrate uptake, lateral root growth, or plant biomass, as described herein.

[00117] In accordance with the disclosed methods, cells expressing DEP2 may be provided in the form of a kit useful for performing an assay of DEP2 function. For example, a kit for detecting a DEP2 may include cells transfected with DNA encoding a full-length DEP2 protein and a medium for growing the cells.

[00118] Assays of DEP2 activity that employ transiently transfected cells may include a marker that distinguishes transfected cells from non-transfected cells. A marker may be encoded by or otherwise associated with a construct for DEP2 expression, such that cells are simultaneously transfected with a nucleic acid molecule encoding DEP2 and the marker.

Representative detectable molecules that are useful as markers include but are not limited to a heterologous nucleic acid, a protein encoded by a transfected construct (e.g., an enzyme or a fluorescent protein), a binding protein, and an antigen.

[00119] Assays employing cells expressing recombinant DEP2 or plants expressing DEP2 may additionally employ control cells or plants that are substantially devoid of native DEP2 and, optionally, proteins substantially similar to a DEP2 protein. When using transiently transfected cells, a control cell may comprise, for example, an untransfected host cell. When using a stable cell line expressing a DEP2 protein, a control cell may comprise, for example, a parent cell line used to derive the /}EP2-expressing cell line. [00120] Anti-DEP2 Antibodies

[00121] In another aspect of the invention, a method is provided for producing an antibody that specifically binds a DEP2 protein. According to the method, a full-length recombinant DEP2 protein is formulated so that it may be used as an effective immunogen, and used to immunize an animal so as to generate an immune response in the animal. The immune response is characterized by the production of antibodies that may be collected from the blood serum of the animal.

[00122] An antibody is an immunoglobulin protein, or antibody fragments that comprise an antigen binding site (e.g., Fab, modified Fab, Fab', F(ab') ₂ or Fv fragments, or a protein having at least one immunoglobulin light chain variable region or at least one

immunoglobulin heavy chain region). Antibodies of the invention include diabodies, tetrameric antibodies, single chain antibodies, tretravalent antibodies, multispecific antibodies (e.g., bispecific antibodies), and domain- specific antibodies that recognize a particular epitope. Cell lines that produce anti-DEP2 antibodies are also encompassed by the invention.

[00123] Specific binding of an antibody to a DEP2 protein refers to preferential binding to a DEP2 protein in a heterogeneous sample comprising multiple different antigens.

Substantially lacking binding describes binding of an antibody to a control protein or sample, i.e., a level of binding characterized as non-specific or background binding. The binding of an antibody to an antigen is specific if the binding affinity is at least about 10 ^"7 M or higher, such as at least about 10 ^"8 M or higher, including at least about 10 ^"9 M or higher, at least about 10 ^"11 M or higher, or at least about 10 ^"12 M or higher.

[00124] DEP2 antibodies prepared as disclosed herein may be used in methods known in the art relating to the expression and activity of DEP2 proteins, e.g., for cloning of nucleic acids encoding a DEP2 protein, immunopurification of a DEP2 protein, and detecting a DEP2 protein in a plant sample, and measuring levels of a DEP2 protein in plant samples. To perform such methods, an antibody of the present invention may further comprise a detectable label, including but not limited to a radioactive label, a fluorescent label, an epitope label, and a label that may be detected in vivo. Methods for selection of a label suitable for a particular detection technique, and methods for conjugating to or otherwise associating a detectable label with an antibody are known to one skilled in the art. [00125] Examples

[00126] The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations which are evident as a result of the teachings provided herein.

[00127] Example 1

[00128] Phenotypic analysis of dep2 mutants

[00129] Two rice mutants, dep2-l (O. sativa L. japonica cv. Zhonghual 1) and dep2-2 (O. sativa L. japonica cv. Nipponbare) were isolated from a T-DNA insertion population. Rice plants were cultivated in an experimental field at the Institute of Genetics and Developmental Biology in Beijing for the natural growing season.

[00130] Phenotypic analysis indicated that the morphology of dep2 mutants was comparable to the wild type plant from the vegetative developmental stage to the early reproductive stage. However, wild type panicles began to bend 3 weeks after anthesis as grain weight increased, while the panicles of dep2 plants stayed upright even after the grains had fully matured (see Figure 1 A).

[00131] In addition, dep2 mutants also showed a slight reduction in plant height (see Figure 1 A and Table 1), an obvious decrease in panicle length (see Figure IB), and a significant increase in both rachis and stem diameter (see Table 1).

[00132] Table 1. Morphometric analysis of wild type and dep2 plants

Grain width(mm) 3.5 + 0.11 3.9 + 0.24*** 3.26 + 0.16 3.73 + 0.14***

Grain 2.3 + 0.09 2.6 + 0.05*** 2.08 + 0.08 2.29 + 0.06*** thickness(mm)

Leave length(mm) 38.5 + 5.5 28.0 + 4.5*** 35.0 + 5.4 25.8 + 3.6***

Leave wideth(mm) 1.43 + 0.06 1.59 + 0.1 *** 1.45 + 0.07 1.61 + 0.09***

100-grain weight 2.72±0.01 2.51±0.03*** 2.26±0.05 2.12±0.01 **

(g)

Grain yield(g/m2) 779.8±55.4 765.8±36.2

NPB - number of primary branches per panicle; NSB - number of secondary branches per panicle; SN - number of spikelets per panicle. Data are averages of 15 plants (±SD).

Asterisks indicate the significance of differences between wild type and dep2 plants as determined by Student's t test: * 0.01<P<0.05, ** 0.001<P<0.01, *** P<0.001.

[00133] The leaves of dep2 are short, wide, and erect, and the overall appearance of the mutant is more compact compared to the wild type (see Figure 2). A detailed analysis showed that there was no difference between wild type and dep2 plants in the number of primary and secondary branches and total number of spikelets per panicle (see Figure ID and Table 1). The grain density of dep2 plants was increased due to the decreased panicle length,. The grains of dep2 plants were also wider and shorter than the wild type (see Figure 1C), and a slight decrease in the 100-grain weight was observed (e.g., 2.51 g in dep2-l in contrast to 2.72 g in Zhonghual 1 (see Table 1)).

[00134] These results indicated that DEP2 has pleiotropic effects on plant architecture, and the increased diameter of the rachis and decreased panicle length altogether contributed to the dense and erect panicle phenotype.

[00135] Example 2

[00136] Histological Analysis

[00137] In order to examine the defects in dep2 panicles, shoot apexes of wild type and dep2 plants were collected on a daily basis from the vegetative stage shortly before phase transition to the end of floral differentiation. Shoot apexes were dissected carefully and fixed overnight at 4 °C in FAA (formalin: glacial acetic acid: 70% ethanol; 1 : 1 : 18), and dehydrated in a graded ethanol series. The samples were dried in a critical-point drier, sputter-coated with platinum, and observed under a scanning electron microscope.

[00138] No significant differences were observed between the wild type and the mutant at early developmental stages, including the generation of the first and second bract (see Figures 3 A and 3E), formation of primary and secondary branch primordia (Figures 3B and 3F and 3C and 3G) and flower organs (see Figures 3D and 3H).

[00139] Further, no differences between wild type and mutant panicles were observed by the time that the wild type panicle had grown to 1 cm in length (see Figure 31). In contrast, the panicle length of the mutant was only about 3.5 cm long when the wild type panicle reached 5 cm in length (see Figure 3 J). The delayed growth of the mutant panicles continued through remaining panicle development, leading to a reduced panicle length (see Figures 3K, 3L and 3M). These results are consistent with the developmental course of the florets (see Figures 3N through 3R).

[00140] Development of rice inflorescence is categorized into nine stages. Proximal primary branch primordia, in spite of earlier formation, seem not to elongate until the last primordium is formed, and all primordia almost simultaneously start to elongate at In8, when the length of inflorescences reach 40 mm and differentiation of all floral organs is complete. Based on these categories, we concluded that the erect panicle in dep2 mutants was formed in the late stage of panicle development, while the formation of primordia and differentiation of spikelets were not affected in young panicle development.

[00141] To further investigate whether the defect in the elongation of the inflorescences in dep2 mutants was caused by abnormal cell elongation and/or cell division, longitudinal sections of uppermost internodes, rachis axis and florets under a microscope at the late stage of heading were compared. The uppermost internodes, rachis axis and florets in the late stage of heading were fixed in FAA (formaldehyde: glacial acetic acid: 70% ethanol; 1 : 1 : 18), and dehydrated in a gradient ethanol series. The samples were embedded in Paraplast® Plus (Sigma). Microtome sections of 10 μπι thickness were applied to silane-coated glass slides (Sigma). Paraffin was removed from the sections using xylene, and the sections were dehydrated through a gradient ethanol series, and stained with toluidine blue before observation.

[00142] No differences were identified between wild type and dep2 mutant cell lengths in any of the three organs (see Figures 4A through 4F), implying that the decrease in panicle length might be caused by a defect in cell division.

[00143] Example 3

[00144] Cloning of the DEP2

[00145] Genetic analysis revealed that dep2-l (SEQ ID NO: 1) and dep2-2 (SEQ ID NO: 3) are allelic to each other and are caused by single recessive nuclear gene mutation. Mapping populations were constructed based on crosses between the mutants and Minghui 63, an indica variety. Plants exhibiting a dense and erect panicle phenotype in the F ₂ progeny were selected for the genetic linkage analysis. Molecular markers distributed throughout the rice genome were utilized for preliminary mapping and additional STS markers were designed according to the DNA sequences of indica and japonica. Forward and reverse primer pairs were used for MP1 (5'- TACCTCTTCCGTTCACTG-3 ' (SEQ ID NO: 6) and 5'- T ACGTTT ACTTTGTTC ATCT-3 ' (SEQ ID NO: 7)), MP2 (5'- AGGAGCCC ATCCGATCTTCT-3 ' (SEQ ID NO: 8) and 5'- GGAGC AGCGCT AGGGTGAG-3 ' (SEQ ID NO: 9)), MP5 (5'- C ATGAACCTTTTGC ATTT-3 ' (SEQ ID NO: 10) and 5'-

TTGGCT AT ACT ATTGAACCTG-3 ' (SEQ ID NO: 11)), MP11 (5'-

CAACCGAATCC AAAGTC A-3 ' (SEQ ID NO: 12) and 5'-

AACGGAACTC AACTC ACC A-3 ' (SEQ ID NO: 13)), and MP15 (5'-

ACTGATTCCGC ATT ATTTG-3 ' (SEQ ID NO: 14) and 5'- TAGTGGCGGTAGAGGTAC- 3'(SEQ ID NO: 15)).

[00146] The DEP2 locus was mapped to the long arm of rice chromosome 7 between markers Ml and M5 (see Figure 5A). Three other molecular markers were developed and further delimited the target gene to a 27-kb region by bounded by markers M2 and Ml 5 (see Figure 4A). Within this 27-kb interval, there were five predicted ORFs: LOC_Os07g42390, LOC_Os07g42395, LOC_Os07g42400, LOC_Os07g42410, and LOC_Os07g42420 (see Figure 5B).

[00147] A DNA sequence comparison revealed a 31-bp deletion in the sixth exon and a G/A substitution in the second intron of LOC_Os07g42410 from dep2-l and dep2-2 respectively (see Figure 5C). No sequence differences were found in other predicted ORFs in either mutant. The 31-bp deletion in dep2-l starts 2184 bp from the initiation codon ATG and caused a frameshift. The G/A substitution in the second intron of dep2-2 caused an altered splicing site of the second intron and also led to a frameshift. The genomic sequences of the DEP2 wild type (SEQ ID NO: 3), dep2-l (SEQ ID NO: 4) and dep2-2 (SEQ ID NO: 5) alleles are provided. A truncated DEP2 polypeptide (SEQ ID NO: 26) based on the dep2-l sequence is also provided. [00148] Example 4

[00149] Complementation Study

[00150] An 11.1-kb genomic fragment containing the entire DEP2 coding region, a 2,397- bp 5' upstream sequence and a 1,335-bp 3' downstream region was acquired from BAC a0079J03 digested with the restriction enzyme BgRVSwal. This 11.1-kb fragment was inserted into a pCAMBIA1300 vector carrying a hygromycin-resistant gene by digesting with BgRllSmal to generate the transformation plasmid for the complementation test. The resulting transformation plasmid, as well as the empty pCAMBIA1300 vector as control, was introduced into the dep2-2 mutant by Agrobacterium-mediated transformation.

[00151] Further, an RNAi construct was also created using methods described in Luo et al, Plant Cell Physiol ; 47 : 181 - 191 (2006). The OsGRF fragment in pCGI was replaced with the ORF fragments oiDEP2 (p4501 targeting to +2875 to + 3203 bp) using forward and reverse primers 5 '-CTCGAGAAAAT AC AAAGCCCTC AG-3 ' (SEQ ID NO: 16) and 5'- AGATCT AATCC AGCTAT ACCGAC A-3 ' (SEQ ID NO: 17). DNA fragments consisting of a sense and an antisense strand separated by an intron were inserted into pXQ35S (a derivative of pCAMBIA2300 carrying the CaMV 35S promoter and the OCS terminator), and wild type plants were transformed according to known protocols.

[00152] As shown in Figures 5D and 5E, the dep2-2 mutant phenotype was rescued in transgenic plants carrying the DEP2 gene. In contrast, DEP2 knockout transgenic plants mimicked the dep2 mutant phenotype (see Figures 3F and 3G). Accordingly, a skilled artisan would be able to readily rescue other mutant plants and/or create knockout mutants from wild type plants using the disclosure provided herein.

[00153] Example 5

[00154] RNA extraction and quantitative RT-PCR

[00155] Total RNA was extracted using the guanidinium isocyanate/acidic phenol method described in Chomczynski, Anal. Biochem., 162: 156-159 (1987). The RNA was pre-treated with DNase I, and first-strand cDNA was synthesized from 2 μg total RNA using oligo(dT)i ₈ as primers. First-strand cDNA product equivalent to 50 ng total RNA was used as template in a 20 μΐ PCR reaction. For quantitative RT-PCR, SYBR® Green I was added to the reaction system and run on a Chromo4 Four-Color Real-Time PCR Detection System (Bio-Rad) according to the manufacturer's instructions. The data were analyzed using Opticon monitor software (Bio-Rad). Experiments were repeated three times for each gene. The rice ACTIN1 gene was used as an internal control in the analysis (primer pairs 5'- AC ATCGCCCTGGACTATGACC A-3 ' (SEQ ID NO: 18) and 5'-

GTCGT ACTC AGCCTTGGC AAT-3 ' (SEQ ID NO: 19)). The primers for quantitative RT- PCR analysis ΟΪΌΕΡ2 expression were 5'- TGCGTGATAGCCTAGAACGAAG-3' (SEQ ID NO: 20) and 5'- CTGGAATC AGC ACTCCTGGATG-3 ' (SEQ ID NO: 21). As shown in Figure 4H, the transcription level of DEP2 is dramatically decreased in dep2-l plants.

[00156] Example 6

[00157] Expression pattern of DEP2

[00158] The spatial and temporal expression pattern of DEP2 was examined using the GUS reporter system. Approximately 2 kb of the DEP2 5' upstream sequence was amplified with primers 5 '-AC AAGCTCCCTTGGTTGCA-3 ' (SEQ ID NO: 22) and 5'- CGAGGTCGGATCTGGTGGA-3 ' (SEQ ID NO: 23), and inserted into the site of Sail and EcoRI of pCAMBIA1391Z vector, resulting in the PRO _DEP2 -GUS construct. The resulting plasmid was transformed into rice, and GUS staining was performed according to the method described in Jefferson, Nature, 342:837-838 (1989). Various tissues or hand-cut sections of PRO _DEP2 ^' GUS transgenic plants were incubated in a solution containing 50 mM NaP0 ₄ buffer pH 7.0, 5 mM K ₃ Fe(CN) ₆ , 5 mM K ₄ Fe(CN) ₆ , 0.1% Triton X-100 and 1 mM X-Gluc at 37 °C. Images were taken directly or under a SZX16 stereomicroscope (Olympus).

[00159] Analysis of transgenic plants harboring the PRO _DEP2 -GUS construct indicated universal expression of DEP2 in various tissues but preferential expression in actively dividing zones (see Figures 6A through 6G). The GUS signal was stronger in rachis, branches, and florets of the dividing zones than the other parts. The signal also became weaker as panicles grew longer (see Figures 6A, 6B and 6C), and was barely detectable when panicles reached their final lengths. In the root, the DEP2 promoter was active in both primary root and lateral root, with stronger activity in root tips (see Figure 6D). Cross- sections showed DEP2 expression in the root is stronger in vascular cylinder and cortex tissues (see Figure 6E). In the stems and leaves DEP2 expression is stronger in vascular tissues (see Figures 6F and 6G).

[00160] Further quantative RT-PCR analysis indicated that DEP2 was highly expressed in young panicles ranging from 1 to 15 cm in length, and low levels of expression was also detected in other organs, including roots, stems, leaves and leaf sheathes. The expression level peaked when the panicle was about 5 cm long, decreasing to a low level when the panicle length reached approximately 20 cm (see Figure 6H). This expression pattern correlated well with the panicle development and expression pattern obtained from the GUS reporter system, suggesting DEP2 is required in the early rapid elongation stage of rice panicle.

[00161] Example 7

[00162] Subcellular localization of DEP2

[00163] To determine the localization of DEP2 protein in plant cells, the full length DEP2 coding sequence was amplified by PCR with primers 5'- AGATCTGATGGAGCCCGACGCCCCG-3 ' (SEQ ID NO: 24) and 5'- CCTAGGCCTGAGCCTTGCATC ACC-3 ' (SEQ ID NO: 25), and inserted into the site of Bgl /Spel of pCAMBIA1302 vector. The full length DEP2 coding sequence was fused in- frame to the 5' end of the GFP gene under the control of the cauliflower mosaic virus 35S promoter, and the construct was introduced into onion epidermal cells and Nicotiana benthamiana leaves via bombardment and infiltration respectively. The signal of DEP2-GFP fused protein could be detected in the cytoplasm, plasma membrane and nucleus in both onion epidermal cells (see Figure 7A) and N. benthamiana leaves (see Figure 7B), showing the same distribution pattern as the control plants.

[00164] Example 8

[00165] DEP2 Homologues

[00166] The DEP2 gene is predicted to encode a 1365-amino acid protein with a pi of 6.23 and molecular mass of 149 kDa. Database searches revealed several putative DEP2 homologues from rice (Oryza sativa L.), Arabidopsis, poplar (Populus trichocarpa), grape (Vitis vinifera), maize (Zea mays) and sorghum (Sorghum bicolof). Twenty six sequences from these plant species were adopted to construct a phylogenetic tree (see Figure 8).

[00167] Notably, three putative homologues, Sb02g039210, AC2100023 FGT017 and

AC1955993 FGT020, which shared around 60% amino acid sequence identity with the DEP2 protein, were identified in the sorghum and maize genome, suggesting that the function of DEP2 is conserved in monocots. There are also three putative homologues At3gl4172, Atlgl7360 and Atlg72410 in Arabidopsis and one from grape GSVIVP0002763000, which shared around 40% amino acid sequence identity with the DEP2 protein.

[00168] There are also some other homologous proteins identified with low sequence identity with DEP2, including CIP7 (At4g27430) which is a COP1 interacting protein. CIP7 is a nuclear protein which contains transcriptional activation activity and acts as a positive regulator of light-regulated genes. However, the similarity between DEP2 and CIP7 is only restricted at the N-terminal of the protein without any functional motif of CIP7.

[00169] Yeast two-hybrid analysis was carried out to elucidate the relationship between rice COPl and DEP2, but no interaction could be detected in vivo, and in contrast to CIP7, no transcriptional activation activity of DEP2 was detected. However, DEP2 can be induced by light both in the wild type and the dep2-l mutant (see Figure 5F), suggesting that DEP2 may participate in the light signaling pathway.

[00170] Weak similarities to DEP2 are also present in gymnosperm plant Picea sitchensis (ABR16652), and green algae, Physcomitrella patens subsp. patens (XP 001780764), but not in yeast or animals. These data suggest that DEP2 is plant specific, and the existence of DEP2 proteins in different plant species suggest a possible conserved biochemical function.

[00171] The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety.

[00172] While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention can be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims include all such embodiments and equivalent variations.