A Marker for Mammalian Stem Cell Pluripotency and Methods and Uses

Thereof

FIELD OF THE INVENTION

[0001] This invention relates to stem cell markers and more specifically to genetic markers for pluripotent stem cells.

BACKGROUND OF THE INVENTION

[0002] Stem cells are unspecialized cells that have the ability to self-renew and produce daughter cells with equivalent developmental potential, or to differentiate into more specialized cells. Differentiation is the biological process whereby a progenitor cell acquires the structure and function of a mature somatic cell through a variety of poorly defined genetic, epigenetic and molecular events.

[0003] Stem cells are classified according to their developmental potential as totipotent, pluripotent or multipotent. Totipotent cells are able to generate a complete organism, including extraembryonic tissue (Verfaillie et al., Hematol Am Soc Hematol Educ Program, pp.369-391, 2002). Pluripotent stem cells are capable of differentiating into all cell types of the adult organism. For example, embryonic stem (ES) cells are pluripotent stem cells derived from pre-implantation embryos of either the compacted morula or the inner cell mass (ICM) of the mammalian blastocyst and are capable of differentiating in vitro into all cell types of the adult organism. Multipotent stem cells have more limited differentiation capacity and are restricted to differentiate into the tissue of origin or parenchyma. For this reason, multipotent stem cells are often referred to as parenchymal, somatic, adult, or tissue-resident stem cells.

[0004] Cancer stem cells are tumor-initiating cells, often transformed stem cells, which can be either pluripotent or multipotent depending upon the origin of the tumor. Tumor-initiating cells (also referred to as "tumor stem cells") are functionally defined as a population of cells in a tumor capable of eliciting the growth of a new tumor after transplant into immune-compromised mice. Tumor-initiating cells are phenotypically similar to somatic stem cells. This observation led to the hypothesis that tumor- initiating cells originate from a resident population of somatic stem cells within the organism (Reya et al., Nature 414:105-111, 2001). Tumor-initiating cells have been

isolated from tumors found in patients with acute myeloid leukemia (Lapidot et al., Nature 367:645-658, 1994) and from solid tumors of the breast (Al-Hajj et al., Proc. Natl. Acad. Sci. USA 100:3983-3988, 2003) and brain (Singh et al., Nature: 432:396- 401, 2004).

[0005] The process of self-renewal is unique to all stem cell populations. Evidence from ES cell models reveals that self-renewal is manifested in part through the inhibition of pro-morphogenetic signals, thereby restricting lineage commitment (Boyer et al., Cell 122:947-956, 2005; Boyer et al., Nature 441 :349-353, 2006; Lee et al., Cell 125:301-313, 2006; Loh et al., Nature Genet. 38:431-440, 2006).

[0006] Tumor-initiating cells and somatic stem cells both have the ability to self- renew and to yield differentiated progeny. There is accumulating evidence that morphogenetic signaling pathways utilized in the generation of somatic stem cells during embryogenesis retain a role in self-renewal of these somatic stem cells, while dysregulation of these signaling pathways can be oncogenic (Reya et al., Nature 414:105-111, 2001). The transcription factors Nanog and Oct4 (encoded by Pou5fl, herein referred to as 0ct4) have been identified as master regulators of ES cell pluripotency. Expression of Oct4 and Nanog is highly regulated in the pre- implantation embryo: Oct4 and Nanog are expressed briefly during early embryogenesis and are not normally expressed in adult tissues. Together Oct4 and Nanog activate expression of genes involved in the maintenance of pluripotency as well as repress the expression of genes involved in cell differentiation (Boyer et al., Cell 122:947-956, 2005; Loh et al., Nature Genet. 38:431-440, 2006). Reactivation of Oct4, Nanog and other pluripotency genes has been observed in tumors and tumor cell lines, and has been shown to be sufficient to promote tumorigenesis (Hochedlinger et al., Cell 121(6):465-477, 2005; Hart et al., Cancer 104:2092-2098, 2005).

[0007] ES cell lines have been used as a tractable model system for analysis of the mechanisms involved in the regulation of stem cell self-renewal and differentiation. Pluripotent ES cells can be maintained in culture in the presence of leukemia inhibitory factor (LIF) and serum-derived factors such as bone morphogenetic proteins (BMP: specifically BMP4) (Chambers, Cloning Stem Cells 6:386-391,

2004). LIF activates STAT3, suppressing mesoderm and endoderm commitment, while BMPs activate Id genes to repress neural ectoderm commitment (Ying et al., J. Biol. Chem. 278(40):39029-39036, 2003). Together LIF and BMPs allow the self- renewing population of ES cells to expand. Conversely, removing the signal mediated by either component promotes differentiation down the respective lineage.

[0008] The E3 ubiquitin ligase Makorin 1 (Makorin ring finger protein 1; "Mkral") was first described by Gray et al. (Genomics 15:76-86, 2000) as the founding mammalian member of a family of three evolutionarily conserved proteins containing four C3H zinc finger domains, an unusual Cys/His arrangement and a RING finger domain (C3HC4). Mkrnl is widely expressed in adult tissues, hi the midgestation embryo, expression levels of Mkrnl mRNA are highest in the developing nervous system. The function of Mkrnl has not been fully elucidated, however, transgenic mouse experiments have shown that a transgene insertion into the Makorinl pseudogene (Mkrnl-pl) results in early postnatal lethality in heterozygous pups. The most obvious phenotypes in these animals are polycystic kidneys, osteogenesis imperfecta, liver cysts, and epithelial defects. Decreased Mkrnl-pl expression was shown to result in destabilization of Mkrnl mRNA; the mutation could be rescued by overexpression of either Mkrnl or Mkrnl-pl in fertilized oocytes (Hirotsune et al., Nature 423:91-96, 2003). Recently, Gray et al. (Proc. Natl. Acad. Sci. USA 103:12039-12044, 2006) engineered Mkrnl mutant mice, generated through a β-Geo transgene insertion into the third intron of Mkrnl, upstream from the imperative RING E3 ubiquitin ligase domain. Mkrnl gene-trapped transcripts were knocked down to less than 1% of the expression levels of Mkrnl wild-type transcripts in both brain and kidney samples when analyzed by quantitative PCR (qPCR). Paradoxically, homozygous Mkrnl mutant mice were shown to be viable and fertile, with no obvious developmental defects. According to Gray et al. (Proc. Natl. Acad. Sci. USA 103:12039-12044, 2006), homozygous and heterozygous Mkrnl gene-trapped murine neonates do not present with polycystic kidneys, osteogenesis imperfecta, liver cysts or epithelial defects.

[0009] The identification of stem cells in situ is hampered by the paucity of unique markers for use in the detection of stem cells. Therefore, there is a need to further

- A - characterize stem cells and to identify markers that can unequivocally detect stem cells both in vitro and in vivo to facilitate the isolation of stem cells for expansion and/or differentiation for tissue regeneration, tissue engineering and transplantation purposes, as well as other similarly useful medical purposes.

SUMMARY OF THE INVENTION

[0010] According to one broad aspect of the invention, methods for maintaining or inducing pluripotency in a mammalian stem cell are provided. The methods comprise upregulating expression of any one of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof.

[0011] According to another aspect of the invention, methods for inducing mammalian stem cell differentiation are provided. The methods comprise downregulating expression of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, in a mammalian stem cell, in the presence or absence of pluripotency maintenance factors.

[0012] According to another aspect of the invention, uses of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, for maintaining or inducing pluripotency in a mammalian stem cell are provided.

[0013] According to another aspect of the invention, uses of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, for inducing mammalian stem cell differentiation are provided.

[0014] According to another aspect of the invention, methods for identifying, characterizing, selecting, inducing or isolating pluripotent mammalian stem cells in a population of mammalian stem cells are provided. The methods comprise determining Mkrnl expression; and isolating mammalian stem cells expressing Mkrnl.

[0015] According to another aspect of the invention, markers of mammalian stem cell pluripotency are provided. The markers of the invention comprise any one of an

isolated nucleic acid encoding Mkrnl or a functional fragment thereof, or an isolated polypeptide encoding Mkrnl or a functional fragment thereof.

[0016] According to another aspect of the invention, pharmaceutical compositions for maintaining or inducing mammalian stem cell pluripotency are provided. The pharmaceutical compositions comprise a marker of mammalian stem cell pluripotency consisting of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, and a pharmaceutically acceptable carrier.

[0017] According to another aspect of the invention, pharmaceutical compositions for inhibiting mammalian stem cell pluripotency are provided. The pharmaceutical compositions comprise an inhibitor of Mkrnl expression and a pharmaceutically acceptable carrier.

[0018] According to another aspect of the invention, pluripotent mammalian stem cells engineered to overexpress a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, are provided

[0019] According to another aspect of the invention, methods for treating cancer in a mammal are provided. The methods comprise downregulating expression of a nucleic acid encoding Mkrnl, or a polypeptide encoding Mkrnl endogenous to a mammalian stem cell.

[0020] According to another aspect of the invention, methods of tissue regeneration are provided. The methods comprise upregulating expression of a nucleic acid encoding Mkrnl, or a polypeptide encoding Mkrnl, in a mammalian stem cell to induce proliferation of the mammalian stem cell; expanding a mammalian stem cell population; and introducing an expanded mammalian stem cell population into a tissue of an individual suffering from a disorder requiring cell or tissue replacement.

[0021] According to another aspect of the invention, uses of an activator of Mkrnl expression and/or activity for maintaining pluripotency of a mammalian stem cell are provided.

[0022] According to another aspect of the invention, uses of an inhibitor of Mkrnl expression and/or activity for inducing differentiation of a mammalian stem cell are provided.

[0023] According to another aspect of the invention, assays for screening for mammalian stem cell pluripotency are provided. The assays comprise providing a factor for determining an expression level of Mkrnl in the mammalian stem cell, and comparing the expression level against a predetermined standard.

BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The invention will now be described in greater detail having regard to the appended drawings in which:

[0025] Figure 1 illustrates FACS data from a differentiation time course of Oct4:eGFP Rl ES cells showing decreasing eGFP expression following culture for 0, 1, 3 or 5 days in the absence (-) of LIF, or 0, 1 or 2 days in the presence (+) of retinoic acid (RA).

[0026] Figure 2 illustrates expression profiles for each Oct4, Nanog and Sox2, in cultured ES cells. Expression levels were determined via microarray analysis and represent expression levels following culture for 0, 1, 3 or 5 days in the absence (-) of LIF, or 0, 1 or 2 days in the presence (+) of RA.

[0027] Figure 3 illustrates the expression profile of Mkrnl in ES cells cultured in the absence (-) of LIF for 0, 1, 3 or 5 days, or in the presence (+) of RA for 0, 1 or 2 days, as determined by microarray analysis.

[0028] Figure 4 illustrates graphical representations of Oct4 (left) and Mkrnl (right) mRNA levels in ES cells cultured for 1 , 3 or 5 days in the absence (-) of LIF, or for 1 or 2 days in the presence (+) of RA, as determined by quantitative RT-PCR analyses.

[0029] Figure 5 A is a graph of fold change in Mkrnl, Oct4, Nanog and Sox2 mRNA expression levels in ES cells cultured in the presence (+) or absence (-) of LIF, with or without RA, for 2 or 3 days compared to mRNA expression levels in undifferentiated Rl ES cells. Expression levels were determined using quantitative real-time PCR.

[0030] Figure 5B is a graph of Mkrnl, Oct4 and Nanog mRNA expression levels in:

1) ES cells cultured in the presence (+) or absence (-) of LIF for 3 days (E 14 ESCs 3d -LIF); 2) ES cells engineered to overexpress Nanog, cultured in the presence (+) of LIF for 3d (Nanog OX (EF4) 3d +LIF); and 3) ES cells engineered to overexpress Nanog, cultured in the absence (-) of LIF for 3d (Nanog OX (EF4) 3d -LIF), compared to mRNA expression levels in undifferentiated El 4 ES cells (expressed as LoglO).

[0031] Figure 5C is an autoradiograph image of a western blot analysis of Mkrnl and Oct4 protein expression in Rl ES cells cultured in the presence (+) or absence (-) of LIF for 3 days. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) expression levels were determined as a loading control.

[0032] Figure 5D illustrates the effects of shRNA knockdown of Oct4 (left) and Sox2 (right) expression on Oct4 and Mkrnl expression in cultured ES cells. Data are presented graphically as log changes in mRNA expression.

[0033] Figure 6 is a schematic of the shRNA Mkrnl vector used to generate Mkrnl knockdown clones. Also included is the sequence of the shRNA cloned into this vector.

[0034] Figure 7 is a schematic of the pCAGGS:Mkrnl vector used to generate Mkrnl overexpressing ES cell clones. Also included is the sequence of the Mkrnl open reading frame (ORF) cloned into the vector.

[0035] Figure 8 is a schematic of the pCAGGS:N-FLAG::Mkral vector used to make N-FLAG Mkrnl overexpressing clones. Also included is the sequence of the N- FLAG tag coding sequence and the Mkrnl ORF cloned into this vector.

[0036] Figure 9 is a schematic of the pCAGGS:N-His/S-Tag Mkrnl vector used to make N-His/S-Tag Mkrnl overexpressing clones. Also included is the sequence of the N-His/S-Tag coding sequence and the Mkrnl ORF cloned into this vector.

[0037] Figure 10 is a schematic of the pCAGGS:C-His/HSV Mkrnl vector used to make C-His/HSV Mkrnl overexpressing clones. Also included is the sequence of the C-His/HSV coding sequence and the Mkrnl ORF cloned into this vector.

[0038] Figure 11 illustrates Mkrnl mRNA levels, determined using quantitative realtime PCR, from ten Mkrnl shRNA treated clones. mRNA levels were quantified using two unique primers.

[0039] Figure 12 illustrates a series of light micrograph images of alkaline phosphatase stained ES cell colonies overexpressing RASGAP shRNA (Control) or Mkrnl shRNA (Mkrnl).

[0040] Figure 13 illustrates in graph format the percentage of total alkaline phosphatase stained ES cell colonies following stable transfection with and expression of RASGAP shRNA (control) or Mkrnl shRNA (Mkrnl). Colonies were characterized as differentiated, partially differentiated or undifferentiated.

[0041] Figure 14 illustrates in graph format Mkrnl and Oct4 mRNA expression levels in ES cells following Mkrnl knockdown relative to untreated control cells, as determined by quantitative real-time PCR. Data are shown for seven Mkrnl shRNA treated clones.

[0042] Figure 15 illustrates in graph format Oct4 protein expression levels in three Mkrnl knockdown ES cell clones in the presence (+) or absence (-) of LIF over a 72 hour period, demonstrating that downregulation of Mkrnl expression results in lower levels of Oct4 protein expression. Each data point represents Oct4 protein expression in 10,000 individual cells.

[0043] Figure 16A is an autoradiograph image following polyacrylamide gel electrophoresis and western blot analysis of lysates extracted from N-FLAG: :Mkrnl (clones D4, D5, E3, DlO, DI l) and empty FLAG expression vector transfected (clones AlO, B4) ES cell clones. Arrows indicate N-terminal FLAG-tagged Mkrnl, endogenous (endo) Mkrn 1 , Oct 4 and GAPDH protein expression.

[0044] Figure 16B illustrates Mkrnl mRNA expression in ES cell clones transfected with N-FLAG::Mkrnl (clones D4, D5, E3, DlO, DI l) or empty FLAG expression vector (clones AlO, B4). The 0.8% agarose gel was stained with ethidium bromide following electrophoresis, indicating the presence or absence of endogenous Mkrnl transcripts as detected by reverse transcription PCR from total RNA isolated from the

ES cell clones (empty FLAG vector transfected: AlO, B4; N-FLAG: :Mkrnl transfected: D4, D5, E3, ElO & F6; and non-transfected Rl ES cells. RT-PCR analyses were performed using primers designed to amplify endogenous Mkrnl with (+) or without (-) reverse transcriptase.

[0045] Figure 16C illustrates Mkrnl mRNA expression in ES cell clones transfected with N-FLAG::Mkrnl (clones D4, D5, E3, DlO, DI l) or empty FLAG expression vector (clones AlO, B4). The 0.8% agarose gel was stained with ethidium bromide following electrophoresis, indicating the presence or absence of endogenous Mkrnl transcripts as detected by reverse transcription PCR from total RNA isolated from the ES cell clones (empty FLAG vector transfected: AlO, B4; N-FLAG: :Mkrnl transfected: D4, D5, E3, ElO & F6; and non-transfected Rl ES cells. RT-PCR analyses were performed using primers complementary to the vector backbone to amplify exogenous Mkrnl with (+) or without (-) reverse transcriptase.

[0046] Figure 16D is a series of light microscope images of alkaline phosphatase stained ES cell clones indicating Mkrnl expression (same ES cell clones indicated in Figures 16B and 16C), a histochemical stain for undifferentiated ES cells.

[0047] Figure 17 illustrates immunofluorescence microscopy analysis of FLAG- tagged Mkrnl expression in ES cell clones transfected with empty FLAG expression vector (clones AlO, B4) or N-FLAG: :Mkrnl expression vector (clones D4, DlO, E3, D5 and DI l), following culture in the presence (+) or absence (-) of LIF. N- FLAG::Mkrnl expression is indicated in green; Hoechst staining of nuclei is also indicated (blue).

[0048] Figure 18A illustrates alkaline phosphatase staining in ES cell clones cultured at medium or low density in the presence (+) or absence (-) of LIF for 1 , 3 or 5 days, and captured by light microscopy. ES cells were transfected with one of empty N- FLAG expression vector (pCAGGS:N-FLAG Control; AlO), or N-FLAG::Mkrnl expression vector (pCAGGS:N-FLAG::Mkral; clones D4 and D5) (magnification=l OX).

[0049] Figure 18B illustrates in graph format the percent of undifferentiated ES cells transfected with one of empty FLAG expression vector or N-FLAG: :Mkrnl

expression vector following 3 or 5 days of culture in the presence (+) or absence (-) of

LIF.

[0050] Figure 18C illustrates the number of alkaline phosphatase (ALP) stained ES cell colonies following culture for 3 days in the presence (+) or absence (-) of LIF. Images of stained cells in the wells of tissue culture dishes are shown on the left. Light microscope images of ALP stained ES cell colonies are shown in the middle (AlO: empty FLAG vector transfected; D4: N-FLAG: :Mkrnl transfected). A graph of the percent total ALP+ colonies for each of clone AlO (control) and N-FLAG::Mkrnl overexpressing clone is shown on the right.

[0051] Figure 19A illustrates Oct4 protein expression levels in three Mkrnl overexpressing ES cell clones cultured in the presence (+) or absence (-) of LIF for 3hours or 72 hours, indicated in fluorescence histograms.

[0052] Figure 19B illustrates in graph format the summary of results obtained in Fig. 19 A. The ratio of Oct4-positive ES cells per unit baseline is shown for each of FLAG expression vector control, and ES cell clones engineered to overexpress N-FLAG tagged Mkrnl (clones D4, D5 and E3).

[0053] Figure 2OA is an autoradiograph image of western blot analysis of N- FLAG: Mkrnl and Oct4 co-immunoprecipitation in ES cell clones transfected with N- FLAG-tagged Mkrnl (Mkrnl OX) or empty FLAG expression vector (Con). Lysates extracted from ES cell clones were subjected to co-immunoprecipitation using anti- FLAG antibody (IP: FLAG) or anti-Oct4 antibody (IP: Oct4), polyacrylamide gel electrophoresis and immunoblotting analysis using anti-FLAG antibody (IB: α- FLAG). Whole cell lysate (WCL) extracted from FLAG-Mkrnl expressing cells (Mkrnl OX) was electrophoresed on the same gel as a positive control for expression; lysates were incubated with beads alone as a negative control (Beads Ctrl).

[0054] Figure 2OB is an autoradiograph image of a western blot analysis of FLAG- Mkrnl and Oct4 co-immunoprecipitation ES cells transfected with FLAG-tagged Mkrnl (F-Mkrnl) or empty FLAG expression vector (Cont.). Lysates were extracted from ES cell clones and subjected to co-immunoprecipitation using anti-FLAG antibody (IP: MαFLAG) or anti-Oct4 antibody (IP: Rbαθct4), followed by

polyacrylamide gel electrophoresis and immunoblotting using anti-0ct4 antibody

(Mαθct4). Whole cell lysates (total) extracted from FLAG-Mkrnl expressing cells or empty FLAG vector cells (Cont.) were electrophoresed on the same gel (M=mouse; Rb=rabbit).

[0055] Figure 21 illustrates a schematic of known protein interactions within a subset of Mkrnl target/interacting proteins identified from STRING (Search Tool for Retrieval of Interacting Genes/Proteins).

DETAILED DESCRIPTION OF THE INVENTION

[0056] This invention provides methods of regulating mammalian stem cell fate through modulation of Mkrnl expression. Upregulation of Mkrnl expression in a stem cell results in the maintenance of stem cell pluripotency. The effects of Mkrnl upregulation on stem cell pluripotency can be achieved in the absence of LIF, a well known stem cell self-renewal factor. Conversely, downregulation of Mkrnl expression in a stem cell results in differentiation of the stem cell, in the presence or absence of LIF.

[0057] The identification of Mkrnl as an upstream regulator of mammalian stem cell pluripotency enables the manipulation of mammalian stem cells to promote self- renewal and/or lineage-specific differentiation for the application of, but not limited to, tissue engineering, drug discovery, in situ stem cell expansion, cancer differentiation therapy and nuclear reprogramming of differentiated cells to retain multipotent and/or unipotent potential. Inhibitors of Mkrnl expression are used to downregulate Mkrnl expression in situations where inhibition of mammalian stem cell pluripotency is required, for example in cancer treatment applications. Activators of Mkrnl expression are used to upregulate Mkrnl expression, for example in tissue regeneration applications.

[0058] This invention provides a method for maintaining or inducing pluripotency in a mammalian stem cell via upregulating expression of any one of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, in the mammalian stem cell (see e.g. Example 3). The invention further provides maintenance or induction of mammalian stem cell

pluripotency via upregulation of Mkrnl. Upregulation of Mkrnl has equivalent effects on stem cell pluripotency in the presence or absence of LIF.

[0059] In one aspect, endogenous Mkrnl is upregulated in a mammalian stem cell. Upregulation of endogenous Mkrnl is achieved via addition of an exogenous factor. The exogenous factor can be added to a cell culture medium in vitro. Exogenous factors for upregulating Mkrnl include small molecules and purified transcription activators, suitable examples of which are known to a person skilled in the art.

[0060] In another aspect, the nucleic acid encoding Mkrnl, a functional fragment of the Mkrnl nucleic acid, a polypeptide encoding Mkrnl, or a functional fragment of the Mkrnl polypeptide, is exogenous to the mammalian stem cell. For example, the nucleic acid encoding Mkrnl (for example, Genbank Accession No. BC037400 provides human Mkrnl coding sequence) or its functional fragment is contained within any one of an episomal expression plasmid, a retrovirus, a lentivirus, and a purified mRNA. The episomal plasmid is suitably introduced into the mammalian stem cell by transfection techniques well known in the art including liposomes, nanoparticles, electroporation, and viral infection, hi one example, the nucleic acid encoding Mkrnl or the functional fragment of Mkrnl is a transgene that stably integrates into the genome of the mammalian stem cell.

[0061] In another aspect, the invention provides a method for inducing mammalian stem cell differentiation via downregulating expression of Mkrnl in a mammalian stem cell, in the presence or absence of pluripotency maintenance factors, such as LIF (see e.g. Example 2). Methods of downregulating Mkrnl expression include techniques for interfering with mRNA expression and protein expression well known in the art. For example, Mkrnl expression can be downregulated by introducing any one of a short hairpin RNA, a micro RNA, or a small interfering RNA (siRNA), or an aptamer, directed against Mkrnl, into a mammalian stem cell. Aptamers for use in this invention include DNA aptamers, RNA aptamers and peptide aptamers. In one aspect, the aptamer is an antisense oligonucleotide.

[0062] Mammalian stem cells for use in the method of the invention include, although are not necessarily limited to, embryonic stem cells, extra-embryonic stem cells, cloned stem cells, induced pluripotent stem cells, tumor initiating stem cells, somatic stem

cells, and adult stem cells. The mammalian stem cell suitably can be one of a human, a primate, a murine, a rat, a sheep, a canine, a feline, a rabbit and a porcine stem cell.

[0063] In another aspect, the invention provides a use of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, for maintaining or inducing pluripotency in a mammalian stem cell (see e.g. Example 3). For example, in order to maintain or induce mammalian stem cell pluripotency, endogenous Mkrnl is upregulated in the mammalian stem cell. Upregulation of endogenous Mkrnl is achieved via addition of an exogenous factor. The exogenous factor can be added to a cell culture medium in vitro. Exogenous factors for upregulating Mkrnl include small molecules and purified transcription activators, suitable examples of which are known to a person skilled in the art. In another example, Mkrnl expression is upregulated by the addition of exogenous Mkrnl to the mammalian stem cell. Mkrnl encoding nucleic acid can be contained within any one of an episomal expression plasmid, a retrovirus, a lentivirus, and a purified mRNA. The episomal plasmid is suitably introduced into the mammalian stem cell by transfection techniques well known in the art including liposomes, nanoparticles, electroporation, and viral infection. In one example, the nucleic acid encoding Mkrnl or the functional fragment of Mkrnl is a transgene that stably integrates into the genome of the mammalian stem cell.

[0064] In another aspect, the invention provides a use of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, for inducing mammalian stem cell differentiation (see e.g. Example 2). Mammalian stem cell differentiation can be induced by downregulation of Mkrnl. Methods of downregulating Mkrnl expression include techniques for interfering with mRNA expression and protein expression well known in the art. For example, Mkrnl expression can be downregulated by introducing any one of a short hairpin RNA, a micro RNA, or a small interfering RNA (siRNA), or an aptamer, directed against Mkrnl, into a mammalian stem cell. Aptamers for use in this invention include DNA aptamers, RNA aptamers and peptide aptamers. In one aspect, the aptamer is an antisense oligonucleotide.

[0065] Mammalian stem cells in which differentiation can be induced by downregulation of Mkrnl suitably include an embryonic stem cell, an extraembryonic stem cell, a cloned stem cell, an induced pluripotent stem cell, a tumor initiating stem cell, a somatic stem cell, and an adult stem cell. The mammalian stem cell can suitably be one of a human, a primate, a murine, a rat, a sheep, a canine, a feline, a rabbit and a porcine stem cell.

[0066] In another aspect, the invention provides a method for identifying, characterizing, selecting, inducing or isolating pluripotent mammalian stem cells in a population of mammalian stem cells (see e.g. Example 3). The steps involved include determining Mkrnl expression; and isolating mammalian stem cells expressing Mkrnl. Mkrnl expression can be determined using a reagent such as an antibody, an antibody fragment, and an oligonucleotide probe specific to Mkrnl. In one example, the antibody is specific to at least one epitope of Mkrnl.

[0067] In another aspect, the invention provides a marker of mammalian stem cell pluripotency consisting of any one of a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof.

[0068] In another aspect, the invention provides a pharmaceutical composition for maintaining or inducing mammalian stem cell pluripotency. The pharmaceutical composition includes a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof, and a pharmaceutically acceptable carrier.

[0069] In another aspect, the invention provides a pharmaceutical composition for inhibiting mammalian stem cell pluripotency. The pharmaceutical composition comprises an inhibitor of Mkrnl expression; and a pharmaceutically acceptable carrier. The inhibitor of Mkrnl expression can be a short hairpin RNA, a micro RNA, a small interfering RNA, and an aptamer, specific for Mkrnl. The pharmaceutical composition of the present invention may also, or alternatively, be a prophylactic, i.e. used to partially or completely inhibit tumor-initiating stem cell pluripotency, where the pharmaceutical composition is used to treat cancer.

[0070] The modes of administering the pharmaceutical compositions of the present invention to a patient are not specifically restricted, and various methods will be readily apparent to persons skilled in the art. The composition, for example, could be delivered by injection, intravenously, intramuscularly, intraperitoneally, topically, subcutaneously, rectally, dermally, sublingually, buccally, intranasally or via inhalation to a patient. The pharmaceutical compositions are typically administered in "an effective amount" or "a therapeutically effective" amount, intended to refer to the total amount of the active compound of the method that is sufficient to show a meaningful patient benefit. Determining an effective or therapeutically effective amount is within the purview of a person skilled in the art.

[0071] In another aspect, the invention provides a pluripotent mammalian stem cell engineered to overexpress a nucleic acid encoding Mkrnl or a functional fragment thereof, or a polypeptide encoding Mkrnl or a functional fragment thereof.

[0072] In another aspect, the invention provides a method for treating cancer in a mammal. The method involves modulating expression of a nucleic acid encoding Mkrnl, or a polypeptide encoding Mkrnl endogenous to a mammalian stem cell. In particular, the method involves downregulating expression of Mkrnl in tumor- initiating cells. Methods of downregulating Mkrnl expression include techniques for interfering with mRNA expression and protein expression well known in the art. For example, Mkrnl expression can be downregulated by introducing any one of a short hairpin RNA, a micro RNA, or a small interfering RNA (siRNA), or an aptamer, directed against Mkrnl, into a mammalian stem cell. Aptamers for use in this invention include DNA aptamers, RNA aptamers and peptide aptamers. In one aspect, the aptamer is an antisense oligonucleotide.

[0073] In another aspect, the invention provides a use of an inhibitor of Mkrnl expression or activity for treating cancer in a mammal. Examples of inhibitors of expression well known in the art include short hairpin RNAs, small interfering RNAs, and microRNAs as well as aptamers and other antisense oligonucleotides.

[0074] In another aspect, the invention provides a method of tissue regeneration including upregulating expression of a nucleic acid encoding Mkrnl, or a polypeptide encoding Mkrnl in a mammalian stem cell to induce proliferation of the mammalian

stem cell; expanding the mammalian stem cell population; and introducing the expanded mammalian stem cell population into a tissue of an individual suffering from a disorder requiring cell or tissue replacement.

[0075] In another aspect, the invention provides a use of an activator of Mkrnl expression or activity for maintaining pluripotency of a mammalian stem cell. Examples of activators of expression well known in the art include isolated transcription factors capable of inducing or increasing Mkrnl transcription or expression. Examples of activators of Mkrnl activity include small molecules directed to Mkrnl.

[0076] In another aspect, the invention provides an assay for screening for mammalian stem cell pluripotency. The assay includes the steps of determining the expression level of Mkrnl in the mammalian stem cell and comparing the expression level against a predetermined standard. The predetermined standard can suitably be calculated based on the average expression level of Mkrnl in mammalian stem cells lack pluripotentiality. Mkrnl expression is determined using one of an antibody, an antibody fragment, or an oligonucleotide probe specific for Mkrnl. With regards to the antibody, the antibody is specific to at least one epitope of Mkrnl. With regards to the oligonucleotide probe, the probe has at least 70% sequence identity to Mkrnl.

[0077] As used herein, the "nucleic acid" means DNA molecules (e.g., a cDNA) and RNA molecules (e.g., an mRNA) and analogs of the DNA or RNA generated, e.g., by the use of nucleotide analogs. The nucleic acid molecule can be an oligonucleotide or polynucleotide and can be single-stranded or double-stranded.

[0078] As used herein, "polypeptide" means proteins, protein fragments, modified proteins, amino acid sequences and synthetic amino acid sequences.

[0079] As used herein, "antibody" means antibodies and antibody fragments containing functional portions thereof. "Antibody" includes any monoclonal or polyclonal compound having a sufficient portion of the light chain variable region and/or the heavy chain variable region to effect binding to the epitope to which the whole antibody has binding specificity. The fragments can include the variable region

of at least one heavy or light chain immunoglobulin polypeptide, and include, but are not limited to, Fab fragments, F(ab') ₂ fragments, Fv fragments and scFv.

[0080] As used herein, "fragment" relating to a polypeptide or polynucleotide means a polypeptide or polynucleotide consisting of only a part of the intact polypeptide sequence and structure, or the nucleotide sequence and structure, of the reference gene. The polypeptide fragment can include a C-terminal deletion and/or N-terminal deletion of the native polypeptide, or can be derived from an internal portion of the molecule. Similarly, a polynucleotide fragment can include a 3' and/or a 5' deletion of the native polynucleotide, or can be derived from an internal portion of the molecule. "Functional fragment" means a fragment of a nucleic acid or polypeptide that retains the normal biological activity of the full length molecule.

[0081] As used herein "isolated" with reference to a nucleic acid molecule, polypeptide, or other biomolecule, means that the nucleic acid or polypeptide has separated from the genetic environment from which the polypeptide or nucleic acid were obtained. It can also mean altered from the natural state. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein. Thus, a polypeptide or polynucleotide produced and/or contained within a recombinant host cell is considered isolated. Also intended as an "isolated polypeptide" (i.e. isolated transcription factor) or an "isolated nucleic acid molecules" are polypeptides or nucleic acid molecules that have been purified, partially or substantially, from a recombinant host cell or from a native source.

[0082] As used herein, "exogenous factor" means any molecule, including a nucleic acid or fragment thereof, a polypeptide or fragment thereof, or a small molecule that does not form part of the mammalian stem cells. "Exogenous factors" are provided to the mammalian stem cells from a source external to the cell.

[0083] As used herein, "stem cell" means a cell capable of each of: 1) self-renewing and producing daughter cells with equivalent developmental potential, and 2) differentiating into more specialized cells. Stem cells are preferably pluripotent stem cells capable of differentiating into all cell types of an adult organism.

[0084] As used herein, "pluripotent stem cell" means a cell that is capable of indefinite proliferation in an undifferentiated state, and maintains the potential to differentiate into derivatives of all three embryonic germ layers (endoderm, mesoderm, and ectoderm). Such a cell retains differentiation potential even after prolonged culture.

[0085] As used herein, "multipotent stem cell" refers to a stem cell that can give rise to a limited number of particular types of cells. For example, hematopoietic stem cells in the bone marrow are multipotent and give rise to the various types of blood cells.

[0086] As used herein, "aptamer" refers to an oligonucleic acid or a peptide molecule that binds to a specific target molecule. More specifically, aptamers can be classified as DNA or RNA aptamers, which consist of typically short strands of oligonucleotides, or peptide aptamers, which consist of a short variable peptide domain, attached at both ends to a protein scaffold.

[0087] hi some cases, nucleic acid sequences described herein are defined by their ability to hybridize to other nucleic acid sequences. Post hybridization washes determine stringency conditions. As used herein, "stringent conditions" means 6xSSC, 0.5% SDS at room temperature for 15 min, then repeated with 2xSSC, 0.5% SDS at 45 ⁰ C for 30 min, and then repeated twice with 0.2xSSC, 0.5% SDS at 5O ⁰ C. for 30 min. "Highly stringent conditions" means the use of higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2xSSC, 0.5% SDS was increased to 6O ⁰ C. "Very highly stringent conditions" the use of two final washes in 0. IxSSC, 0.1% SDS at 65 ⁰ C.

[0088] As used herein, "pharmaceutically acceptable carrier" means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives

or buffers, which enhance the shelf life or effectiveness of the pharmacological agent.As used herein, "treating" means inhibiting, eliminating, ameliorating, diminishing and/or reducing symptoms associated with a disease or condition.

Materials and Methods

ES Cell Culture

[0089] Rl murine ES cells and Rl -derived clones including: Oct4::eGFP ES cells, RasGAP knock down control ES cells, Mkrnl knockdown ES cells and Mkrnl overexpressing ES cells were cultured at 37 ⁰ C and 5% CO ₂ , on a layer of mitomycin- treated murine embryonic fibroblasts (MEFs). Cells were cultured in ES media; specifically, Dulbecco modified eagle media (DMEM) supplemented with 15% fetal bovine serum (FBS; Northbio, Lot #SF30408), 1000U/mL leukemia inhibitory factor (LIF; ESGRO from Chemicon, batch 11061065), O.lmM non-essential amino acids (Gibco), ImM sodium pyruvate (Gibco), 2mM L-glutamine (Gibco) and 10 ^"4 M β- mercaptoethanol (Sigma). Selection media consisted of ES media supplemented with 150/xg/mL G418 (Geneticin; Gibco). Differentiation media consisted of either selection media without LIF, or selection media without LIF and supplemented with O.lμM retinoic acid (RA). Freezing media consisted of 50% FBS/40% ES media/10% DMSO (Sigma). ES cells were passaged every two days at a ratio of 1:5 by washing with phosphate buffered saline (PBS) (Gibco), dissociating with 0.05% trypsin (Gibco) for 5 minutes at 37 ⁰ C, and resuspending in appropriate media.

Time Course of Oct4:eGFP ES Cell Differentiation

[0090] Oct4:eGFP ES cells (Viswanathan et al. Biotechnol Appl Biochem. 42(pt. 2): 119-131, 2005.) were plated at a density allowing growth for a set number of days without overcrowding. Cells were plated on 10-cm tissue culture treated dishes (Falcon) coated with 0.1% gelatin in LIF-negative differentiation media at a density of 5x10 ⁵ cells/dish for 5 days, 1x10 ⁶ cells/dish for 3 days, 2x10 ⁶ cells/dish for 2 days, or 3.5x10 ⁶ cells/dish for 1 day of differentiation. Differentiation media was changed each day. Control, undifferentiated cells were harvested two days after plating in +LIF conditions. For FACS sorting of differentiating cells, Oct4:eGFP ES cells were trypsinized, and resuspended in 2% FBS in PBS at a dilution of 8x10 ⁶ cells/mL. Cells

were sorted into three populations based on GFP expression (high, medium and low).

Sorted cell populations were collected, and RNA was extracted using Trizol (Invitrogen).

Microarray Hybridizations

[0091] Total RNA extracted from FACS sorted cells using Trizol (Invitrogen) was subjected to two cycles of standard cDNA synthesis and in vitro transcription. Five hundred ng of cRNA was used for the second cycle of amplification and 1 μg of purified cDNA from the second cycle was used for biotin labeling. Amplified and biotin-labeled cRNA was hybridized to each of the Affymetrix GeneChips MG_U74av2 and MG_U74bv2.

Microarray Analysis

[0092] The normalized data obtained from MAS5.0 analysis of the Affymetrix MGU74a and MGU74b chips of 16 time points were analyzed as follows: first, the Present/ Absent/Marginal designations for each probe were used to isolate only probes for which at least one hybridization was measured as Present (14,000 probes). Probes in which all hybridizations were measured as marginal or absent were disregarded from this point forward. The data were centered by taking the average of all hybridizations for a given probe and dividing each expression value by that average in order to shift the data so that each value was a number between 0 and 1, and the average of expression values for a given probe was 1. The standard deviation across the 16 hybridizations of each probe was calculated and compared to the standard deviation of all probes (the latter calculated to be 0.449). Only probes with a standard deviation greater than 0.449 were considered further (2,700 probes in total). K-means clustering analysis was performed using the JAVA-based application Multiexperiment Viewer (MeV) v4.0 (TIGR).

siRNA Design

[0093] Qiagen

(http://wwwl .qiagen.com/Products/GeneSilencing/CustomSiRna/SiRnaDesigner .aspx ), Dharmacon (http://www.dharmacon.com/sidesign/default.aspx?source=Q ^' ) and Ambion (http://www.ambion.com/techlib/misc/siRNA_finder.html) websites were

used to generate a 21 -base pair siRNA sequence specific to the Mkrnl mRNA sequence (SEQ ID No. 1). Criteria for selection of an appropriate Mkrnl siRNA sequence required that the sequence be at least 100 nucleotides away from both the start and the termination codon, had approximately 50% GC content, had no more than three successive G or Cs or four successive A or Ts, and was not homologous to any other murine gene, as determined by a BLAST search. The siRNA sequence selected to knockdown endogenous Mkrnl expression in ES cells was 5'-AAT GCC GGA TCA CAT CTA ACT-3' (SEQ ID No. 1). Custom complementary oligonucleotides were synthesized.

Construction of Mkrnl shRNA Transgene

[0094] Mkrnl siRNA was subcloned into a selectable plasmid shRNA vector as described in Kunath et al., Nature Biotechnol. 21:559-561, 2003. The selectable plasmid shRNA vector utilizes the human Hl RNA polymerase III promoter to drive expression of the inserted siRNA sequence, and contains the neomycin-resistance gene under the control of the SV40 early promoter, enabling selection of transfected cells. lOμL of each of the Mkrnl siRNA sense and antisense strands were combined, heated for 3 minutes at 99°C and allowed to cool slowly to room temperature over one hour. The vector backbone was digested using Xbal (New England Biolabs (NEB) R0145S) and Asρ718 (Roche 814253), and the digested vector was isolated using the QIAquick® gel extraction kit (Qiagen). The annealed oligonucleotides were ligated into the Xbal/Asp718 digested vector using the Quick T4 DNA Ligase kit (NEB). DH5α bacteria (Invitrogen) were transformed with the resulting ligation mixture. Colonies were picked and screened for the correct sequence. Qiaprep® Miniprep kits (Qiagen) were using to extract plasmid DNA. Sequencing was performed using the BigDye sequencing kit and T7 primer. Plasmids with verified sequences were propagated and isolated using HiSpeed™ Plasmid Purification Maxi kits (Qiagen). The plasmids were precipitated with ethanol and purified with phenol chloroform (Invitrogen) to obtain a high concentration of pure plasmid for electroporation.

Creation ofMkrnl Overexpressing Constructs pCAGGSrMkrnl Construct

[0095] Mkrnl cDNA (Genbank Accession No. NM 018810) was reverse transcribed from murine ES cell RNA using the Omniscript RT-PCR kit (Qiagen) and amplified using the forward primer 5 '-GCACGCGTCGCTGTCTTCTCCTTCTC-S' (SEQ ID No. 2) and the reverse primer 5'-GACACGCGTCACACAGCACAGGGGA-S' (SEQ ID No. 3). Primers were designed to introduce MIuI restriction sites into the 5' and 3' ends of the PCR product. Mkrnl cDNA was first subcloned into the pCR2.1-TOPO vector. Positive clones were identified through blue/white selection. Mkrnl cDNA was excised from the pCR2.1-TOPO vector using MM; the insert was treated with Klenow fragment (Invitrogen) to generate blunt ends. The pCAGGS vector was linearized using Smal to generate blunt ends. The gel-purified, blunted Mkrnl cDNA insert was ligated into the linearized and blunted pCAGGS vector. The resulting pCAGGS :M&rn 7 construct was verified and confirmed using restriction enzyme mapping and DNA sequencing.

pCAGGS:N-FLAG::Mkrnl Construct

[0096] The 3xFLAG epitope (DYKDHDGDYKDHDIDYKDDDDK) was excised from the pCMV 3xFLAG 7.1 vector (Sigma) using Sad and Xmal restriction enzymes, maintaining the 5' KOZAK sequence. The 3xFLAG insert was treated with Klenow fragment to generate blunt ends and the insert was cloned into the Smal digested pCAGGS vector. The resulting pCAGGS :FLAG vector was linearized using HindIII restriction enzyme then treated with Klenow fragment to generate blunt ends. Mkrnl protein encoding cDNA was amplified via PCR using the forward primer 5'- GATATCAGCTGTATAATGGCGGAGGCTGCG-S ¹ (SEQ ID No. 4) and the reverse primer 5'-GGTCGCAGCTGCTATAGATCCAAGTC-S' (SEQ ID NO. 5). The resulting PCR product was digested using PvuII to generate blunt ends, gel-purified and cloned into the pCAGGS-FLAG vector, immediately downstream of the FLAG epitope. The pCAGGS :N-FLAG::Mkrnl construct was verified and confirmed by restriction enzyme mapping and DNA sequencing.

pCAGGS:C-His/HSV::Mkrnl

[0097] The pTriEx-2 Neo vector (Novagen) was digested with Ncol and PvuII to excise the intervening His-Tag and S-Tag sequence. Mkrnl protein-coding cDNA was amplified with the forward primer 5'-GTAATACCATGGCGGAGGCTGCGGC- 3' (SEQ ID No. 6) and the reverse primer 5'- GAGCGC AGCTGTAGATCCAAGTCATAAAAG-S' (SEQ ID NO. 7) which primed the Mkrnl cDNA sequence lacking a stop codon. The resulting PCR product was digested with Ncol and PvuII, gel-purified and cloned into the pTriEx-2 Neo vector. The pCAGGS:C-His/HSV::Mkrnl construct was verified and confirmed by restriction enzyme mapping and DNA sequencing.

pCAGGS:N-His/S-Tag::Mkrnl

[0098] The pTriEx-2 Neo vector (Novagen) was digested with Smal. Mkrnl protein- coding cDNA was amplified with a 5'-phosphorylated forward primer 5'- GGGGAAT AATGGCGGAGGCTGCG-3' (SEQ ID No. 8) and the reverse primer 5'- GGTCGC AGCTGCTAT AGATCC AAGTC-3' (SEQ ID No. 9). The resulting PCR product was digested with PvuII to generate blunt ends, gel-purified and cloned into the pTriEx-2 Neo vector. The pCAGGS:N-His/S-Tag::Mkrnl construct was verified and confirmed by restriction enzyme mapping and DNA sequencing.

Generation of Mkrnl Knockdown Cell Lines

[0099] For electroporation, 50μg of purified plasmid shRNA vector was linearized using Seal (NEB R0122L). Digested DNA was ethanol (EtOH) precipitated and resuspended in 50μL of double distilled water (ddH ₂ O) to yield a final concentration of lμg/μL. Fresh ES cell media was added to the ES cells two hours prior to electroporation. The cells were trypsinized, washed with PBS and resuspended in electroporation buffer. Twenty-five μg of plasmid DNA was added to 1.5xlO ⁷ Rl ES cells in one electroporation cuvette with a 4mm gap (VWR Scientific, 47727-644). Cells were electroporated with 250V using the GenePulser XCell® (Biorad). After electroporation, cells were put on ice for 10 minutes, followed by warmed media for 20 minutes, and finally plated on 0.1% gelatin coated 10-cm TCP dishes. Each cuvette was plated onto two dishes. Selection was started 24 hours after the electroporation. Selection media was changed each day for approximately seven days following which 96 single colonies were picked and placed into an individual well of

a V-bottom 96-well plate (Costar 3894, Corning) with 50μL of trypsin. Colonies were trypsinized, resuspended and plated onto a flat-bottom 96-well plate (Falcon 35- 3072) with MEFs. Clones were maintained by splitting 1 :3 onto MEFs. Clones were frozen in 2x freezing media and RNA was isolated from clones using the RNeasy® 96 kit (Qiagen).

Generation ofN-FLAG::Mkrnl Overexpressing Cell Lines

[00100] pCAGGS:N-FLAG::M£r«7 and pCAGGS:N-FLAG empty vector plasmids were linearized with Xmnl. Rl murine ES cells were trypsinized and resuspended in electroporation buffer (Specialty Media, Phillipsburg, NJ). 1.5 x 10 ⁷ ES cells were added to each electroporation cuvette. Twenty-five μg of linearized DNA was added to each cuvette and cells were subsequently electroporated (BioRad Gen Pulser X-cell; 250V, 500μF). Electroporated cells were seeded in ES media on a 0.1% gelatin coated plates and cultured at 37 ⁰ C, 5% CO ₂ . The following day the ES media was replaced with selection media and cultured at 37 ⁰ C, 5% CO ₂ . Electroporated cells were maintained in fresh selection media until isolated colonies formed. Individual undifferentiated ES cell colonies were picked under the dissecting microscope in sterile conditions. Colonies were treated with 0.1% Trypsin/0.5mM EDTA (ethyl enediaminetetraacetic acid) at 37 ⁰ C for 5min and transferred to a 96-well plate containing MEFs. ES cells were cultured in selection media at 37 ⁰ C, 5% CO ₂ for 2 days before splitting the 96-well plate into 3 distinct 96-well plates. ES cells were seeded the wells of two 96-well plates coated with 0.1% gelatin; seeded cells were used for alkaline phosphatase staining and RNA extraction while the remaining ES cells were suspended in 2x freezing media and frozen as a master stock.

[00101] The respective ES cell clones were fixed in 10% cold neutral formalin buffer (NFB: 10OmL formalin, 16g Na ₂ HPO ₄ -H ₂ O in IL ddH ₂ O) for 45min. Alkaline phosphatase (ALP) stain was made as 0.0 Ig Naphthol AS MX-PO ₄ (N4875, Sigma) dissolved in 400μL N,N-dimethylformamide (DMF; Sigma), 25mL 0.2M Tris-HCl (pH=8.3), 0.06g red violet LB salt in 25mL ddH ₂ O and filtered through Whatman's No. 1 filter paper. ALP stain was added to the fixed ES cells and allowed to incubate for Ih at room temperature. Stained cells were washed three times with PBS and subsequently imaged with the Leica DC200 light microscope and Leica IM50 V 1.20

software. Upon imaging, ES cell colonies were classified as differentiated if there was little or no ALP stain present, partially differentiated if less than 75% of the colony stained positive ALP expression or undifferentiated if greater than 75% of the colony stained positive for ALP expression.

Staining ES Cell Clones for Alkaline Phosphatase Expression

[00102] The respective ES cell clones were fixed in 10% cold neutral formalin buffer (NFB: 10OmL formain, 16g Na ₂ HPO ₄ -H ₂ O in IL ddH ₂ O) for 45min. Alkaline phosphatase (ALP) stain was made: 0.01 g Naphthol AS MX-PO ₄ (N4875, Sigma) dissolved in 400μL N,N-dimethylformamide (DMF; Sigma), 25mL 0.2M Tris-HCl (pH-8.3), 0.06g red violet LB salt in 25mL ddH ₂ O and filtered through Whatman's No. 1 filter paper. ALP stain was added to the fixed ES cells and allowed to incubate for Ih at room temperature. Stained cells were washed three times with PBS and subsequently imaged with the Leica DC200 light microscope and Leica IM50 V 1.20 software. Upon imaging, ES cell colonies were classified as differentiated if there was little or no ALP stain present, partially differentiated if less than 75% of the colony stained positive ALP expression or undifferentiated if greater than 75% of the colony stained positive for ALP expression.

RT-PCR Screen for N-FLλG::Mkrnl Overexpressing Clones

[00103] Total RNA from N-FLAG: :Mkrnl over-expression clones and N-

FLAG control clones were isolated using the RNeasy Mini kit (Qiagen) and then treated with RNase-free DNase I (DNAfree kit, Ambion). First strand cDNA was reverse transcribed from 1 μg of template RNA using the Omniscript RT kit (Qiagen) in combination with random hexamer primers (Invitrogen). Reactions proceeded at 37 ⁰ C for Ih. Reactions were performed in the presence and absence of reverse transcriptase to assess the extent of contamination from genomic DNA. The RT-PCR product was used as the template in the subsequent PCR to detect the presence of endogenous and transgenic Mkrnl transcripts. Endogenous Mkrnl transcripts were assessed with primers complementary to regions outside the transgenic transcript (forward: 5'-CCTCCCTTCGCTGTCTTCTCC-S' (SEQ ID NO. 10), reverse: 5'- GGAGGTGAGGGT AGAGGAAC AGG-3' (SEQ ID No. H)). The transgenic Mkrnl transcript was detected with the forward primer 5'-

GATATCAGCTGTAT AATGGCGGAGGCTGCGC-3' (SEQ ID No. 12) and the reverse primer 5'-GGAGGGGCAAACAACAGATGGCTGGC-S' (SEQ ID NO. 13). cDNA was amplified with Taq polymerase (Invitrogen). Cycles were performed as follows: 94 ⁰ C for 3min; 30 cycles of 94 ⁰ C for 30s, 65 ⁰ C for 30s and 72 ⁰ C for lmin 45s; and a final extension of 72 ⁰ C for 3min.

Quantitative Real-Time PCR

[00104] Total RNA was isolated using RNeasy Mini kit (Qiagen) and then treated with DNase (DNAfree kit, Ambion). RNA (lμg) was reverse transcribed using Super-Script II RNase H-Reverse Transcriptase (Invitrogen) with oligo(dT) ₂₃ primers (Sigma). Mouse genomic DNA (Roche) standards or the cDNA equivalent to IOng of total RNA were added to the qPCR reaction in a final volume of lOμL containing: Ix PCR buffer (without MgCl ₂ ), 3mM MgCl ₂ ,0.2mM dNTP, SYBR Green I (Molecular Probes), ROX reference dye (Invitrogen) and 0.5μM primers. Amplification conditions were: 95 ⁰ C (3min); 40 cycles of 95 ⁰ C (10s), 65 ⁰ C (15s), 72 ⁰ C (20s); 95 ⁰ C (15s), 6O ⁰ C (15s), 95 ⁰ C (15s). qPCR was performed using the ABI Prism® 7900HT Sequence Detection System (Applied Biosystems). Primes were designed using Applied Biosystems PrimerExpress program and synthesized. Serial dilutions of mouse genomic DNA at concentrations of 9ng, 3ng, Ing, 0.3ng and O.lng were run on each plated with each primer. Two endogenous housekeeping genes (β- actin and elongation factor 1) were run on each plate. Measured transcript levels were normalized to the housekeeping genes and compared to a control, untreated sample. Samples were run in triplicate. Primer sequences: Mkrnl_F (primer 1): AGCCGGACCGGAACTATGT (SEQ ID NO. 14); Mkrnl_R (primer 1): TGTTTATCCCACACAGCAATGG (SEQ ID NO. 15); Mkrnl_F (primer 2): GTTGGATCACTTGCTGAAATGAAT (SEQ ID NO. 16); Mkrnl_R (primer 2): TTGGAAAGCTTGGGTTTCGTG (SEQ ID NO. 17); /5-actin_F: TGGCTGAGGACTTTGTACATTGTT (SEQ ID NO. 18); /3-actin_R: GGGACTTCCTGTAACCACTTATTTCA (SEQ ID NO. 19).

Intracellular Immunofluorescnece Analysis of N-FLAG: :Mkrnl Protein

[00105] N-FLAG: \Mkrnl clones and N-FLAG control clones were plated in individual wells of a 24-well plate coated with 0.1% gelatin at a density of 9.OxIO ⁴

cells/well. Cells were cultured in selection media for 48h before being fixed with 4%

PFA in PBS for 12min. Following extensive washes, cells were permeabilized with 100% methanol for lOmin and washed extensively with PBS. Non-specific binding sites were blocked by incubating permeabilized cells in blocking buffer (5% goat serum [Gibco], 5% BSA [Sigma] in 0.05% Tween PBS) for Ih. Cells were subsequently incubated with 5/xg/mL murine anti-FLAG M2 monoclonal antibody (Sigma Aldrich) in PBS for Ih, washed extensively with PBS and incubated with 5μg/mL Alexa Fluor 488 (H+L) goat anti-mouse antibody (Molecular Probes) and lOμg/mL Hoechst (Molecular Probes) nuclear dye in PBS for Ih. Following immunostaining, cells were washed with PBS and imaged with the Leica DMIRE2 fluorescent microscope and OpenLab software.

Self-Renewal Maintenance Assay

[00106] To determine whether continuous Mkrnl expression could prevent ES cells from differentiating after 1, 3 and 5 days in -LIF conditions, N-FLAG: :Mkrnl over-expression clones and N-FLAG control clones were plated in individual wells of a 24- well plate coated with 0.1% gelatin at three different densities depending on the length of time the cells spent in culture. ES cells cultured for 1 day were seeded at a density of 9xlO ⁴ cells/well, 2.5xlO ⁴ cells/well for 3 days and 1.3xlO ⁴ cells/well for 5 days. 24h after seeding, selection media was removed, cells were washed extensively with PBS to remove residual LIF and the cells were cultured in either +LIF or -LIF selection media for the indicated time points. On the appropriate day, the media was removed and alkaline phosphatase activity was assessed through ALP staining. ES cell colonies were imaged with the Leica DC200 light microscope and Leica IM50 V 1.20 software and characterized as differentiated, partially differentiated and undifferentiated as previously described.

Oct4 Protein Quantification in Single Cells Following Removal of LIF

[00107] Cells were plated in a 96-well plate (6005182; Packard) coated with a fibronectin/gelatin mixture (12.5ug/ml fibronectin; Fl 141; Sigma- Aldrich, 0.02% gelatin) at a density of 12,000 cells/well for the 3-hour time-point and 6,000 cells/well for the 24-hour, 48-hour and 72-hour time-points. Cells were cultured in DMEM with 15% knockout-serum replacement (10828-028; Invitrogen). Cells were cultured in -

LIF and +LIF (ESGRO, Chemicon; ESGl 106) conditions. All cells were plated in

+LIF conditions and media was changed to -LIF after 3 hours. Each cell line was plated in triplicate.

[00108] At each time-point, cells were fixed in 3.7% formalin, permeabilized with 100% methanol and stained with a primary antibody targeting Oct3 (Oct4) (611202; BD Transduction Laboratories), followed by a secondary antibody AlexaFluor 546, (A-11030; Molecular Probes) and Hoechst (862096; Sigma-Aldrich) (0.1 ug/mL). Cells were imaged using the ArrayScan II automated fluorescent microscope (Cellomics). Average pixel intensity of Oct4- AlexaFluor 546 fluorophore within the nuclear area (as defined by Hoechst staining) of individual cells was determined. 10,000 individual cells were imaged and the percentage of Oct4-negative cells was determined.

Quantification of Transgenic N-FLAG: xMkrnl Protein Using Western Blot Analysis

[00109] N-FLAG: :Mfcrwi over-expression clones and N-FLAG control clones were plated on 10-cm dishes coated with 0.1% gelatin at a density of 2x10 ⁶ cells/dish. Cells were cultured in selection media (+ or -LIF where indicated) for 72h prior to lysis with Ix TNTE lysis buffer (15OmM NaCl, 5OmM Tris, IM EDTA, 0.5% TritonX-100, pH=7.4) including Ix protease inhibitor cocktail (Roche). Total protein concentration of each cell lysis mixture was determined using the Bradford Reagent (Sigma Aldrich). 30μg of total protein was loaded into each lane and run through 10% SDS-PAGE. Western blots were probed for N-FLAG: :Mkrnl protein, endogenous Mkrnl protein, endogenous Oct4 protein and the loading control GAPDH with 5μg/mL murine anti-FLAG M2 monoclonal antibody (Sigma Aldrich), 0.5μg/mL rabbit anti-Mkrnl polyclonal antibody (Bethyl Laboratories, Inc.), 0.25μg/mL murine anti-Oct4 antibody (BD Transduction Laboratories) and 0.5μg/mL rabbit anti-GAPDH polyclonal antibody (Abeam Inc.), respectively. All antibody solutions were prepared in 5% skim milk TBST solutions. Western blot analysis was conducted with the ECL Plus Western Blotting Reagents (GE Healthcare).

Co-immunoprecipitation and Liquid Chromatography-Tandem Mass Spectrometry

Analysis

[00110] N-FLAG Mkrnl over-expression clones and N-FLAG control clones were each cultured on four 10-cm dishes coated with 0.1% gelatin in selection media for 48h. Prior to lysis two plates of each clone were treated with either lOμM of the proteasome inhibitor, MGl 32 or the equivalent volume of the vehicle DMSO and returned to 37 ⁰ C for 5h. The cells were washed twice with PBS and lysed in IX TNTE (0.5% Triton-XlOO) for 20min on a 4 ⁰ C rocker. The supernatant was used in a lhr Flag-M2-bead immunoprecipitation at 4 ⁰ C. Subsequently, the beads were washed 4X with IX TNTE wash buffer (0.1% Triton-XlOO), 2X with Tris-CaCl ² solution

(pH=8) and digested with 500pg of porcine-trypsin for 6hrs. The protonated peptides were separated by reverse phase liquid chromatography (LC) using 0.1% formic acid Buffer A. The tandem mass spectrometry (MS/MS) was carried out on a Finnigan LTQ mass spectrometer, programmed for data-dependent MS/MS acquisition (one survey scan, three MS/MS of the most abundant ions). The RAW files generated by XCalibur (Finnigan) were converted into DTA files and searched using Mascot against the NCBI Mouse protein database (2007 version). Data analysis was performed using an in-house software designed for peptide and protein score comparison and ranking.

EXAMPLE 1

Identification of Mkrnl as a Stem Cell Fate Regulator

[00111] The process of stem cell asymmetric division is highly regulated and perturbations of this process can lead to a variety of disorders including degenerative disease and, conversely, cancer. The identification of molecules with key roles in regulating stem cell pluripotency is critical to provide an improved understanding of the molecular pathways responsible for maintenance of the stem cell phenotype. In addition, information regarding stem cell markers can be used to identify potential therapeutic targets.

[00112] While most somatic stem cells are not isolatable due to the fact that their phenotypic identity has not yet been determined or due to an inability to isolate enough pure stem cells to study them biochemically, embryonic stem (ES) cells can be utilized to model somatic stem cell behavior and to investigate critical stem cell signaling pathways. An Affymetrix microarray screen for regulators of ES cell self- renewal and commitment was performed on Rl ES cells expressing transgenic eGFP driven by the Oct4 promoter.

[00113] eGFP expression was used to track the time course of differentiation.

Two different methods of differentiating ES cells in vitro were used. The first method of differentiation involved the removal of LIF (-LIF) from the culture medium. Using this method, it was observed that a significant population of ES cells had differentiated after 5 days, as indicated by decreased Oct4::eGFP expression levels, and determined by an assay of Oct4 promoter activity (Figure 1; -LIF day 1, 3 and 5). The second method of differentiation involved culturing ES cells in -LIF medium supplemented with 0.1 μM retinoic acid (+RA). hi the +RA culture conditions, ES cells differentiated much more rapidly than under -LIF conditions, as determined by the dramatic decrease in eGFP expression within 2 days (Figure 1; +RA day 1 and day 2). The time required for ES cell differentiation was dependent on the method of differentiation, indicating that unique molecular events drive-LIF induced- differentiation compared to +RA induced differentiation. The observed differences in the differentiation pathways prompted investigation into the set of critical pluripotency genes regulated in both time courses.

[00114] Because each cell population exhibited a heterogeneous expression of eGFP, cells were sorted into three groups (High, Medium and Low) at each time point based on eGFP expression. This ensured that only cells at the very initial stages of commitment were isolated. RNA was extracted from the sorted cells and separate microarray hybridizations were performed for each sorted population at each time point. Extracted RNA was hybridized to the Affymetrix murine chips MG_U74Av2 and MG_U74Bv2 on each sorted population of cells, at each time point. The Oct4 probes on the microarray chips showed gradual and consistent downregulation throughout both time courses, as predicted by the down-regulation in eGFP driven by the Oct4 promoter (Figure 2; left side). Similarly, two additional regulators of ES

cell self-renewal, Nanog and Sox2, showed gradual and consistent down-regulation

(Figure 2; middle and right, respectively). The observed subtle decline in each of Oct4, Nanog and Sox2 transcript levels validated the model for determining the initial stages of commitment, and captured gene expression changes at time points following incremental losses in Oct4, Nanog and Sox2 expression.

[00115] Analysis of the two time courses was performed separately to establish four lists of regulated genes: 1) downregulated following LIF withdrawal; 2) upregulated following LIF withdrawal; 3) downregulated following RA addition; and 4) upregulated following RA addition. For the -LIF time course, 14,840 probes of the 24,967 probes on the two microarray chips were expressed in at least one of the time points. All probes that were not expressed at any time point were excluded from further analysis. Of the remaining genes, 3,357 probes exhibited greater variation across the time course than the average variation of the population. These 3,357 genes were clustered, revealing 880 downregulated probes and 1,059 upregulated probes. For the +RA time course, 12,954 probes were expressed in at least one time point, 4,170 probes showed significant variation across the time course, and clustering revealed 1,385 downregulated genes and 1,265 upregulated genes. The cluster of genes that were downregulated upon differentiation by both -LIF and +RA treatment were investigated further given the postulation that expression of the genes most critical to the maintenance of ES cell self-renewal would be universally silenced immediately following renewal to allow differentiation.

[00116] Comparison of the set of downregulated genes from both experiments was performed. Twenty-seven genes were found to be common to both data sets, including Oct4, Nanog and Sox2, as well as previously identified targets of Oct4 including Utfl, Rexl (Zfp42) and Foxd3. Mkrnl, a RING finger protein previously characterized as an E3 ubiquitin ligase, was identified as one of 189 genes co- regulated with Oct4, Nanog and Sox2, upon the removal of self-renewal signals from (e.g. LIF) or the addition of differentiation signals (e.g. retinoic acid) to the culture medium. However, no association between Mkrnl and stem cell self-renewal and commitment was previously established. The present invention represents the first disclosure of a role for Mkrnl in regulating embryonic and somatic stem cell fate.

[00117] The mRNA expression profile of Figure 3 indicates 2-fold downregulation of Mkrnl after 5 days of ES cell culture in the absence of LIF (-LIF), conditions that induce differentiation. A similar gradual repression of Mkrnl was observed in ES cell cultures following 2 days of RA induced differentiation (+RA treatment). The kinetics of Mkrnl repression was comparable to the kinetics of the known ES cell regulators Oct4, Sox2 and Nanog.

[00118] Microarray data were confirmed by qPCR experiments designed to quantify both Oct4 and Mkrnl transcript levels in all three sorted populations Oct4:eGFP ES cell clones at each time point. The qPCR data verified the same trend as that observed in the microarray analysis: both Oct4 and Mkrnl transcript levels decreased following both modes of differentiation (Figure 4).

[00119] Mkrnl expression was shown to correlate with the pluripotent state of the ES cells. Mkrnl mRNA levels were downregulated along with Oct4, Nanog and Sox2 mRNA in ES cells induced to differentiate by the removal or LIF for 3 days or by the removal of LIF and the addition of 10OnM RA (Figure 5A). Mkrnl and Oct4 protein levels were downregulated in ES cells cultured in the absence of LIF for 3 days compared to ES cells cultured in the presence of LIF for 3 days (Figure 5C). Mkrnl mRNA expression was upregulated in Nanog overexpressing El 4 ES cells cultured in the presence or absence of LIF for 3 days (Figure 5B). Nanog overexpressing ES cells are known to self-renew independently of LEF and, thus, were utilized to quantify Mkrnl expression levels in an undifferentiated ES cell in the absence of LIF. Upregulation of Mkrnl mRNA levels in the Nanog overexpressing ES cells in the absence of LIF indicated that Mkrnl expression in undifferentiated ESCs was independent of the LIF/gpl30/STAT3 signalling pathway. As evidenced by the data presented in Figure 5D, perturbation of either Sox2 or Oct4 expression induced differentiation even in the presence of LIF and, as a result, induced the downregulation of Mkrnl mRNA expression.

EXAMPLE 2

Downregulation of Mkrnl Causes Stem Cell Differentiation

[00120] To further explore the function of Mkrnl in ES cells, and in particular its capacity to maintain stem cell identity, endogenous Mkrnl expression was downregulated ("knocked down") using short hairpin interfering RNA (shRNAi). Mkrnl expression was silenced through the generation of stably transfected shRNA knockdown ES cell lines using a plasmid vector having an Hl pol III promoter driving expression of hairpin loop Mkrnl shRNA (Figure 6). The SV40 early promoter drove expression of the neomycin-resistance gene permitting selection of neomycin-resistant clones.

[00121] Quantitative RT-PCR was performed on ten Mkrnl knockdown ES cell clones and one RasGAP control ES cell clone using two unique primer sequences specific to endogenous Mkrnl. Primer sets were designed to detect both the 1.7-kb and 2.9-kb Mkrnl mRNA isoforms. Compared to the RasGAP control {RasGAP is not expressed in ES cells), Mkrnl mRNA copy number was knocked down at least 40% in all ten Mkrnl shRNA clones (Figure 11). Results were normalized to both β- actin and elongation factor- 1 reference genes; only β-actin normalized results were shown.

[00122] In a parallel experiment, colonies were stained for alkaline phosphatase

(ALP) activity following G418 selection for Mkrnl shRNA knockdown clones. In the ALP histological, undifferentiated ES cells stained red whereas differentiated ES cells did not take up the stain (Figure 12). Knock down of Mkrnl expression was shown to drastically affect the ES cell phenotype and morphology. Mkrnl shRNA-treated colonies demonstrated decreased ALP activity, indicated by weak staining throughout the colony (typically, ALP staining decreases around the edges first), hyperproliferation leading to enlarged colony size, and differentiated morphology (a flattened morphology typical of differentiating cells rather than the rounded ES morphology) (Figure 12, lower panels). RasGAP control clones retained high alkaline phosphatase activity as well as the canonical ES cell morphology (Figure 12, upper panels).

[00123] The total number of colonies present on two 10cm dishes following electroporation with shRNA, and G418 selection, were counted and characterized as undifferentiated, partially differentiated or differentiated. Fifty-five percent of

RasGAP control colonies were characterized as undifferentiated; in contrast, 30% of

Mkrnl shRNA- treated colonies were characterized as undifferentiated. Despite being cultured in presence of LIF, the majority of Mkrnl shRNA-treated colonies were characterized as differentiated while a significant percentage of colonies were partially differentiated (Figure 13). These data showed that even in culture conditions supporting undifferentiated ES cells, downregulation of Mkrnl expression resulted in ES cell differentiation.

[00124] The effects of decreased Mkrnl expression on ES cell self-renewal capacity were determined via qPCR analysis of Mkrnl and Oct4 mRNA levels. Transcript levels from seven Mkrnl knockdown clones were compared to transcript levels in the RasGAP control clone. Knockdown of Mkrnl expression resulted in a concomitant decrease in Oct4 mRNA levels (Figure 14). The data provide evidence that knockdown of Mkrnl expression perturbed expression of οct4, a critical regulator of ES cell self-renewal.

[00125] In light of evidence that knockdown of Mkrnl expression caused Oct4 mRNA levels to decrease, the effects of Mkrnl knockdown on ES cell self-renewal was investigated. A self-renewal screen using the Cellomics ArrayScan high content analysis system was employed in the study. The screen was based upon the use of antibody immunoreactivity and immunofluorescence imaging to quantitatively measure Oct4 protein expression at a single cell level as a surrogate marker of ES cell pluripotency (self-renewal). Loss of Oct4 protein expression and, thus, decrease of fluorescence below a threshold value, signified cell differentiation.

[00126] It was demonstrated that decreased Mkrnl expression resulted in the induction of ES cell differentiation at a more rapid rate than in RasGAP control clones (Figure 15). Oct4 expression was more rapidly inhibited in Mkrnl knockdown ES cell clones in both the presence and absence of LIF over a 72 hour period, compared to RasGAP control clones, as determined by single cell measurements of Oct4 protein levels. Measurement of Oct4 protein levels were determined from single cell readings averaged over 10,000 cells. Mkrnl knockdown ES cell clones were also observed to more rapidly undergo differentiation in the presence of LIF, which is known to maintain high levels of Oct4 protein expression in ES cells. These data provide

further evidence of a role for Mkrnl in intrinsic stem cell self-renewal, and suggests

Mkrnl functions in parallel and perhaps dominates over signals transduced from the cell surface.

[00127] Downregulation of Mkrnl is tightly linked to the decreased expression of Oct4 mRNA as determined by analysis of differentiation time courses using both microarray and quantitative real time PCR techniques. Knockdown of Mkrnl by short hairpin RNA (shRNA) in murine ES cells resulted in a concomitant decrease in Oct4 mRNA levels and hastened differentiation as assessed by a high-content screen for surrogate markers of ES cell self-renewal. Mkrnl shRNA-expressing ES cell clones displayed decreased alkaline phosphatase activity and loss of the canonical ES cell morphology. Furthermore, overexpression of the Mkrnl transgene in ES cells resulted in maintenance of high alkaline phosphatase activity after either of 3 or 5 days of LIF deprivation. These data provide evidence that Mkrnl expression is capable of maintaining mammalian stem cell pluripotency under differentiation- inducing conditions.

EXAMPLE 3

Upregulation of Mkrnl Expression Maintains Stem Cell Pluripotency

[00128] Previously, studies were conducted in ES cell lines engineered to overexpress Nanog to confirm a role for Nanog in maintaining embryonic stem cell pluripotency (Chambers et al., 2003). Similarly, the role of Mkrnl in stem cell self- renewal was investigated using Mkrnl overexpressing ES cell lines. Rl ES cells were engineered to constitutively overexpress transgenic Mkrnl via stable transfection of a Mkrnl expression construct (one of those provided in Figures 7-10). Briefly, cDNA encoding Mkrnl was reverse transcribed from RNA extracted from murine ES cells and cloned into the respective vectors. For vectors containing FLAG, N-His and C- His tags, Mkrnl was subcloned into the vector in frame with the tag sequence to enable fusion protein expression. Expression constructs were then transfected into ES cells using electroporation, and transfected clones subjected to G418 selection. Positive clones were isolated, stained for ALP activity and screened for expression of endogenous and transgenic Mkrnl expression. Expression of the N-FLAG tagged Mkrnl transgene was confirmed using western blot analysis (Figure 16A). Briefly, N-

FLAG::Mkrnl overexpressing ES cells and N-FLAG control ES cells were plated separately onto 10-cm dishes coated with 0.1% gelatin at a density of 2x10 ⁶ cells/dish. Cells were cultured in selection media (+ or -LIF where indicated) for 72h prior to lysis with Ix TNTE lysis buffer (15OmM NaCl, 5OmM Tris, IM EDTA, 0.5% TritonX-100, pH=7.4) including Ix protease inhibitor cocktail (Roche). Total protein concentration of each cell lysis mixture was determined using the Bradford Reagent (Sigma Aldrich). Thirty μg of total protein was loaded into each lane and subjected to electrophoresis on a 10% polyacrylamide gel (SDS-PAGE). Gels were transferred to membranes which were subsequently subjected to western blot analysis to detect N- FLAG Mkrnl protein, endogenous Mkrnl protein, endogenous Oct4 protein and GAPDH (loading control) using 5μg/mL murine anti-FLAG M2 monoclonal antibody (Sigma Aldrich), 0.5μg/mL rabbit anti-Mkrnl polyclonal antibody (Bethyl Laboratories, Inc.), 0.25μg/mL murine anti-Oct4 antibody (BD Transduction Laboratories) and 0.5μg/mL rabbit anti-GAPDH polyclonal antibody (Abeam Inc.), respectively. All antibody solutions were prepared in 5% skim milk TBST solutions. Western blot analysis was conducted with the ECL Plus Western Blotting Reagents (GE Healthcare).

[00129] Transgenic FLAG-tagged Mkrnl transcripts were shown to be expressed exclusively in Mkrnl overexpressing (transfected) ES cell clones (D4, D5, DlO, DI l, E3); expression was not detected in empty FLAG expression vector transfected controls (clones AlO, B4) (Figure 16).

[00130] ES cell clones determined to overexpress Mkrnl, as well as the respective control clones, were shown to stain positively for ALP activity (Figure 16D). ALP positivity was an indicator that the ES cell clones were in a pluripotent, undifferentiated state.

[00131] Ectopic N-FLAG: :Mkrnl expression in transfected ES cells cultured in the presence (+) or absence (-) of LIF was confirmed using immunocytochemistry and fluorescence microscopy analysis (Figure 17). N-FLAG-Mkrnl expression levels were shown to be highest in the D4, D5 and E3 clones. Lower expression levels were detected in the DlO and DI l clones.

[00132] ES cell pluripotency was found to be maintained in ES cell lines engineered to constitutively express Mkrnl, and cultured in the absence LEF for 1, 3 and 5 days (Figure 18). In the absence of LIF, which normally functions as an extrinsic self-renewal signal, for prolonged time periods, constitutive Mkrnl expression was capable of maintaining ES cell self-renewal capacity. Mkrnl overexpressing clones were shown to retain pluripotentiality, and remained in an undifferentiated state as evidenced by positive staining for ALP activity (Figure 18 A, middle and lower panels). Conversely, pCAGGS vector control clones treated in parallel underwent complete differentiation after 5 days of LIF deprivation (Figure 18A, upper panel). Mkrnl overexpressing transfectants were also shown to readily form ALP positive colonies in the presence (+) of LEF, and to retain ES cell colony morphology upon removal of LEF (Figure 18C, middle images). Under these conditions, 75% of the Mkrnl overexpressing ES cell colonies were demonstrated to be ALP positive compared to 50% of control colonies.

[00133] Quantification of the percent of undifferentiated ES cells was performed using the Cellomics ArrayScan using Oct4 protein levels as a surrogate marker of pluripotency (Figure 19). Mkrnl overexpressing transfectants and control cells were cultured for 72 hours in the presence (+) or absence (-) of LIF and normalized to baseline Oct4 protein levels. The varying intensities of Oct4 protein levels within the entire population of cells at each time point were represented in histograms (Figure 19A). There was shown to be little difference in the self-renewal capacity of control and Mkrnl overexpressing ES cells cultured in the presence of LEF. However, an effect similar to that observed in ALP stained cells was observed in ES cell clones cultured in the absence of LEF. Visualization of the histograms revealed that Oct4 protein levels fall below threshold for the majority of control cells while the enforced expression of Mkrnl in transfected cells resulted in retention of Oct4 protein expression in the majority of cells (Figure 19B). The qualitative and quantitative data together provide evidence that Mkrnl expression was required for the maintenance of ES cell pluripotency in culture and furthermore indicate that the enforced expression of Mkrnl protein impeded differentiation in the absence of critical self-renewal signals (i.e. LIF).

EXAMPLE 4

Co-immunoprecipitation of Mkrnl and Oct4

[00134] The data demonstrated correlation between the expression levels of

Oct4 and Mkrnl (both mRNA and protein) in ES cells. Co-immunoprecipitation analyses were performed to evaluate interaction between Mkrnl and Oct4. Lysates were extracted from ES cell clones transfected with either FLAG:Mkrnl expression construct or empty FLAG expression vector. Co-immunoprecipitation was determined following incubation of lysates with each of anti-FLAG antibody and anti- Oct4 antibody (Figure 20A). Immunoprecipites were subjected to polyacrylamide gel electrophoresis and western blot analysis using anti-FLAG antibody. The data showed that Mkrnl co-immunoprecipitated with Oct4 (Figure 20A). Similarly, Oct4 was shown to co-immunoprecipite with FLAG:Mkrnl (Figure 20B) indicating that the two proteins interacted.

EXAMPLE 5

Identification of Additional Mkrnl Binding Proteins: Co-immunoprecipitation and Liquid Chromatography-Tandem Mass Spectrometry Analysis

[00135] To identify additional Mkrnl binding proteins in undifferentiated ES cells, FLAG:Mkrnl immunoprecipitates were run through liquid chromatography- tandem mass spectrometry analysis (LC MS/MS). N-FLAG-Mkrnl overexpressing ES cell clones and N-FLAG control ES cell clones were each plated onto four 10-cm dishes coated with 0.1% gelati, and cultured in selection media for 48h. Prior to lysis, two plates of each clone were treated with either lOμM of MGl 32 proteasome inhibitor, or the equivalent volume of DMSO vehicle, and incubated at 37°C for 5h. The cells were washed twice with PBS then lysed in IX TNTE buffer (0.5% Triton- XlOO) for 20min. on a rocker (4 ⁰ C). The supernatant was subjected to anti-Flag-M2- bead immunoprecipitation at 4 ⁰ C for lhr. Subsequently, the beads were washed 4X with IX TNTE wash buffer (0.1% Triton-XIOO), 2X with Tris-CaCl ² solution (pH=8) and digested with 500pg of porcine trypsin for 6hrs. The protonated peptides were separated by reverse phase liquid chromatography (LC) using 0.1% formic acid Buffer A. Tandem mass spectrometry (MS/MS) was carried out on a Finnigan LTQ mass spectrometer, programmed for data-dependent MS/MS acquisition (one survey

scan, three MS/MS of the most abundant ions). The RAW files generated by

XCalibur (Finnigan) were converted into DTA files and searched using Mascot against the NCBI Mouse protein database (2007 version). Data analysis was performed using in-house software designed for peptide and protein score comparison and ranking.

[00136] Table 1 lists the unique Mkrnl interacting proteins/ targets identified by the mass spectrometry analysis. The majority ofMkrnl -interacting proteins isolated in the analysis were found to be RNA-binding proteins involved in stabilization/degradation of target mRNA species, suggesting a role for Mkrnl in regulating stem cell self-renewal via a post-transcriptional complex (PTC).

Table 1. Mkrnl interacting proteins identified by mass spectrometry analysis

Sequenc

NCBl Gene Protein No. of Protein

Protein Name e

Protein ID Symbol Characteristics Peptides Score Coverage

116256512 Hnφd pre-mRNA

AU-RICH ELEMENT RNA-BINDING PROTEIN 23% (Auf) binding 5 300

13435603 Hnmpr HETEROGENEOUS NUCLEAR pre-mRNA

D/o

RIBONUCLEOPROTEIN R binding

21704096 Tardbp DNA/RNA

TAR DNA-BINDING PROTEIN binding 18% 5 300

26330019 Elavil pre-mRNA

HU-ANTIGEN R (HuR) binding 40% 8 539

12838033 Paip2 POLYADENYLATE-BINDING PROTEIN- pre-mRNA

INTERACTING PROTEIN 2 binding

6576815 Syncrip SYNAPTOTAGMIM BINDING, CYTOPLASMIC RNA pre-mRNA c

INTERACTING PROTEIN binding

11933384 Igf2bp3 IGF2 mRNA-BINDING PROTEIN 3 RNA processing 22% 7 411

42558248 Caprini

CAPRIN 1 GPI membrane 21% 8 484 anchored protein

20806532 Csda COLD-SHOCK DOMAIN PROTEIN A Transcriptional ronressor 53% 6 787

13507601 Upf1 Regulator of

UP-FRAMESHIFT MUTATION 1 nonsense 25% 18 1195 transcripts

94390107 Larpi LA RIBONUCLEOPROTEIN DOMAIN FAMILY RNA binding MEMBER 1 24% 16 866

6678920 Mov10 Argonaute-

MOLONEY LEUKEMIA VIRUS 10 associated 27% 18 945 protein

13096978 Pabpc4 POLYADENYLATE-BINDING PROTEIN, pre-mRNA 1

CYTOPLASMIC, 4 binding n1

28972720 Nufip2 NUCLEAR FRAGILE X MENTAL RETARDATION RNA processing OfW

INTERACTING PROTEIN 2

94372071 L1td1 LINE-1 TYPE TRANSPOSASE DOMAIN ESC associated fi OmTU

CONTAINING 1 protein

9506945 Pabpni POLYADENYLATE-BINDING PROTEIN, NUCLEAR, pre-mRNA

Q4

1 binding

7305075 G3bp1 RAS-GTPase-ACTIVATING PROTEIN SH3- binds to p53 in

Io DOl

DOMAIN BINDING PROTEIN 1 vitro and in vivo

1698657 G3bp2 RAS-GTPase-ACTIVATING PROTEIN SH3- binds to p53 in

IU

DOMAIN BINDING PROTEIN 2 vitro and in vivo

13386026 2700060 E02Rik 13% 2 125

33585617 AU01464

14% 7 370 5

[00137] A subset of Mkrnl target proteins were identified only in lysates incubated with MGl 32 (Table 2). Detection of these interacting proteins only in the presence of a proteasome inhibitor suggests the proteins of this subset are Mkrnl E3 ubiquitin ligase targets that are directly ubiquitinated by Mkrnl and subsequently degraded. Such proteins are likely negative regulators of ES cell self-renewal.

Table 2. Mkrnl interacting proteins identified by mass spectrometry analysis in lysates incubated with MGl 32 proteasome inhibitor.

NCBl Gene Protein Sequence No. of Protein rrotein Name

Protein ID Symbol Characteristics Coverage Peptides Score

SPLICING FACTOR, PROLINE-AND GLUTAMINE-

10442545 Sfpq RNA processing 13% 3 92 RICH

RNA-BINDING PROTEIN GENE WITH MULTIPLE

13124485 Rbpms RNA processing 7% 1 62 SPLICING

40018610 Ascc3l1 U5 snRNP-SPECIFIC PROTEIN RNA processing 1% 1 84

3834675 Hf3 INTERLEUKIN ENHANCER-BINDING FATOR 3 dsRNA binding 3% 2 123

CLEAVAGE AND POLYADENYLATION pre-mRNA

16751835 Cpsfi 5% 4 229 SPECIFICITY FACTOR 1 binding

HETEROGENEOUS NUCLEAR pre-mRNA

21313308 Hnrpm 11% 6 303 RIBONUCLEOPROTEIN M4 binding

[00138] All references cited are incorporated by reference herein. Although preferred embodiments of the invention have been described herein, it will be understood by those skilled in the art that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims.