Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
ECTOPIC CELLULAR GROWTH FACTOR EXPRESSION FOR LOW-COST PRODUCTION OF CELL-CULTURED FOODS
Document Type and Number:
WIPO Patent Application WO/2024/097749
Kind Code:
A2
Abstract:
The present disclosure relates to cultured tissue, methods for production of self-sufficient modified cells for producing cultured tissue. Further, the disclosure provides methods of generating cultured meat products without exogenous addition of growth hormones.

Inventors:
KAPLAN DAVID (US)
STOUT ANDREW (US)
Application Number:
PCT/US2023/078341
Publication Date:
May 10, 2024
Filing Date:
November 01, 2023
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
TUFTS COLLEGE (US)
International Classes:
C12N15/85; A23L13/00
Attorney, Agent or Firm:
MCWHINNEY, Christopher, T. (US)
Download PDF:
Claims:
Atty. Dkt. No.166118.01354.T002660 CLAIMS What is claimed: 1. A modified non-human cell ectopically expressing one or more proteins that promote cell growth, wherein the one or more expressed proteins comprise growth factors, cytokines, receptors, or signaling proteins selected from Table 1. 2. The modified non-human cell of claim 1, wherein the one or more proteins comprise a constitutively active Ras or fibroblast growth factor 2 (FGF-2). 3. The modified non-human cell of claim 1, wherein the one or more proteins comprise RasG12V or fibroblast growth factor 2 (FGF-2). 4. The modified cell of claim 1, wherein the growth of these cells do not require exogenous supplementation with growth factors. 5. The modified non-human cell of claim 1, wherein the cell is capable of growing in media that contains no exogenous recombinant protein components. 6. The modified non-human cell of claim 1, wherein the one or more ectopically expressed proteins comprise one or more proteins selected from fibroblast growth factor-1 (FGF1), fibroblast growth factor-2 (FGF-2), a constitutively active ras protein, transforming growth factor (TGF), neuregulin (NRG), insulin, insulin-like growth factor (IGF), FGF-receptor (FGF- R), insulin, albumin, and combinations thereof. 7. The modified non-human cell of claim 1, wherein the ectopically expressed proteins comprise (a) FGF-2; Page 80  Atty. Dkt. No.166118.01354.T002660 (b) transferrin; (c) insulin, insulin-like growth factor (IGF) or combination thereof; (d) recombinant albumin; (e) a constitutively active Ras protein; or (f) combinations of (a)-(e). 8. The modified non-human cell of claim 1, wherein the one or more ectopically expressed proteins comprise FGF-2 and a constitutively active Ras protein. 9. The modified non-human cell of claim 1, wherein the one or more ectopically expressed proteins are expressed by one or more exogenous vectors in the cell. 10. The modified non-human cell of claim 1, wherein the exogenous vector is one vector that can express two or more ectopically expressed proteins. 11. The modified non-human cell of claim 10, wherein the vector comprises multi-cistronic expression to express the two or more ectopically expressed proteins. 12. The modified non-human cell of claim 11, wherein the one or more vector constitutively expresses the two or more ectopically expressed proteins. 13. The modified non-human cell of claim 11, wherein the one or more vector is and inducible vector capable of inducing the cell to express the one or more ectopically expressed proteins when contacted with an induction factor. Page 81  Atty. Dkt. No.166118.01354.T002660 14. The modified non-human cell of claim 1, wherein the two or more ectopically expressed proteins are expressed by engineering via crispr/cas9 editing. 15. The modified non-human cell of any one of the preceding claims, wherein the cells comprise a muscle cell, a fat cell, or a connective tissue cell. 16. The modified non-human cell of any one of clams 1-14, wherein the cell comprises a bovine cell, a piscine cell, a porcine cell, or a galline cell. 17. A composition comprising the modified non-human cells of any one of claims 1-14. 18. A meat product comprising a population of the cells of claim 17. 19. The meat product of claim 18, wherein the meat produce comprises a combination of two or more selected from muscle cells, stem cells, fat cells and connective tissue cells. 20. The meat product of claim 19, wherein the meat product is a three-dimensional meat product. 21. A method of producing a meat product in in vitro culture, the method comprising: culturing a population of the modified non-human cells of any one of claims 1-14 in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors. Page 82  Atty. Dkt. No.166118.01354.T002660 22. The method of claim 21, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates or recombinant albumin. 23. The method of claim 21, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally hydrolyzed or unhydrolized plant protein isolates. 24. The method of claim 21, wherein the minimal media contains no exogenous recombinant protein components. 25. The method of claim 21, wherein the method comprises: culturing a combination of two or more modified cells selected from muscle cell, stem cells, fat cell, and connective tissue cell in a culture to produce a three-dimensional meat product suitable for human or animal consumption. 26. A method of producing a population of modified cells for making a food product, the method comprising: (a) ectopically expressing two or more proteins of Table 1 in cells; (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. 27. The method of claim 26, wherein the number of modified cells produced in step (b) is increase at least 20% or more, preferably 30% or more relative to culturing of non-modified non- human cells in the minimal medium. Page 83  Atty. Dkt. No.166118.01354.T002660 28. The method of claim 26, wherein step (a) comprises expressing three or more ectopically expressed proteins. 29. The method of claim 26, wherein step (a) comprises expressing four or more ectopically expressed proteins. 30. The method of claim 26, wherein the two or more factors comprise two or more factors selected from fibroblast growth factor-1 (FGF1), fibroblast growth factor-2 (FGF-2), a constitutively active ras protein, transforming growth factor (TGF), neuregulin (NRG), insulin, insulin-like growth factor (IGF), FGF-receptor (FGF-R), hepatocyte growth factor (HGF), platelet-derived growth factor (PDGF), insulin, albumin, and combinations thereof. 31. The method of claim 26, wherein the two or more factors comprise (a)FGF-2; (b) transferrin; (c) insulin, insulin-like growth factor (IGF) or combination thereof; (d) recombinant albumin; (e) a constitutively active Ras protein; or (f) combinations of (a)-(e). 32. The method of claim 26, wherein the ectopically expressed protein comprise FGF-2 and a constitutively active Ras protein. 33. The method of claim 26, wherein step (a) further comprises introducing one or more exogenous vectors in the cell capable of expressing the two or more ectopically expressed proteins. Page 84  Atty. Dkt. No.166118.01354.T002660 34. The method of claim 33, wherein the one or more exogenous vectors is a single vector capable of expressing the two or more ectopically expressed proteins. 35. The method of claim 33, wherein the vector comprises ribosomal skipping sites to express the two or more ectopically expressed proteins. 36. The method of claim 33, wherein the one or more vector constitutively expresses the two or more factors. 37. The method of claim 33, wherein the one or more vector is and inducible vector; and the method further comprises contacting the cell with an inducible factor, wherein contact with the inducible factor induces expression of the one or more ectopically expressed proteins within the cell. 38. The method of claim 26, wherein step (a) comprises engineering the cell via crispr/cas9 editing to either express an endogenous factor or increase the expression of the factor within the cell. 39. The method of any one of claims 26-38, wherein the cells is a muscle cell, a fat cell, a stem cell, or a connective tissue cell. 40. The method of any one of claims 26-38, wherein the cells is a bovine cell, a piscine cell, a porcine cell, an insect cell or a galline cell. 41. The method of any one of claims 26-38, wherein the cells are a combination of two or more cells selected from muscle cell, a fat cell, a stem cell, or a connective tissue cell. Page 85  Atty. Dkt. No.166118.01354.T002660 42. The method of any one of claims 26-38, wherein the method is large scale production of cells in bioreactors. 43. A population of cells made by the method of any one of claims 26-38. 44. A food product comprising the population of cells of claim 43. 45. The food product of claim 44, wherein the food product is a three-dimensional tissue suitable for human or non-human animal consumption. 46. A method of producing a meat product in in vitro culture, the method comprising: co-culturing a population of target cells and a feeder cell population comprising the modified non-human cells of any one of claims 1-14 in minimal culture medium for a sufficient time to increase the number of target cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors and wherein the target cell is not genetically modified. 47. The method of claim 46, wherein the target cells and the feeder cells are separated by a permeable or semi-permeable membrane, wherein the feeder cells secrete factors capable of crossing the membrane. 48. The method of claim 46, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally hydrolyzed or unhydrolized plant protein isolates or recombinant albumin. 49. The method of claim 46, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally Page 86  Atty. Dkt. No.166118.01354.T002660 hydrolyzed or unhydrolized plant protein isolates, preferably wherein the minimal media contains no exogenous recombinant protein components. 50. The method of claim 46, wherein the method comprises: culturing a combination of two or more target cells selected from muscle cell, stem cells, fat cell, and connective tissue cell in a culture with the feeder cells to produce a meat product suitable for human or animal consumption. 51. The method of claim 46, wherein the target cells is a muscle cell, a fat cell, a stem cell, a connective tissue cell, or combinations thereof. 52. The method of claim 46, wherein the target cells is a bovine cell, a piscine cell, a porcine cell, an insect cell or a galline cell. 53. The method of claim 46, wherein the target cell and feeder cells are of the same species. 54. A food product comprising a population of the target cells produced by the method of any one of claims 46-53. 55. The food product of claim 54, wherein the food product is substantially free of feeder cells. Page 87 
Description:
Atty. Dkt. No.166118.01354.T002660 ECTOPIC CELLULAR GROWTH FACTOR EXPRESSION FOR LOW-COST PRODUCTION OF CELL-CULTURED FOODS STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under grant 2021-69012-35978 awarded by the U.S. Department of Agriculture. The government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS This application is related to, claims priority to, and incorporates herein by reference for all purposes U.S. Provisional Patent Application 63/381,927, filed November 1, 2022. The contents of this application are incorporated herein by reference in their entirety. SEQUENCE LISTING A Sequence Listing accompanies this application and is submitted as an XML file of the sequence listing named “166118.01354.xml” which is 135,773 bytes in size and was created on October 23, 2023. The sequence listing is electronically submitted via Patent Center with the application and is incorporated herein by reference in its entirety. BACKGROUND Cultured meat, or meat produced through cell culture and tissue engineering, offers the potential to drastically alter our world’s meat production system by addressing the environmental, ethical, and health concerns associated with modern animal agriculture. The high costs of current cell culture media are prohibitive to this effort as it requires many exogenous recombinant proteins and growth factors for propagation and expansion. Therefore, bringing down the costs of this media is a key hurdle facing cultured meat’s development and reaching price parity with conventional meats. The proposed approach offers a promising option, as it completely eliminates the need for the most expensive components of cell culture media, thereby drastically lowering costs. Page 1  Atty. Dkt. No.166118.01354.T002660 SUMMARY The present invention provides modified cells that can grow in minimal media for use in cultured meat, methods of making and uses thereof. Further, the invention provides a cultured meat product comprising in vitro grown cells in minimal media. Methods of culturing cells in minimal media to make a cultured meat product are also provided. In one aspect, the disclosure provides a modified non-human cell ectopically expressing one or more proteins that promote cell growth, wherein the one or more expressed proteins comprise growth factors, cytokines, receptors, or signaling proteins selected from Table 1. In some aspects, the growth of these cells do not require exogenous supplementation with growth factors. In another embodiment, a composition comprising the modified non-human cells described herein are provided. In a further embodiment, a meat product comprising a population of the cells described herein is provided. In a further aspect, a method of producing a meat product in in vitro culture is provided. The method comprises culturing a population of the modified non-human cells described herein in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors. In a further aspect, the disclosure provides a method of producing a population of modified cells for making a food product, the method comprising: (a) ectopically expressing two or more proteins of Table 1 in cells; (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. In another aspect, the disclosure provides a method of producing a meat product in in vitro culture, the method comprising: co-culturing a population of target cells and a feeder cell population comprising the modified non-human cells described herein in minimal culture medium for a sufficient time to increase the number of target cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors and wherein the target cell is not Page 2  Atty. Dkt. No.166118.01354.T002660 genetically modified. In another aspect, a food product comprising a population of the target cells produced by the method described herein is provided. In a further aspect, compositions and food products comprising cells made by the methods described herein are provided. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1. Growth factor expression cassette for the constitutive endogenous production of bovine FGF-2, bovine TGFb3, NRG1, and GFP all connected by ribosomal skipping sequences. Additionally, constitutive expression of a puromycin resistance gene enables selection of engineered cells. FIG. 2. Brightfield and green-fluorescence images of bovine satellite cells engineered with the construct in Figure 1 (as well as a Tet-inducible construct) two days after transfection and following ten days of selection in puromycin-containing media. Images show stable expression of GFP and growth factors in engineered cells. FIG. 3A-FIG. 3B. Efficacy of ectopic growth factor expression in serum-free and growth- factor free media. (FIG.3A) composition of B8 serum free media and B5 serum free media without any FGF-2, NRG-1, or TGFb3. (FIG. 3B) Growth over four days of bovine satellite cells engineered with the construct from Figure 1 with a constitutive promoter (CMV), or with an inducible promoter (Tet). Cells expressing growth factor genes (Tet + Dox & CMV) showed improved growth compared with cells not expressing growth factor genes (Tet-Dox). This is particularly true for constitutive expression of growth factor genes. FIG. 4. Efficacy of ectopic growth factor expression in optimized serum-free media containing added recombinant albumin, but lacking growth factors. Results show that cells engineered to express growth factors (“pCMV-3GF-GP”) grow over ten days in culture without growth-factors added, and that this growth is substantially and significantly (p<0.01) more than that of cells not engineered to express growth factors (“pCMV-GP”). FIG. 5. Expression cassette for the constitutive endogenous production of bovine FGF-2, bovine FGF receptor 1 (FGFR1) and GFP all connected by ribosomal skipping sequences. Additionally, constitutive expression of a puromycin resistance gene enables selection of engineered cells. FIG. 6A. Expression cassette for the constitutive endogenous production of bovine FGF-2, bovine FGF receptor 1 (FGFR1), long-range IGF-1, bovine transferrin and GFP all connected by Page 3  Atty. Dkt. No.166118.01354.T002660 ribosomal skipping sequences. This construct could potentially eliminate the need for FGF, Insulin, and Transferrin in B8 or Beefy-9 media, which, in concert with the potential elimination of NRG and TGF, could result in a highly simplified, highly cost-effective medium for cell expansion. FIG.6B. Bovine satellite cells engineered to express this cassette and cultured over 13 days show good gene expression, as indicated by GFP fluorescence. FIG.7. Growth of bovine satellite cells over 3 & 4 days in B8 media (indicated by blue arrows) or media containing higher or lower concentrations of NRG1 and TGFb3. Results suggest that it might be possible to remove these growth factors from B8 media (or potentially Beefy-9) without negatively affecting cell growth. This would further imply that ectopic expression of these growth factors may not be necessary to ameliorate growth-factor requirements in serum-free media. FIG. 8A-FIG. 8B. Overview of approach and proposed mechanism. (FIG. 8A) Genetic constructs inserted into immortalized bovine satellite cells (iBSCs). Constructs contained either luciferase (as a negative control), FGF-2 alone, Ras G12V alone, or a combination of FGF-2 and Ras G12V , all under a Tet-on promoter system. Constitutive expression of a neomycin resistance was used for selection. (FIG.8B) Suggested mechanism of action of overexpressed FGF-2 and Ras G12V , where induction by treatment with doxycycline induces gene expression. In the case of FGF-2, growth factors are secreted through an unconventional secretory mechanism comprised of oligomerization in the plasma membrane and subsequent extracellular transport 12,13 . These overexpressed growth factors (as well as any potential native FGFs) complex with FGF receptor 1 (FGFR-1), which induces activation of both the PI3K/Akt pathway, as well as activation (via phosphorylation) of the Ras/Raf/MEK/ERK pathway. These two pathways subsequently promote proliferation and inhibit myoblast fusion and differentiation. In the case of Ras G12V , two mechanisms offer possible impact on FGF-2 signaling. The first is that the mutant Ras protein itself is constitutively active, thereby initiating Raf/MEK/ERK activation in the absence of its own activating FGF-2. The second is that mutant Ras has been suggested to activate endogenously expressed FGF-2, potentially by promoting release from heparan sulfate proteoglycans (HSPGs), or else otherwise altering FGF-HSPG interactions 11,14 . FIG. 9A-FIG. 9B. Growth of engineered cells in media without exogenous recombinant FGF (rFGF).(FIG.9A) Cell growth results showed that control cells (expressing luciferase) grew very little over six days in the absence of exogenous rFGF (and then died off), but grew Page 4  Atty. Dkt. No.166118.01354.T002660 consistently in the presence of exogenous rFGF. Cells expressing FGF-2 alone or Ras G12V alone grew significantly more than controls without rFGF, but significantly less than controls with rFGF. Cells co-expressing both genes showed consistent proliferation equivalent to control cells with exogenous rFGF. n=3 distinct samples; statistical significance was calculated via one-way ANOVA of day 14 data with multiple comparisons between all conditions. p<0.05 for all comparisons except where indicated (n.s.). (FIG.9B) Growth curve conversion to doubling times further demonstrates the conclusions from FIG. 9A. Specifically, control cells in the absence of rFGF grew exceedingly slowly (>200 hours per doubling during the first passage), while control cells in the presence of rFGF grew at a rate of 58.7 hours per doubling averaged over three passages. Cells engineered with FGF-2 alone, Ras G12V alone, or both genes showed doubling times of 71.7, 73.7, and 60.6 hours, respectively. Cells expressing both genes in Beefy-R medium without rFGF showed a doubling time of 32.9 for one passage. n=9 distinct samples (3 samples per passage for three passages) for Ctrl + rFGF, FGF2, Ras G12V , and FGF2/Ras G12V , and n=3 distinct samples (3 samples per passage for one passage) for Ctrl – rFGF and FGF2/Ras G12V (BeefyR); statistical significance was calculated via one-way ANOVA with multiple comparisons between all conditions and is indicated for p <0.05 (*), p <0.01 (**), p <0.001 (***), and p <0.0001 (****). FIG.10. Media cost comparisons for BSC-GM containing 20% FBS, Beefy-9 serum-free medium containing both recombinant albumin (dark pink) and recombinant FGF-2 (yellow), Beefy-R medium containing recombinant FGF-2 but albumin replaced by rapeseed protein isolates, and Beefy-R medium without recombinant FGF-2, as is possible when culturing BFRon1 cells. Prices are based on bulk purchase prices from available suppliers. FIG. 11. 14-day growth of all engineered cells +/- 40 ng/mL of exogenous recombinant FGF (rFGF). Results showed that growth is maintained for all cells except for luciferase control cells in the absence of exogenous rFGF (Luc – rFGF). FIG. 12. 4-day primary bovine satellite cell (BSC) growth in Beefy-9 media containing various concentrations of recombinant insulin. Results show a significant reduction in growth for cells treated with zero insulin, but that down to a concentration of 3 ug/mL, no significant reduction in cell growth was observed compared with the usual Beefy-9 concentration of 20 ug/mL. FIG.13 Shows (A) growth of primary bovine satellite cells (BSCs) vs. immortalized bovine satellite cells engineered with telomerase reverse transcriptase (TERT) and Cyclin-dependent Page 5  Atty. Dkt. No.166118.01354.T002660 kinase 4 (CDK4) in serum-containing media. (B) Doublings per day of primary vs. immortalized BSCs in serum-containing medium over 36 passages. (C) Average doubling times of immortalized BSCs in serum-containing medium over 36 passages. FIG.14 shows (a) primary bovine satellite cells in serum-containing medium (BSC-GM), serum-free medium with recombinant albumin (Beefy-9) and serum-free medium in which recombinant albumin has been replaced by rapeseed protein isolate (Beefy-R). (b) Doubling times of cells from “b.” DETAILED DESCRIPTION Before the present invention is described in further detail, it is to be understood that the invention is not limited to the particular embodiments described. It is also understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. The scope of the present invention will be limited only by the claims. As used herein, the singular forms "a", "an", and "the" include plural embodiments unless the context clearly dictates otherwise. It should be apparent to those skilled in the art that many additional modifications beside those already described are possible without departing from the inventive concepts. In interpreting this disclosure, all terms should be interpreted in the broadest possible manner consistent with the context. Variations of the term "comprising" should be interpreted as referring to elements, components, or steps in a non-exclusive manner, so the referenced elements, components, or steps may be combined with other elements, components, or steps that are not expressly referenced. Embodiments referenced as "comprising" certain elements are also contemplated as "consisting essentially of" and "consisting of" those elements. When two or more ranges for a particular value are recited, this disclosure contemplates all combinations of the upper and lower bounds of those ranges that are not explicitly recited. For example, recitation of a value of between 1 and 10 or between 2 and 9 also contemplates a value of between 1 and 9 or between 2 and 10. Cultured meat (also called in vitro, cell-based, cultivated, lab grown meat) prepared using tissue and bioengineering techniques in vitro is another alternative to traditional animal agriculture. By directly growing meat (muscle and fat tissue) in vitro, energy and nutrients may be more efficiently focused on the outcome. The time frame to generate cultured meat tissues in vitro is also thought to be faster compared to traditional animal agriculture, and may only require weeks Page 6  Atty. Dkt. No.166118.01354.T002660 as opposed to months or years for pork and beef, for example. Moreover, tight control over cell biology during tissue cultivation, as well as the production process, allows for the fine tuning of nutritional parameters by engineering muscle or fat cells to produce vital nutrients that would otherwise not be found (or found only at low concentrations) in conventional meat. Thus, cultured meat production systems may offer healthier, more efficient, and more environmentally friendly alternatives to animal-derived meats. The technology disclosed herein exploits genetic strategies to generate “self-sufficient” cell lines that endogenously produce all of the requisite signaling molecules for growth in low cost, chemically defined cell culture media. The "self-sufficient" cell lines described herein are genetically modified or engineered to endogenously produce required molecules for growth in minimal tissue culture media. Specifically, ectopic expression of growth factors (e.g., fibroblast growth factor (FGF), transforming growth factor (TGFb), neuregulin (NRG), Insulin-like growth factor (IGF), etc.), growth factor receptors (FGF receptors, TGF receptors, NRG receptors, IGF receptors, etc.) and/or signaling/nutrient transport proteins (e.g., insulin, albumin, transferrin, etc.) ameliorate the need for the exogenous inclusion of these proteins in cell culture media. As growth factors and signaling proteins contribute over 95% of the cost of standard cell culture media, this invention could drastically lower the cost of production of cultured meats producing products that could compete pricewise with animal agriculture. In the instant disclosure, stem cell lines from food-relevant tissues (e.g., muscle, fat, liver, connective tissue) of relevant animal species (e.g., bovine (immortalized bovine satellite cells (iBSCs)), porcine, piscine, galline) are engineered (modified) to express the aforementioned genes (and potentially others) constitutively or under controllable promoter systems allowing the necessary protein growth and propagation factors to be endogenously expressed by the cell. This allows for minimal media to be used for tissue culture, preferably wherein the minimal media does not comprise exogenous growth factors. Options for genetic engineering include insertion of cassettes, i.e., polynucleotide encoding the signaling/growth molecules (e.g., through CRISPR/Cas9, transposon-mediated, or recombinase-mediated genetic insertion), or by genetic activation of the native genes in cells. Endogenous growth factors and signaling molecules have been produced in CHO cells and 3T3 fibroblasts to abrogate the need for these components in cell culture media (Pak et al. “Super-CHO-A cell line capable of autocrine growth under fully defined protein-free conditions”. Page 7  Atty. Dkt. No.166118.01354.T002660 Cytotechnology 1996 Jan ; 22(1-3):139-46, DOI: 10.1007/BF00353933; Z Pietrzkowski, Z. et al. “Constitutive expression of insulin-like growth factor 1 and insulin-like growth factor 1 receptor abrogates all requirements for exogenous growth factors”. Cell Growth Differ.1992 Apr;3(4):199- 205. PMID_1325181; U.S. Patent No. US6797515B2, each of which are incorporated herein by reference). Specifically, these cells were engineered to express insulin or IGF, IGFR, and transferrin. While this has been demonstrated for these proteins and in CHO and 3T3 cells for pharmaceutical applications, the use in food production is novel. Methods of generating “self-sufficient” cells for low-cost production of cell-cultured foods In one aspect of the current disclosure, modified non-human cells ectopically expressing two or more proteins (e.g., growth factors, signaling proteins, cytokines, or receptors) that promote cell growth are provided. In some embodiments, the two or more proteins are selected from the proteins listed in Table 1, which include growth factors. As used herein, “factors” refer to the growth factors, cytokines, or other proteins used to generate self-sufficient cells. As used herein, "self-sufficient" refers to cells that require minimal exogenous supplementation with growth factor, or more preferably, no exogenous supplementation with growth factors. In some embodiments, factors refers to the proteins listed in Table 1. In certain contexts, factors refer to the nucleotide sequence encoding the proteins listed in Table 1. As used herein, “ectopic” expression refers to expression of mRNA or proteins under the control of a non-native heterologous promoter and/or enhancer. The term "ectopic" further encompasses exogenous polynucleotides that are introduced into the cell and capable of expressing the factors described herein. Thus, in some embodiments, ectopic expression is achieved through exogenous polynucleotide sequences integrated into the genome of the cells of the instant disclosure, e.g., through transposons, viral transduction, or recombination. In some embodiments, exogenous expression is achieved through polynucleotide sequences that are not integrated into the genome of the cells of the instant disclosure, but are expressed episomally. Episomes, in eukaryotes, are extrachromosomal, closed circular DNA molecules of a plasmid or a viral genome origin, that are replicated autonomously in the host cell and therefore, they bear significant vector potential for the transfer of nucleic acids into cells. Such is the case of the Replicating Episomal Vectors, that have been engineered and used for the study of gene expression and in gene therapy applications. In some embodiments, ectopic expression is achieved through activating the Page 8  Atty. Dkt. No.166118.01354.T002660 expression of the endogenously encoded proteins by activation through exogenously introduced elements, e.g., Tal effector-like nucleases (TALENS), zing finger nucleases (ZFN), Cas9 molecules, etc. In some embodiments, the transposons are, for example, Piggy bac or Sleeping Beauty transposons. In further embodiments, in vitro transcribed (IVT) mRNA encoding the factors is delivered to the cells. In some embodiments, factors that are receptor ligands, e.g., growth factors, cytokines, etc. are expressed by the cells of the instant disclosure. In such embodiments, the receptor ligands may signal in an autocrine, or paracrine manner in vitro. However, in some embodiments, cytokine or growth factor receptors are also exogenously expressed in the cell. In such embodiments, the receptors may be wild type, that is, not comprising any mutations that alter their function as compared to the standard receptor known in the art. In other embodiments, receptors comprise mutations that alter their function are contemplated. In one such example, mutations may render the receptors as “constitutively active,” meaning that the receptors signal in the absence of their ligand. Several such constitutively active receptors are known in the art, for example, mutant FGF receptor. See, for example, Brewer et al. “Genetic insights into the mechanisms of Fgf signaling,” Genes Dev.2016 Apr 1; 30(7): 751–771, which is incorporated by reference herein. Furthermore, Overexpression or mutation of Epidermal growth factor receptor (EGFR) can also lead to constitutive expression. See, for example, Chakraborty et al. “Constitutive and ligand-induced EGFR signaling triggers distinct and mutually exclusive downstream signaling networks,” Nature Communications volume 5, Article number: 5811 (2014); and Holland et al. “A constitutively active epidermal growth factor receptor cooperates with disruption of G1 cell-cycle arrest pathways to induce glioma-like lesions in mice”, Genes & Dev.1998.12: 3675-3685, which are incorporated by reference herein in their entireties including, but not limited to the sequences and mutations necessary for constitutive activation. In some embodiments, EGFR mutations involve deletion of most of the extracytoplasmic domain of the receptor, resulting in a hybrid mRNA between new sequences and the truncated EGFR sequence. See, for example, Wong A.J. et al. “Structural alterations of the epidermal growth factor receptor gene in human gliomas,” PNAS April 1, 199289 (7) 2965-2969, which is incorporated by reference herein in its entirety. In some embodiments, constitutively active PDGF is contemplated. Various mutations in PDGF result in constitutively active signaling, e.g., mutations that effect two regions within the receptor, the autoinhibitory juxtamembrane region (exon 12 mutations) and the kinase domain itself (exon 14 Page 9  Atty. Dkt. No.166118.01354.T002660 and exon 18 mutations). Whereas exon 14 mutations affect the upper lobe of the kinase domain, exon 18 mutations are located within the activation loop. See, for example, Bahlawane et al. “Constitutive activation of oncogenic PDGFRα-mutant proteins occurring in GIST patients induces receptor mislocalisation and alters PDGFRα signaling characteristics,” Cell Commun Signal.2015; 13: 21; and Heinrich, M. C. et al. “PDGFRA activating mutations in gastrointestinal stromal tumors”, Science. 2003 Jan 31;299(5607):708-10, which are incorporated by reference herein regarding the constitutive activation and sequences required for such activation. In some embodiments, constitutive insulin receptor is contemplated for use as a factor. See, for example, Yamada et al. “Substitution of the insulin receptor transmembrane domain with the c-neu/erbB2 transmembrane domain constitutively activates the insulin receptor kinase in vitro”, Journal Biol Chem, Volume 267, Issue 18, 25 June 1992, Pages 12452-12461. In some embodiments, constitutively active FGFR as a factor is contemplated. See, for example, Rutland P et al. “Identical mutations in the FGFR2 gene cause both Pfeiffer and Crouzon syndrome phenotypes”, Nature Genetics volume 9, pages173–176 (1995), which is incorporated by reference herein. Transition of T to C at nucleotide 1036 has been reported in human subjects. The resulting Cys342Arg mutation has previously been observed in a single case of Crouzon syndrome. Other mutation are a G to A transition at nucleotide 1037-Tyr for Cys, which has previously been reported in three cases of Crouzon syndrome. Other suitable mutations of FGFR2 are an A to C transversion at nucleotide 1033, changing Thr to Pro at position 341, adjacent to the Cys 342 residue. Furthermore, a mutation that replaces the cysteine at position 342 with tyrosine, thus disrupting the formation of the third immunoglobulin (Ig)-like loop in the extracellular portion of the receptor and results in constitutive activation is contemplated as a factor for use in the methods of the current disclosure. See, for example, Mangasarian et al. “Mutation associated with Crouzon syndrome causes ligand-independent dimerization and activation of FGF receptor-2”, Journal of Cell. Phys. Vol.172, Issue 1, July 1997, pp.117-125, which is incorporated by reference herein. In some embodiments, proteins involved in promoting cell growth and division through signaling, (e.g., signaling proteins or signal transduction proteins) are expressed by the cells of the instant disclosure. In such embodiments, the protein may signal in an intracellular, autocrine, or paracrine manner. In some embodiments, the protein is exogenously expressed in the cell. In such embodiments, the protein may be wild type, that is, not comprising any mutations that alter their function as compared to the standard receptor known in the art. In other embodiments, proteins Page 10  Atty. Dkt. No.166118.01354.T002660 (e.g., signal transduction proteins) comprise mutations that alter their function are contemplated. In one such example, mutations may render the receptors as “constitutively active,” meaning that the protein signals in the absence of an upstream signal. Several such constitutively active proteins are known in the art, for example, mutant ras, such as the constitutively active ras mutation, Ras G12V . Additional constitutively active Ras mutants include, but are not limited to, Ras G12S , Ras G12A , Ras G13D , Ras Q61R , Ras G12D , Ras G12R , Ras G12C , Ras Q61K , Ras G22V , and Ras Q71L . A nucleic acid sequence encoding Ras G12V is found in SEQ ID NO: 101. There are several genes known to encode ras (e.g., HRAS, KRAS, NRAS) in eukaryotic systems, with several mutations for these proteins known to result in constitutive activation. Other growth promoting proteins include signaling proteins within cell division signaling transduction pathways that include but are not limited to tyrosine kinase pathways (which includes ras protein), cyclin-dependent kinase pathways, mitogen activated kinase pathways, and p21- relarted pathways. As used herein, the term “signaling” in reference to a “signal transduction protein” refers to proteins that are activated or otherwise affected by ligand binding to a membrane receptor protein or some other stimulus. As mentioned above, signal transduction proteins can be mutated to a constitutively active form that does not require upstream signaling or activation. In some embodiments of the current disclosure, the population of cells is grown for the purpose of producing comestible or edible products, i.e., lab-grown meat. Therefore, the culture conditions for producing such products must be carefully controlled to ensure the safety and wholesomeness of the resulting product. Further, the culture conditions may be amenable to industrial size production and GMP. For example, all culture materials, vessels, growth factors, media, etc. must be carefully selected and controlled to prevent the growth of pathogenic organisms or introduce toxins or pollutants into the product. In some embodiments, the cells are propagated from primary cells. The term "primary cells" refers to cells taken directly from living tissue (e.g., muscle or fat tissue of an animal or a biopsy material) and established for growth in vitro. Primary cells are contemplated to be, without limitation, fibroblasts, adipocytes, hepatocytes, etc. Primary cells usually have undergone very few population doublings in culture and are therefore more representative of the main functional component of the tissue from which they are derived in comparison to continuous (tumor or artificially immortalized) cell lines. In some embodiments, the cells are immortalized precursor Page 11  Atty. Dkt. No.166118.01354.T002660 cells, which are immortalized through various methods, e.g., TERT or CDK4 expression. The primary cells may be derived from an animal source described herein. The cells may be from animal source including, without limitation, from bovine, avian (e.g., chicken, quail), porcine, seafood, or murine sources. The cells may also be derived from seafood such as fish (e.g., salmon, tuna, tilapia, perch, mackerel, cod, sardine, trout, etc.), shellfish (e.g., clams, mussels, and oysters); crustaceans (e.g., lobsters, shrimp, prawns, and crayfish), echinoderms (e.g., sea urchins and sea cucumbers), and insects. In another embodiment, the cells are propagated from stem cells. In some embodiments, the stem cells are derived from an animal. In some embodiments, the stem cells are induced pluripotent stem cells that are derived from animal cells (e.g., muscle cells, fat cells, connective tissue). Methods of producing induced pluripotent stem cells are known in the art. In other embodiments, the methods comprise using a mixture of cells, e.g., “feeder cells” and target cells in culture. As used herein, “feeder cells” are modified cells that produce factors that aid in, for example, the culturing, differentiation or overall production of “target cells.” In some embodiments, the feeder cells produce the factors in a culture system such that the target cells are not genetically modified but benefit from the factors secreted by the feeder cells which are genetically modified. In some embodiments, the feeder cells and the target cells are separated by a permeable or semi-permeable membrane. In some embodiments, the factors secreted by the feeder cells are able to cross the permeable or semi-permeable membrane and induce signaling on the target cells without contamination of the target cells with the feeder cells in the final product of the method. The use of serum as a source of growth factors and other vital proteins is a major cost in the generation of cultured meat. Further, given that serum is derived from bovine and other animal sources and cannot be fully characterized, it provides obstacles for standardization and GMP protocol development. Therefore, methods and compositions to reduce or eliminate the costs associated with using animal serum to culture cells for comestible meat products would greatly increase the production appeal and market appeal of such products. In the instant disclosure, cells and methods to generate “self-sufficient” modified cells are provided. In some embodiments, self- sufficient cells exogenously express two or more factors selected from Table 1. In some embodiments, cells express three or more factors from Table 1. In some embodiments, cells express four or more factors from Table 1. Table 1. List of growth factors for use in the methods and compositions disclosed herein. Page 12  Atty. Dkt. No.166118.01354.T002660 Protein name Neuregulin (NRG) Page 13  Atty. Dkt. No.166118.01354.T002660 Transforming growth factor beta 1 (TGFb1) Transforming growth factor beta 2 (TGFb2) In ord quire delivering or expressing factors to enable cells to become self-sufficient. As used herein, delivering or grammatical variations thereof refer to the process of contacting the cultured cells with the delivered agent such that the agent has the intended effect on the target cell. The term expressing as used herein refers to the cells ability to produce the intended factor (e.g., protein) in the cells such that the cell is self-sufficient and does not require endogenous factors (e.g., proteins) for tissue culture growth in vitro. In some embodiments, expression of the two or more factors is achieved by genetically modifying the cell to contain a polynucleotide(s) that encode and are capable of expressing the two or more factors. As used herein, genetic modification refers to changes in the nucleotide sequence of the genome of a cell or organism, either in a coding, i.e., a region which is transcribed into mRNA, or a non-coding region of the genome that results in a non-naturally occurring cells that is capable of expression of the factors described herein. In some embodiments, the polynucleotides of the present disclosure may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection, DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis, L., Dibner, M., Battey, I., 1986 “Basic Methods in Molecular Biology”). Other methods of transformation include for example, lithium acetate transformation and electroporation (see, e.g., Gietz et al., Nucleic Acids Res.27:69-74 (1992); Ito et al., J. Bacterol. 153:163-168 (1983); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991)). In some embodiments, the present disclosure teaches methods for introducing exogenous protein, RNA, and DNA into a cell. Various methods for achieving this have been described previously including direct transfection of protein/RNA/DNA or DNA transformation followed by intracellular expression of RNA and protein (Dicarlo, J. E. et al. “Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.” Nucleic Acids Res (2013). doi:10.1093/nar/gkt135; Ren, Z. J., Baumann, R. G. & Black, L. W. “Cloning of linear DNAs in vivo by overexpressed T4 DNA ligase: construction of a T4 phage hoc gene display Page 14  Atty. Dkt. No.166118.01354.T002660 vector.” Gene 195, 303-311 (1997); Lin, S., Staahl, B. T., Alla, R. K. & Doudna, J. A. “Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery.” Elife 3, e04766 (2014)). In some embodiments, the polynucleotide is a nucleic acid construct comprising an endogenous promoter linked to the polynucleotide sequence encoding the factor(s). In some embodiments, the construct is a vector. As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors" (or simply, "vectors"). The term vector encompasses "plasmids", the most commonly used form of vector. Plasmids are circular double-stranded DNA loops into which additional DNA segments, e.g., factor, may be ligated. However, other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adena- associated viruses), may also be used with the present invention. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors may be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. In one embodiment, the vectors comprise viral vectors that use viral machinery to carry the peptide to be expressed in a host cell. In some embodiments, the vectors of the present invention further comprise heterologous nucleic acid backbone sequence. As used herein, "heterologous nucleic acid sequence" refers to a non-human nucleic acid sequence, for example, a bacterial, viral, or other non-human nucleic acid sequence that is not naturally found in a human. Heterologous backbone sequences may be necessary for propagation of the vector and/or expression of the encoded peptide. Many commonly used expression vectors and plasmids contain non-human nucleic acid sequences, including, for example, CMV promoters. As used herein, “promoter” refers to a region of DNA where transcription of a gene is initiated. Promoter/enhancer combination (as per, for example, the Eukaryotic Promoter Data Base EPDB, through world wide web at epd.isb-sib.ch/) could also be used to drive expression. Use of a T3, T7 or SP6 cytoplasmic expression system is another possible embodiment. Eukaryotic cells Page 15  Atty. Dkt. No.166118.01354.T002660 can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct. In some embodiments, muscle-cell specific promoters are used to express the factors in cultured muscle cells. See, for example, Wang et al. “Construction and analysis of compact muscle- specific promoters for AAV vectors,” Gene Therapy volume 15, pages1489–1499 (2008); Liu et al. “Synthetic promoter for efficient and muscle-specific expression of exogenous genes”, Plasmid, Volume 106, November 2019, 102441; and Sarcar et al. “Next-generation muscle-directed gene therapy by in silico vector design,” Nature Communications volume 10, Article number: 492 (2019), which are incorporated by reference herein. Suitable promoters for the practice of the present invention include, without limitation, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, physically regulated (e.g., light regulated or temperature-regulated), tissue-preferred, and tissue- specific promoters. Suitable promoters include "heterologous promoters", a term that refers to any promoter that is not naturally associated with a polynucleotide to which it is operably connected. In mammalian cells, typical promoters include, without limitation, promoters for Rous sarcoma virus (RSV), human immunodeficiency virus (HIV-1), cytomegalovirus (CMV), SV40 virus, and the like as well as the translational elongation factor EF-lα promoter or ubiquitin promoter. Those of skill in the art are familiar with a wide variety of additional promoters for use in various cell types. In some embodiments, the promoters are, without limitation, CMV, EF1a, SV40, PGK1, Ubc, Human beta actin, CAG, TRE, UAS, Ac5, and polyhedrin promoters. Non-limiting examples of promoters include early or late viral promoters, such as, SV40 early or late promoters, cytomegalovirus (CMV) immediate early promoters, Rous Sarcoma Virus (RSV) early promoters; eukaryotic cell promoters, such as, e.g., beta actin promoter (Ng, 1989; Quitsche et al., 1989), GADPH promoter (Alexander et al., 1988, Ercolani et al., 1988), metallothionein promoter (Karin et al., 1989; Richards et al., 1984); and concatenated response element promoters, such as cyclic AMP response element promoters (cre), serum response element (SRE) promoter, phorbol ester promoter (TPA) and response element promoters (tre) near a minimal TATA box. It is also possible to use human growth hormone promoter sequences (e.g., the human growth hormone minimal promoter described at Genbank, accession no. X05244, Page 16  Atty. Dkt. No.166118.01354.T002660 nucleotide 283-341) or a mouse mammary tumor promoter (available from the ATCC, Cat. No. ATCC 45007). A specific example could be a phosphoglycerate kinase (PGK) promoter. “Enhancer” refers to cis-regulatory elements in the genome that cooperate with promoters to control target gene transcription. Unlike promoters, enhancers are not necessarily adjacent to target genes and can exert their functions regardless of enhancer orientations, positions and spatial segregations from target genes. Therefore, one of skill in the art must select appropriate promoters and, in some embodiments, enhancers to drive expression of proteins encoded on the delivered DNA molecule. See, for example, Meersseman C. et al. “Genetic variability of the activity of bidirectional promoters: a pilot study in bovine muscle,” DNA Research, Volume 24, Issue 3, June 2017, Pages 221–233, incorporated herein by reference, for potential bi-directional promoters active in bovine muscle. See, for example, Kern C. et al. “Functional annotations of three domestic animal genomes provide vital resources for comparative and agricultural research,” Nature Communications volume 12, Article number: 1821 (2021), incorporated herein by reference, for enhancers found in the muscle of chickens, pigs, and cows. Exogenous expression molecules (polynucleotides), also referred to as “exogenous vectors,” for use the disclosed methods may include one or more externally inducible transcriptional regulatory elements for inducible expression of the one or more transient immortalization factors. For example, polynucleotides useful in the invention may comprise an inducible promoter, such as a promoter that includes a tetracycline response element. In some aspects, the polynucleotide comprises a gene delivery system. Many gene delivery systems are known to those of ordinary skill in the art, and non-limiting examples of useful gene delivery systems include a viral gene delivery system, an episomal gene delivery system, an mRNA delivery system, or a protein delivery system. A viral gene delivery system useful in the invention may be an RNA-based or DNA-based viral vector. An episomal gene delivery system useful in the invention may be a plasmid, an Epstein-Barr virus (EBV)-based episomal vector, a yeast-based vector, a simian virus 40 (SV40)-based episomal vector, a bovine papilloma virus (BPV)-based vector, or the like. Thus, in some embodiments, the methods of the current disclosure comprise introducing a polynucleotide to a population of cells that comprises a promoter that is inducible by addition or removal of another “induction factor” or “inducible factor.” In some embodiments, the induction factor is tetracycline or the analogue doxycycline. Other suitable induction factors are known in Page 17  Atty. Dkt. No.166118.01354.T002660 the art including, for example, cumate inducible, rapamycin inducible, FKCsA inducible, Abcisic acid inducible, tamoxifen inducible, blue-light inducible promoters, riboswitches, or non-chemical stimuli including, but not limited to, temperature. In some embodiments, the selected factors disclosed herein are under the control of inducible promoters. In some embodiments, the inducible promoter is a tetracycline inducible promoter (TetON or TetOFF). An exemplary Tet-responsive promoter is described in WO 04/056964A2 (incorporated herein by reference). See, for example, FIG.1 of WO 04/056964A2. In one construct, a Tet operator sequence (TetOp) is inserted into the promoter region of the vector encoding the disclosed factors. TetOp is preferably inserted upstream of the transcription initiation site, upstream or downstream from the TATA box. In some embodiments, the TetOp is immediately adjacent to the TATA box. The expression of the target protein encoding sequence is thus under the control of tetracycline (or its derivative doxycycline, or any other tetracycline analogue). Addition of tetracycline or Dox relieves repression of the promoter by a tetracycline repressor that the host cells are also engineered to express. Thus, in such embodiments, the inducible factor is tetracycline. In the TetOFF system, a different tet transactivator protein is expressed in the tetOFF host cell. The difference is that Tet/Dox, when bind to an activator protein, is now required for transcriptional activation. Thus, such host cells expressing the activator will only activate the transcription of an shRNA encoding sequence from a TetOFF promoter at the presence of Tet or Dox. In some embodiments, the selected factors are under the control of a cumate-inducible promoter. See U.S. Patent No. 10/135,362, which is incorporated by reference herein. Thus, in such embodiments, the inducible factor is cumate, or other similar compounds. Other suitable inducible promoter systems are known in the art and can be found in, for example, Kallunki et al. Cells. 2019 Aug; 8(8): 796, which is incorporated by reference herein. Additional inducible promoter systems include rapamycin, abscisic acid and FK506 binding protein 12 based inducible promoter systems. Protein and nucleic acid sequence identities are evaluated using the Basic Local Alignment Search Tool ("BLAST") which is well known in the art (Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87: 2267-2268; Altschul et al., 1997, Nucl. Acids Res.25: 3389-3402). The BLAST programs identify homologous sequences by identifying similar segments, which are Page 18  Atty. Dkt. No.166118.01354.T002660 referred to herein as "high-scoring segment pairs," between a query amino or nucleic acid sequence and a test sequence which is preferably obtained from a protein or nucleic acid sequence database. Preferably, the statistical significance of a high-scoring segment pair is evaluated using the statistical significance formula (Karlin and Altschul, 1990), the disclosure of which is incorporated by reference in its entirety. The BLAST programs can be used with the default parameters or with modified parameters provided by the user. "Percentage of sequence identity'' or "percent similarity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or peptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The term "substantial identity'' or "substantial similarity" of polynucleotide or peptide sequences means that a polynucleotide or peptide comprises a sequence that has at least 75% sequence identity. Alternatively, percent identity can be any integer from 75% to 100%. More preferred embodiments include at least: 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described. These values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. "Substantial identity" of amino acid sequences for purposes of this invention normally means polypeptide sequence identity of at least 75%. Preferred percent identity of polypeptides can be any integer from 75% to 100%. More preferred embodiments include at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.7%, or 99%. In some embodiments, “sleeping beauty” transposons are used to introduce polynucleotides into target cells. See, for example, Sharma et al: "Efficient Sleeping Beauty DNA Transposition From DNA Mini circles", Molecular Therapy-Nucleic Acids, vol.2, No.2, Feb.1, Page 19  Atty. Dkt. No.166118.01354.T002660 2013, p. e74; Kacherovsky et al., "Combination of Sleeping Beauty transposition and chemically induced dimerization selection for robust production of engineered cells." Nucleic Acids Research, vol.40, No.11, Jun.1, 2012, pp. e85-e85; Kacherovsky et al: "Multiplexed 1-16 gene transfer to a human T-cell line by combining Sleeping Beauty transposon system with methotrexate selection", Biotechnology and Bioengineering, vol.112, No.7, Jul.23, 2015 (Jul.23, 2015), pp. 1429-1436; Kay et al, "A robust system for production of minicircle DNA vectors", Nature Biotechnology, vol.28, No.12, Nov.21, 2010, pp.1287-1289, incorporated by reference herein. As the expression of multiple different factors in cells is required for the generation of the modified cells of the instant disclosure, ribosomal skipping sequences are used to generate several functional proteins from a single transcript. Suitably, polynucleotides encoding the factors comprise any ribosomal skipping sequence that is known in the art. In some embodiments, the ribosomal skipping sequences are 2A oligonucleotide sequences, e.g., T2A sequence (GSGEGRGSLLTCGDVEENPGP, SEQ ID NO: 66) or P2A sequence (GSGATNFSLLKQAGDVEENPGP, SEQ ID NO: 67) or combinations thereof. Ribosomal skipping sequences are non-limiting examples of “multi-cistronic expression” wherein more than one open reading frame is encoded on a single transcript allowing for translation of two distinct polypeptides from a single transcript. In some embodiments, the polynucleotides comprise internal ribosome entry sequences (IRES). In some embodiments, the modified cells of the instant disclosure express two or more factors from Table 1, alternatively three or more factors selected from Table 1, alternatively 4 or more factors selected from Table 1, alternatively five or more factors selected from Table 1. The factors contemplated in Table 1 may be combined in a number of different combinations to provide modified cells that has superior growth properties under minimal defined media conditions as described herein. In some embodiment, the combination of the two or more factors of Table 1 are capable of increasing the growth of the modified cells in vitro in minimal defined media as compared to unmodified cells in the same minimal defined media. In one example, the two or more factors expressed by the modified cells are selected from fibroblast growth factors (FGFs; such as FGF-1 and/or FGF-2), transforming growth factor (TGF), neuregulin (NRG), insulin, insulin-like growth factor (IGF), FGF-receptor (FGF-R), insulin, albumin, and combinations thereof. For example, in some embodiments, the modified cells can express (a)FGF-2, receptor FGFR1 or combination thereof; (b) transferrin; (c) insulin, insulin-like Page 20  Atty. Dkt. No.166118.01354.T002660 growth factor (IGF) or combination thereof; (d) recombinant albumin; (e) NRG, NRG receptor or combinations thereof; (f) TGF, TGF receptor or combinations thereof; (g) combinations of any of (a)-(f). For example, the modified cells may express any suitable combinations of factors from (a)-(f), such as, but not limited to, (a), (a) and (b), (a) and (c), (a) and (d), (a) an (e), (a) and (f), (b) and (c), (b) and (d), (b) and (e), (b) and (f), (c) and (d), (c) and (e), (c) and (f), (d) and (e), (d) and (f), (e) and (f), (a) and (b) and (c), (a) and (b) and (The d), etc. In one suitable embodiment, the modified non-human cell express factors FGF-2, NRG1, and TGF-beta3. In some embodiments, the cell further expresses albumin. In some further embodiments, the cell expresses transferrin. In some embodiments, the cell ectopically expresses at least one growth factor and at least one signaling protein. For example, the cell may ectopically express FGF-2 and a constitutively active form of ras, Ras G12V . Minimal media In some embodiments, the cells of the instant disclosure are capable of growing in “minimal media.” The term minimal media is used interchangeably with the term "minimal defined media" and refers to media in which are the components are able to be identified and chemically defined and suitable does not contain any animal serum. As used herein, minimal media refers to media containing a carbon source (e.g., glucose), amino acids, salts, minerals, trace nutrients (e.g., vitamins), and optionally recombinant albumin, hydrolyzed or unhydrolized plant protein isolates, or crude plant hydrolysates (e.g., to replace albumin if not endogenously produced). In a preferred example, the minimal media does not contain any growth factors. In another preferred example, the minimal media does not contain any recombinant exogenous proteins (e.g., exogenous growth factors). For example, the media consists of a carbon source (e.g., glucose), amino acids, salts, minerals, trace nutrients (e.g., vitamins)). Suitable chemically defined and minimal media are known in the art, for example, B8 medium (see, for example, Kuo et al. “Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture”, Stem Cell Report. 2020 Feb 11;14(2):256-270, which is incorporated by reference) Beefy-9 (see, for example, Sout A. J. et al. “Simple and effective serum-free medium for sustained expansion of bovine satellite cells for cell cultured meat”, doi.org/10.1101/2021.05.28.446057, which is incorporated by reference herein), essential 8 and other serum-free media with growth factors removed (see, for example, Das, M et al. “Developing a Novel Serum-Free Cell Culture Model of Skeletal Muscle Differentiation by Page 21  Atty. Dkt. No.166118.01354.T002660 Systematically Studying the Role of Different Growth Factors in Myotube Formation”, In Vitro Cell Dev Biol Anim.2009 Jul-Aug; 45(7): 378–387, which is incorporated by reference herein). Exemplary factors for use in the compositions and methods of the current disclosure As described herein, the modified cells and meat product described herein comprise two or more factors in Table 1. Table 1 comprises growth factors and their receptors, cytokines, and other protein factors that have been found to play a role in the ability to grow and propagate cells in in vitro culture. Some of the factors are described in more detail below and exemplary sequences of the factors for use in the present invention are provided for exemplary purposes only in Tables 2, 3 and 6, but the present invention is not limited thereto. Other suitable sequences and modifications may be readily ascertained and determined by one skilled in the art. One suitable factor for practicing the invention is neuregulin (NRG). Neuregulin has been shown to have diverse functions in the development of the nervous system and play multiple essential roles in vertebrate embryogenesis, including: cardiac development, Schwann cell and oligodendrocyte differentiation, some aspects of neuronal development, as well as the formation of neuromuscular synapses. Bovine neuregulin has the sequence SEQ ID NO: 1. Tilapia (Oreochromis niloticus) neuregulin has the sequence SEQ ID NO: 2. Another suitable factor for practicing the invention is insulin. Insulin regulates the cellular uptake of glucose. Bovine insulin has the sequence SEQ ID NO: 3, Tilapia insulin has the sequence SEQ ID NO: 4. Another suitable factor for practice of the invention is serotransferrin or transferrin. Serotransferrin is an iron binding transport protein which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. Bovine serotransferrin has the sequence SEQ ID NO: 5. Tilapia serotransferrin has the sequence SEQ ID NO: 6. Another suitable factor for practice of the invention is fibroblast growth factor (FGF). FGF stimulates blood vessel growth and is aplayer in wound healing. Bovine FGF1 has the sequence SEQ ID NO: 7. Tilapia FGF1 has the sequence SEQ ID NO: 8. A sequence encoding Fibroblast growth factor-2 (FGF2) has a sequence SEQ ID NO: 100. Fibroblast growth factor receptor 2 (FGFR2) Bovine FGFR2 has the sequence SEQ ID NO: 11. Another suitable factor for practice of the invention is transforming growth factor (TGF). One suitable TGF is TGF3beta (TGF3b) is a multifunctional protein that regulates embryogenesis and cell differentiation and is required in various processes such as secondary palate development. Page 22  Atty. Dkt. No.166118.01354.T002660 Bovine TGF3b has the sequence SEQ ID NO: 15. Tilapia TGF3b has the sequence SEQ ID NO: 16. Another suitable factor for practice of the invention is the receptor for fibroblast growth factor-1, e.g., FGF receptor 1 (FGFR1). FGFR1 is membrane receptor involved in many cellular processes including proliferation and migration. Bovine FGFR1 has the sequence SEQ ID NO: 9. Tilapia FGFR hast the sequence SEQ ID NO: 10. In some embodiments, the modified cell of the present disclosure can express FGF-1, FGFR1, or both FGF1 and FGFR1 in the modified cell. In some embodiments, the modified cell can express a constitutively active FGFR1 receptor which is actively on even without binding of FGF, and therefore removed the need for modifying the cell to express FGF-1. See, for example, Rutland et al. supra, and Mangasarian et al., supra. Another suitable factor for practice of the invention is insulin-like growth factor 1 (IGF- 1). IGF-1 is a hormone that helps promote bone and tissue growth. Bovine IGF-1 has the sequence SEQ ID NO: 18. Tilapia IGF-1 has the sequence SEQ ID NO: 19. Insulin can also be a factor expressed by the modified cells of the present invention. In some embodiments, the cell may express both IGF-1 and insulin. In some aspects, for example, delivery of different combinations of factors are disclosed herein. In one embodiment, mRNA is delivered to the population of cells. In another embodiment, nucleic acid sequences (e.g., DNA) encoding the factors described herein are used. The invention of the current disclosure provides, in some embodiments, methods of generating self-sufficient modified cells. Thus, in some embodiments, factors capable of CRISPR interference (CRISPRi) and/or CRISPR activation (CRISPRa) are used in the methods and compositions of the current disclosure to allow expression of the two or more factors. In some embodiments, the present disclosure teaches methods of modulating the expression of host cell genes via CRISPRi (CRISPR interference) and CRISPRa (CRISPR activation) technologies. In some embodiments, the presently disclosed technologies utilize catalytically inactivated (i.e., nuclease-deactivated) CRISPR endonucleases that have been mutated to no longer generate double DNA stranded breaks, but which are still able to bind to DNA target sites through their corresponding guide RNAs. In some embodiments, the present disclosure refers to these catalytically inactivated CRISPR enzymes as “dead CRISPR,” or “dCRISPR” enzymes. The “dead” modifier may also be used in reference to specific CRISPR enzymes, such as dead Cas9 (dCas9), or dead Cpf1 (dCpf1). Page 23  Atty. Dkt. No.166118.01354.T002660 In some embodiments, CRISPR or other suitable genome editing methods are used to modify the FGFR such that cysteine at position 342 is replaced with tyrosine, thus disrupting the formation of the third immunoglobulin (Ig)-like loop in the extracellular portion of the receptor and conferring constative activity to the receptor. This constitutive FGFR can be expressed in the cells described herein. dCRISPR enzymes function by recruiting the catalytically inactivated dCRISPR enzyme to a target DNA sequence via a guide RNA, thereby permitting the dCRISPR enzyme to interact with the host cell's transcriptional machinery for a particular gene. In some embodiments, The CRISPRi methods of the present disclosure utilize dCRISPR enzymes to occupy target DNA sequences necessary for transcription, thus blocking the transcription of the targeted gene (L. S. Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression.” Cell. 152, 1173-1183 (2013); see also L. A. Gilbert et al., “CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.” Cell.154, 442-451 (2013)). In other embodiments, the CRISPRi methods of the present disclosure utilized CRISPR enzymes translationally fused, or otherwise tethered to one or more transcriptional repression domains, or alternatively utilize modified guide RNAs capable of recruiting transcriptional repression domains to the target site (e.g., tethered via aptamers, as discussed below). In some embodiments, the CRISPRa methods of the present disclosure employ dCRISPR enzymes translationally fused or otherwise tethered to different transcriptional activation domains, which can be directed to promoter regions by guide RNAs. (See A. W. Cheng et al., “Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.” Cell Res.23, 1163-1171 (2013); see also L. A. Gilbert et al., “Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation.” Cell.159, 647-661 (2014)). In other embodiments, the CRISPRa methods of the present disclosure utilize modified guide RNAs that recruit additional transcriptional activation domains to upregulate expression of the target gene (e.g., tethered via aptamers, as discussed below). In some embodiments, CRISPRa is used to activate expression of endogenous factors, for example, those listed in Table 1. In yet other embodiments, the presently disclosed invention also envisions exploiting dCRISPR enzymes and guide RNAs to recruit other regulatory factors to target DNA sites. In addition to recruiting transcriptional repressor or activation domains, as discussed above, the dCRISPR enzymes and guide RNAs of the present disclosure can be modified so as to recruit Page 24  Atty. Dkt. No.166118.01354.T002660 proteins with activities ranging from DNA methylation, chromatin remodelers, ubiquitination, sumoylation. Thus, in some embodiments, the dCRISPR enzymes and guide RNAs of the present disclosure can be modified to recruit factors with methyltransferase activity, demethylase activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, sumoylating activity, desumoylating activity, ribosylation activity, deribosylation activity, myristoylation activity, remodeling activity, protease activity, oxidoreductase activity, transferase activity, hydrolase activity, lyase activity, isomerase activity, synthase activity, synthetase activity, demyristoylation activity, cytidine deaminase activity and any combinations thereof In other embodiments, the dCRISPR enzymes and guide RNAs of the present disclosure can be modified to recruit one or more marker genes/composition, such as fluorescent proteins, gold particles, radioactive isotopes, GUS enzymes, or other known biological or synthetic compositions capable of being detected. This last embodiment would permit researchers to tag and track regions of a host cell's genome. As used herein, the term “cis regulatory factors” refers to any of the biological or synthetic compositions that can be recruited by the dCRISPR or guide RNAs of the present disclosure. In some embodiments, the dCRISPR enzyme and the transcriptional modulator domain are linked via a peptide linker. A peptide linker sequence may be employed to separate the first and the second peptide components by a distance sufficient to ensure that each peptide folds into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion protein using standard techniques well known in the art. Suitable peptide linker sequences may be chosen based on the following factors: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional regions on the first and second peptides; and (3) the lack of hydrophobic or charged residues that might react with the peptide functional regions. In certain embodiments, the peptide linker sequences contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Thr and Ala may also be used in the linker sequence. Page 25  Atty. Dkt. No.166118.01354.T002660 In some embodiments, the present disclosure teaches the use of protein-protein interaction domains to tether the transcriptional modulator domains to the dCRISPR. Thus, in some embodiments, the sequence of the dCRISPR enzyme is translationally fused to a first protein- protein interaction domain (PP1) capable of dimerizing with a second protein-protein interaction domain (PP2) that is translationally fused to the transcriptional modulator (or other cis regulatory factor). When expressed, each of the dCRISPR-PP1 and the PP2-Transcriptional Modulator will dimerize, thus recruiting the transcriptional modulator to the DNA target site. Persons having skill in the art will be aware of methods of using naturally occurring, or synthetic protein-protein interaction domains to create in-vivo dimers. (See Giescke et al., 2006 “Synthetic protein-protein interaction domains created by shuffling Cys2His2 zinc-fingers.” Mol Syst Biol 2: 2006.0011). In other embodiments, the present disclosure also teaches modified guide RNAs with RNA aptamers capable of recruiting one or more cis regulatory factors. The RNA aptamers of the present disclosure may be operably linked to the 5′ or 3′ end of a guide RNA, and are designed so as to not affect dCRISPR binding to a DNA target site. Instead, the RNA aptamers provide an additional tether from which to recruit one or more cis regulatory factors, such as transcriptional modulators. In some embodiments, the present disclosure teaches customized RNA aptamers designed to directly interact with one or more cis regulatory factors. In other embodiments, the present disclosure teaches use of known aptamers targeting specific sequences. Thus, in some embodiments, the present disclosure envisions guide RNAs with validated RNA aptamers, which then bind to their natural targets, which are in turn translationally fused to one or more cis regulatory factor (i.e., guide_RNA-Aptamer-Aptamer_Target-Cis_Regulatory_Factor). In some embodiments, guide RNAs that incorporate RNA aptamers to tether cis regulatory factors are referred to as scaffold RNAs (scRNAs). (Zalatan J G, et al. “Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds.” Cell. 2015; 160:339-350). The scRNAs are designed by extending the guide RNA sequence with orthogonally acting protein-binding RNA aptamers. Each scRNA can encode information both for DNA target recognition and for recruiting a specific repressor or activator protein. By changing the DNA targeting sequence or the RNA aptamers in a modular fashion, multiple dCas9-scRNAs can simultaneously activate or repress multiple genes in the same cell Page 26  Atty. Dkt. No.166118.01354.T002660 For example, an improvement, termed the synergistic activation mediator (SAM) system, was achieved by adding MS2 aptamers to a guide RNA. The MS2 aptamers were designed to recruit cognate MS2 coat protein (MCP), which were fused to p65AD and heat shock factor 1 (HSF1) (Dominguez et al., 2016 “Beyond editing; repurposing CRISPR-Cas9 for precision genome regulation and interrogation” Nat Rev Mol Cel Biol January 17(1) 5-15). The SAM technology, together with dCas9-VP64, further increased endogenous gene activation compared with dCas9-VP64 alone and was shown to activate 10 genes simultaneously. (Konermann S, et al. “Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.” Nature. 2014; 517:583-588). Similar results may be achieved through the use of other validated aptamer- scaffold protein combinations, such as PP7 or com. (Zalatan J G, et al. “Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds.” Cell.2015; 160:339-350). In some embodiments, the present disclosure also envisions the use of double-sided aptamers capable of tethering a dCRISPR enzyme to one or more cis regulatory factors. The double-sided aptamers of the present disclosure function similarly to the aptamers discussed above, but are capable of binding both the dCRISPR protein, and the cis regulatory factor. In one illustrative example, the dCRISPR enzyme would be translationally fused to an MS2 coat protein domain, and the cis regulatory element (a VP16 domain) would be translationally fused to a PP7 domain. The double-sided RNA aptamer would comprise an MS2 binding domain on one end, and a PP7 binding domain on another end. Thus, in some embodiments, the double-sided aptamers of the present disclosure can would be expected to form the following generic structure: dCRISPR- Aptamer_Target-Aptamer_Side1-Aptamer_Side2-Aptamer_Target-Ci s_Regulatory_Factor. A non-limiting list of the transcriptional activation domains compatible with the presently disclosed invention include: fragments of transcription regulatory domains and fragments of domains having transcription regulation function of VP16, VP64, VP160, EBNA2, E1A, Gal4, Oaf1, Leu3, Rtg3, Pho4, Gln3, Gcn4, Gli3, Pip2, Pdr1, Pdr3, Lac9, Teal, p53, NFAT, Sp1 (e.g., Sp1a), AP-2 (e.g., Ap-2a), Sox2, NF-κB, MLL/ALL, E2A, CREB, ATF, FOS/JUN, HSF1, KLF2, NF-1L6, ESX, Oct1, Oct2, SMAD, CTF, HOX, Sox2, Sox4, VPR, RpoZ, or Nanog. In some embodiments the transcriptional activator is VPR (see Kiani S. et al., “Cas9 gRNA engineering for genome editing, activation and repression” Nature Methods 12, 1051-1054 (2015)). Page 27  Atty. Dkt. No.166118.01354.T002660 In some embodiments, the nucleic acids encoding for the dCRISPR enzyme and/or the guide RNA are contained in one or more insert parts of a modular CRISPR construct of the present disclosure. Thus, in some embodiments, the modular CRISPR constructs of the present disclosure permit users to quickly and efficiently modify the construct to add or subtract insert parts encoding for different guide RNAs (e.g., guide RNAs targeting different genes, or encoding aptamers capable of recruiting different cis regulatory factors, as discussed above), or encoding different dCRISPR enzymes (e.g., dCas9, or dCpf1, or dCRISPR protein fusions with various cis regulatory factors, as discussed above). The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. A protein may comprise different domains, for example, a nucleic acid binding domain and a nucleic acid cleavage domain. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain. A protein can be a growth factor, a cytokine, a receptor, and/or a signaling protein. Nucleic acids, proteins, and/or other compositions described herein may be purified. As used herein, “purified” means separate from the majority of other compounds or entities, and encompasses partially purified or substantially purified. Purity may be denoted by a weight-by- weight measure and may be determined using a variety of analytical techniques such as but not limited to mass spectrometry, HPLC, etc. Polypeptide sequence identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured Page 28  Atty. Dkt. No.166118.01354.T002660 over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or Sequence Listing, may be used to describe a length over which percentage identity may be measured. The terms “nucleic acid” and “nucleic acid molecule,” as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Nucleic acids generally refer to polymers comprising nucleotides or nucleotide analogs joined together through backbone linkages such as but not limited to phosphodiester bonds. Nucleic acids include deoxyribonucleic acids (DNA) and ribonucleic acids (RNA) such as messenger RNA (mRNA), transfer RNA (tRNA), etc. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides). In some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms “oligonucleotide” and “polynucleotide” can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, “nucleic acid” encompasses RNA as well as single and/or double-stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule. On the other hand, a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA/RNA hybrid, or include non-naturally occurring nucleotides or nucleosides. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the Page 29  Atty. Dkt. No.166118.01354.T002660 5′ to 3′ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g. adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5- methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5- propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadeno sine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2- thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose); and/or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages). The term “hybridization,“ as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between “substantially complementary” nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as “stringent hybridization conditions” or “sequence-specific hybridization conditions.” Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989, Molecular Cloning– A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3/4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference). In some embodiments, the present disclosure teaches the use of origins of replication to maintain (i.e., continue to replicate) a plasmid in one or more species. Persons having skill in the art will be familiar with various available origin of replication sequences. Common features of origins of replications for bacterial, archael, eukaryotic, and multicellular organisms is discussed Page 30  Atty. Dkt. No.166118.01354.T002660 in Leonard and Mechali, “DNA replication Origins” Cold Spring Harb Perspect Biol 2013 October; 5(10). In some embodiments, the polynucleotides of the current disclosure comprise “selection markers.” Selection markers are factors encoded by the polynucleotide that allow selection of a cell harboring the polynucleotide. In some embodiments, selection markers are, for example, fluorescent proteins or luminescent proteins. In some embodiments, selection markers are polynucleotide sequences that encode proteins that confer resistance to antibiotics. In some embodiments, polynucleotides comprise multiple selection markers. Exemplary selection markers include puromycin, blasticidin, zeocin, G418, or hygromycin resistance. Puromycin resistance is conferred by expression of the protein with SEQ ID NO: 64. Green fluorescent protein (GFP) has the sequence SEQ ID NO: 65. In some embodiments, the current disclosure provides a meat product comprising the modified non-human cells of the current disclosure. Methods for production of in vitro cultured meat product In another aspect of the current disclosure, methods of producing a meat product in in vitro culture are provided. In some embodiments, the methods comprise: culturing a population of the modified non-human cells, wherein the cells are ectopically expressing two or more proteins, growth factors or cytokines or receptors thereof that promote cell growth, wherein the two or more factors are selected from the factors listed in Table 1, in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors. In some embodiments, the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates or recombinant albumin. In some embodiments, the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates. In some embodiments, the minimal media contains no exogenous recombinant protein components. In some embodiments the method comprises: culturing a combination of two or more modified cells selected from muscle cell, stem cells, fat cell, and connective tissue cell in a culture to produce a three-dimensional meat product suitable for human or animal consumption. Page 31  Atty. Dkt. No.166118.01354.T002660 In another aspect of the current disclosure, methods of producing a population of modified cells for making a food product are provided. In some embodiments, the method comprises: (a) expressing two or more factors of Table 1 in cells; (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. In some embodiments, the number of modified cells produced in step (b) is increase at least 10% or more, 15% or more, 20% or more, 35% or more, 30% or more, 35% or more, 40% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, or 100% or more relative to culturing of non-modified non-human cells in the minimal medium. Suitable percentages and amounts in between these amounts are contemplate, e.g., 10%, 11%, 12%, 13%, 25%, 27%, 36%, etc. In some embodiments, the methods of the instant disclosure comprise expressing two or more factors and/or proteins from Table 1, alternatively three or more factors selected from Table 1, alternatively 4 or more factors and or proteins selected from Table 1, alternatively five or more factors and/or proteins selected from Table 1. The factors and/or proteins contemplated in Table 1 may be combined in a number of different combinations in the disclosed methods to provide modified cells that have superior growth properties under minimal defined media conditions as described herein. In some embodiments, the combination of the two or more factors and/or proteins of Table 1, when used in the disclosed methods, are capable of increasing the growth of the modified cells in vitro in minimal defined media as compared to unmodified cells in the same minimal defined media. In some embodiments, the number of modified cells produced in step (b) is increase at least 10% or more, 15% or more, 20% or more, 35% or more, 30% or more, 35% or more, 40% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, or 100% or more relative to culturing of non-modified non-human cells in the minimal medium. In one example, the two or more factors and/or proteins of the disclosed methods are selected from fibroblast growth factor (FGF; such as FGF1 and/or FGF2), transforming growth factor (TGF), neuregulin (NRG), insulin, insulin-like growth factor (IGF), FGF-receptor (FGF-R), insulin, albumin, signaling proteins (e.g., a constitutively active signaling protein such as Ras G12V ), and combinations thereof. For example, in some embodiments, the disclosed methods comprise expressing (a)FGF-2, receptor FGFR1 or combination thereof; (b) transferrin; (c) insulin, insulin- like growth factor (IGF) or combination thereof; (d) recombinant albumin; (e) NRG, NRG Page 32  Atty. Dkt. No.166118.01354.T002660 receptor or combinations thereof; (f) TGF, TGF receptor, signaling proteins (e.g., Ras G12V ) or combinations thereof; (g) combinations of any of (a)-(f). For example, the modified cells may express any suitable combinations of factors from (a)-(f), such as, but not limited to, (a), (a) and (b), (a) and (c), (a) and (d), (a) an (e), (a) and (f), (b) and (c), (b) and (d), (b) and (e), (b) and (f), (c) and (d), (c) and (e), (c) and (f), (d) and (e), (d) and (f), (e) and (f), (a) and (b) and (c), (a) and (b) and (The d), etc. In one suitable embodiment, the methods comprise expressing factors FGF- 2, NRG1, and TGF-beta3. In some embodiments of the methods, the cell further expresses albumin. In some further embodiments, the cell expresses transferrin. In some embodiments, step (a) further comprises introducing one or more, two or more, or three or more exogenous vectors in the cell capable of expressing the two or more factors. In some embodiments of the methods, the one or more exogenous vectors is a single vector capable of expressing the two or more factors, three or more factors, four or more factors or five or more factors. In some embodiments, the vector comprises ribosomal skipping sites to express the two or more factors. In some embodiments, the one or more vector constitutively expresses the two or more factors. In some embodiments, the one or more vector is and inducible vector; and the method further comprises contacting the cell with an inducible factor, wherein contact with the inducible factor induces expression of the one or more factors within the cell. In some embodiments, step (a) comprises engineering the cell via crispr/cas9 editing to either express an endogenous factor or increase the expression of the factor within the cell. In some embodiments, the cells is a muscle cell, a fat cell, a stem cell, or a connective tissue cell. In some embodiments, the cells is a bovine cell, a piscine cell, a porcine cell, or a galline cell. In some embodiments, the cells are a combination of two or more cells selected from muscle cell, a fat cell, a stem cell, or a connective tissue cell. Population of cells In another aspect of the current disclosure, a population of cells is provided. In some embodiments, the population of cells is made by the method comprising: culturing a population of the modified non-human cells, wherein the cells are ectopically expressing two or more proteins (e.g., signaling proteins), growth factors or cytokines or receptors thereof that promote cell growth, wherein the two or more factors are selected from the factors listed in Table 1, in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non- human animal tissue suitable for human and/or animal consumption and wherein the minimal Page 33  Atty. Dkt. No.166118.01354.T002660 media does not contain exogenous growth factors. In some embodiments, the population of cells is made the method comprising: (a) expressing two or more factors and/or proteins of Table 1 in cells; (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. In some embodiments, the number of modified cells produced in step (b) is increase at least 10% or more, 15% or more, 20% or more, 35% or more, 30% or more, 35% or more, 40% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, or 100% or more relative to culturing of non-modified non-human cells in the minimal medium. Food product In another aspect of the current disclosure, food products are provided. In some embodiments, the food products comprise a population of cells made by the method comprising: culturing a population of the modified non-human cells, wherein the cells are ectopically expressing two or more factors and/or proteins, growth factors or cytokines or receptors thereof that promote cell growth, wherein the two or more factors are selected from the factors listed in Table 1, in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors. In some embodiments, the food product comprises a population of cells made the method comprising: (a) expressing two or more factors of Table 1 in cells; (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. In some embodiments, the number of modified cells produced in step (b) is increase at least 10% or more, 15% or more, 20% or more, 35% or more, 30% or more, 35% or more, 40% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, or 100% or more relative to culturing of non-modified non- human cells in the minimal medium. In some embodiments, the food product is a three- dimensional tissue suitable for human or non-human animal consumption. In another aspect of the current disclosure, consumable compositions are provided. In some embodiments, the compositions comprise a population of cells made by the methods described herein. In one embodiment, the composition comprises one or more target cell type made by the methods described herein. In another embodiment, the consumable composition comprising one or more populations of the non-human modified cells described herein. In one embodiment, Page 34  Atty. Dkt. No.166118.01354.T002660 the consumable composition is made by a method comprising: culturing a population of the modified non-human cells, wherein the cells are ectopically expressing two or more proteins (e.g., signaling proteins), growth factors or cytokines or receptors thereof that promote cell growth, wherein the two or more factors and/or proteins are selected from the factors listed in Table 1, in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors. In some embodiments, the composition comprises a population of cells made the method comprising: (a) expressing two or more factors and/or proteins (e.g., signaling proteins) of Table 1 in cells; (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. In some embodiments, the number of modified cells produced in step (b) is increase at least 10% or more, 15% or more, 20% or more, 35% or more, 30% or more, 35% or more, 40% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, or 100% or more relative to culturing of non-modified non-human cells in the minimal medium. In some embodiments, the composition comprises a three-dimensional tissue suitable for human or non-human animal consumption. In some embodiments, the meat product or composition produced by the methods of the invention may be intended for consumption by human beings, non-human animals, or both. In some embodiments, the cultured meat products are food products for human consumption. In other embodiments, the cultured meat products are used for animal feed such as feed for livestock, feed for aquaculture, or feed for domestic pets. In some embodiments, the method includes culturing myoblasts in vitro or ex vivo and allowing these cells to differentiate into specific types of muscle cells such as skeletal muscle cells or smooth muscle cells. In some embodiments, the meat product comprises muscle cells including skeletal muscle cells, smooth muscle cells and satellite cells. In some embodiments, the meat product comprises fat cells (e.g., adipocytes). In some embodiments, the meat product comprises an extra cellular matrix secreted by specialized cells (e.g., fibroblasts). In some embodiments, the meat product comprises endothelial cells or capillary endothelium formed by endothelial cells, including, but not limited to aortic endothelial cells and skeletal microvascular endothelial cells. In some Page 35  Atty. Dkt. No.166118.01354.T002660 embodiments, the meat product further comprises an extracellular matrix. In some embodiments, the meat product further comprises adipocytes. In some embodiments, the meat product further comprises capillaries. The cells may be edible cells including muscle cells, fat cells, and combinations thereof. The precursor cells may be muscle precursor cells or adipocyte precursor cells. Examples of suitable cell types include, but are not limited to, satellite cells, fat cells (i.e., adipocytes), fibroblasts, myoblasts, muscle cells, precursors thereof, and combinations thereof. The cells may be derived from primary cells of suitable animals, as described herein. The cells may be from animal source including, without limitation, from bovine, avian (e.g., chicken, quail), porcine, seafood, or murine sources. The cells may also be derived from seafood such as fish (e.g., salmon, tuna, tilapia, etc.), shellfish (e.g., clams, mussels, and oysters); crustaceans (e.g., lobsters, shrimp, prawns, and crayfish), and echinoderms (e.g., sea urchins and sea cucumbers), and insects. In some embodiments, the cells may be engineered to produce vital nutrients such as proteins and essential fatty acids. In some aspects, media formulations may include transgenic components to drive cell growth and/or differentiation. For example, tetracycline-responsive promoters inserted into transgenic cells may be activated by including tetracycline in the culture medium, resulting in forced expression of myogenic or adipogenic genes in edible cell lines (e.g., chicken fibroblasts, bovine satellite cells, etc.). Bovine satellite cells may be cultured in growth media (e.g., DMEM with Glutamax, and 1% antibiotic-antimycotic) and modified to express two or more factors described herein. In some embodiments, the method comprises a differentiation step and a growth step in minimal culture medium. In one embodiment, to differentiate satellite cells into mature myotubes, cells may be cultured to confluence and triggered for differentiation by a low growth factor environment. For example, the culture medium may shift from a growth factor-rich proliferation media to a growth factor-poor differentiation media. Bovine fat cells may also be cultured in growth media (e.g., DMEM with Glutamax, , 1% antibiotic-antimycotic). To differentiate adipogenic precursor cells into mature adipocytes, cells may be cultured to a desired confluence (e.g., 75%), and the media may then be supplemented with free fatty acid solution or the cells can be modified to express at least one of the adipogenic factors found in Table 4. An exemplary free fatty acid solution may be 50 millimolar (mM) free Page 36  Atty. Dkt. No.166118.01354.T002660 fatty acid solutions containing elaidic acid, erucic acid, myristoleic acid, oleic acid, palmitoleic acid, phytanic acid, and pristanic acid. To verify lipid accumulation, Oil Red O (ORO) may be used to stain differentiated cells. Growth factors that can be used in the methods and compositions of the invention include but are not limited to platelet-derived growth factors (PDGF), insulin-like growth factor (IGF-1). PDGF and IGF-1 are known to stimulate mitogenic, chemotactic and proliferate (differentiate) cellular responses. The growth factor can be, but is not limited to, one or more of the following: PDGF, e.g., PDGF AA, PDGF BB; IGF, e.g., IGF-I, IGF-II; fibroblast growth factors (FGF), e.g., acidic FGF, basic FGF, β-endothelial cell growth factor, FGF 4, FGF 5, FGF 6, FGF 7, FGF 8, and FGF 9; transforming growth factors (TGF), e.g., TGF-P1, TGF β1.2, TGF-β2, TGF-β3, TGF- β5; bone morphogenic proteins (BMP), e.g., BMP 1, BMP 2, BMP 3, BMP 4; vascular endothelial growth factors (VEGF), e.g., VEGF, placenta growth factor; epidermal growth factors (EGF), e.g., EGF, amphiregulin, betacellulin, heparin binding EGF; interleukins, e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14; colony stimulating factors (CSF), e.g., G-CSF, GM-CSF, M-CSF; nerve growth factor (NGF); stem cell factor; hepatocyte growth factor, and ciliary neurotrophic factor. Various cost-effective biopolymers or complex extracts from natural sources may be used as coating materials for the surfaces of culture vessels used to culture the modified cells or used in the methods disclosed herein. In some embodiments, extracellular matrix proteins and/or chemical/synthetic coatings may be used as coatings to improve cell attachment to the culture vessel and mimic in vivo cell behavior. Other types of coating materials may include commercially available products such as, but not limited to, fibronectin, laminin, vitronectin, collagen, cadherin, elastin, hyaluronic acid, poly-D-lysine, poly-L-lysine, poly-L-ornithine, concanavalin A, and other adhesive, non-toxic chemicals. Conconavalin A, laminin, and hyaluronic acid may be obtained from animal-free origins and have been shown to enhance muscle cell attachment to various biomaterials. The structural hierarchy and marbling of the cultured tissue construct may be tunable by changing the ratio of muscle cell fibers and fat cell fibers. Warner-Bratzler shear force test may be used to assess the texture and tenderness of the cultured tissue product. According to the present disclosure, cultured muscle provides versatile outputs that meet target metrics pertaining to properties such as texture, thermal response upon cooking, Page 37  Atty. Dkt. No.166118.01354.T002660 composition, nutrition, density, alignment, composition, and marbling. This cultured meat system is cost-efficient, scalable, and generates cultured meats that mimic whole muscle. PCT application number US2021/071171 describes methods and systems to generate whole muscle meat in culture. Accordingly, PCT application number US2021/071171, filed August 12, 2021 is incorporated herein by reference in its entirety. The methods of transiently expanding a population of cells in culture may be used in the bioreactors described in PCT application number US2021/071171. Thus, the instantly disclosed cells and methods for developing cultured cell populations without genetically modifying the cells are suitable for use in the systems and methods disclosed in PCT application number US2021/071171. Suitable, the methods and systems are suitable for large scale production of the modified cells of the instant invention. In some embodiments, the compositions comprise a mixture of cells, e.g., “feeder cells” and target cells. As used herein, “feeder cells” are cells that produce factors that aid in, for example, the culturing, differentiation or overall production of “target cells.” The target cells are the cells used to produce a cultured meat product. In some embodiments, the feeder cells produce the factors in a culture system such that the target cells are not genetically modified but benefit from the factors secreted by the feeder cells which are genetically modified. In some embodiments, the feeder cells and the target cells are separated by a permeable or semi-permeable membrane. In some embodiments, the factors secreted by the feeder cells are able to cross the permeable or semi- permeable membrane and induce signaling on the target cells without contamination of the target cells with the feeder cells in the final product. In some embodiments, a meat product comprising the target cells is produced by the methods described herein, wherein the target cells are not modified. This method further allows the target cells and feeder cells to grow in minimal culture medium without the addition of exogenous growth factors, and the ability to produce a meat product that does not contain modified cells. In some embodiments, the meat product comprises the target cells and is substantially free of feeder cells or is free of feeder cells. As used herein the terms “ingestible” and “edible” refer to compositions which can be safely taken into the body. These compositions include those which are absorbed, and those which are not absorbed as well as those which are digestible and non-digestible. As used herein, the term “chewable” refers to a composition which can be broken/crushed into smaller pieces by chewing prior to swallowing. One skilled in the art will appreciate that a suitable edible composition may Page 38  Atty. Dkt. No.166118.01354.T002660 be selected according to physical properties (e.g., Young's modulus, viscosity modulus, stiffness, etc.) to a desired use (e.g., consumption by a human adult). While the above work focuses on proliferation medium, it is possible that this same technique could be used for differentiation alone or in addition to cell growth to made edible meat products. For instance, an inducible promoter system could be used to express muscle- differentiation growth factors and/or their receptors (e.g., EGF (SEQ ID NO:68), EGF receptor (SEQ ID NO:69) and IGF 4 (SEQ ID NO:70)) when the cells are triggered to differentiate. While the above work focuses on bovine muscle cells, this could be applicable to other species (in some instances by using gene homologues from these species) and other cell types. For example, the methods can be used for making fat cells for food production (e.g., with relevant growth factors such as those mentioned above as well as fatty acid binding protein 4 (FABP4), bone morphogenic protein 4 (BMP4, SEQ ID NO:72 (Bovine), SEQ ID NO:71), peroxisome proliferator activated receptor ^ (PPAR ^ ^ ^SEQ ID NO ^ ^ ^ ^ ^, or CCAAT enhancer binding protein alpha (CEBPA, SEQ ID NO:74)). Other potential applications of the disclosed technology include the use of preadipocytes, dedifferentiated fat cells (DFAT cells), mesenchymal stem cells or other similar cells, e.g., adipose derived stem cells. Table 4 provides a list of genes that can be ectopically expressed to induce adipogenesis in various adipogenic precursor cells. As such, in one embodiment, the present invention provides modified cells or methods of producing modified cells that express one or more factors found in Table 4. The modified cells can be made by a method comprising expressing one or more factors from Table 4 in adipose-derived stem cells. These adipose cells can be used in food products, including, in combination with muscle cells to produce a mixture of cells for the food product. While the above work lists several relevant growth factors, a wide range of possible targets exist (along with their associated receptors), including: FGF (Fibroblast growth factor, including FGF1 and FGF2), TGF (transforming growth factor), IGF (insulin-like growth factor), PDGF (platelet-derived growth factor), CT1 (Cardiotropin), HGF (Hepatocyte growth factor), EGF (epidermal growth factor), PEDF (Pigment epithelium-derived factor), GH (growth hormone), IL-6 (interleukin 6), LIF (Leukemia inhibitory factor), TNFa (Tumor necrosis factor), VEGF (Vascular endothelial growth factor), additional options include the production of hormones or steroidal molecules, micro RNAs (miRNAs) and signaling proteins (e.g., Ras G12V ). In addition, other factors comprising the ectopic or expression of pro-proliferative metabolites are introduced. Page 39  Atty. Dkt. No.166118.01354.T002660 In one embodiment, controlling signaling cascades without ectopic growth factor expression, for example, by using a constitutively active receptor for a growth factor. For instance, a mutation in the FGF receptor is known to lead to a “permanently on” status, which would lead to permanent signaling. This mutation is involved in Crouzon syndrome, and the associated mutation could induce FGF signal transduction in bovine muscle cells to achieve similar outcomes desired by the present invention. In one embodiment, Crispr/Cas9 can be used to provide the mutation into a muscle cell. In another embodiment, a vector comprising the mutant FGFr is introduced into the cell. Other proteins that can be used to control signaling cascades include signal transduction proteins (signaling proteins) are constitutively active, or can be mutated to become constitutively active, such as Ras G12V . In certain embodiments, the disclosure relates to any of the following numbered paragraphs: 1. A modified non-human cell ectopically expressing one or more proteins that promote cell growth, wherein the one or more expressed proteins comprise growth factors, cytokines, receptors, or signaling proteins selected from Table 1. 2. The modified cell of paragraph 1, wherein the growth of these cells do not require exogenous supplementation with growth factors. 3. The modified non-human cell of paragraph 1 or paragraph 2, wherein the cell is capable of growing in media that contains no exogenous recombinant protein components. 4. The modified non-human cell of any one of the previous paragraphs, wherein the one or ectopically expressed proteins comprise one or more proteins selected from fibroblast growth factor-1 (FGF1), fibroblast growth factor-2 (FGF), a constitutively active ras protein, transforming growth factor (TGF), neuregulin (NRG), insulin, insulin-like growth factor (IGF), FGF-receptor (FGF-R), insulin, albumin, and combinations thereof. 5. The modified non-human cell of any one of the previous paragraphs, wherein the ectopically expressed proteins comprise (a) FGF-2; (b) transferrin; (c) insulin, insulin-like growth factor (IGF) or combination thereof; Page 40  Atty. Dkt. No.166118.01354.T002660 (d) recombinant albumin; (e) a constitutively active ras protein; or (f) combinations of (a)-(f). 6. The modified non-human cell of any one of the previous paragraphs, wherein the ectopically expressed proteins comprise FGF-2 and constitutively active ras protein. 7. The modified non-human cell of any one of the previous paragraphs, wherein the ectopically expressed protein comprises ras G12V . 8. The modified non-human cell of any one of the previous paragraphs, further comprising ectopically expressed FGF-2. 9. The modified non-human cell of any one of the previous paragraphs, wherein the one or more ectopically expressed proteins are expressed by one or more exogenous vectors in the cell. 10. The modified non-human cell of any one of the previous paragraphs, wherein the exogenous vector is one vector that can express two or more ectopically expressed proteins. 11. The modified non-human cell of any one of the previous paragraphs, wherein the vector comprises ribosomal skipping sites to express the two or more ectopically expressed proteins. 12. The modified non-human cell of any one of the previous paragraphs, wherein the one or more vector constitutively expresses the two or more ectopically expressed proteins. 13. The modified non-human cell of any one of the previous paragraphs, wherein the one or more vector is and inducible vector capable of inducing the cell to express the one or more ectopically expressed proteins when contacted with an induction factor. 14. The modified non-human cell of any one of the previous paragraphs, wherein the two or more ectopically expressed proteins are expressed by engineering via crispr/cas9 editing. 15. The modified non-human cell of any one of the previous paragraphs, wherein the cells comprise a muscle cell, a fat cell, or a connective tissue cell. 16. The modified non-human cell of any one of the previous paragraphs, wherein the cell comprise a bovine cell, a piscine cell, a porcine cell, or a galline cell. Page 41  Atty. Dkt. No.166118.01354.T002660 17. A composition comprising the modified non-human cells of any one of the previous paragraphs. 18. A meat product comprising a population of the cells of any one of paragraphs 1-17. 19. The meat product of paragraph 18, wherein the meat produce comprises a combination of two or more selected from muscle cells, stem cells, fat cells and connective tissue cells. 20. The meat product of paragraph 18 or paragraph 19, wherein the meat product is a three- dimensional meat product. 21. A method of producing a meat product in in vitro culture, the method comprising: culturing a population of the modified non-human cells of any one of paragraphs 1-16 in minimal culture medium for a sufficient time to increase the number of cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors. 22. The method of paragraph 21, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates or recombinant albumin. 23. The method of paragraph 21, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates. 24. The method of anyone of paragraphs 21-23, wherein the minimal media contains no exogenous recombinant protein components. 25. The method anyone of paragraphs 21-24, wherein the method comprises: culturing a combination of two or more modified cells selected from muscle cell, stem cells, fat cell, and connective tissue cell in a culture to produce a three-dimensional meat product suitable for human or animal consumption. 26. A method of producing a population of modified cells for making a food product, the method comprising: (a) ectopically expressing two or more proteins of Table 1 in cells; Page 42  Atty. Dkt. No.166118.01354.T002660 (b) culturing the cells of (a) in minimal medium for a sufficient time to promote growth of cells to a sufficient number to produce a food product; wherein the minimal media does not contain exogenous growth factors. 27. The method of paragraph 26, wherein the number of modified cells produced in step (b) is increase at least 20% or more, preferably 30% or more relative to culturing of non-modified non-human cells in the minimal medium. 28. The method of paragraph 26 or paragraph 27, wherein step (a) comprises expressing three or more ectopically expressed proteins. 29. The method of any one of paragraphs 26-28, wherein step (a) comprises expressing four or more ectopically expressed proteins. 30. The method of any one of paragraphs 26-29, wherein the two or more factors comprise two or more factors selected from fibroblast growth factor-1 (FGF1), fibroblast growth factor-2 (FGF), a constitutively active ras protein, transforming growth factor (TGF), neuregulin (NRG), insulin, insulin-like growth factor (IGF), FGF-receptor (FGF-R), insulin, albumin, and combinations thereof. 31. The method of any one of paragraphs 26-30, wherein the two or more factors comprise (a)FGF-2; (b) transferrin; (c) insulin, insulin-like growth factor (IGF) or combination thereof; (d) recombinant albumin; (e) a constitutively active ras protein; (f) combinations of (a)-(f). . 32. The method of any one of paragraphs 26-31, wherein the ectopically expressed protein comprise FGF-2 and constitutively active ras protein. 33. The method of any one of paragraphs 26-32, wherein step (a) further comprises introducing one or more exogenous vectors in the cell capable of expressing the two or more ectopically expressed proteins . Page 43  Atty. Dkt. No.166118.01354.T002660 34. The method of any one of paragraphs 26-33, wherein the one or more exogenous vectors is a single vector capable of expressing the two or more ectopically expressed proteins . 35. The method any one of paragraphs 26-34, wherein the vector comprises ribosomal skipping sights to express the two or more ectopically expressed proteins . 36. The method any one of paragraphs 26-35, wherein the one or more vector constitutively expresses the two or more factors. 37. The method any one of paragraphs 26-36, wherein the one or more vector is and inducible vector; and the method further comprises contacting the cell with an inducible factor, wherein contact with the inducible factor induces expression of the one or more ectopically expressed proteins within the cell. 38. The method any one of paragraphs 26-37, wherein step (a) comprises engineering the cell via crispr/cas9 editing to either express an endogenous factor or increase the expression of the factor within the cell. 39. The method of any one of paragraphs 26-38, wherein the cells is a muscle cell, a fat cell, a stem cell, or a connective tissue cell. 40. The method of any one of paragraphs 26-39, wherein the cells is a bovine cell, a piscine cell, a porcine cell, an insect cell or a galline cell. 41. The method of any one of paragraphs 26-40, wherein the cells are a combination of two or more cells selected from muscle cell, a fat cell, a stem cell, or a connective tissue cell. 42. The method of any one of paragraphs 26-41, wherein the method is large scale production of cells in bioreactors. 43. A population of cells made by the method of any one of paragraphs 26-42. 44. A food product comprising the population of cells of paragraph 43. 45. The food product of 44, wherein the food product is a three-dimensional tissue suitable for human or non-human animal consumption. 46. A method of producing a meat product in in vitro culture, the method comprising: Page 44  Atty. Dkt. No.166118.01354.T002660 co-culturing a population of target cells and a feeder cell population comprising the modified non-human cells of any one of paragraphs 1-16 in minimal culture medium for a sufficient time to increase the number of target cells, whereby the method produces a non-human animal tissue suitable for human and/or animal consumption and wherein the minimal media does not contain exogenous growth factors and wherein the target cell is not genetically modified. 47. The method of paragraph 46, wherein the target cells and the feeder cells are separated by a permeable or semi-permeable membrane, wherein the feeder cells secrete factors capable of crossing the membrane. 48. The method of paragraph 46 or 47, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates or recombinant albumin. 49. The method of paragraph 46 or paragraph 47, wherein the minimal culture medium consists of a combination of one or more of a carbon source, amino acids, salts, minerals, trace nutrients, and optionally crude plant hydrolysates, preferably wherein the minimal media contains no exogenous recombinant protein components. 50. The method of any one of paragraphs 46-49, wherein the method comprises: culturing a combination of two or more target cells selected from muscle cell, stem cells, fat cell, and connective tissue cell in a culture with the feeder cells to produce a meat product suitable for human or animal consumption. 51. The method of any one of paragraphs 46-50, wherein the target cells is a muscle cell, a fat cell, a stem cell, a connective tissue cell, or combinations thereof. 52. The method of any one of paragraphs 46-51, wherein the target cells is a bovine cell, a piscine cell, a porcine cell, an insect cell or a galline cell. 53. The method of any one of paragraphs 46-52, wherein the target cell and feeder cells are of the same species. 54. A food product comprising a population of the target cells produced by the method of any one of paragraphs 46-53. Page 45  Atty. Dkt. No.166118.01354.T002660 55. The food product of paragraph 54, wherein the food product is substantially free of feeder cells.     Page 46  0 6 0 2 0 8 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 9 0 5 0 3 1 1 4 2 0 3 6 3 2 4 8 4 4 5 0 6 6 6 0 7 6 2 1 8 1 4 2 0 3 6 3 2 4 8 4 4 5 0 6 4 6 6 0 1 6 1 1 . 0 6 6 2 0 0 T . 4 5 3 1 0 . 8 1 1 6 6 1. o N . t k D . y t t A u r q e D L P S V I V o s P f n s i e e S R E D L P R C F T L N E E S S L R R G I H Q R D E R T R S L E Q K I V Y R P R F A G S H D R T G V T L R L L P t o Y I T E E S L I F I S T F K V E R P K P I P S R S A S F P H G L E R S D F T A W P E E P S T S V N P V A P H T K K A P Q P W G L L T A E G E Q F K E G V I I L V A F c r P M C P A K Q N T H L L A E V Y T E R A Q S T H A Q A G n E M H E S V Q T T I Q E M P M L e u q e s s s e d c mu i s s s u i s r si r m n u n u o u r m o u a r h c i t u a r h c i t a o a s S g r t s c o o o e l t c o l r O B r i n s o o e r i n o O B O t c a f e 1 h t m 1 a n i w l n i l n i n i o n r n u i g u g l u l g e f t e r e r s u s o o r u e u e n I n I t P N N s i L . 2 D : e I l O 1 2 3 4 b Q a E N S T 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 4 0 0 4 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 5 0 0 0 7 1 1 2 3 3 4 4 5 0 6 6 6 0 7 6 2 1 8 1 4 2 0 3 6 3 2 4 8 4 4 5 0 6 6 6 1 7 6 2 1 8 1 4 2 0 3 6 3 2 4 6 4 6 2 1 8 1 0 2 K K K V V C V S A V V F A P Y G Y S H T F F E L Q I P R N L D V K N T E G R H F F E S A A C V K V N P A K E L H N T N S P K I T L C G W A R E V Y T V R L E G P G D D A L L T C V L A G D L A V E A N C N S A L I L A A K R I V C A D F P M R H S M T D K D E K E A A Y E T V E I P T S W A I G K S M G E V L Y P T M S N G s s u i s r ms s i s u o u u a r t h c r m i o u c t u a r t h c i c t s o o o B e l s o l r i n o o e r i n O B O n ir n r ir e r f e s f n s 1 a n F 1 F rt a o rt G F G F r o e r S e S 5 6 7 8 0 8 5 8 0 6 0 2 0 8 0 4 0 0 0 6 0 9 0 6 0 2 0 8 0 4 0 0 0 6 5 0 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 9 9 0 6 0 0 0 0 0 0 2 7 7 1 1 2 3 3 3 1 1 2 3 3 4 1 1 2 3 3 4 4 4 2 1 8 1 4 2 0 3 6 3 2 4 5 4 C P S Y P E L P Q S L D L Y E E N T T L T L I R D L D E V L Q K F T P R Q S P V A H W C D R M M M Y L E N T C N A R P P K D D P Y s s u i s s u s r m u o u a r c r u r i u a u t h s c t t a t o o o l i s s B e r n o B o O B 1 b 1 1 3 F b R b G F F F T G T G T G T 2 1 3 1 4 1 5 1 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 4 0 0 0 6 0 2 6 6 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 4 0 0 0 0 7 1 1 2 3 3 4 4 5 6 6 7 7 8 9 9 0 0 1 1 2 3 3 4 4 5 6 6 7 7 8 0 9 6 9 2 0 8 0 0 1 I P F T P E V W D G P F L D N P E V Q Y I G H Y C I T R L S T F F E P A T T H D E L T A V F V T M R E S D Y L F K C P T Y L L Y L G P T V H S S S A S T P A I S D M G V A T T I P T A S S I L F L L C G N M C P H D T E M Q F F T L Q S E Y S K V D s i m o s s r u u h c r i u c t a o o t e l s r i n o O B a R b F R G F D G P D P 5 2 6 2 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 8 4 4 0 6 1 7 6 2 1 8 1 4 2 0 6 2 4 8 4 4 0 6 2 7 8 7 4 0 6 2 8 4 1 0 2 6 2 2 3 8 3 8 3 S C S A Q K G A T C G K V S I L C S E R L V R Y S D K K T K L E H Y S L S Q Y D S N H M V N M Q L Q Q S I Q S V D G P T K S Q N Y R D D Q F L S A L N W R Q C R G K E R N K S H V D V Y F V V F A F G R F C V T L F K P Y L I R W K N G R F H D L M D N I R C S V D P G W C V A K Y I D V T G R L E T V A T T D L H C R T I S V A K K K R E L H T P D M R Y P G V C Y P A G L M H L L E L S F H W K T S F E H F V L L I Q C S N F S L V F T F H W D D s i m o s s u r u r h c i u c t a o o t e l r i n s o O B F R G F H G H 0 3 1 3 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 0 0 0 0 0 0 0 0 0 8 0 0 2 0 6 1 1 2 4 4 7 7 4 0 6 2 8 4 1 0 2 6 2 2 7 6 2 1 4 1 6 1 1 Y I G V K G D D Y L I I N V E M A N V L Q I A P I F N E H A N T D F V S R P G S L E S Y S T T V G S N L L N K L Q G F K C T D T E E S N S A R R D L C P Q G G T H Q V Y S E S S L L R K V P T a I R H I F I N F M W Y L A T C L K K P V S V H S T E V T E L S M G L M T V L K E P A L R E P F S E V E D V L S R K A R L N V W N R C G D F L Q P P E D K R D N G L S T L P C S N G S V K N I L R S T S A S A F T V T T E K P L E R H E K N G I E N L T N L A V G Q V Q Q T R G P L T D K D T L C L D V T H V Q L N V G C L C F A G Q L A M I L A G N V F F S G T K L F F V P T C A V F I K V N E Q F A G S T P S L Y S Y L C I A Y D F Y G A Q T Q P I N Y F T H G V V L H R R E D T G L A D D R H Y V T V E L K A L I R A S Q I V Y S R I V T V S D G D V T R I Q S I S P V D I N G E T N G F A K Y L C N G V R R C Q L C V V S V D E Q L I H H V L S E D K D I D L L R R N P R V E E G A L V A C S N S L Y R R V A L R H I W G M S P D L A L V E K P K R Y F V C T A L V N G Y E Y R S Y N C A V A M M Y I T P N K A M V A I F V D S N Y H E D Y E V P A R E M V L V N R N T V E K F Y P M V K L C N R V E I P S S Q I s i m o s s r u u s u h c r r i c t u a u o o t a t e l r i n s o s o O B B R F F R G G F H E G E 2 3 3 3 4 3 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 0 0 4 0 0 0 0 0 0 0 0 0 0 5 0 0 0 8 0 0 0 0 1 1 2 3 3 4 8 4 4 5 0 6 3 6 6 2 1 8 1 4 2 0 3 6 3 2 4 8 4 4 5 0 6 3 6 6 2 1 8 1 0 2 6 2 1 8 1 2 2 E P P S T R W C V K S T T F Y K S P S N N G F S Y S C N S T N E E L G V A P S V Y L Y I D Q P L C S E Q K S W A E R Q I V L D F R A R P I T Y A F E M S Q G V S S F G A P D S S Q F S L G S A H V N A A G I H N K N P P H P I P D R S N S A K H L P I N L S H L L L T D T G G L E M Q L L L S S N T I S E L A L L S S D E E E L V S K I C T E Q I S E S I L W N Y P D K N D A T N L N R Y T S E D P Q S R T E I H P P F K L L F F S S L H S E F P E Q S E A S N F Q P L S E K Y P A S R M Y D I I H L A K R Y Y L C T L T D H N V V N S H Y L I K A Q S L I I I Q V E G T T A L K N E E H W F K I L G D N K Q Q A H P L V P S F S T E E G G T A E Q F S Y A F Y K L L T I W L K S D Y A L L G I N Y E T V K K L L D L A S G P H R I I N I E E K D E C G V I L L F L G A P N V Q L K S I M C P S N K D Q Y K V S P Q A V R M L Y M E K L C D A Q M S Q R I L Q T S P P M V E W M S H K H Y s s u i s i r ms s u r ms u o a r u c u o u c t h i t a r h i t s c o o o e l t i n s c o o o e l i B r B r n O O R R H H 6 - 6 G G L - I L I 9 3 0 4 1 4 2 4 0 6 0 2 0 8 0 4 0 0 0 6 0 2 4 6 0 6 0 2 0 8 0 4 0 0 0 6 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 1 2 3 3 4 4 1 1 2 3 3 2 4 8 4 4 5 0 6 6 6 2 7 8 7 4 8 9 8 6 2 1 8 1 4 2 0 3 W H S V I T Q A P N K D E E P P P G V D F G G V P V C L T R L V T S V G N A A P H G P D V E S R Y F T L C V S D Y S N G F A S V E D L S A L P Q C V G S K Q L L V L L L A R T R G G S V G P G T R L D A T E H Y S K I T a A A S A R S L S V D V S G E P W P H E K P A P W S Y E T E W N I H V H P R K W Y Q K L K S C W E S G D G S S S R C F G A R R T S L R E N R T G L A K A F D G E A N R T G C L G C A L W F S L I L R P H S D P G A N L A H N V E P A S V Y I C F N I S C N I T Q P A K K A I T N P E E F I L V G R E W C T A H R C T L H S V R C L F Q T G L S P S C L H E S L M S K I S G T S I S S E A P A F L L G S S L T G V H K N D V T W N N N F A G N E Y C A K Q P L Y Q Q Q Q P Q A A N V P V A T L L R V G P L P K T N Y R V R G I P N C M P V Y E A P V I P T W K P E A P P F S R Q S Y Y P V S A I K S M V K C R I S N Q W P D W I F N D K L S M E R P S A T I D T L V D K F Y S L I A E E N L R R I N G D D L A R Q S S W F L S S P V S K S L A T P V G L M L V I C S D N W E S A P P V V M C K R Y P G T V P Q G T N A S T R V E S G L Y N K K T I L V P P L N P Q N P F V P M F L S P N S P R S L V s s u i r ms s u u o u c r a r t h i u s c t a t o o o B e l s r i n o O B R 6 R - 6 - F I L I L I L 3 4 4 4 5 4 0 6 0 2 0 8 0 4 0 0 0 6 0 0 0 0 0 0 0 0 0 0 1 0 0 0 4 0 0 0 0 7 0 0 0 0 0 0 3 0 0 5 1 1 2 3 3 2 4 8 4 4 5 0 6 6 6 2 7 8 7 4 8 0 9 6 9 9 9 6 2 1 8 1 3 2 6 2 1 8 1 4 2 4 2 6 2 1 8 1 9 1 6 2 1 5 1 6 2 1 5 1 L W G S A I R S S L R E I Q K T V G S L F W N S F P T S C L E T L V P Q N Q V P S T F V T W L T G W T Q D H A L H G T S H V K S T N S V F T W P F L S V V I T W E L Y F L W V V T F E G N S F S E I T L R K L I L T I P L T D L F S T L T H A A G M G G s i m s s i o s u ms s u s u s u r u c r o u c r r r h i u c t a r o o t h i u c t a u t a u t a t e l s o o l s s s r i n o e i n o o o O B r O B B B F a F a F R F 2 I N F G G F L T N T E V E G V F 6 4 7 4 8 4 9 4 0 5 1 5 0 6 0 2 5 5 0 6 3 8 0 6 0 2 0 8 0 4 0 0 0 6 0 2 0 8 9 9 0 6 0 2 0 8 1 0 8 0 0 6 0 0 0 0 0 0 0 0 6 4 1 1 1 1 2 4 4 4 1 1 2 2 6 1 1 6 2 1 4 1 6 2 1 8 1 4 2 0 6 2 4 8 4 8 4 2 I H Y P K D R N S K R E Y R T I N G Y N D V N G S G E D L S R K E I L R F L Y C F F E G D G T N A K R C R Y A L G R F L K P R D G K D R F F N N G M P A P L F Y R G S N S A G C G I D G E K P I T V A V E P L G T V T S I T G A G Q T L A Q M L K s i s m i s s o s c s u u c s u i s s u c r u i h c t i e r m u o r i b r m u o u c r i t e c t o o h t a t h c m a a r t h i u c t a t h t e l r i n n y s o s s o o l s n S o B e r s o o e r i n o y S O O m B O B r o h t t 3 2 R 1 1 p ) F w o F L G _ R 1 b R e b c R R e r D E F r g ) r G o o t F - F F I I ( F G P n G I T G T L G r M a c a T o h f f c e A m ( 2 5 3 5 4 5 5 5 6 5 7 5 8 5 9 5 0 6 0 2 0 8 0 4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 0 0 0 0 0 0 7 0 0 2 1 1 2 0 3 6 3 9 3 6 2 1 8 1 4 2 0 3 6 3 8 3 6 2 1 8 1 4 2 0 3 6 3 1 4 6 2 1 8 1 4 2 0 3 6 3 0 4 6 2 1 4 1 A L I R K L N K G S Y L E I V Q M G L V R I R A T E V I E R K K A R Y K Y V D A L E E M P D E I P T E K T C E T A S S E L G G A A V V P R R D G R P T T S L N Y M L L L A W L L I L A P E F L P L F L L P G P L P L P S V H S P A T A K W Y Y M L L S S I S L P L Y Y Q E F A S I I R V K R A C Y T N F L S V W R V K R S I H G V R D S L L G V I L N W Q G V S V F S E A Y C I F S A E C Y T N V G E F L L G S L D L I L L F K Q T K L E A G Q K Y D L A L V D Y D L A Y R N R S S M R N G R D K P L F W N S D N P H V P P I E D S L R P I E T L R P V P P K S R R P L A P M S K L L K K H Q C P R Y E L L Y S N Y E D G C T A P P D L G F E K I I T Q I R G Y H V E Y F R Q S A V V V F R S L L E Y V M S Y Y S D L M E V N L W V M E T T K N R K R S N M E E P T Q T N N A R V K D I E P P S s s u i s s s i s s r m u o a r u u c r m u o r u u c r u t h i s c t o a h i t a o o l t c o l t B e r i n s o o e r i s n o O B O B 1 b 1 b 2 2 F b b F G F F F G T G T G T G T E 0 6 1 6 2 6 3 6 8 6 0 6 0 2 0 8 9 9 0 6 0 2 0 8 8 1 2 1 1 1 1 1 3 2 2 2 e D c P G L G F G L D S F N S N V n V L E A T I K M e u q T H A P M V A T Q H G D R K D . e s S R n T R o A P A G R E E D R G Q A K i P G I E A E V G Y T E G I Y N P ti s Y o D E A A E R V E P V N D p A F F V V G S F M A H K S S L m A A P K S N V o A A G L H K F S c d L A E V G F N Q n T V V A N V F Y T a R S S D D H E L S L P P G 4 s V d A E P G L A G D R K K H Y G P 6 e o R h P T G G L M G H N P N N E g t V T D W K V G P Q K E R V H L D L I D P E E E V a P e D A H P N L V D m d R V D T M I P Y R G D L V D G G A e T s A A A P S C W V V S F E K P G C T Q K o l L c R G V T G C F D L L V D D G V R P T F Q V D I G L L s i d T e P A K V T W A G L G G I P S G S F L E P E E Y T K L T N R G N T h t Y E V K F W V E G K L T E Q E A n T G A V I Q G G i M I P D S M T V R N Y H S G S G e s u r s t e n i o e f n e s n c t t o e n a o t r p e e n p m s e a i s t n ) d i t d i t n m o o c n e n r e c s P F p e p e p l a i e n t i c e r p p o G ( A m n o o i o y u c t r P m l f 2 A T 2 P l i a d o r d u n e n A P e r o i G ti d d : 3 O A. 3 e N l 4 5 6 7 e l b D a I 6 6 6 6 b T Q a E T S Atty. Dkt. No.166118.01354.T002660 Table 4. List of genes that have been ectopically expressed to induce adipogenesis in various adipogenic precursor cells. Adipogenic Gene Species Cell Types Peroxisome proliferator-activated receptor Human (SEQ ID NO:75), PSCs/MSCs, Myoblasts, EXAMPLES Example 1- Generating “self-sufficient” cells for low-cost production of cell-cultured foods The disclosed technology exploits genetic strategies to generate “self-sufficient” cell lines that endogenously produce all of the requisite signaling molecules for growth in low cost, chemically defined cell culture media. Specifically, ectopic expression of growth factors (e.g., fibroblast growth factor (FGF), transforming growth factor (TGF), neuregulin (NRG), Insulin-like growth factor (IGF), etc.), growth factor receptors (FGF receptors, TGF receptors, NRG receptors, IGF receptors, etc.) and signaling/nutrient transport proteins (e.g., insulin, transferrin, etc.) Page 65  Atty. Dkt. No.166118.01354.T002660 ameliorate the need for the exogenous inclusion of these proteins in cell culture media. As growth factors and signaling proteins contribute over 95% of the cost of standard cell culture media, this invention could drastically lower the cost of production of cultured meats. In this work, stem cell lines from food-relevant tissues (e.g., muscle, fat, liver, connective tissue) of relevant animal species (e.g., bovine, porcine, piscine, galline) are engineered to express factors comprising the aforementioned genes, constitutively, or under controllable promoter systems. Options for genetic engineering include insertion of cassettes containing these genes, e.g., through CRISPR/Cas9, transposon-mediated, or recombinase-mediated genetic insertion, or by activating the expression of the endogenous genes in cells. In the preliminary work, transposon- mediated insertion of FGF2, TGF-beta3, and NRG1 and their corresponding receptors are demonstrated. However, more directed engineering strategies such as CRISPR/Cas9 also be utilized along with additional proteins, including insulin and transferrin. A full list of relevant potential genes is included in Table 1. Cultured meat—or meat produced through cell culture and tissue engineering—offers the potential to drastically alter our world’s meat production system by addressing the environmental, ethical, and health concerns associated with modern animal agriculture. The high costs of current cell culture media are prohibitive to this effort. Therefore, bringing down the costs of this media is a key hurdle facing cultured meat’s development and reaching price parity with conventional meats. The proposed approach offers a promising option, as it completely eliminates the need for the most expensive components of cell culture media, thereby drastically lowering costs. Endogenous growth factors and signaling molecules have been produced in CHO cells and 3T3 fibroblasts to abrogate the need for these components in cell culture media (DOI: 10.1007/BF00353933; PMID_1325181; Patent #US6797515B2). Specifically, these cells were engineered to express insulin or IGF, IGFR, and transferrin. While this has been demonstrated for these proteins and in CHO and 3T3 cells for pharmaceutical applications, the use in food production is novel. Additionally, the growth factors that are most relevant for food-relevant stem cells (e.g., FGF, TGF) are not mentioned or explored in these past examples. Figure 1 shows a genetic construct that has been generated and transfected into bovine muscle stem cells. Figure 2 shows GFP expression in bovine satellite cells that have been transfected with the construct in shown in Figure 1 as well as the same construct with a TetOn inducible promoter system instead of a constitutive CMV promoter. These constructs were Page 66  Atty. Dkt. No.166118.01354.T002660 produced and inserted into the genome of bovine satellite cells through Sleeping beauty transposon-mediated transgenesis. In addition, the inventors expect that adding growth factor receptor overexpression, will improve the efficacy of endogenously produced growth factors. Growth of engineered cells: Engineered bovine satellite cells (shown in Fig. 2) were cultured in a B8-based media without growth factors FGF-2, NRG1, or TGFb3 (called “B5”; Fig 3) 1 . Over four days, cells expressing growth factor genes (i.e., Tet-inducible construct with doxycycline & constitutive CMV construct) showed increased growth compared with cells not expressing growth factor genes (Tet-inducible construct without doxycycline). This is particularly true for constitutive expression, which potentially correlates with the increased expression levels apparent in figure 2 (as shown by increased GFP expression & green fluorescence compared with inducible expression). These results suggest that ectopic expression of growth factor genes improves growth in growth-factor-free media by overcoming cellular requirements for exogenous medium factors, and that higher levels of expression may improve outcomes. Current efforts (as before) are exploring combining growth factor expression with growth factor receptor expression in order to amplify signaling pathways and improve outcomes. After the data in Figure 3 was gathered, B8 media was optimized for bovine satellite cell growth by the addition of recombinant albumin 2 . This media has been termed “Beefy-9.” Since Beefy-9 showed significantly improved bovine satellite cell growth compared to B8, growth- factor-producing cells were cultured in Beefy-9 minus all three growth factors (Figure 4). Results indicate that ectopic growth factor expression significantly improves cell growth over four days. FGF-2 and FGFR1 co-expression: To explore how co-expression of relevant growth factors and growth factor receptors can improve upon results in Figure 3, we have built additional constructs which contain FGF-2 and its associated receptor, FGFR1, along with a linked GFP (Figure 5). This system is designed to amplify FGF signal transduction. Cells capable of growth in fully protein-free-medium: The ultimate extension of the above-described work is to generate cells which are capable of growing in medium that contains no recombinant protein components. These cells would need to ectopically express, for instance: FGF-2 with or without FGFR1; insulin or insulin-like growth factor (IGF) with or without the insulin / IGF receptor; Transferrin; Albumin (unless albumin were replaced in the media with something such as plant hydrolysates 3 ); and potentially NRG and TGF with or without respective receptors (though it may be the case that these growth factors are less necessary to the media and Page 67  Atty. Dkt. No.166118.01354.T002660 so could be removed without ectopically expressing them in cells. Ultimately, these cells would be capable of growing in a highly minimal media consisting only of a carbon source (e.g., glucose), amino acids, salts, minerals, trace nutrients (e.g., vitamins), and potentially crude plant hydrolysates (e.g., to replace albumin if not endogenously produced) which would significantly lower the cost of culture media and the resulting price of cultured meat products. We have generated one such construct and demonstrated successful expression in bovine satellite cells (Figure 6B). Current efforts are focused on exploring the efficacy of these constructs using similar experiments to those in Figure 4. Additional considerations and applications: The above work uses the Sleeping Beauty transposition system; however, other options include CRISPR/Cas systems, TALENS, ZFNs, viral delivery (e.g., lentivirus), other transposons (e.g., Piggy Bac), gene plasmids, or transient tools (e.g., mRNAs, siRNAs, small molecules, etc.) which are well known in the art. References: 1. Kuo, H., Gao, X., Dekeyser, J., Fetterman, K. A., Pinheiro, E. A., Weddle, C. J., Orman, M. V, Romero-tejeda, M., Jouni, M., Blancard, M., Magdy, T., Epting, C., George, A. L. & Burridge, P. W. Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture. Stem Cell Reports 14, 256–270 (2019). 2. Stout, A. J., Mirliani, A. B., White, E. C., Yuen, J. S. K. & Kaplan, D. L. Simple and effective serum-free medium for sustained expansion of bovine satellite cells for cell cultured meat. bioRxiv 2021.05.28.446057 (2021). doi:10.1101/2021.05.28.446057 3. George, F., Kerschen, D., Van Nuffel, A., Rees, J. F. & Donnay, I. Plant protein hydrolysates (plant peptones) as substitutes for animal proteins in embryo culture medium. Reprod. Fertil. Dev.21, 587–598 (2009). 4. Das, M., Rumsey, J. W., Bhargava, N., Gregory, C., Riedel, L., Kang, J. F., Hickman, J. J., Reidel, L., Kang, J. F. & Hickman, J. J. Developing a novel serum-free cell culture model of skeletal muscle differentiation by systematically studying the role of different growth factors in myotube formation. In Vitro Cell. Dev. Biol. Anim.45, 378–387 (2009). Page 68  Atty. Dkt. No.166118.01354.T002660 Example 2: Ectopic FGF-Ras signaling ameliorates exogenous fibroblast growth factor requirements for bovine satellite cells in vitro Following the replacement of recombinant albumin, the clearly dominant cost contributor in Beefy-R serum-free medium is recombinant fibroblast growth factor 2 (FGF- 2), also known as basic FGF or bFGF. Specifically, FGF-2 is responsible for 64% of the cost of Beefy-R, which is nearly four times more than the next most expensive component (insulin), and nearly nine times more than the next most expensive component (transferrin). As such, lowering the cost-burden of this component is a clear priority for achieving affordable, scalable cultured meat. One particularly attractive option for this is to eliminate the need for exogenous FGF-2 entirely. FGF-2 is one of 22 fibroblast growth factors which are involved in tissue development and regeneration, and it acts by binding cell surface FGF receptors (FGFRs, primarily FGFR- 1 in the case of FGF-2) and activating key mitogenic pathways 1 . These include the PI3k/Akt pathway (comprised of Phosphoinositide 3-kinase and protein kinase B), the Ras/Raf/MEK/ERK pathway (comprised of rat sarcoma virus protein, rapidly accelerated fibrosarcoma protein, mitogen activated protein kinase, and extracellular-signal-regulated kinase), and JNK (Jun N-terminal kinase) 2,3 In muscle cells, the activation of these and other signaling cascades through FGF signaling maintains a growth phenotype and inhibits cell fusion 4 . Without FGF-2, muscle cell growth rapidly decays, and an aberrant cell phenotype is observed 5 . As such, it is typically considered a necessary growth media component for culturing muscle satellite cells. However, engineering cells for autocrine signaling (or cellular "self-signaling") is another potential method for achieving the cellular effects of exogenous growth factors. For instance, genetic overexpression of insulin-like growth-factor I (IGF-1) and its associated receptor have previously been demonstrated to overcome IGF-1 requirements in Chinese hamster ovary (CHO) cells 6 . Similarly, overexpression of transforming growth factor alpha (TGF-a) has been shown to overcome epidermal growth factor (EGF) requirements in colon cancer cells in vitro 7 . In this study, the potential for engineered autocrine signaling to overcome FGF-2 requirements in serum-free culture of immortalized bovine satellite cells (iBSCs) was explored, informed by three previously published observations. The first was that MMI 4 Page 69  Atty. Dkt. No.166118.01354.T002660 mouse myoblasts naturally express some level of FGF-2 but are still fully dependent on the exogenous factor for proliferation 4,8 The second was that, in these cells, overexpression of additional FGF-2 can partially, but not completely, recover the pro-proliferative effects of exogenous FGF-2 9 . Finally, it was observed that overexpression of a mutated form of Ras (Ras G12V ) can amplify the effects of native FGF-2 in MMI 4 cells to recover the proliferative effects of a relatively low level of exogenous FGF-2 in vitro, but is not itself sufficient to induce proliferation 10,11 . Here, it was suggested that Ras G12V "activates" the native endogenously expressed FGF-2, along with offering its own pro-proliferative effect. Together, these observations suggested that engineered overexpression ofFGF-2 and/or Ras G12V in bovine satellite cells (BSCs) might fully recover the effects of exogenous fibroblast growth factor in culture, allowing for the complete elimination of this component from the culture medium. Throughout the course of the study, previously immortalized bovine satellite cells were engineered via Sleeping Beauty transposon-mediated integration to express either luciferase (as a negative control), FGF-2 alone, Ras G12V alone, or both FGF-2 and Ras G12V under the control of a Tet-on promoter system. Growth studies showed that control cells were unable to proliferate without exogenous FGF-2, and that, while FGF-2 and Ras G12V showed some growth potential in the absence of exogenous factor, the combination of both genes offered substantially improved growth. Specifically, co-expression of both FGF-2 and Ras G12V was able to fully recover proliferation compared with control cells cultured in the presence of 40 ng/mL FGF-2. An overview of this approach and proposed mechanism is given in Figure 8A-B. This genetic engineering, in combination with low-cost rapeseed protein isolate (RPI) albumin alternatives can dramatically lower the cost of serum-free medium for cultured meat, thereby accelerating the path to adoption. Results Overexpression of FGF-2 and RasG12V recovers iBSC growth in the absence of exogenous FGF. Immortalized bovine satellite cells (iBSCs) engineered with the constructs shown in Figures 8A-B were transferred to serum-free Beefy-9 medium with or without 40 ng/mL of recombinant FGF-2 (rFGF), and transgene expression was induced by treatment with doxycycline. Page 70  Atty. Dkt. No.166118.01354.T002660 Cell growth was analyzed over fourteen days (Figures 9A-9B). Results showed that, in the presence of exogenous rFGF, all cells maintained a growth phenotype (Figure 11). In the absence of exogenous rFGF, luciferase-expressing control cells quickly ceased proliferating. In contrast, FGF-2 alone and RasG12V alone each significantly increased growth compared with negative controls, though not to the degree of luciferase-expressing control cells plus rFGF (Figure 9A). However, when both FGF-2 and Ras G12V were expressed, cells grew at a comparable rate to positive controls (6.2 vs 6.6 cumulative doublings, respectively, no significant difference). Partway through this experiment, a portion of cells expressing both FGF-2 and Ras G12V were also transferred to Beefy- R medium without rFGF, where recombinant albumin was replaced with rapeseed protein isolate. These cells maintained robust growth, indicating that autocrine FGF signaling can be combined with low-cost albumin alternatives to reduce the total media cost by >75% compared with the original Beefy-9 formulation. Comparing the data as doubling times (Figure 9B) offers another frame for understanding these data. Specifically, the average doubling time over three passages for cells expressing FGF-2 and Ras G12V was 60.6 hours, in contrast with 58.7 hours for positive controls (with exogenous rFGF), 71.7 hours for FGF-2 only cells, and 73.7 hours for Ras G12V only cells. These results reveal the synergistic value of co-expressing both FGF-2 and RasG12V to overcome exogenous rFGF requirements, where neither of these factors is sufficient on their own to enable robust growth without rFGF, together they can completely recover the exogenous factor’s efficacy. For the single passage of FGF-2/Ras G12V cells grown in Beefy-R medium, the doubling time was 32.9 hours, which could suggest additional benefits of combining rapeseed protein isolates with autocrine signaling, though further studies are needed to understand this over multiple passages. Discussion As discussed previously, lowering the cost of serum-free cell culture media is paramount for producing cultured meat at a scale and price point that will enable market success and consumer adoption. Here, the largest cost contributors of most serum-free media formulations are recombinant proteins. We have previously established Beefy-9 as a serum-free medium which is effective for bovine satellite cells (BSCs), but which is dependent on pricey recombinant factors, most notably albumin and FGF-2 (rFGF). We also previously demonstrated that recombinant albumin can be replaced by low-cost rapeseed protein isolates to generate Beefy-R, a similarly effective serum-free medium with substantially reduced cost. Here, we further reduce media cost Page 71  Atty. Dkt. No.166118.01354.T002660 by engineering cells for autocrine FGF signaling through inducible Tet-on expression of FGF-2 and a mutated form of the Ras protein (Ras G12V ). This cell line, which we designate BFRon1 (Bovine Fgf Ras on 1) is capable of consistent proliferation in the complete absence of exogenous rFGF, thereby effectively eliminating concerns around one of the biggest cost-drivers of cultured meat to-date. However, reduced growth rates for all engineered cells suggest that further optimization of expression systems is required. The cost of culturing BFRon1s in serum-free Beefy-R medium without exogenous FGF is shown in Figure 10 3 . Specifically, the cost of Beefy-R is $17.72 per liter when FGF-2 is removed (as is possible for BFRon1 cells). This is in comparison with $49.72 for Beefy-R plus FGF-2, $74.28 for Beefy-9 with both recombinant albumin and recombinant FGF-2, and $184.24 for growth medium containing 20% fetal bovine serum (FBS). As such, BFRon1 cells demonstrate the possibility for a ten-fold reduction in media costs compared with commonly used serum- containing media. After removal of FGF-2, the next most expensive components of this media are insulin ($8.28 USD per liter of media, or 46% of the remaining cost) and transferrin ($3.65 USD per liter of media, or 20% of the remaining cost). Preliminary results suggest that a substantial reduction in insulin (down to 3 ug/mL) may not significantly decrease cell growth (Figure 12), and so it is possible that further substantial price reductions can be achieved simply by tuning the remaining factors. Alternatively, genetic strategies for autocrine signaling can be explored here, as well. For instance, expression of IGF-1, its receptor, and transferrin by CHO cells has been demonstrated to enable long-term growth in media without these components 6 . Similar approaches would dramatically decrease the cost of Beefy-R medium and should be explored. Comparing growth rates of all cells, it can be seen that doubling is slower for both positive control and BFRon1 cells than for primary BSCs in Beefy-R medium (FIG.14), as well as for immortalized iBSCs in serum-containing medium (FIG. 13). While the latter can be explained by the absence of serum (since all serum-free media developed in this work still do not match 20% FBS for proliferation), the former is possibly due to transgenic burden on cells, or effects of treatment with doxycycline (1 ug/mL in this study) 15 . Because of this, and because of potential concerns around using doxycycline in food production, the described system should be optimized for high transgene efficiency and the use of food-safe induction systems. For instance, inducible promoters which rely on abscisic acid, a natural phytochemical found in many fruits and vegetables, have been described for mammalian systems 16,17 . Ultimately, this study builds on the Page 72  Atty. Dkt. No.166118.01354.T002660 prior development of Beefy-R and iBSCs to generate a cell line that is capable to growing in low- cost serum-free medium. This system leverages the expression of two proteins (FGF-2 and mutant Ras G12V ), which have been shown to work in concert to enable sufficient autocrine signaling for the removal of exogenous fibroblast growth factor from the medium. Together with low-cost rapeseed protein isolate albumin alternatives, BFRon1 cells can lower the cost of cell expansion, thereby bringing the field closer to large scale, sustainable, and affordable production of cultured meat. Materials and Methods Bovine satellite cell culture and routine maintenance Immortalized BSCs (iBSCs) used in this study were engineered and characterized previously. For routine cell maintenance, cells were cultured in 37°C with 5% CO2 on tissue- culture plastic coated with 0.25 ug/cm2 iMatrix recombinant laminin-511 (Iwai North America #N892021, San Carlos, CA, USA). BSC growth media (BSC-GM) was used, comprised of DMEM+Glutamax (ThermoFisher #10566024, Waltham, MA, USA), 20% fetal bovine serum (FBS; ThermoFisher #26140079), 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), 1% antibiotic-antimycotic (ThermoFisher #1540062), and 2.5 µg/mL puromycin (ThermoFisher #A1113803). For routine culture, cells were expanded to a maximum of 70% confluence, harvested using 0.25% trypsin-EDTA (ThermoFisher #25200056), counted using an NC-200 automated cell counter (Chemometec, Allerod, Denmark) and either seeded at a density of 2,000- 5,000 cells/cm2 on new tissue culture plastic with growth medium and laminin, or else frozen in FBS with 10% Dimethyl sulfoxide (DMSO, Sigma #D2650, St. Louis, MO, USA). For preliminary data in Figure 12, primary BSCs were used. These cells were maintained just as iBSCs, except for the exclusion of puromycin from the culture medium. Cloning and transfections The amino acid sequence for bovine FGF-2 was obtained from UniProt (accession number P03969). The gene sequence for this protein was optimized for expression in Bos taurus using codon optimization software (IDT, Coralville, IA), and a self-cleaving 2A peptide sequence was added to the end to facilitate bi-cistronic expression18. This fragment was ordered through ThermoFisher’s GeneArt gene synthesis service (Table 6). DNA for Ras G12V was obtained from Page 73  Atty. Dkt. No.166118.01354.T002660 the mEGFP-HRas G12V plasmid, which was a gift from Karel Svoboda (Addgene #18666)19. Finally, DNA for the neomycin resistance was obtained from the pCDNA3.1 vector (ThermoFisher #V79020). Genes were inserted into a Sleeping Beauty plasmid pSBtet-Pur, which was a gift from Eric Kowarz (Addgene #60507)20. Specifically, four new plasmids were generated: 1) pSBtet- Luciferase-NeoR, in which the puromycin resistance of pSBtet-Pur had been replaced with a neomycin resistance, 2) pSBtet-FGF-NeoR, in which the luciferase of pSBtet-Luciferase-NeoR had been replaced with FGF-2 (minus the 2A peptide), 3) pSBtet-Ras-NeoR, in which the luciferase of pSBtet-Luciferase-NeoR had been replaced with Ras G12V , and 4) pSBtet-FGF/Ras- NeoR, in which the Luciferase of pSBtet-Luciferase-NeoR had been replaced by FGF (plus the 2A peptide) followed by RasG12V. In these plasmids, genes of interest (e.g., FGF and/or Ras) were promoted under a Tet-on promoter system, while the Neomycin resistance was promoted by a synthetic RPBSA promoter which ran counter to the Tet-on promoter system. An ampicillin resistance and origin of replication were present for standard plasmid maintenance. All cloning was performed via gibson assemblies. This involved amplification with Q5 high-fidelity DNA polymerase (NEB #M0494S, Ipswich, MA, USA), DpnI digestion (NEB #R0176S), PCR cleanup (NEB #T1030S), assembly with the NEBuilder HiFi kit (NEB #E2621S), and heat-shock transformation into competent E. coli (NEB #C3019H), according to the suppliers’ instructions. Plasmids were purified with the GeneJet miniprep (ThermoFisher #K0503) and verified via Sanger sequencing (Genewiz, Cambridge, MA, USA). The transposase plasmid which was used for transposon integration was pCMV(CAT)T7-SB100, and was a gift from Zsuzsanna Izsvak (Addgene #34879)21. For transfecting iBSCs, cells were thawed and seeded at 25,000 cells/cm2 in 6-well plates with BSC-GM (minus puromycin) and iMatrix laminin-511. The next day, cells were transfected with Lipofectamine 3000 (ThermoFisher #L3000015) according to the manufacturer’s protocol. Briefly, 2.5 μg of each transposon plasmid was combined with 0.25 μg of pCMV(CAT)T7- SB100 and added to 250 uL of Opti-MEM medium (ThermoFisher #31985088) containing 7.5 uL of Lipofectamine 3000, and 5 uL of p3000. The DNA solution was incubated for 15 minutes at room temperature, during which time cells were rinsed 1X with DPBS and fed 2 mL of Opti- MEM. Next, the DNA solutions were added to the cells, and cells were incubated for six hours at 37°C before 2 mL of BSC-GM (minus puromycin) was added to wells containing Opti-MEM and Page 74  Atty. Dkt. No.166118.01354.T002660 lipofectamine mixture. Cells were incubated at 37°C overnight, after which media was replaced with BSC-GM supplemented with 2.5 μg/mL puromycin (ThermoFisher #A1113803) and 250 μg/mL G418 (a neomycin analog) (ThermoFisher #10131035). This joint treatment selected for cells which had integrated the new plasmid DNA (e.g., resistant to G418) but also maintained the immortalization transgenes (e.g., resistant to puromycin). Cells were selected for fourteen days before being expanded and cryopreserved. For routine culture, engineered cells were cultured in this puromycin and G418-supplemented media according to the same protocols mentioned above. Growth analysis of engineered cells with or without exogenous FGF-2 Multi-passage growth studies were then performed to further validate the utility of FGF-2 and Ras G12V expression in serum-free medium lacking recombinant FGF. Briefly, “B8 + FGF”, “B8 - FGF”, “Beefy-9 - FGF”, and “Beefy-9 – FGF” medium were prepared as previously described5,22. “Beefy-9 + FGF” had all components, “Beefy-9 – FGF” had all components except FGF-2, “B8 + FGF” had all components except recombinant albumin, and “B8 – FGF” had all components except FGF-2 and recombinant albumin. The formulations and sources of components can be found in Table 5. Table 5. Components of the various media used. Component  Concentration  Supplier  Catalog #    Page 75  Atty. Dkt. No.166118.01354.T002660 Antibiotic/Antimycotic  1% (v/v)  ThermoFisher  1540062  9 5 . Briefly, iBSCs (passage 2) were seeded into triplicate wells of 6-well plates (Corning #353046, Corning, NY, USA) in BSC-GM supplemented with 2.5 µg/mL puromycin, 250 µg/mL neomycin, and 0.25 ug/cm2 iMatrix laminin-511.f After allowing cells to adhere overnight, cells were washed 1x with DPBS and fed either Beefy-9 + FGF or Beefy-9 – FGF. Cells were fed these same media every two days. For passaging, cells were cultured to 70% confluency, rinsed 1x with DPBS, and dissociated with 500 µL of TrypLE Express (ThermoFisher #12604021). After incubating cells at 37°C for 12 minutes, plates were tapped to dislodge cells, and cells were collected with an additional 1.5 mL of B8 – FGF. Cells were then counted using an NC-3000 automated cell counter (Chemometec), centrifuged at 300 g for 5 minutes, resuspended in either B8 + FGF or B8 – FGF (depending on their previous media treatment), re-counted, and seeded onto new 6- well plates at 2,500 cells/cm2 with 1.5 µg/cm2 of truncated recombinant human vitronectin (Vtn- N; ThermoFisher #A14700). After allowing cells to adhere overnight, media was replaced with either Beefy-9 + FGF or Beefy-9 – FGF, as appropriate. This process was repeated over the course of the experiment. For the final passage, a portion of BFRon1 cells harvested from Beefy- 9 – FGF conditions were seeded onto to additional wells, and these cells were feed Beefy-R – FGF (e.g., in which albumin was replaced with 0.4 mg/mL rapeseed protein isolate) after overnight adhesion. Preliminary insulin-dilution short-term growth studies B8 medium was prepared as before, but without insulin, and short term primary BSC growth (4 days) was analyzed in media containing various concentrations of supplementary insulin (ThermoFisher #12585014). Briefly, BSCs were thawed (passage number < 2) and plated in BSC- GM on 96-well tissue-culture plastic plates at a density of 2,500 cells/cm2 with 0.25 ug/cm 2 iMatrix recombinant laminin-511. After 24 hours, BSC-GM was removed, cells were washed 1x with DPBS, and new media (B8 +/- insulin) was added. On day 3, media was removed, and plates were frozen at -80°C. Cell number was then analyzed using a FluoReporter dsDNA quantitation kit (ThermoFisher #F2962) according to the manufacturer’s protocol. Fluorescence was read on a Page 76  Atty. Dkt. No.166118.01354.T002660 Synergy H1 microplate reader (BioTek Instruments, Winooski, VT, USA) using excitation and emission filters centered at 360 and 490 nm, respectively. Table 6 Gene Sequences Used in Constructs* SEQ ID NO Protein Sequence 1 00 FGF-2 ATGGCGGCAGGTTCAATAACTACCCTGCCTGCTCTGCCTGAGGATGGCGGATCT C A C G A C G c G A C G T C A C G C fter Statistical analysis GraphPad Prism 9.0 software (San Diego, CA, USA) was used to perform all statistical tests. Specifically, for growth analysis, one-way ANOVA was performed along with a Tukey’s HSD post-hoc test between day 14 data all samples. For doubling time analysis, doublings were averaged across all passages and one-way ANOVA was performed along with a Tukey’s HSD post-hoc test between all samples. For short-term growth analysis, one-way ANOVA was performed along with a Tukey’s HSD post-hoc test between all samples. P values <0.05 were treated as statistically significant, and all errors are given as ± standard deviation. References 1. Itoh, N. & Ornitz, D. M. Evolution of the Fgf and Fgfr gene families. Trends in Genetics 20, 563–569 (2004). 2. Yablonka-Reuveni, Z., Danoviz, M. E., Phelps, M. & Stuelsatz, P. Myogenic-specific Page 77  Atty. Dkt. No.166118.01354.T002660 ablation of Fgfr1 impairs FGF2-mediated proliferation of satellite cells at the myofiber niche but does not abolish the capacity for muscle regeneration. Frontiers in Aging Neuroscience 7, (2015). 3. Xie, Y. et al. FGF/FGFR signaling in health and disease. Sig Transduct Target Ther 5, 1–38 (2020). 4. Clegg, C. H., Linkhart, T. A., Olwin, B. B. & Hauschka, S. D. Growth factor control of skeletal muscle differentiation: commitment to terminal differentiation occurs in G1 phase and is repressed by fibroblast growth factor. Journal of Cell Biology 105, 949–956 (1987). 5. Stout, A. J. et al. Simple and effective serum-free medium for sustained expansion of bovine satellite cells for cell cultured meat. Commun Biol 5, 1–13 (2022). 6. Pak, S. C. O., Hunt, S. M. N., Bridges, M. W., Sleigh, M. J. & Gray, P. P. Super-CHO— A cell line capable of autocrine growth under fully defined protein-free conditions. Cytotechnology 22, 139–146 (1996). 7. Ziober, B. L., Willson, J. K., Hymphrey, L. E., Childress-Fields, K. & Brattain, M. G. Autocrine transforming growth factor-alpha is associated with progression of transformed properties in human colon cancer cells. J Biol Chem 268, 691–698 (1993). 8. Kästner, S., Elias, M. C., Rivera, A. J. & Yablonka–Reuveni, Z. Gene Expression Patterns of the Fibroblast Growth Factors and Their Receptors During Myogenesis of Rat Satellite Cells. J Histochem Cytochem.48, 1079–1096 (2000). 9. Hannon, K., Kudla, A. J., McAvoy, M. J., Clase, K. L. & Olwin, B. B. Differentially Expressed Fibroblast Growth Factors Regulate Skeletal Muscle Development through Autocdne and Paracdne Mechanisms. The Journal of Cell Biology 132, 9 (1996). 10. Olson, E. N., Spizz, G. & Tainsky, M. A. The oncogenic forms of N-ras or H-ras prevent skeletal myoblast differentiation. Molecular and Cellular Biology 7, 2104–2111 (1987). 11. Fedorov, Y. V., Rosenthal, R. S. & Olwin, B. B. Oncogenic Ras-Induced Proliferation Requires Autocrine Fibroblast Growth Factor 2 Signaling in Skeletal Muscle Cells. Journal of Cell Biology 152, 1301–1306 (2001). 12. Steringer, J. P. et al. Key steps in unconventional secretion of fibroblast growth factor 2 reconstituted with purified components. eLife 6, e28985. 13. La Venuta, G., Zeitler, M., Steringer, J. P., Müller, H.-M. & Nickel, W. The Startling Properties of Fibroblast Growth Factor 2: How to Exit Mammalian Cells without a Signal Page 78  Atty. Dkt. No.166118.01354.T002660 Peptide at Hand. J Biol Chem 290, 27015–27020 (2015). 14. Cai, Z., Grobe, K. & Zhang, X. The Role of Heparan Sulfate Proteoglycans in Optic Disc and Stalk Morphogenesis. Dev Dyn 243, 1310–1316 (2014). 15. Ahler, E. et al. Doxycycline Alters Metabolism and Proliferation of Human Cell Lines. PLOS ONE 8, e64561 (2013).  16. Kallunki, T., Barisic, M., Jäättelä, M. & Liu, B. How to Choose the Right Inducible Gene Expression System for Mammalian Studies? Cells 8, 796 (2019). 17. Zocchi, E. et al. Abscisic Acid: A Novel Nutraceutical for Glycemic Control. Frontiers in Nutrition 4, (2017). 18. Szymczak, A. L. et al. Correction of multi-gene deficiency in vivo using a single ‘self- cleaving’ 2A peptide–based retroviral vector. Nature Biotechnology 22, 589–594 (2004). 19. Yasuda, R. et al. Supersensitive Ras activation in dendrites and spines revealed by two- photon fluorescence lifetime imaging. Nat Neurosci 9, 283–291 (2006). 20. Kowarz, E., Löscher, D. & Marschalek, R. Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines. Biotechnology Journal 10, 647–653 (2015). 21. Mátés, L. et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nature Genetics 41, 753–761 (2009). 22. Kuo, H.-H. et al. Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture. Stem Cell Reports 14, 256–270 (2020).   Page 79