Background of the Invention Tuberculosis (TB) remains to be a major global health problem. It was estimated that

8,7 million new cases of TB and 1,4 million death occurred because of TB over the world in 2011. TB causing agent Mycobacterium tuberculosis is transmitted by respiratory secretion aerosols originating from patients with pulmonary TB. Because BCG vaccination protection is at low level, the most important part of tuberculosis control is to identify the patients who produce sputum containing M. tuberculosis bacilli at early stages and treat them efficiently before they transmit the disease to uninfected individuals. In TB high burden countries, the laboratory capabilities are limited for early diagnosis of TB. Diagnosis should be made in an efficient, timely manner, preferably at point-of-care (POC), using accurate, field-friendly tools (World Health Organisation, Global TB Report, 2012; Tiemersma et.al., Plos One 2011;6(4):el7601).

For that reason, WHO recommends "ASSURED' (Affordable, Sensitive, Specific, User- friendly, Rapid and robust, Equipment-free, and Deliverable to the end user) diagnostics for developing countries (Rotherham et al., Plos One 2012;7(10): e46862). Point of care testing platforms includes smear-microscopy, nucleic acid amplification tests, antigen detection- based tests, and newer nucleic acid amplification based methods. In addition, aptamer- based techniques are also alternative for point-of-care assays for the diagnosis of TB (Dheda et al., Respirology 2013;18:217-232).

Summary of the Invention The present invention provides DNA aptamers, compositions and methods for detecting the presence of M. tuberculosis and for treatment of tuberculosis which is a major global health problem all over the world.

In one embodiment, the present invention provides a DNA aptamer 40 bases in length comprising a binding sequence as a motif, which may be responsible of binding to bacteria, that is Aptamer Mtb3 (SEQ ID NO: 3), Aptamer Mtb8 (SEQ ID NO: 8), Aptamer Mtb9 (SEQ ID NO: 9), Aptamer Mtbll (SEQ ID NO: 11), Aptamer Mtbl3 (SEQ ID NO: 13), Aptamer Mtbl7 (SEQ ID NO: 17), Aptamer Mtb25 (SEQ ID NO: 25), Aptamer Mtb28 (SEQ ID NO: 28), Aptamer Mtb32 (SEQ ID NO: 32), Aptamer Mtb33 (SEQ ID NO: 33), Aptamer Mtb35 (SEQ ID NO: 35), Aptamer Mtb36 (SEQ ID NO: 36), Aptamer Mtb38 (SEQ ID NO: 38), Aptamer Mtb40 (SEQ ID NO: 40), Aptamer Mtb44 (SEQ ID NO: 44), Aptamer Mtb46 (SEQ ID NO: 46), Aptamer Mtb49 (SEQ ID NO: 49), Aptamer Mtb50 (SEQ ID NO: 50), Aptamer Mtb52 (SEQ ID NO: 52), Aptamer Mtb57 (SEQ ID NO: 57).

The present invention provides a composition comprising a DNA aptamer operably linked to one or more entities.

The present invention further provides a method for detecting M. tuberculosis in a sample comprising the sample with a DNA aptamer as described herein or the composition as described herein to form bound M. tuberculosis, and detecting the presence of bound M. tuberculosis.

Brief Description of Drawings

Figure 1. Representative structures of the DNA aptamers as derived by the MFOLD program show stem-loop structures. Aptamer Mtb36 (SEQ ID NO: 36).

Figure 2. Pool of Aptamers. Gel Electrophoresis, 2% Agarose. 1, negative control; 2, non- equal PCR products; 3, 50bp DNA ladder.

Figure 3. PCR amplification of selected aptamers. Purified amplicons before ligation, separated by 2% agarose gel. 1, negative control; 2 and 3, purified amplicons by ultrafiltration method; 4, purified amplions by centrifugation method; 5, 50 bp DNA ladder (Thermo Scientific Bio, USA). Figure 4. Alignment of selected DNA aptamer sequences binding to M. tuberculosis H37Ra (Aptamer Mtb3 (SEQ ID NO: 3), Aptamer Mtb8 (SEQ ID NO: 8), Aptamer Mtb9 (SEQ ID NO: 9), Aptamer Mtbll (SEQ ID NO: 11), Aptamer Mtbl3 (SEQ ID NO: 13), Aptamer Mtbl7 (SEQ ID NO: 17), Aptamer Mtb25 (SEQ ID NO: 25), Aptamer Mtb28 (SEQ ID NO: 28), Aptamer Mtb32 (SEQ ID NO: 32), Aptamer Mtb33 (SEQ ID NO: 33), Aptamer Mtb35 (SEQ ID NO: 35), Aptamer Mtb36 (SEQ ID NO: 36), Aptamer Mtb38 (SEQ ID NO: 38), Aptamer Mtb40 (SEQ ID NO: 40), Aptamer Mtb44 (SEQ ID NO: 44), Aptamer Mtb46 (SEQ ID NO: 46), Aptamer Mtb49 (SEQ ID NO: 49), Aptamer Mtb50 (SEQ ID NO: 50), Aptamer Mtb52 (SEQ ID NO: 52), Aptamer Mtb57 (SEQ ID NO: 57). It is estimated that underlined sequences may include a motif which may be responsible of binding to bacteria.

Figure 5. The M. tuberculosis to M. bovis binding ratio of DNA aptamers.

Figure 6. Binding of Aptamer Mtb36 (SEQ ID NO: 36) to different species of bacteria.

Detailed Description of the Invention Monoclonal and polyclonal antibodies have been most commonly used for diagnosis of pathogens. Aptamers have also been used for this purpose. Aptamers are DNA, RNA, and protein molecules selected by SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process which was first defined by Tuerk and Gold (1990). They expressed SELEX as "the beginning of evolution in a test tube" (Tuerk and Gold, Science 1990;249:505- 510). In this process, a single stranded DNA or RNA library is used for the selection of DNA/RNA aptamers. These nucleic acid libraries have molecules with sites of random sequences which are approximately 40 nucleotides in the center. In addition to this random site, these libraries include flanked region on either end, which are primer sites. So, each single stranded nucleic acid molecule has same primer sequences, but different random sequences in a library. An aptamer library is expected to have 10 ¹⁴ -10 ¹⁶ unique sequences theoretically. When an aptamer library is incubated with a target of interest, some ssDNAs/RNAs are able to bind to the target. Then, nucleic acids bound to the target are separated from the unbound, by washing the latter. Target-bound sequences are then amplified by PCR and amplicons are used for next round selection. These selection rounds are performed until with high affinity aptamers are obtained. These aptamers are cloned and sequenced (Ellington and Szostak, Nature 1990;346:818-22; Gold et al., Cold Spring Harbor Perspective in Biology 2012;4:a003582).

Aptamers have special three dimensional folding structures in buffers or water. These folding properties help to bind specifically to any target. Aptamers have several advantages over antibodies. For example, they are very stable at room temperature, can be synthesized easily, and can be modified chemically. Their production is much cheaper than antibodies. They do not exhibit batch to batch variation. Aptamers are stable to long-term storage at room temperature and when they are denatured, after then they can be renatured easily. In addition to these properties, since their amplification use polymerase chain reaction (PCR), they can detect lower concentrations of an analyte. So, aptamers are very attractive to use for diagnosis.

Aptamers can be single stranded RNA, single stranded DNA, modified single stranded RNA, and modified single stranded DNA. These modifications are about adding some modifying groups to nucleotides or bases of single stranded DNA or RNA molecules. These modifications are used for many different purposes, especially to produce or to amplify signal in biosensor systems.

Aptamers can be selected for wide range of targets, from purified target molecules to whole living cells. These can include small molecules such as ATP (Huizenga and Szostak, Biochemistry-US 1995;34:656-665), more complex molecules such as proteins or cell components (Qin L at al., Clin Chem Lab Med 2009;47:405-119), and whole-living cells such as bacteria (Cao X et al., Nucleic Acids Res 2009;37:4621-4628). SELEX process received attention and many studies have been performed since Tuerk and Gold, (1990) published the first study. Aptamers are oligonucleotides used as powerful tools in the fields of therapeutics, beacuse of their stability, low toxicity, low immunogenic properties (NS Que-Gewirth et al., Gene Therapy (2007) 14, 283-291).

In this study, the inventors used Mycobacterium tuberculosis H37Ra as a model organism to select aptamers that can be used for capture and subsequent PCR-based detection of the organism from complex sample matrices.

The present invention provides a DNA aptamer consisting of Aptamer Mtb3 (SEQ ID NO: 3), Aptamer Mtb8 (SEQ ID NO: 8), Aptamer Mtb9 (SEQ ID NO: 9), Aptamer Mtbll (SEQ ID NO: 11), Aptamer Mtbl3 (SEQ ID NO: 13), Aptamer Mtbl7 (SEQ ID NO: 17), Aptamer Mtb25 (SEQ ID NO: 25), Aptamer Mtb28 (SEQ ID NO: 28), Aptamer Mtb32 (SEQ ID NO: 32), Aptamer Mtb33 (SEQ ID NO: 33), Aptamer Mtb35 (SEQ ID NO: 35), Aptamer Mtb36 (SEQ ID NO: 36), Aptamer Mtb38 (SEQ ID NO: 38), Aptamer Mtb40 (SEQ ID NO: 40), Aptamer Mtb44 (SEQ ID NO: 44), Aptamer Mtb46 (SEQ ID NO: 46), Aptamer Mtb49 (SEQ ID NO: 49), Aptamer Mtb50 (SEQ ID NO: 50), Aptamer Mtb52 (SEQ ID NO: 52), Aptamer tb57 (SEQ ID NO: 57).

Aptamer of the present invention can be operably linked to one or more entities. In certain embodiments, the entity is a protein, fluorescence tag, a solid substrate, affinity tag, a cellular component, or a cell surface. In certain embodiments, the cellular component is a cell membrane or cell wall. In certain embodiments, the solid substrate is a component of, nylon, cellulose, polyethersulfone, cellulose acetate, silica, nitrocellulose, polyester, polyolefin, or polyvinylidene fluoride, or combinations thereof. In certain embodiments, the solid substrate is a filter, magnetic bead, metal oxide, latex particle, nanoparticles, microtiter plates, polystyrene bead, or CD-ROM. In certain embodiments, the DNA aptamer is linked to the entity by means of a linker. In certain embodiments, the linker is a binding pair. In certain embodiments, the "binding pair" refers to two molecules which interact with each other through any of a variety of molecular forces including, for example ionic, van der Waals, covalent, hydrophobic, and hydrogen bonding, so that the pair have the property of binding specifically to each other. Specific binding means that the binding pair members exhibit binding to each other under conditions where they do not bind to another molecule. Examples of binding pairs are biotin-avidin, hormone-receptor, receptor-ligand, enzyme- substrate, IgG-protein A, antigen-antibody, and the like. In certain embodiments, a first member of the binding pair comprises avidin or streptavidin and a second member of the pair comprises biotin. In certain embodiments, the DNA aptamer is linked to the entity by means of a covalent bond.

The entity, for example, may additionally or alternatively, be a detection means. A number of "molecular beacons" (such as fluorescence compounds) can be attached to aptamers to provide a means for signaling the presence of and quantifying a target chemical or biological agent. For instance, the inventors have identified aptamers specific for Mycobacteria. A fluorescence beacon, which quenches when Mycobacteria is reversibly bound to the aptamer, is used with a photodetector to quantify the concentration of Mycobacteria present. Aptamer-based biosensors can be used repeatedly, in contrast to antibody-based tests that can be used only once. Examples of molecular beacons are amplifying fluorescent polymers (AFP). Other exemplary detection labels that could be attached to the aptamers include biotin, amine modification, alkalinephosphatase, any fluorescent dye, horseradish peroxidase, etc.

In certain embodiments, the aptamer is operably linked to a detection means and to a solid substrate. For example, the aptamer may be linked to a fluorescent dye and to magnetic beads.

Until day, many patents have been fulfilled about Mycobacterium tuberculosis by other researchers. These are:

• -C 102071204 (A)- "Deoxyribonucleic acid (DNA) aptamer for Mycobacterium tuberculosis glycolipid antigen and application thereof"

The invention discloses a deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen. According to the patent, DNA aptamer disclosed by the invention has high specificity and strong appetency when acting with the Mycobacterium tuberculosis, and a novel preparation is provided for the diagnosis of tuberculosis.

• -CN101619313 (B) Target Mycobacterium tuberculosis ag85b oligonucleotide aptamer and its preparation method and application

The invention claims a targeting Mycobacterium tuberculosis ag85b oligonucleotide aptamer and its preparation method and application of the oligonucleotide aptamer having 1 to an access point ap 13 represented by nucleotide sequence.

• -C 101481687 (A) - "Anti-Mycobacter/um tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof"

The invention discloses a DNA adaptorprotein capable of inhibiting tubercle bacillus infection and a preparation method thereof. The DNA adaptorprotein can be directly used as a tubercle bacillus antagonist, can prevent and cure tuberculosis and overcome the disadvantage that clinical common drugs, such as rifampin, streptomycin, and the like, have long treatment cycles and great side effects.

• -EP2437061 (A) - "Mycobacterial protein detection" The invention provides use of a technique for detecting mycobacterial proteins using quantum dot (QD) labels. This allows rapid and direct detection of the main mycobacterial pathogens, for example Mycobacterium tuberculosis complex (MTC), M. avium complex (MAV) and M. avium subsp paratuberculosis (MAP), in clinical samples, in a way that is highly specific, very easy to perform, and requires minimum infrastructure and expertise.

Example 1

Materials and Methods Microorganisms

E. coli was obtained from THSK (Turkish Public Health Agency, Tiirkiye), M. tuberculosis H37Ra and M. bovis from ATCC (The American Type Culture Collection, USA). E. coli were grown in tryptic soy agar (Merck, Germany) at 37°C for 18h; M. tuberculosis H37Ra and M. bovis were cultured in U Medium (Salubris Inc., Tiirkiye) at 37°C for 21 days. 2.2 Designing and Obtaining DNA Aptamer Library

We designed an aptamer library of random 45-nucleotide sequence, flanked with constant regions. The oligonucleotides in the library had the following sequences: 5'- CCGTCAGCCGAGGACCACAC-N45-TTGGGTGCAATGAAT-3' (SEQ ID NO: 1), where 45N is a variable 45-nucleotide site. Primer sequences for PCR were 5'-CCGTCAGCCGAGGACCACAC-3' and 5 '-ATTCATTGCACCCAA-3 ' (SEQ ID NO: 2). The aptamer library was synthesized by MerMadel92 instrument (BioAutomation, USA) and desalted using sephadex G25 (Sigma, Germany) column. Primer annealing temperature for the aptamer library was determined by gradient PCR. For amplification of aptamer library, both regular PCR and asymmetric PCR were applied. While each primer was used in equal amounts in regular PCR, in asymmetric PCR, the concentration ratio for forward and reverse primers was 100/1. Thus, ssDNA molecules were obtained by asymmetric PCR.

We performed SELEX using two different methods, ultrafiltration and centrifugation. In ultrafiltration method, ultrafiltration filters were used to remove unbound ssDNA molecules from the ones bound to mycobacteria. In centrifugation method, unbound ssDNA molecules were removed by washing after sedimentation of aptamers bound to mycobacteria, by centrifugation. Different buffers, for binding and washing, were used in each method. While PBS buffer (Sambrook and Russel, Cold Spring Harbor Laboratory Press 2001;3th Ed.) (137mM NaCl, 2,7mM KCI, lOmM Na2HP04, 2mM KH2P04, pH 7,4) and PBST (0,05 % Tween 20 in PBS) were used as binding and washing buffers in centrifugation method, HEPES buffer (Lianhu Q et al., Clin Chem Lab Med 2009;47(4):405-ll) (20mM HEPES, 120mM KCI; ImM CaCl2; lmM MgCI2, pH 7,4;) and HEPES-T (0,05 % Tween 20 in HEPES buffer) were used in ultrafiltration method, as described previously in literature (Chang YC et al., Sci Rep 2017;3:1863). In each experiment before starting binding and selection, the aptamer library was heated to 952C for 15 min, and snap-cooled on ice for 10 min. M. tuberculosis H37Ra were used for SELEX-cycles, while M. bovis was used for counter- SELEX.

Preparing BSA coated microcentrifuge tubes

To prevent non-specific binding of aptamers to tubes, they were coated by bovine serum albumin (BSA). For this purpose, 1400 μΙ of 100 mM NaHC03 (pH 9,5) was added in microcentrifuge tubes (Axygen, USA) and tubes were agitated at 200xrpm for 1 hour. Then, the tubes were similarly treated 4 times by PBST (0,05 % in PBS, pH 7,4). Finally, 1400 μΙ PBST-BSA (3% BSA in PBST) were added into the tubes which were agitated at room temparature, 900xrpm for 1 hour. The solution was discarded and the tubes were stored at 49C until using. It was determined by Real-Time PCR that non-specific DNA binding to BSA- treated tubes was negligible (data not shown). So, binding experiments for the ultrafiltration method were performed in these tubes.

The Centrifugation Method

Bacteria were harvested from U Media and resuspended in glass-bead suspension tubes (Salubris A.S., Tiirkiye) including PBS. For the first cycle, 1 ml of 1 McFarland M. tuberculosis H37Ra suspension was transferred to low-DNA binding tubes (Eppendorf, USA) and centrifuged at 14000xg for 5 min. Supernatants were discarded. Pellets were resuspended with PBS. After centrifugation, supernatants were removed and pellets were resuspended with 100 μΙ of the aptamer library in PBS (final aptamer concentration was 105 μΜ). Tubes were incubated for 30 min at 372C by agitating at 1300xrpm (Hangzou, China) (at 15th min, it was additionally mixed by pipetting). Then, tubes were centrifuged at 14000xg for 5 min. Supernatants were discarded. Pellets were resuspended with 100 μΙ PBST followed by centrifugation. Supernatants were discarded. This washing step was repeated for three times. Then, pellets were resuspended in PBS. After centrifugation and discarding the supernatant, pellets were resuspended with PCR buffer[23] (50 mM KCI, lOOmM Tris-HCl, 15mM MgCl2, pH 8,3). Tubes were then kept at 95°C for 10 min and centrifuged at 14000xg for 2 min. Supernatants were transferred to clean tubes and used as template to amplify these aptamers by PCR. For this purpose, first regular PCR, then asymmetric PCR was done. PCR products obtained by asymmetric PCR (Figure 2) were mixed with 2xPBS in equal volume (50 μΙ:50 μΙ), kept at 95^C for 15 min, and snap-cooled on ice for 10 min. These molecules were used as aptamer pools (100 μΙ) for next selection. For second cycle, 1 ml of 1 McFarland M. bovis suspension was transferred to the aptamer pools (100 μΙ) in low-DNA binding tubes and incubated for 30 min at 37 ^S C and agitated at 1300xrpm for binding (at 15th min, it was additionally mixed by pippetting). And then, tubes were centrifuged at 14000xg for 5 min. Supernatants were transferred to a clean tube and used for the next selection round for M. tuberculosis H37Ra. These selection rounds were repeated six more times. At the seventh round, binding time for M. tuberculosis H37Ra was shortened to 15 minutes and washing steps were performed 10 times. Finally, DNA molecules obtained in this last round were amplified by PCR and cloned to determine DNA sequences. The Ultrafiltration Method

For ultrafiltration method (Chang YC et al., Sci Rep 2017;3:1863), ultrafiltration tubes (Amicon Ultra-Millipore 50K, USA) were used. 500 μΙ of 80 μΜ aptamer library was added to 500 μΙ of 2X HEPES binding buffer. Bacteria were harvested from U Media and resuspended in glass-bead suspension tubes in HEPES binding buffer. For the first cycle, 500 μΙ of 0,5 McFarland M. bovis suspension was transferred to a microcentrifuge tube coated with BSA and 500 μΙ of aptamer library was added. The mixture was incubated for 30 min at 37 ⁹ C and agitating at 1300xrpm for binding (at 15th min, it was additionally mixed by pippetting). Then, the mixture was transferred to the filters and tubes were centrifuged at 14000xg for 5 min. Filtered liquid were used as aptamer pool for M. tuberculosis H37Ra. The filtered liquid was transferred to 1000 μΙ of 0,5 McFarland M. tuberculosis H37Ra suspension. It was incubated for 30 min at 37^0 agitating at 1300xrpm for binding (at 15th min, it was pippetted). Then, the mixture was transferred to filters and tubes were centrifuged at 14000xg for 5 min. The filters were washed three times by passing 500 μΙ of HEPES-T Buffer and two times HEPES binding buffer. Finally, 100 μΙ of PCR buffer was added and incubated for 1 minute at room temperature. Then, tubes were centrifuged at 14000xg for 5 min, and liquids containing aptamers were collected into clean tubes which were used as PCR template. To amplify DNA, two PCR steps, regular and asymmetric, were performed. PCR products obtained by asymmetric PCR were mixed with 2X HEPES binding buffer in equal volume (50 μΙ:50 μΙ). And, the mixture was kept at 952C for 5 min, and snap-cooled on ice for 10 min. Until 6th SELEX cycle, binding and washing conditions were the same, but in 6th cycle, washing step for M. tuberculosis H37Ra was performed 5 times with washing buffer and two times with binding buffer. In 8th SELEX cycle, incubation time with M. tuberculosis H37Ra, was decreased for 15 min and washing steps were performed 9 times with washing buffer and single time with binding buffer. In all these cycles, binding conditions for M. bovis were not changed. DNA molecules obtained in the last cycle were amplified by PCR and cloned to determine DNA sequences.

Cloning Experiments

After SELEX with both centrifuge and the ultrafiltration methods, DNA molecules obtained were amplified by PCR and amplicons were purified using ethanol precipitation method (Sambrook and Russel, Cold Spring Harbor Laboratory Press 2001;3th Ed.). Briefly, 50 μΙ of each amplicon was transferred in a microcentrifuge tube and 10 μΙ of precipitation solution (120 mM sodium acetate pH 5,2; 40 mM EDTA, 4 μg Glycogen) and 120 μΙ of cold- ethanol was added. The tubes were centrifuged at 4"C, 14000xg for 15 min. Supernatant was discarded. Precipitates were dissolved by 15 μΙ of distilled water and concentration of the DNA was determined by spectrophotometer (Nanodrop-1000, USA). DNA molecules were also run in 2% agarose gel (Figure 3).

Purified amplicons were used in cloning. For this purpose, Fermentas InsTAclone PCR Cloning Kit, USA was used according to the kit's instructions. After transformation, colony screening was performed using PCR to identify colonies of bacteria which included DNA aptamers. PCR amplicons, obtained from 50 colonies, were purified using ethanol precipitation and DNA molecules were sequenced.

Binding Experiments

21 different DNA aptamers were determined and their similarities were calculated using ClustalW2 program (http://ebi.ac.uk/Tools/). Eight DNA aptamers were randomly selected to investigate their binding capabilities to M. tuberculosis H37Ra. HPLC purified DNA aptamers were ordered (Metabion, Germany). As negative control, a ssDNA molecule including the same aptamer primer sites, but a different random sequence in the middle, was used. Experiments were performed as biological repeats in three different days to be able to compare all specific and random aptamers with each other. M. tuberculosis specific and random aptamers were dissolved in binding buffer (Lianhu Q et al., Clin Chem Lab Med 2009;47(4):405-ll) (20mM HEPES, pH 7,4; 120mM KCl; ImM CaCl2; ImM MgCl2) and their final concentrations were at 2,5 μ . Ready to use PCR mix, SYBR Green I Master Mix (Roche, Germany) was used with primers at final concentration of 0,7 μΜ. Tubes were washed with PBST buffer and then with PBS for 3 times. Prior to each experiment, all aptamers were kept at 95SC for 5 min, and snap-cooled on ice for 10 min. 100 μΙ of 0,5 McFarland bacteria ( bovis or M. tuberculosis H37Ra) prepared in binding buffer were transferred to tubes and 10 μΙ of 2,5 μΜ specific or random aptamers were added. They were mixed by pipetting. As another negative control, 100 μΙ of binding buffer was also transferred to the tubes and added the same amount of aptamers. These were used to determine the binding of aptamers to the tubes. The mixtures were incubated for 30 min at 37 ^S C and mixing at 1300xrpm for binding (at 15th min, it was pippetted). Tubes were centrifuged at room temperature, 14000xg for 5 min. Supernatant was discarded. Pellets were resuspended with 1000 μΙ of washing buffer (binding buffer including 0,05% Tween-20). Tubes were centrifuged at room temperature, 14000xg for 5 min. The washing step was repeated 7 times. Then pellets were resuspended by 100 μΙ of binding buffer, and suspensions were transferred to clean tubes. Tubes were centrifuged at room temperature, 14000xg for 5 min. Pellets were resuspended with 50 μΙ PCR buffer and tubes were boiled for 10 min. After centrifugation, supernatant from each tube was transferred to a clean tube and 5 μΙ was used for PCR both with aptamer primers and primers (Telenti A et al., J Bacteriol 1993;31(2): 175-78) Tbll [5'-ACCAACGATGGTGTGTCCAT] and Tbl2 [5*- CTTGTCGAACCGCATACCCT] which are specific to M. tuberculosis DNA. Primer final concentrations in PCR mixture were 0,7 μΜ.

Results

Determining of selected DNA aptamer sequences

After cloning and sequencing, selected ONA aptamers were sequenced (Table 1, Figure 4).

Table .1 Aptamer candidates after SELEX against Mycobacterium tuberculosis H37Ra.

Selected Aptamers Sequences

5'-CGCTTCACGTGTCAGTGAATTTTCTCCATCGTTTGGTGGG-

3'

3 (SEQIDNO:3)

b'-CIAICLCGIGGIC AI IGU 11 ICCCGGIUCI ICICIGG-

3'

8 (SEQID NO:8)

5'-

GCCGTGCTGAGTCTGTCAGCAGTTTGCTAGTCTTCCCrGC-3'

9 (SEQIDNO:9)

5'-

CGCCGGCCTTCTTACAAGACCTGTTCAATTCCCAGTGTGG-3'

11 (SEQID NO:ll)

5'-

CGATCACTGTACAGTCCTGGATAAGCCGTTCTTTCCGTGG-3'

13 (SEQID NO:13)

5'-

GCGTCAATATGCTCGAGTCCCTTACTCCGTAATCTTGGGG-3'

17 (SEQIDNO:17)

5'-

ATAGGAAGTATGCGGTCGTAGTTAATCGCCTGTCCTGGGG=

3'

25 (SEQIDNO:25)

5'-

CTCCATCACGTGTAGTCAGCTGACCATTGATCGTGCCTGG-3'

28 (SEQIDNO:28)

5'-

CTGGGCTCA rCACTGGCGTATCATTCGTCCGCGGTGGGG-

3'

32 (SEQID NO-.32)

Determining of the best DNA aptamer that recognizes M. tuberculosis H37Ra

Eight DNA aptamers were randomly selected to determine their specific binding capabilities to M. tuberculosis H37Ra. Binding results were calculated according to Ct (threshold cycle) values in real-time PCR (Pinto A et al., Mol Biosyst 2009;5:548-53). Both the copy number of DNA aptamers and bacterial genomic DNA were determined according to Ct values. Since amount of the DNA doubles after every PCR cycle, we calculated the number of DNA aptamers per bacterium according to formula 2 ^{(bacterial genomic DNA ct ' DNA aptamers ct)} . After determining these values for each aptamer for M. tuberculosis H37Ra and M. bovis, we calculated the binding ratio to determine the binding specificity to M. tuberculosis H37Ra (Figure 5).

According to these results, Mtb36 DNA aptamer (Figure 6) which was the most specific for M. tuberculosis H37Ra was chosen for further experiments. It was subjected three times to binding assays to M. tuberculosis H37Ra, M. bovis and E . coli.

Determination of Mtb36 aptamer specificity to M. tuberculosis H37Ra

In these experiments, tubes treated by BSA and PBST, were used. Before starting binding assays, specific aptamers were kept at 95^C for 5 min, and snap-cooled on ice for 10 min. 100 μΙ of 0,5 McFarland bacteria ( . bovis, M. tuberculosis H37Ra, or E. coli) prepared in binding buffer (Cao X et al., Nucleic Acids Res 2009;37:4621-4628) (0.1 mg/ml tRNA, 1%BSA, 1XPBS, 0.05%(v/v) Tween-20, pH 7,4) were transferred to the tubes and 10 μΙ of 2,5 μΜ aptamers were added. They were mixed by pipetting. As a control for non-specific binding to the tubes, ΙΟΟμΙ of binding buffer was also transferred to the tubes and the same amount of aptamers was added. The mixtures were incubated for 30 min at 372C agitating at 1300xrpm for binding. The tubes were centrifuged at room temperature; at 14000xg for 5 min. Supernatant was discarded. Pellets were resuspended with 1000 μΙ of washing buffer (PBST, pH 7,4). The tubes were centrifuged at room temperature at 14000xg for 5 min. The washing step was repeated 3 times. Then pellets were resuspended by 100 μΙ of binding buffer, and suspensions were transferred to clean tubes. The tubes were centrifuged at room temperature, at 14000xg for 5 min. Pellets were resuspended with 50 μΙ PCR buffer and the tubes were boiled for 30 min. After centrifugation, supernatants were transferred to clean tubes and 5 μΙ of them were used for PCR both with aptamer primers and bacterial genomic DNA primers. Ct values and the number of DNA aptamers per bacterium are shown in Figure 8. Discussion In this study, DNA aptamers specific to M. tuberculosis H37Ra were selected. M. bovis was used as counter selection target, since this is one of the phylogenetically closest species of mycobacteria included in the group of Mycobacterium tuberculosis complex together with M. tuberculosis and an attenuated strain of M. bovis, bacillus Calmette-Guerin (BCG), which is used as a vaccine for tuberculosis (Chen F et al., Biochem Bioph Res Co 2007;357:743- 748). Selected DNA aptamers shared a specific motif. Affinity of the selected aptamers to M. tuberculosis H37Ra was effective and specific. When compared to binding to other bacteria, aptamer Mtb36 was bound at least 3.5 times more to M. tuberculosis H37Ra than M. bovis. The binding ratio was 68 times higher when binding of aptamer Mtb36 to M. tuberculosis H37Ra was compared to binding to a phylogenetically more distant species, E. coli.

According to our knowledge, there are no data published so far, about using realtime PCR for quantitating aptamer binding to whole-bacteria. In this study we have demonstrated that real-time PCR is a convenient and easy method to quantitate aptamer binding. In this method, treatment of tubes by BSA and/or PBST was critical to eliminate non-specific binding.

Mtb36 aptamer can be used to detect M. tuberculosis. It can be used as a part of several new biosensing methods using aptamers. like electrochemical, (Gold L et al.. Cold Spring Harbor Perspective in Biology 2012;4:a003582), electronic based (Baker BR et al., J Am Chem Soc 2006,128:3138-3139), fluorescence-based (Li B et al., Chem Commun 2007;(1):73- 75), chemiluminescence-based (Li T et al., Anal Bioanal Chem 2007;389:887-893), and colorimetric methods (Liu J and Lu Y, J Fluoresc 2004;14(4):343-354).

There are several studies in literature using aptamers for the diagnosis of tuberculosis. In one study, aptamers are used to determine the amount of IFN-gamma the release of which from T-lymphocytes, by stimulation TB specific antigens, is used as an indicator for tuberculosis (Mm K et al., Biosens Bioelectron 2008;23:1819-1824). They developed an electrochemical biosensor to detect IFN-gamma in sodium phosphate buffer and fetal bovine serum. Their results showed that a low detection limit which was 100 fM with RNA aptamer in buffer and 10 pM with DNA aptamer in serum. Another group developed an amplified surface plasmon resonance immunosensor using interferon-gamma aptamers (Chang CC et al., Biosens Bioelectron 2012;37:68-74) for serological diagnosis. The detection limit for IFN-v was found 33 pM using their DNA aptamer hairpin structure designing.

A sandwich ELISA assay with MPT64 antibody aptamers (Zhu C et al., BMC Infect Dis 2012,12:96) was used to detect MPT64 which is a protein secreted by M. tuberculosis complex. Their lineer detection range was found as 10 mg/L to 800 mg/L.

1. Direct detection of TB bacilli in sputum samples (Rotherham LS et al., Plos One 2012;7(10): e46862) was also attempted. With and aptamer named as CSIR 2.11 against culture filtrate protein (CFP-10) and early secreted antigen target (ESAT-6) of M. tuberculosis, sensitivity was 35% and specificity 95%.

It has been also suggested that aptamers can be used as therapeutic agents. Chen et al. investigated this, using aptamers selected to virulent M. tuberculosis strains (Zhu C et al., BMC Infect Dis 2012;12:96). Shum et al. tried aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2, using G-quadriplex aptamers (Shum KT et al., Biochemistry-US 2011;50:3261-71).

All of these studies have promising results, however, several comparative trials are needed to enable these aptamer-based methods to be used for the diagnosis and treatment of tuberculosis. Aptamer tb36 that we have developed in this study, need further binding assays to M. tuberculosis in different conditions such as in clinical specimens like sputum, before being integrated into biosensing systems to become a rapid, sensitive and specific diagnostic tool for tuberculosis.