ENDOCYTOSIS INHIBITORS AND THEIR USE FOR PAIN TREATMENT CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of Provisional U.S. Application No.63/329,120, filed April 8, 2022, the contents of which are incorporated by reference in their entireties for all purposes. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH [0002] This invention was made with government support under NS102722, DE026806, DK118971, and DE029951 awarded by National Institutes of Health, and W81XWH-18-1- 0431 and W81XWH-22-1-0239 awarded by the Department of Defense. The government has certain rights in the invention. FIELD OF THE INVENTION [0003] The application relates to methods for treating chronic pain involving administering to a subject in need thereof a therapeutically effective amount of an inhibitor of endocytosis. BACKGROUND [0004] Chronic pain is common, poorly understood and difficult to treat. The analgesic properties of µ-opioid agonists, a common treatment, dwindle with time and their usefulness is limited by respiratory depression, constipation and addiction ¹ . The inherent redundancy of pain signaling pathways, where multiple receptors and channels activate the same neurons ² , may limit the effectiveness of selective antagonists of pronociceptive mediators for the treatment of multi-modal forms of pain. SUMMARY OF THE INVENTION [0005] As specified in the Background section above, there is a great need in the art for effective treatment of multiple modalities of chronic pain. The present application addresses these and other needs. [0006] In one aspect, provided herein is a method for treating chronic pain in a subject in need thereof, said method comprising administering to the subject a therapeutically effective amount of an inhibitor of endocytosis. 1

[0007] In some embodiments, the inhibitor inhibits endocytosis of synaptic vesicles at terminals of primary sensory neurons. [0008] In some embodiments, inhibition of the endocytosis inhibits the release of one or more of a neurotransmitter(s). [0009] In some embodiments, the inhibitor inhibits endocytosis of synaptic vesicles at terminals of primary sensory neurons of the spinal cord. [0010] In some embodiments, the primary sensory neurons are nociceptors. [0011] In some embodiments, the neurotransmitter(s) is substance P, calcitonin gene-related peptide (CGRP), or glutamate, or a combination thereof. [0012] In some embodiments, the inhibitor is an inhibitor of dynamin (Dnm) 1, Dnm2, Dnm3, adaptor-associated protein kinase 1 (AAK1), clathrin, G-alpha interacting protein (GAIP) interacting protein C-terminus 1 (GIPC1), synaptojanin-1 (Synj1) and/or endophilin A1 (EndoA1). [0013] In some embodiments, the inhibitor is a small molecule, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense oligonucleotide, an antibody or antibody fragment, or a site-specific nuclease. [0014] In some embodiments, the inhibitor is a small molecule that inhibits Dnm1, Dnm2, and/or Dnm3. [0015] In some embodiments, the small molecule that inhibits Dnm1, Dnm2, and/or Dnm3 is Dyngo4a. [0016] In some embodiments, the inhibitor is a small molecule that inhibits clathrin. [0017] In some embodiments, the small molecule that inhibits clathrin is PitStop2. [0018] In some embodiments, the inhibitor is a small molecule that inhibits AAK1. [0019] In some embodiments, the small molecule that inhibits AAK1 is LP935509 or SGC- AAK1-1. [0020] In some embodiments, the small molecule inhibitor that inhibits Dnm1, Dnm2, Dnm3, clathrin and/or AAK1 may be used in any combination thereof. [0021] In some embodiments, the inhibitor is an siRNA that inhibits Dnm1. [0022] In some embodiments, the siRNA that inhibits Dnm1 comprises GCGUGUACCCUGAGCGUGU (SEQ ID NO: 1), UGGUAUUGCUCCUGCGACA (SEQ ID NO: 2), GGGAGGAGAUGGAGCGAAU (SEQ ID NO: 3), or GCUGAGACCGAUCGAGUCA (SEQ ID NO: 4), or a modified version, an ortholog, a variant, or a fragment thereof. 2

[0023] In some embodiments, the inhibitor is an siRNA that inhibits Dnm2. [0024] In some embodiments, the siRNA that inhibits Dnm2 comprises ACCAUGAGCUGCUGGCUUA (SEQ ID NO: 5), GAAGAGGGCCAUACCCAAU (SEQ ID NO: 6), AAAGUUCGGUGCUCGAGAA (SEQ ID NO: 7), or GGAGCCCGCAUCAAUCGUA (SEQ ID NO: 8), or a modified version, an ortholog, a variant, or a fragment thereof. [0025] In some embodiments, the inhibitor is an siRNA that inhibits Dnm3. [0026] In some embodiments, the siRNA that inhibits Dnm3 comprises CAACGAAGGCUGACGAUAA (SEQ ID NO: 9), GCUCAGAGUUCCUGCGAAA (SEQ ID NO: 10), GUGAAUGGAACUCGUAUAA (SEQ ID NO: 11), or GCAGAAACAGACCGCGUAA (SEQ ID NO: 12), or a modified version, an ortholog, a variant, or a fragment thereof. [0027] In some embodiments, the inhibitor is an siRNA that inhibits AAK1. [0028] In some embodiments, the siRNA that inhibits AAK1 comprises GAAGGUGGAUUCGCUCUUG (SEQ ID NO: 13), GGACUCAAAUCUCCUGACA (SEQ ID NO: 14), GCAGAUAUUUGGGCUCUAG (SEQ ID NO: 15), or AAAUGUGCCUUGAAACGUA (SEQ ID NO: 16), or a modified version, an ortholog, a variant, or a fragment thereof. [0029] In some embodiments, the inhibitor is an siRNA that inhibits Synaptojanin-1 (Synj1). [0030] In some embodiments, the siRNA that inhibits Synj1 comprises GGAAAGAGCUAUUAAAUCG (SEQ ID NO: 21), CCACUGAGUUUAUAUCAUU (SEQ ID NO: 22), CCAAAGUACUGGAUGCAUA (SEQ ID NO: 23), or GAAGAUAAAAUGUGGGUUA (SEQ ID NO: 24), or a modified version, or a fragment thereof. [0031] In some embodiments, the inhibitor is an siRNA that inhibits Endophilin A1 (EndoA1). [0032] In some embodiments, the siRNA that inhibits EndoA1 comprises GCUGGAAGGCCGACGCUUA (SEQ ID NO: 25), CUUCAGAGGUUUAGCGUGC (SEQ ID NO: 26), GAAGGUGGGAGGAGCGGAA (SEQ ID NO: 27), or GUAUAUACGUAGCCCGUUU (SEQ ID NO: 28), or a modified version, an ortholog, a variant, or a fragment thereof. [0033] In some embodiments, the inhibitor is an siRNA that inhibits G-alpha interacting protein (GAIP) interacting protein C-terminus 1 (GIPC1). 3 [0034] In some embodiments, the siRNA that inhibits GIPC1 comprises

GCAUCGAGGGCUUCACUAA (SEQ ID NO: 29), CGUCGGCCUUUGAGGAGAA (SEQ

ID NO: 30), GUGGAUGACUUGCUAGAGA (SEQ ID NO: 31), or

GCUGAGGCCUUCCGACUAC (SEQ ID NO: 32), or a modified version, an ortholog, a variant, or a fragment thereof.

[0035] In some embodiments, the inhibitor is an shRNA that inhibits Dnml .

[0036] In some embodiments, the shRNA that inhibits Dnml comprises

ACCACAGAAUAUGCCGAGUUCCUGCACUG (SEQ ID NO: 37),

CUUCAUAGGCUUUGCCAAUGCUCAGCAGA (SEQ ID NO: 38),

GUGUGGACAUGGUUAUCUCGGAGCUAAUC (SEQ ID NO: 39), or

GCUGAGAAUCUGUCCUGGUACAAGGAUGA (SEQ ID NO: 40), or a modified version, or a fragment thereof. In some embodiments, the shRNA that inhibits Dnml is encoded by

ACCACAGAATATGCCGAGTTCCTGCACTG (SEQ ID NO: 33),

CTTCATAGGCTTTGCCAATGCTCAGCAGA (SEQ ID NO: 34),

GTGTGGACATGGTTATCTCGGAGCTAATC (SEQ ID NO: 35), or

GCTGAGAATCTGTCCTGGTACAAGGATGA (SEQ ID NO: 36), or a modified version, an ortholog, a variant, or a fragment thereof.

[0037] In some embodiments, the inhibitor is an shRNA that inhibits AAK1.

[0038] In some embodiments, the shRNA that inhibits AAK1 comprises

UGUUGGCGGAAGGUGGAUUCGCUCUUGUC (SEQ ID NO: 45),

AGAGCCAGGUGGCGAUUUGUGACGGAAGC (SEQ ID NO: 46),

GGCACAGACGGAUUCUCAGUGAUGUAACC (SEQ ID NO: 47), or

GGCAGCACUUCUGAUGCUGUUAUUGACAA (SEQ ID NO: 48), or a modified version, an ortholog, a variant, or a fragment thereof. In some embodiments, the shRNA that inhibits AAK1 is encoded by TGTTGGCGGAAGGTGGATTCGCTCTTGTC (SEQ ID NO: 41), AGAGCCAGGTGGCGATTTGTGACGGAAGC (SEQ ID NO: 42),

GGCACAGACGGATTCTCAGTGATGTAACC (SEQ ID NO: 43), or GGCAGCACTTCTGATGCTGTTATTGACAA (SEQ ID NO: 44), or a modified version, an ortholog, a variant, or a fragment thereof.

[0039] In some embodiments, the siRNA that inhibits Dnml, Dnm2, Dnm3, Synjl, EndoAl, GIPC1 and/or AAK1 may be used in any combination thereof.

[0040] In some embodiments, the siRNA that inhibits Dnm1, Dnm2, Dnm3, Synj1, EndoA1, GIPC1 and/or AAK1 may be used in any combination with any of the small molecule inhibitors disclosed herein. [0041] In some embodiments, the shRNA that inhibits Dnm1 and/or AAK1 may be used in any combination thereof. [0042] In some embodiments, the shRNA that inhibits Dnm1 and/or AAK1 may be used in any combination with any of the small molecule inhibitors disclosed herein. [0043] In some embodiments, the siRNA that inhibits Dnm1, Dnm2, Dnm3, Synj1, EndoA1, GIPC1 and/or AAK1 may be used in any combination with the shRNA that inhibits Dnm1 and/or AAK1. [0044] In some embodiments, any of the endocytosis inhibitors disclosed herein may be used in any combination thereof. [0045] In some embodiments, the inhibitor of endocytosis does not cause motor deficits. [0046] In some embodiments, the chronic pain is inflammatory pain. [0047] In some embodiments, the inflammatory pain is inflammatory bowel disease, irritable bowel syndrome, pancreatitis, arthritis, postoperative pain, migraine, or cancer pain. [0048] In some embodiments, the chronic pain is neuropathic pain. [0049] In some embodiments, the neuropathic pain is neuropathic pain secondary to nerve injury and trauma, diabetic neuropathy, viral neuropathy (e.g. trigeminal neuralgia), chemotherapy-induced peripheral neuropathy, migraine, or cancer pain. [0050] In some embodiments, the cancer pain is associated with oral cancer or pancreatic cancer. [0051] In some embodiments, the inhibitor of endocytosis is administered locally to an area affected by the chronic pain. [0052] In some embodiments, the inhibitor of endocytosis is administered intrathecally, intranasally, intracolonically, intraluminally, intraintestinally, intracisternally, intraventricularly, intratumorally, or intraarticularly. [0053] In some embodiments, the subject is a mouse. [0054] In some embodiments, the subject is a human. BRIEF DESCRIPTION OF THE DRAWINGS [0055] Figs. 1A-1E show localization of Dnm messenger RNA (mRNA) in dorsal root ganglia (DRG) and spinal cord. (Figs.1A-1B) RNAScope® localization of Dnm1, Dnm2 and 5

Dnm3 mRNA in DRG (Fig. 1A) and dorsal horn of the spinal cord (Fig. 1B; SC) of mice. Arrows indicate mRNA expression within DRG and spinal cord neurons. Scale bar, 50 μm and in the detail box 20 μm. Representative images, n=5 mice per group. (Figs.1C-1D) Expression of Dnm1, Dnm2 and Dnm3 mRNA in the DRG (Fig. 1C) and spinal cord (Fig. 1D) of mice determined by quantitative reverse transcription (qRT-PCR), n=5 mice per group. (Fig. 1E) RNAScope® localization of Dnm1, Dnm2 and Dnm3 mRNA in human DRG. Arrows indicate mRNA expression within DRG. Scale bar, 50 μm. * Indicates fluorescent signal due to the presence of lipofuscin in human DRG neurons. [0056] Figs.2A-2E show Dnm knockdown and inflammatory pain. (Fig.2A) RNAScope® localization and (Fig.2B) quantification (number of dots per area) of Dnm1, Dnm2 and Dnm3 mRNA expression in mouse DRG at 2 d after intrathecal (i.t.) administration of Dnm1, Dnm2, Dnm3 or control (CTR) siRNA, n=4 mice per group. (Fig. 2C) Experimental timeline. (Figs. 2D-2E) Mechanical allodynia (Fig. 2D) and thermal hyperalgesia (Fig. 2E) induced by intraplantar Complete Freund's Adjuvant (CFA) measured 1 or 2 d after intrathecal Dnm1, Dnm2, Dnm3 or CTR siRNA, n=8 mice per group. Mean±SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs. CTR siRNA. Parametric unpaired two-tailed t test (Fig. 2B) or 2-way ANOVA, Sídák multiple comparisons test (Figs.2D-2E). [0057] Figs 3A-3E depict Dnm knockdown and neuropathic pain. (Fig. 3A) Experimental timeline. (Figs. 3B-3C) Mechanical and cold allodynia in spared nerve injury (SNI) mice measured 1-4 d after intrathecal injection of Dnm1 or CTR siRNA (Fig.3B) or Dnm1+2+3 or CTR siRNA (Fig.3C), n=10 mice per group. (Figs.3D-3E) Non-evoked nociceptive behavior in SNI and sham control mice recorded for 20 min at 2 d after intrathecal injection of Dnm1+2+3 or CTR siRNA. Visits to center area marked by black square (Fig. 3D) and representative images of the track records (Fig. 3E) are shown, n=8 mice per group for Sham/Dnm1+2+3 siRNA, n=9 mice per group for Sham/CTR siRNA and SNI/CTR siRNA and n=10 mice per group for SNI/Dnm1+2+3 siRNA. Mean±SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs. CTR siRNA; Sham vs SNI; SNI/CTR siRNA vs SNI/Dnm1+2+3 siRNA.2-way ANOVA, Sídák multiple comparisons test (Figs.3B-3C) or 1- way ANOVA, Tukey multiple comparisons test (Fig.3D). [0058] Figs.4A-4D show localization of Aak1 mRNA in DRG ganglia and spinal cord. (Fig. 4A) RNAScope® localization of Aak1 mRNA in DRG and dorsal horn of the spinal cord of mice. Arrows indicate mRNA expression within DRG and spinal cord neurons. Scale bar, 50 μm and in the detail box 20 μm. Representative images, n=5 independent experiments. n=5 6

mice per group (Fig.4B) Localization of Aak1 mRNA in CGRP+ve DRG neurons. Scale bar, 50 μm. Representative images, n=3 mice per group. (Fig. 4C) Expression of Aak1 mRNA in the DRG, spinal cord and TG of mice determined by qRT-PCR, n=4 mice per group. (Fig.4D) RNAScope® localization of Aak1 mRNA in human DRG. Arrows indicate mRNA expression within DRG. Scale bar, 50 μm. * Indicates fluorescent signal due to the presence of lipofuscin in human DRG neurons. [0059] Figs.5A-5F show AAK1 knockdown and inflammatory and neuropathic pain. (Fig. 5A) RNAScope® localization and (Fig.5B) quantification (number of dots per area) of Aak1 mRNA expression in mouse DRG at 1 d after intrathecal injection of AAK1 or CTR siRNA, n=4 mice per group. (Fig. 5C) Experimental timeline for CFA-evoked inflammatory pain. Mechanical allodynia and thermal hyperalgesia induced by intraplantar CFA measured 1 or 2 d after intrathecal injection of AAK1 or CTR siRNA, n=8 mice per group. (Fig. 5D) Experimental timeline for SNI-evoked neuropathic pain. Mechanical and cold allodynia in SNI mice measured 1-4 d after intrathecal injection of AAK1 or CTR siRNA, n=10 mice per group. (Figs.5E-5F) Non-evoked nociceptive behavior in SNI and sham control mice recorded for 20 min at 2 d after intrathecal injection of AAK1 or CTR siRNA. Visits to center area marked by black square (Fig.5E) and representative images of the track records (Fig.5F) are shown, n=7 mice per group. Mean±SEM. **P<0.01, ***P<0.001, ****P<0.0001 vs. CTR siRNA. Parametric unpaired two-tailed t test (b) or 2-way ANOVA, Sídák multiple comparisons test (c, d). [0060] Figs.6A-6H show the effects of Dnm, clathrin and AAK1 inhibitors on inflammatory and neuropathic pain. (Fig. 6A) Experimental timeline for CFA-evoked inflammatory pain. (Fig. 6B) Effects of Dyngo4a (Dy4a), PitStop2 (PS2), inactive analogs (Dy4aØ, PS2Ø) (all 5 µl, 50 μM, i.t.) or vehicle on CFA-evoked mechanical allodynia (left panel) and thermal hyperalgesia (right panel), n=6 mice per group for vehicle and inactive analogs and n=7 mice per group for Dyngo4a and PitStop2. (Figs. 6C-6D) Effects of LP935509, SGC-AAK1-1 (5 µl, 1-10 µg, i.t.) or vehicle on CFA-evoked mechanical allodynia (Fig. 6C) and thermal hyperalgesia (Fig. 6D), n=8 mice per group. (Fig.6E) Experimental timeline for SNI-evoked neuropathic pain. (Fig. 6F) Effects of Dyngo4a, PitStop2, inactive analogs (5 µl, 50 μM, i.t.) or vehicle on SNI-evoked mechanical allodynia (left panel) and cold allodynia (right panel), n=7 mice per group for inactive analogs and n=8 mice per group for vehicle, Dyngo4a and PitStop2. (Figs.6G-6H) Effects of LP935509, SGC-AAK1-1 (5 µl, 1-10 µg, i.t.) or vehicle on SNI-evoked mechanical allodynia (Fig. 6G) and cold (Fig. 6H) allodynia, n=10 mice per 7

group. Mean±SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs. vehicle. 2-way ANOVA, Sídák multiple comparisons test. [0061] Figs. 7A-7H depict ultrastructural analysis of spinal cord slices after Dnm1 knockdown. (Figs. 7A-7B) Electron micrographs of spinal cord from mice at 2 d after intrathecal injection of CTR siRNA showing presynaptic terminals filled with abundant SVs. (Figs.7C-7F) Electron micrographs of spinal cord from mice at 2 d after intrathecal injection of Dnm1 siRNA. Images of presynaptic terminals reflect the range in the severity of the phenotype from nearly normal (Fig.7C) to a major accumulation of clathrin-coated pits (CCPs) with few remaining SVs (Fig. 7D). (Figs. 7E-7F) Arrows show interconnected CCPs in synapses from Dnm1 siRNA treated mice. Scale bars, 200 nm. (Fig.7G) Quantification of SVs in Dnm1 and CTR siRNA treated neurons expressed as the number per synaptic profile. (Fig. 7H) Quantification of CCPs expressed as the percentage of CCPs relative to the total of SVs + CCPs/synapse (Dnm1, n=212; CTR n=182 synapses). Mean±SEM. **P<0.01, ***P<0.001 vs. CTR siRNA. Parametric unpaired two-tailed t test. [0062] Figs.8A-8E depict Dnm-mediated sensitization of nociceptors. (Fig. 8A) Effects of intraplantar injection of trypsin (10 µl, 80 nM) on mechanical allodynia in mice at 2 d after intrathecal injection of Dnm1+2+3 or CTR siRNA. Mechanical allodynia was measured at 60 min after trypsin, n=5 mice per group. (Fig. 8B) Experimental timeline for electrophysiology experiments. (Figs. 8C-8D) Representative traces of rheobase (Rh) and mean rheobase response of DRG neurons at 2 d after intrathecal injection of CTR siRNA (Fig. 8C) or Dnm1+2+3 siRNA (Fig. 8D). DRG neurons were challenged with trypsin and washed. Rheobase was measured at T=0 and T=30 min following trypsin challenge. Numbers in bars denote neurons measured. Mean±SEM. *P<0.05, **P<0.01 vs. control or CTR siRNA.2-way ANOVA, Sídák multiple comparisons test (Fig. 8B) or 1-way ANOVA, Dunnett’s multiple comparisons test (Figs.8C-8D). (Fig.8E) The contributions of Dnm-mediated endocytosis in nociceptors to pain transmission. The role of endocytosis for GPCR signaling in the periphery and SV recycling centrally are depicted. [0063] Figs. 9A-9B show localization of Dnm and Aak1 mRNA in TG. (Fig. 9A) RNAScope® localization of Dnm1, Dnm2, Dnm3 and Aak1 mRNA in TG of mice. Arrows indicate mRNA expression within TG neurons. Scale bar, 50 μm. Representative images, n=3 mice per group. (Fig. 9B) Expression of Dnm1, Dnm2 and Dnm3 mRNA in the TG of mice determined by qRT-PCR, n=5 mice per group. 8

[0064] Figs. 10A-10C show localization of Dnm mRNA in CGRP-positive DRG neurons. Localization of Dnm1 (Fig. 10A), Dnm2 (Fig. 10B) and Dnm3 (Fig. 10C) mRNA by RNAScope® and of CGRP immunoreactivity in DRG neurons of mice. Scale bar, 50 μm. Representative images, n=3 mice per group. [0065] Figs.11A-11B show expression of Dnm and Aak1 mRNA in spinal cord after siRNA injection. (Fig.11A) RNAScope® localization and (Fig.11B) quantification (number of dots per area) of Dnm1, Dnm2, Dnm3 and Aak1 mRNA in spinal cord at 2 d after intrathecal injection of Dnm1, Dnm2, Dnm3, Aak1 or CTR siRNA injection, n= 3 mice per group. Scale bar, 50 µm. Mean±SEM. Parametric unpaired two-tailed t test. [0066] Figs.12A-12F show Dnm knockdown and inflammatory pain. (Figs.12A-12B) Time course of the effect of Dnm1 siRNA (Fig. 12A) or Dnm1+2+3 siRNA (Fig. 12B) on mechanical allodynia and thermal hyperalgesia induced by intraplantar CFA, n=7-8 mice per group. (Fig.12C and Fig.12F) Time course of the effect of Dnm1 siRNA (Fig.12C, n=7 mice per group), Dnm2 siRNA (e, n=8 mice per group), Dnm3 siRNA (Fig. 12F, n=8 mice per group) and Dnm1+2+3 siRNA (Fig.12D, n=5 mice per group) on mechanical allodynia of the contralateral hind paw after CFA injection to the ipsilateral paw. Mean±SEM. **P<0.01, ****P<0.0001 vs. CTR siRNA.2-way ANOVA, Sídák multiple comparisons test. [0067] Figs. 13A-13B show Dnm knockdown, mechanical allodynia and non-evoked nociception. (Fig.13A) Time course of the effect of Dnm1 siRNA and Dnm1+2+3 siRNA on mechanical allodynia tested in the contralateral hind paw after SNI ipsilateral surgery, n=5 mice per group. (Fig. 13B) Non-evoked nociceptive behavior and locomotor activity were recorded in sham surgery control mice for 20 min at 2 d after intrathecal injection of Dnm1+2+3 siRNA or CTR siRNA, n=8 mice per group for Sham/Dnm1+2+3 siRNA, n=9 mice per group for Sham/CTR siRNA. Average velocity, track length, total activity, ambulation, grooming, and distance from wall were recorded. Mean±SEM. 2-way ANOVA, Sídák multiple comparisons test (Fig.13A) or parametric unpaired two-tailed t test (Fig.13B). [0068] Figs. 14A-14C show Aak1 knockdown, mechanical allodynia and non-evoked nociception. Time course of the effect of AAK1 and CTR siRNA on mechanical allodynia tested in the contralateral hind paw after CFA injection to the ipsilateral paw (Fig.14A) or SNI ipsilateral surgery (Fig. 14B), n=6-7 mice per group. (Fig. 14C) Non-evoked nociceptive behavior and locomotor activity were recorded in sham surgery control mice for 20 min at 2 d after intrathecal injection of AAK1 siRNA or CTR siRNA, n=7 mice per group. Average velocity, track length, total activity, ambulation, grooming, distance from wall and visits center 9

number were recorded. 2-way ANOVA, Sídák multiple comparisons test (Figs. 14A-14B) or parametric unpaired two-tailed t test (Fig.14C). [0069] Figs.15A-15F show the effect of Dnm and AAK1 inhibitors on mechanical allodynia in the contralateral paw after CFA and SNI. Time course of the effect of Dyngo4a (Dy4a), PitStop2, inactive analogs (Dy4aØ and PS2Ø) (PS2, 5 µl, 50 µM, i.t.) (Fig.15A and Fig.15D), LP-935509 (Fig. 15B and Fig. 15E), SGC-AAK1-1 (5 µl, 1-10 µg, i.t.) (Fig. 15C and Fig. 15F) and vehicle on mechanical allodynia tested in the contralateral hindpaw after CFA injection into the ipsilateral paw (Figs.15A-15C) or SNI ipsilateral surgery (Figs. 15D-15F), n=5-7 mice per group.2-way ANOVA, Sídák multiple comparisons test. [0070] Figs.16A-16B show the experimental timeline for CFA-evoked inflammatory pain, and mechanical allodynia and thermal hyperalgesia measured 1-6 d after administration of Dnm1, AAK1 or CTR shRNA, n=8 mice per group (Fig.16A). Experimental timeline for SNI- evoked neuropathic pain, and mechanical and cold allodynia measured 1-7 d after administration of Dnm1, AAK1 or CTR shRNA, n=8 mice per group (Fig.16B). Mean±SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs. CTR shRNA. 2-way ANOVA, Sídák multiple comparisons test. [0071] Figs. 17A-17B show that Dnm and AAK1 shRNA knockdown and mechanical allodynia, thermal hyperalgesia and cold allodynia in the contralateral paw after CFA and SNI. Time course of the effect of Dnm1, AAK1 and CTR shRNA on mechanical allodynia, thermal hyperalgesia and cold allodynia tested in the contralateral hind paw after administration of CFA into the ipsilateral paw (Fig. 17A) or SNI ipsilateral surgery (Fig. 17B), n=8 mice per group. 2-way ANOVA, Sídák multiple comparisons test. [0072] Figs. 18A-18C show that Synaptojanin-1 (Synj1) and Endophilin A1 (EndoA1) knockdown prevent capsaicin nociceptive effect. Time course of the effects of Synj1, EndoA1 or CTR siRNA (i.t.) on CPS (0.1nmol/10 µl, i.pl.) induced mechanical allodynia (Fig. 18A) and thermal hyperalgesia (Fig.18B) in mice. N=6 mice per group. [0073] Figs.19A-19I show that EndoA1 knockdown does not impair locomotor activity. [0074] Figs.20A-20C show that GIPC1 knockdown prevents NGF nociceptive effect. Time course of the effects of GIPC1 or CTR siRNA (i.t.) on NGF (50 nM/10 µl, i.pl.) induced mechanical allodynia (Fig.20A) and thermal hyperalgesia (Fig.20B) in mice. N=6-8 mice per group. [0075] Figs. 21A-21E show the effects of GIPC1 siRNA on inflammatory pain. Fig. 21A shows the study design. Effects of intrathecal injection of GIPC1 or CTR siRNA on CFA- 10

evoked mechanical allodynia (Figs. 21B-21C) and thermal hyperalgesia (Figs. 21D-21E) in mice. n=6 mice per group [0076] Figs.22A-22H show that GIPC1 knockdown does not impair locomotor activity. [0077] Fig. 23 shows GIPC1 knockdown in DRG neurons. RNAScope® localization and quantification (number of dots per area) of Gipc1 mRNA expression in mouse DRG at 2 d after intrathecal injection of GIPC1or control (CTR) siRNA, n=4-5 mice per group. [0078] Fig. 24A-24D show the effect of Synj1and EndoA1 knockdown in a postoperative pain model. Time course of the effects of Synj1, EndoA1 or CTR siRNA (i.t.) on CPS (0.1nmol/10 µl, i.pl.) induced mechanical allodynia (Fig.24A) and thermal hyperalgesia (Fig. 24B) in mice. Fig.24D shows a sample plantar incision. DETAILED DESCRIPTION [0079] Chronic pain is poorly understood and inadequately treated. Mediators from damaged tissues activate G protein-coupled receptors (GPCRs), receptor tyrosine kinases and ligand- gated ion channels at the peripheral endings of nociceptors to initiate pain ² . The central terminals of nociceptors in the dorsal horn of the spinal cord release substance P, calcitonin gene-related peptide (CGRP) and glutamate, which activate GPCRs on second order neurons that transmit signals centrally. Synaptic vesicle (SV) cycling is required for synaptic transmission ^{3, 4} . SV exocytosis at presynaptic terminals releases neurotransmitters into the synapse. Clathrin-dependent endocytosis retrieves SVs from the plasma membrane of presynaptic neurons, which replenishes the releasable SV pool and is necessary for sustained neurotransmission. Dynamin (Dnm) GTPase mediates fission of clathrin-coated SVs and is thus required for endocytosis. Of the three Dnm isoforms (Dnm1, Dnm2, Dnm3), Dnm1 and Dnm3 are expressed in the nervous system ⁵ . Dnm1 deletion in mice impairs activity-dependent endocytosis of SVs at nerve terminals and thereby disrupts neurotransmission during intense stimulation ⁶ . Although Dnm3 deletion alone does not severely disrupt synaptic transmission, deletion of Dnm3 and Dnm1 depletes SVs and causes accumulation of clathrin-coated pits (CCPs) in presynaptic terminals ⁶ . Dnm inhibitors recapitulate these effects ⁷ . In some embodiments, the Dnm described herein refers to human Dnm1 (NCBI Gene ID: 1759), human Dnm2 (NCBI Gene ID: 1785), or human Dnm3 (NCBI Gene ID: 26052). In some embodiments, the Dnm described herein refers murine Dnm1 (NCBI Gene ID: 13429), Dnm2 (NCBI Gene ID: 13430), or Dnm3 (NCBI Gene ID: 103967). 11

[0080] Together with clathrin, adaptor protein 2 (AP2) constitutes the major coated protein of the endocytic vesicles. Adaptor associated kinase 1 (AAK1) (also known as AP2-associated protein kinase 1) recruits clathrin and AP2 to the plasma membrane and phosphorylates the µ2 subunit of AP2 (AP2M1), thereby stimulating cargo binding and recruitment, vesicle assembly and internalization ⁸ . Clathrin assembly promotes AAK1-dependent phosphorylation of AP2M1, which constitutes a feedforward loop for pit maturation ⁹ . Clathrin and Dnm also mediate endocytosis and sustained endosomal signaling of GPCRs, which mediate neuronal activation and nociception ^{10, 11, 12, 13, 14} . In some embodiments, the AAK1 described herein refers to human AAK1 (NCBI Gene ID: 22848). In some embodiments, the AAK1 described herein refers to murine AAK1 (NCBI Gene ID: 269774). [0081] The contribution of clathrin, Dnm and AAK1 to synaptic transmission in nociceptive circuits is not fully understood. A screen of knockout mice identified AAK1 as a mediator and therapeutic target for neuropathic pain ¹⁵ . Aak1 deletion and inhibition using LP-935509 attenuated neuropathic pain in mice and rats. The α subunit of the AP2 complex (AP2α2) is expressed in CGRP+ve nociceptors and AP2 shRNA disruption suppressed nociception in mice ¹⁶ . However, the distribution of Dnm and AAK1 isoforms in nociceptive circuits in experimental animals and humans is unknown and their role in nociceptive transmission is unexplored. [0082] GIPC1 (synectin), GIPC2 and GIPC3 are cytoplasmic adaptor proteins that regulate protein trafficking and signaling. The GIPC1 PDZ domain interacts with transmembrane receptors, coreceptors, channels, adhesion molecules and proteins involved in endocytosis and organelle trafficking. The GH2 domain interacts with myosin VI, an actin-based retrograde motor, to mediate internalization of endocytic vesicles. Thus, GIPC1 regulates assembly of receptor signaling complexes and controls multiple steps of receptor trafficking (clustering, endocytosis, recycling). GIPC1 is a critical node in signaling networks that underlie tumor proliferation, growth, metastasis, and angiogenesis. GIPC1 interacts with neuropilin 1 and tropomyosin receptor kinase A and likely serves to cluster signaling molecules in transport vesicles. The expression of GIPC1 in pain circuits and its role in pain signaling is unknown. In some embodiments, the GIPC1 described herein refers to human GIPC1 (NCBI Gene ID: 10755). In some embodiments, the GIPC1 described herein refers to mouse GIPC1 (NCBI Gene ID: 67903). [0083] Synaptojanin-1 (Synj1) and endophilin A1 (EndoA1) (also known as SH3 domain containing GRB2 like 2) mediate synaptic neck formation during endocytosis. Their expression 12

in pain circuits and role in pain signaling is unknown. In some embodiments, the Synj1 described herein refers to human Synj1 (NCBI Gene ID: 8867). In some embodiments, the Synj1 described herein refers to mouse Synj1 (NCBI Gene ID: 104015). In some embodiments, the EndoA1 described herein refers to human EndoA1 (NCBI Gene ID: 6456). In some embodiments, the EndoA1 escribed herein refers to mouse EndoA1 (NCBI Gene ID: 20404). [0084] The present disclosure describes the contribution of endocytosis to synaptic transmission in nociceptive circuits, in particular, involving primary sensory neurons and second order neurons in the dorsal horn of the spinal cord, and relates to the therapeutic targeting of endocytosis to ameliorate chronic pain. The endocytosis mediators Dnm 1-3 and AAK1 were detected in primary sensory neurons of dorsal root ganglia of mouse and human by RNAScope®. When injected intrathecally to mice, Dnm and AAK1 siRNA and pharmacological inhibitors reversed mechanical and thermal allodynia and hyperalgesia and normalized non-evoked nociceptive behavior in preclinical models of inflammatory and neuropathic pain, without affecting normal motor functions. Dnm1 and AAK1 disruption inhibited synaptic transmission between primary sensory neurons and neurons in lamina I/II of the spinal cord dorsal horn by suppressing release of synaptic vesicles from presynaptic primary afferent neurons. By disrupting synaptic transmission in the spinal cord, endocytosis inhibitors offer a therapeutic approach for pain treatment. Together, anatomical, electrophysiological and behavioral studies disclosed herein support the hypotheses that Dnm and AAK1 are necessary for nociceptive transmission in the spinal cord and that endocytosis inhibition reverses chronic nociception. Definitions [0085] The terms “treat” or “treatment” of a state, disorder or condition include: (1) preventing, delay-ing, or reducing the incidence and/or likelihood of the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or sub-clinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing, delaying or reversing the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or sub-clinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms. The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician. 13

[0086] As used herein, the term “therapeutically effective amount” refers to the amount of a compound (e.g., an inhibitor of endocytosis) or a composition that, when administered to a subject for treating (e.g., preventing, ameliorating, or reversing) a state, disorder or condition, is sufficient to effect such treatment. The “therapeutically effective amount” will vary depending, e.g., on the compound, or analogues administered as well as the disease, its severity, and physical conditions and responsiveness of the subject to be treated. [0087] The term “simultaneous administration,” as used herein, means that a first agent and second agent in a combination therapy are administered with a time separation of no more than about 15 minutes, such as no more than about any of 10, 5, or 1 minutes. When the first and second agents are administered simultaneously, the first and second agents may be contained in the same composition (e.g., a composition comprising both a first and second agent) or in separate compositions (e.g., a first agent in one composition and a second agent is contained in another composition). [0088] As used herein, the term “sequential administration” means that the first agent and second agent in a combination therapy are administered with a time separation of more than about 15 minutes, such as more than about any of 20, 30, 40, 50, 60, or more minutes. Either the first agent or the second agent may be administered first. The first and second agents are contained in separate compositions, which may be contained in the same or different packages or kits. [0089] As used herein, the term “concurrent administration” means that the administration of the first agent and that of a second agent in a combination therapy overlap with each other. [0090] The terms “patient”, “individual”, “subject”, and “animal” are used interchangeably herein and refer to mammals, including, without limitation, human and veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models. In a preferred embodiment, the subject is a human. [0091] The term “about” or “approximately” means within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art. [0092] The terms “a,” “an,” and “the” do not denote a limitation of quantity, but rather denote the pres-ence of “at least one” of the referenced item. 14

[0093] The term “percent sequence identity” in the context of nucleic acid sequences means the percent of residues when a first contiguous sequence is compared and aligned for maximum correspondence to a second contiguous sequence. The length of sequence identity comparison may be over a stretch of at least about nine nucleotides, usually at least about 18 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36, 48 or more nucleotides. There are a number of different algorithms known in the art which can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA, which includes, e.g., the programs FASTA2 and FASTA3, provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, Methods Enzymol.183:63-98 (1990); Pearson, Methods Mol. Biol.132:185-219 (2000); Pearson, Methods Enzymol.266:227-258 (1996); Pearson, J. Mol. Biol.276:71-84 (1998); herein incorporated by reference). Unless otherwise specified, default parameters for a particular program or algorithm are used. For instance, percent sequence identity between nucleic acid sequences can be determined using FASTA with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) or using Gap with its default parameters as provided in GCG Version 6.1, herein incorporated by reference. [0094] A reference to a nucleotide sequence encompasses its complement unless otherwise specified. Thus, a reference to a nucleic acid having a particular sequence should be understood to encompass its complementary strand, with its complementary sequence. [0095] The term “percent sequence identity” means a ratio, expressed as a percent of the number of identical residues over the number of residues compared. [0096] The term “substantial similarity” or “substantial sequence similarity,” when referring to a nucleic acid or fragment thereof, means that when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 85%, preferably at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap, as discussed above. [0097] The practice of the present invention employs, unless otherwise indicated, conventional tech-niques of statistical analysis, molecular biology (including recombinant 15

techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such tools and techniques are described in detail in e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Boni-facino et al. eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Ho-boken, NJ; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, NJ; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, NJ. Additional techniques are explained, e.g., in U.S. Patent No. 7,912,698 and U.S. Patent Appl. Pub. Nos.2011/0202322 and 2011/0307437, each of which is herein incorporated by reference in its entirety for all intended purposes. Methods of Treatment [0098] The present application in one aspect provides a method for treating pain in a subject, comprising administering to the subject a therapeutically effective amount of an inhibitor of endocytosis. [0099] Within the context of the present disclosure, the term "pain" includes chronic inflammatory pain (e.g. pain associated with rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis); musculoskeletal pain, lower back and neck pain, sprains and strains, neuropathic pain, sympathetically maintained pain, myositis, pain associated with cancer and fibromyalgia, pain associated with migraine, pain associated with cluster and chronic daily headache, pain associated with influenza or other viral infections such as the common cold, rheumatic fever, pain associated with functional bowel disorders such as non-ulcer dyspepsia, non-cardiac chest pain and irritable bowel syndrome, pain associated with myocardial ischemia, post operative pain, headache, toothache, dysmenorrhea, neuralgia, fibromyalgia syndrome, complex regional pain syndrome (CRPS types I and II), neuropathic pain syndromes (including diabetic neuropathy, chemoterapeutically induced neuropathic pain, sciatica, non-specific lower back pain, multiple sclerosis pain, HIV-related neuropathy, post- herpetic neuralgia, trigeminal neuralgia) and pain resulting from physical trauma, amputation, cancer, toxins or chronic inflammatory conditions. [00100] In various embodiments, the pain is a chronic pain. 16

[00101] In some embodiments, the chronic pain is inflammatory pain, such as the pain associated with inflammatory bowel disease, irritable bowel syndrome, pancreatitis, arthritis, postoperative pain, migraine, or cancer pain. [00102] In some embodiments, the chronic pain is neuropathic pain, such as neuropathic pain secondary to nerve injury and trauma, diabetic neuropathy, viral neuropathy (e.g., trigeminal neuralgia), chemotherapy-induced peripheral neuropathy, migraine, or cancer pain. In some embodiments, the cancer pain is associated with oral cancer or pancreatic cancer. [00103] In some embodiments, the inhibitor inhibits endocytosis of synaptic vesicles at terminals of primary sensory neurons (e.g., nociceptors). In some embodiments, the inhibitor inhibits endocytosis of synaptic vesicles at terminals of primary sensory neurons (e.g., nociceptors) of the spinal cord. [00104] In some embodiments, an inhibitor of endocytosis inhibits the release of one or more of a neurotransmitter(s) as compared to the level of neurotransmitter(s) release in the absence of the inhibitor. In some embodiments, the inhibitor inhibits the release of one or more of a neurotransmitter(s) by at least about 10%, 20%, 30%, 40%, or 50%. In some embodiments, the inhibitor inhibits the release of one or more of a neurotransmitter(s) by at least about 60%, 70%, 80%, 90%, or more. The neurotransmitter(s) may include, but are not limited to, substance P, calcitonin gene-related peptide (CGRP), or glutamate, or a combination thereof. [00105] In various embodiments, the inhibitor of endocytosis does not cause motor deficits. [00106] In some embodiments, the inhibitor is an inhibitor of an endocytosis mediator described herein, such as dynamin (Dnm) 1, Dnm2, Dnm3, adaptor-associated protein kinase 1 (AAK1), clathrin, G‐alpha interacting protein (GAIP) interacting protein, C terminus 1 (GIPC1), synaptojanin-1 (Synj1), and/or endophilin A1 (EndoA1). [00107] The endocytosis mediators (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1) described in the present application include any naturally occurring proteins or variants thereof that have function of the wild-type protein, preferably in human. Also included are orthologs of the endocytosis mediators found in other species, such as in horse, bull, chimp, chicken, zebrafish, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. The endocytosis mediators may also be targeted at the gene or mRNA level to reduce expression of the respective proteins. [00108] In some embodiments, the inhibitor of endocytosis is a small molecule, an siRNA, an shRNA, an antisense oligonucleotide, a miRNA, an antibody or antibody fragment, a peptide, a polypeptide, a peptide analog, a fusion peptide, a polynucleotide, a peptidomimetic, 17

a natural product, a carbohydrate, an aptamer, an avimer, an anticalin, a speigelmer, or a site- specific nuclease. Non-limiting examples of the inhibitor are described below, [00109] In some embodiments, the inhibitor is a small molecule that inhibits Dnm1, Dnm2, and/or Dnm3. A non-limiting example of small molecules that inhibit Dnm1, Dnm2, and/or Dnm3 is Dyngo4a. [00110] In some embodiments, the inhibitor is a small molecule that inhibits clathrin. A non- limiting example of small molecules that inhibit clathrin is PitStop2. [00111] In some embodiments, the inhibitor is a small molecule that inhibits AAK1. Non- limiting examples of small molecules that inhibit AAK1 include LP935509 or SGC-AAK1-1. [00112] In some embodiments, the inhibitor is a small interfering RNAs (siRNA), also known as short interfering RNA or silencing RNA. siRNAs are a class of double-stranded RNA molecules, typically about 20-25 base pairs in length that target nucleic acids (e.g., mRNAs) for degradation via the RNA interference (RNAi) pathway in cells. Such siRNA molecules typically include a region of sufficient homology to the target region, and are of sufficient length in terms of nucleotides, such that the siRNA molecules down-regulate target nucleic acid. It is not necessary that there be perfect complementarity between the siRNA molecule and the target, but the correspondence must be sufficient to enable the siRNA molecule to direct sequence-specific silencing, such as by RNAi cleavage of the target RNA. In some embodiments, the sense strand need only be sufficiently complementary with the antisense strand to maintain the overall double-strand character of the molecule. [00113] In some embodiments, the inhibitor is an siRNA that inhibits Dnm1. In some embodiments, the siRNA that inhibits Dnm1 comprises GCGUGUACCCUGAGCGUGU (SEQ ID NO: 1), UGGUAUUGCUCCUGCGACA (SEQ ID NO: 2), GGGAGGAGAUGGAGCGAAU (SEQ ID NO: 3), or GCUGAGACCGAUCGAGUCA (SEQ ID NO: 4), or a modified version, an ortholog, a variant or a fragment thereof. [00114] In some embodiments, the inhibitor is an siRNA that inhibits Dnm2. In some embodiments, the siRNA that inhibits Dnm2 comprises ACCAUGAGCUGCUGGCUUA (SEQ ID NO: 5), GAAGAGGGCCAUACCCAAU (SEQ ID NO: 6), AAAGUUCGGUGCUCGAGAA (SEQ ID NO: 7), or GGAGCCCGCAUCAAUCGUA (SEQ ID NO: 8), or a modified version, an ortholog, a variant or a fragment thereof. [00115] In some embodiments, the inhibitor is an siRNA that inhibits Dnm3. In some embodiments, the siRNA that inhibits Dnm3 comprises CAACGAAGGCUGACGAUAA (SEQ ID NO: 9), GCUCAGAGUUCCUGCGAAA (SEQ ID NO: 10), 18

GUGAAUGGAACUCGUAUAA (SEQ ID NO: 11), or GCAGAAACAGACCGCGUAA (SEQ ID NO: 12), or a modified version, an ortholog, a variant or a fragment thereof. [00116] In some embodiments, the inhibitor is an siRNA that inhibits AAK1. In some embodiments, the siRNA that inhibits AAK1 comprises GAAGGUGGAUUCGCUCUUG (SEQ ID NO: 13), GGACUCAAAUCUCCUGACA (SEQ ID NO: 14), GCAGAUAUUUGGGCUCUAG (SEQ ID NO: 15), or AAAUGUGCCUUGAAACGUA (SEQ ID NO: 16), or a modified version, an ortholog, a variant or a fragment thereof. [00117] In some embodiments, the inhibitor is an siRNA that inhibits Synj1. In some embodiments, the siRNA that inhibits Synj1 comprises GGAAAGAGCUAUUAAAUCG (SEQ ID NO: 21), CCACUGAGUUUAUAUCAUU (SEQ ID NO: 22), CCAAAGUACUGGAUGCAUA (SEQ ID NO: 23), or GAAGAUAAAAUGUGGGUUA (SEQ ID NO: 24), or a modified version, an ortholog, a variant or a fragment thereof. [00118] In some embodiments, the inhibitor is an siRNA that inhibits EndoA1. In some embodiments, the siRNA that inhibits EndoA1 comprises GCUGGAAGGCCGACGCUUA (SEQ ID NO: 25), CUUCAGAGGUUUAGCGUGC (SEQ ID NO: 26), GAAGGUGGGAGGAGCGGAA (SEQ ID NO: 27), or GUAUAUACGUAGCCCGUUU (SEQ ID NO: 28), or a modified version, an ortholog, a variant or a fragment thereof. [00119] In some embodiments, the inhibitor is an siRNA that inhibits GIPC1. In some embodiments, the siRNA that inhibits GIPC1 comprises GCAUCGAGGGCUUCACUAA (SEQ ID NO: 29), CGUCGGCCUUUGAGGAGAA (SEQ ID NO: 30), GUGGAUGACUUGCUAGAGA (SEQ ID NO: 31), or GCUGAGGCCUUCCGACUAC (SEQ ID NO: 32), or a modified version, an ortholog, a variant or a fragment thereof. [00120] In some embodiments, the inhibitor is a short hairpin RNA (shRNA). A “ small hairpin RNA ” or “short hairpin RNA” or “shRNA” described herein may include a short RNA sequence that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. The shRNAs provided herein may be chemically synthesized or transcribed from a transcriptional cassette in a DNA plasmid. The shRNA hairpin structure may be cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). [00121] Non-limiting examples of shRNAs include a double-stranded polynucleotide molecule assembled from a single-stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; and a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense 19

and antisense regions. In some embodiments, the sense and antisense strands of the shRNA are linked by a loop structure comprising from about 1 to about 25 nucleotides, from about 2 to about 20 nucleotides, from about 4 to about 15 nucleotides, from about 5 to about 12 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides. [00122] In some embodiments, the inhibitor is an shRNA that inhibits Dnm1. In some embodiments, the shRNA that inhibits Dnm1 comprises ACCACAGAAUAUGCCGAGUUCCUGCACUG (SEQ ID NO: 37), CUUCAUAGGCUUUGCCAAUGCUCAGCAGA (SEQ ID NO: 38), GUGUGGACAUGGUUAUCUCGGAGCUAAUC (SEQ ID NO: 39), or GCUGAGAAUCUGUCCUGGUACAAGGAUGA (SEQ ID NO: 40), or a modified version, an ortholog, a variant or a fragment thereof; or is encoded by ACCACAGAATATGCCGAGTTCCTGCACTG (SEQ ID NO: 33), CTTCATAGGCTTTGCCAATGCTCAGCAGA (SEQ ID NO: 34), GTGTGGACATGGTTATCTCGGAGCTAATC (SEQ ID NO: 35), or GCTGAGAATCTGTCCTGGTACAAGGATGA (SEQ ID NO: 36), or a modified version, an ortholog, a variant or a fragment thereof. [00123] In some embodiments, the inhibitor is an shRNA that inhibits AAK1. In some embodiments, the inhibitor is an shRNA that inhibits AAK1 comprises UGUUGGCGGAAGGUGGAUUCGCUCUUGUC (SEQ ID NO: 45), AGAGCCAGGUGGCGAUUUGUGACGGAAGC (SEQ ID NO: 46), GGCACAGACGGAUUCUCAGUGAUGUAACC (SEQ ID NO: 47), or GGCAGCACUUCUGAUGCUGUUAUUGACAA (SEQ ID NO: 48), or a modified version, an ortholog, a variant or a fragment thereof, or is encoded by TGTTGGCGGAAGGTGGATTCGCTCTTGTC (SEQ ID NO: 41), AGAGCCAGGTGGCGATTTGTGACGGAAGC (SEQ ID NO: 42), GGCACAGACGGATTCTCAGTGATGTAACC (SEQ ID NO: 43), or GGCAGCACTTCTGATGCTGTTATTGACAA (SEQ ID NO: 44), or a modified version, an ortholog, a variant or a fragment thereof. [00124] In some embodiments, the siRNAs or shRNAs of the present disclosure comprise an ortholog version (e.g., human) of the sequences described herein. [00125] Specificity of siRNA molecules may be measured via the binding of the antisense strand of the molecule to its target RNA. Effective siRNA molecules are often fewer than 30 20

to 35 base pairs in length, e.g., to prevent stimulation of non-specific RNA interference pathways in the cell by way of the interferon response, however longer siRNA may also be effective. In various embodiments, the siRNA molecules are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs in length. In various embodiments, the siRNA molecules are about 35 to about 70 more base pairs in length. In some embodiments, the siRNA molecules are more than 70 base pairs in length. In some embodiments, the siRNA molecules are 8 to 40 base pairs in length, 10 to 20 base pairs in length, 10 to 30 base pairs in length, 15 to 20 base pairs in length, 19 to 23 base pairs in length, 21 to 24 base pairs in length. In some embodiments, the sense and antisense strands of the siRNA molecules are each independently about 19 to about 24 nucleotides in length. In some embodiments, the sense strand of an siRNA molecule is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand of an siRNA molecule are 21 nucleotides in length. [00126] In various embodiments, an siRNA molecule can comprise a 3' overhang at one end of the molecule. In some embodiments, the other end can be blunt-ended or may also comprise an overhang (e.g., 5' and/or 3'). When the siRNA molecule comprises an overhang at both ends of the molecule, the length of the overhangs may be different or the same. In some embodiments, an siRNA molecule described herein may comprises 3' overhangs of about 1 to about 3 nucleotides on both ends of the molecule. In some embodiments, the siRNA molecule comprises 3’ overhangs of about 1 to about 3 nucleotides on both the sense strand and the antisense strand. In some embodiments, the siRNA molecule comprises 3’ overhangs of about 1 to about 3 nucleotides on the antisense strand. In some embodiments, the siRNA molecule may comprise 3’ overhangs of about 1 to about 3 nucleotides on the sense strand. [00127] In various embodiments, the siRNA molecule comprises one or more modified nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more). In some embodiments, all of the nucleotides of the sense strand and/or the antisense strand of the siRNA molecule are modified. In certain embodiments, the siRNA molecule can comprise one or more modified nucleotides and/or one or more modified internucleotide linkages. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first and second internucleoside linkages at the 5′ end of the siRNA molecule sense strand. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first and second internucleoside linkages at the 5′ and 3′ ends of the siRNA molecule antisense strand. In some embodiments, the siRNA molecule may comprise modified internucleotide 21

linkages at the first and second internucleoside linkages at the 5′ end of the siRNA molecule sense strand and at the first and second internucleoside linkages at the 5′ and 3′ ends of the siRNA molecule antisense strand. [00128] In some embodiments, the modified nucleotide may comprise a modified sugar moiety (e.g., a 2' modified nucleotide). In some embodiments, the siRNA molecule can comprise one or more 2’ modified nucleotides, e.g., a 2'-deoxy, 2'-fluoro (2’-F), 2'-O-methyl (2’-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O- dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O- dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA). In various embodiments, each nucleotide of the siRNA molecule can a modified nucleotide (e.g., a 2'-modified nucleotide). In some embodiments, the siRNA molecule may comprise one or more phosphorodiamidate morpholinos. In some embodiments, each nucleotide of the siRNA molecule consists of a phosphorodiamidate morpholino. [00129] In various embodiments, the siRNA molecule may comprise a phosphorothioate or other modified internucleotide linkage. In various embodiments, the siRNA molecule may comprise, e.g., a phosphorothioate internucleoside linkage(s). In some embodiments, the siRNA molecule may comprise a phosphorothioate internucleoside linkage(s) between two or more nucleotides. In some embodiments, the siRNA molecule may comprise a phosphorothioate internucleoside linkage(s) between all nucleotides. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first, second, and/or third internucleoside linkage at the 5' or 3' end of the siRNA molecule. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first and second internucleoside linkages at the 5′ and/or 3′ end of the siRNA molecule. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first and second internucleoside linkages at the 5′ end of the siRNA molecule sense strand. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first and second internucleoside linkages at the 5′ and 3′ ends of the siRNA molecule antisense strand. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first and second internucleoside linkages at the 5′ end of the siRNA molecule sense strand and at the first and second internucleoside linkages at the 5′ and 3′ ends of the siRNA molecule antisense strand. In some embodiments, the siRNA molecule may comprise modified internucleotide linkages at the first internucleoside linkage at the 5′ and 3′ ends of the siRNA molecule sense strand, at the first, second, and third internucleoside linkages at the 5′ 22

end of the siRNA molecule antisense strand, and at the first internucleoside linkage at the 3′ end of the siRNA molecule antisense strand. [00130] A “variant” of a molecule is a sequence that is substantially similar to the sequence of the referenced molecule. Naturally occurring allelic variants such as these can be identified with the use of molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis. Generally, nucleotide sequence variants of the disclosure will have at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the referenced nucleotide sequence. [00131] The present application also provides an expression cassette containing an isolated nucleic acid sequence encoding an siRNA or shRNA targeted against an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1). The expression cassette may further contain a pol II promoter. Examples of pol II promoters include regulatable promoters and constitutive promoters. For example, the promoter may be a CMV or RSV promoter. The expression cassette may further contain a polyadenylation signal, such as a synthetic minimal polyadenylation signal. The nucleic acid sequence may further contain a marker gene. The expression cassette may be contained in a viral vector. An appropriate viral vector for use in the present disclosure may be an adenoviral, lentiviral, adeno-associated viral (AAV), poliovirus, herpes simplex virus (HSV) or murine Maloney- based viral vector. [00132] In some embodiments, the inhibitor of endocytosis reduces the expression of an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1). In some embodiments, the inhibitor reduces the expression of an endocytosis mediator described herein by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% as compared to the level without the inhibitor. In some embodiments, the inhibitor renders the expression of an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1) comparable as a reference level. In some embodiments, the reference level is the level of gene expression in a subject or group of subjects that do not have the disease or condition. [00133] In some embodiments, the inhibitor of endocytosis is an antibody or an antigen- binding fragment. In some embodiments, an antigen-binding fragment may be selected from 23

the group consisting of a single-chain Fv (scFv), a Fab, a Fab’, a F(ab’)2, an Fv fragment, a disulfide stabilized Fv fragment (dsFv), a (dsFv) ₂ , a V _H H, a Fv-Fc fusion, a scFv-Fc fusion, a scFv-Fv fusion, a diabody, a tribody, and a tetrabody. In some embodiments, the antibody is a scFv. In some embodiments, the antibody is a Fab or Fab’. In some embodiments, the antibody is chimeric, human, partially humanized, fully humanized, or semi-synthetic. Antibodies and/or antibody fragments may be derived from murine antibodies, rabbit antibodies, human antibodies, fully humanized antibodies, camelid antibody variable domains and humanized versions, shark antibody variable domains and humanized versions, and camelized antibody variable domains. [00134] In some embodiments, the inhibitor of endocytosis is a polypeptide. The inhibitory polypeptide may be about 50 to about 1000 amino acids in length, such as about 50-800, 50- 500, 50-400, 50-300 or 50-200 amino acids in length. In some embodiments, the inhibitory polypeptide may be about 50 to about 100 amino acids, about 100 to about 150 amino acids, or about 150 amino acids to about 200 amino acids in length. [00135] In some embodiments, the antibody, an antigen-binding fragment, or inhibitory polypeptide may further comprise a stabilizing domain. The stabilizing domain can be any domain that stabilizes the inhibitory polypeptide (for example, extending half-life of the inhibitory polypeptide in vivo). In some embodiments, the stabilizing domain is an Fc domain. [00136] In some embodiments, the inhibitor of endocytosis (e.g., antibody, antigen-binding fragment, polypeptide) comprises an Fc fragment. In some embodiments, the Fc fragment is selected from the group consisting of Fc fragments from IgG, IgA, IgD, IgE, IgM, and combinations and hybrids thereof. In some embodiments, the Fc fragment is derived from a human IgG. In some embodiments, the Fc fragment comprises the Fc region of human IgG1, IgG2, IgG3, IgG4, or a combination or hybrid IgG. [00137] In some embodiments, the inhibitor of endocytosis described herein may be a multi- specific molecule. Multi-specific molecules are molecules that have binding specificities for at least two different antigens or epitopes (e.g., bispecific antibodies have binding specificities for two antigens or epitopes). Multi-specific molecules with more than two valences and/or specificities are also contemplated. For example, trispecific antibodies can be prepared (Tutt et al. J. Immunol.147: 60 (1991)). [00138] In some embodiments, the inhibitor of endocytosis comprises a multi-specific (e.g., bispecific) molecule comprising a first binding moiety (such as a first antibody) specifically recognizing an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, 24

clathrin, Synj1, EndoA1, and/or GIPC1), and a second binding moiety (such as a second antibody) specifically recognizing a second antigen. In some embodiments, the multi-specific molecule is, for example, a diabody (Db), a single-chain diabody (scDb), a tandem scDb (Tandab), a linear dimeric scDb (LD-scDb), a circular dimeric scDb (CD-scDb), a di-diabody, a tandem scFv, a tandem di-scFv (e.g., a bispecific T cell engager), a tandem tri-scFv, a tri(a)body, a bispecific Fab2, a di-miniantibody, a tetrabody, an scFv-Fc-scFv fusion, a dual- affinity retargeting (DART) antibody, a dual variable domain (DVD) antibody, an IgG-scFab, an scFab-ds-scFv, an Fv2-Fc, an IgG-scFv fusion, a dock and lock (DNL) antibody, a knob- into-hole (KiH) antibody (bispecific IgG prepared by the KiH technology), a DuoBody (bispecific IgG prepared by the Duobody technology), a heteromultimeric antibody, or a heteroconjugate antibody. [00139] In some embodiments, the inhibitor of endocytosis comprises a site-specific nuclease that targets an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1). In some embodiments, the site-specific nuclease comprises a DNA nuclease such as an engineered (e.g., programmable or targetable) DNA nuclease to induce genome editing of a target DNA sequence of an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1). Any suitable DNA nuclease can be used including, but not limited to, CRISPR-associated protein (Cas) nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, other endo- or exo-nucleases, variants thereof, fragments thereof, and combinations thereof. In some embodiments, the genome editing comprises modifying a gene encoding an endocytosis mediator described herein (e.g., Dnm1, Dnm2, Dnm3, AAK1, clathrin, Synj1, EndoA1, and/or GIPC1) so that no functional protein is produced, or the modified protein no longer mediates endocytosis or mediates endocytosis to a less extent than wildtype protein. [00140] In some embodiments, the method comprises administering to the subject a combination of the inhibitors of endocytosis described herein. Two or more inhibitors of endocytosis described herein may be administered sequentially, simultaneously, and/or concurrently. [00141] The methods may also involve multiple rounds of administration of the inhibitors of endocytosis described herein. In some embodiments, following an initial round of administration, the level and/or symptoms of pain, in the subject may be evaluated, and, if 25

needed, an additional round of administration can be performed. In this way, multiple rounds of the inhibitors of endocytosis administration can be performed. [00142] In some embodiments, the inhibitor of endocytosis is administered locally to an area affected by the chronic pain. In some embodiments, the inhibitor of endocytosis is administered intrathecally, intranasally, intracolonically, intraluminally, intraintestinally, intracisternally, intraventricularly, intratumorally, or intraarticularly. [00143] Any of the inhibitors of endocytosis described herein can be present in a composition (such as a formulation) that includes other agents, excipients, or stabilizers. [00144] It is understood that the compounds of the present disclosure can be present in one or more stereoisomers (e.g., diastereomers). The disclosure includes, within its scope, all of these stereoisomers, either isolated (e.g., in enantiomeric isolation) or in combination (including racemic and diastereomeric mixtures). The present disclosure uses amino acids independently selected from L and D forms (e.g., the peptide may contain two serine residues, each serine residue having the same or opposite absolute stereochemistry), etc., are intended for the use of both L- and D-form amino acids. [00145] Accordingly, the compounds of the present disclosure also include substantially pure stereoisomeric form of the specific compound with respect to the asymmetric center of the amino acid residue, for example about 90% de, such as greater than about 95% to 97% de, or 99% de. For larger compounds, as well as mixtures thereof (such as racemic mixtures). Such diastereomers may be prepared, for example, by asymmetric synthesis using chiral intermediates, or the mixture may be divided by conventional methods, such as chromatography or the use of dividing agents. [00146] If the compounds of the disclosure require purification, chromatographic techniques such as high-performance liquid chromatography (HPLC) and reverse phase HPLC can be used. Peptides may be characterized by mass spectrometry and / or other suitable methods. [00147] If the compound contains one or more functional groups that can be protonated or deprotonated (e.g., at physiological pH), the compound can be prepared and / or isolated as a pharmaceutically acceptable salt. It will be appreciated that the compound can be zwitterion at a given pH. As used herein, the expression "pharmaceutically acceptable salt" refers to a salt of a given compound, which salt is suitable for pharmaceutical administration. Such salts can be formed, for example, by reacting an acid or base with an amine or carboxylic acid group, respectively. 26 [00148] Pharmaceutically acceptable acid addition salts can be prepared from inorganic and organic acids. Examples of inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like. Examples of organic acids include acetic acid, propionic acid, glycolic acid, pyruvate, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartrate acid, citrate, benzoic acid, cinnamic acid, mandelic acid. Examples thereof include methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid and salicylic acid.

[00149] Pharmaceutically acceptable base addition salts can be prepared from inorganic and organic bases. Corresponding counterions derived from inorganic bases include salts of sodium, potassium, lithium, ammonium, calcium and magnesium. Organic bases include isopropylamine, trimethylamine, diethylamine, tri ethylamine, tripropylamine, ethanolamine, 2-dimethylarainoethanol, tromethamine, lysine, arginine, histidine, caffeine, prokine, hydrabamine, choline, betaine, ethylenedi amine, glucosamine, Substituted amines such as primary, secondary and tertiary amines such as N-alkylglucamine, theobromine, purines, piperazine, piperazine and N-ethylpiperidine, substituted amines such as natural substituted amines and cyclic amines can be mentioned

[00150] Acid/base addition salts tend to be more soluble in aqueous solvents than the corresponding free acid/base forms.

[00151] In some embodiments, it is envisioned that two or more combinations of the compounds of the disclosure will be administered to the subject. It is believed that the compound (s) may also be administered in combination with one or more additional therapeutic agents. This combination can allow separate, continuous or simultaneous administration with the other active ingredients of the above compounds. This combination may be provided in the form of a pharmaceutical composition.

[00152] As used herein, the term " combination" is used by the combination agents as defined above dependently or independently, or by the use of different fixed combinations with different amounts of combination agents, i.e. simultaneously or at different times. Refers to a kit of compositions or parts that can be administered. The combination agents can then be administered, for example, simultaneously or staggered in time (i.e., at different times and at equal or different time intervals for any part of the kit). The ratio of the total amount of combination agents administered in a combination can vary, e.g., to address the needs of a subpopulation of patients to be treated or the needs of a single patient, and different needs are the age of the patient, it can be due to gender, weight, etc.

[00153] The route of administration and the type of pharmaceutically acceptable carrier will depend on the condition being treated and the type of mammal. Formulations containing the active compound may be prepared such that the activity of the compound is not disrupted during the process and the compound can reach its site of action without disruption. In some cases, it may be necessary to protect the compound by means known in the art, such as microencapsulation. Similarly, the route of dosing selected should be such that the compound reaches its site of action. [00154] In some embodiments, the composition further comprises a targeting agent or a carrier that promotes the delivery of the inhibitors of endocytosis to an area affected by the chronic pain. Exemplary carriers include liposomes, micelles, nanodisperse albumin and its modifications, polymer nanoparticles, dendrimers, inorganic nanoparticles of different compositions. [00155] The appropriate formulation for the compound of the disclosure can be adjusted for pH. Buffer systems are routinely used to provide pH values in the desired range and include carboxylic acid buffers such as acetates, citrates, lactates and succinates. In some embodiments, the composition is formulated to have a pH range of about 4.5 to about 9.0, including for example pH ranges of about any of 5.0 to about 8.0, about 6.5 to about 7.5, and about 6.5 to about 7.0. In some embodiments, the pH of the composition is formulated to no less than about 6, including for example no less than about any of 6.5, 7, or 8 (such as about 8). The composition can also be made to be isotonic with blood by the addition of a suitable tonicity modifier, such as glycerol. [00156] The formulation may also include suitable excipients, such as antioxidants. Examples of antioxidants include phenolic compounds such as BHT or Vitamin E, reducing agents such as methionine or sulfites, and metal chelating agents such as EDTA. [00157] The compounds or pharmaceutically acceptable salts thereof described herein can be prepared in parenteral dosage forms such as those suitable for intravenous, intrathecal, and intracerebral or epidural delivery. Suitable pharmaceutical forms for injectable use include sterile injectable or dispersions and sterile powders for the immediate preparation of sterile injectable solutions. They must be stable under manufacturing and storage conditions and protected from reduction or oxidation and the contaminating effects of microorganisms such as bacteria or fungi. [00158] The solvent or dispersion medium for the injectable solution or dispersion may include either conventional solvents or carrier systems for the active compound, e.g., water, 28

ethanol, polyols (e.g., glycerol, propylene glycol and). Liquid polyethylene glycol, etc., suitable mixtures thereof, and vegetable oils may be included. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, the maintenance of the required particle size in the case of dispersions, and the use of surfactants. Prevention of the action of microorganisms can be performed as needed by incorporating various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it may be preferable to include agents that regulate osmotic pressure, such as sugar or sodium chloride. Preferably, the injectable formulation is isotonic with blood. Sustained absorption of the injectable composition can be brought about by the use of agents that delay absorption (e.g., aluminum monostearate and gelatin) in the composition. Suitable pharmaceutical forms for injection can be delivered by any suitable route, including intravenous, intramuscular, intracerebral, intrathecal, epidural injection or infusion. [00159] Sterilized injectable solutions are prepared by adding the required amount of the compounds of the disclosure to a suitable solvent containing various other components, such as those listed above, as needed, followed by filtration sterilization. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile vehicle containing a basic dispersion medium and other required ingredients from those described above. For sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is vacuum drying or lyophilization of the pre-sterile filtered solution of the active ingredient plus any additional desired ingredients. [00160] Other pharmaceutical forms include the oral and enteral formulations, where the active compound can be formulated with an inert diluent or an assimilated edible carrier, or encapsulated in hard or softshell gelatin capsules. The formulations can also be tableted, or it can be incorporated directly into diet foods. For oral therapeutic administration, the active compound is taken up with excipients and used in the form of ingestible tablets, buccal or sublingual tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. The amount of active compound in such a therapeutically useful composition is such that an appropriate dose can be obtained. [00161] Tablets, lozenges, pills, capsules, etc. may also contain the ingredients listed below: binders such as gum, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; corn starch, Disintegrants such as potato starch, arginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin, or flavors such as peppermint, winter green oil, or cherry flavor may be added. If the dosage unit form is a capsule, it may contain a 29

liquid carrier in addition to the above types of materials. Various other materials may be present as a coating or in other ways to alter the physical form of the dosage unit. For example, tablets, pills, or capsules can be coated with shellac, sugar, or both. The syrup or elixir may contain active compounds, sucrose as a sweetener, methyl and propylparabens as preservatives, pigments and flavors such as cherry or orange flavors. Of course, any substance used to prepare the dosage unit form must be pharmaceutically pure and substantially non-toxic in the amount used. In addition, the compounds of the disclosure may be incorporated into sustained release formulations and formulations comprising those that specifically deliver the active peptide to a particular region of the intestine. [00162] Liquid formulations can also be administered enterally via the stomach or esophageal canal. The enteral preparation can be prepared in the form of a suppository by mixing with a suitable base such as an emulsifying base or a water-soluble base. It is possible, but not necessary, to administer the compound of the present disclosure topically, intranasally, intravaginally, intraocularly or the like. [00163] Pharmaceutically acceptable vehicles and / or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarders, and the like. The use of such vehicles and agents for pharmaceutically active substances is well known in the art. Its use in therapeutic compositions is intended unless any conventional vehicle or agent is incompatible with the active ingredient. Auxiliary active ingredients can also be incorporated into the composition. [00164] It is particularly advantageous to formulate the composition in unit dosage form for ease of administration and uniformity of dosage. As used herein, a dosage unit form means a physically distinct unit suitable as a unit dosage for a mammalian subject to be treated; each unit is a required pharmaceutically acceptable vehicle. Contains a predetermined amount of active substance calculated to produce the desired therapeutic effect in connection with. Details of the novel dosage unit forms of the disclosure include (a) the unique properties of the active substance and the particular therapeutic effect to be achieved, and (b) physical health as disclosed in detail herein. It is determined by and directly dependent on the technology-specific limitations of the active substances formulated for the treatment of the disease in living subjects with impaired disease states. [00165] As mentioned above, the main active ingredient may be formulated for convenient and effective administration in therapeutically effective amounts using a suitable pharmaceutically acceptable vehicle in the form of a dosage unit. The unit dosage form can 30

contain, for example, the major active compound in an amount ranging from 0.25 μg to about 2000 mg. Expressed in proportion, the active compound may be present in a carrier of about 0.25 μg to about 2000 mg / mL. In the case of a composition containing an auxiliary active ingredient, the dose is determined with reference to the usual dosage and mode of administration of the ingredient. [00166] In some embodiments, the composition is suitable for administration to a human. In some embodiments, the composition is suitable for administration to a mammal such as, in the veterinary context, domestic pets and agricultural animals. There are a wide variety of suitable formulations of the composition comprising the inhibitor of endocytosis. The following formulations and methods are merely exemplary and are in no way limiting. Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the compound dissolved in diluents, such as water, saline, or orange juice, (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as solids or granules, (c) suspensions in an appropriate liquid, and (d) suitable emulsions. Tablet forms can include one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible excipients. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such excipients as are known in the art. [00167] Examples of suitable carriers, excipients, and diluents include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline solution, syrup, methylcellulose, methyl- and propylhydroxybenzoates, talc, magnesium stearate, and mineral oil. In some embodiments, the composition comprising the inhibitor of endocytosis with a carrier as discussed herein is present in a dry formulation (such as lyophilized composition). The formulations can additionally include lubricating agents, wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavoring agents. [00168] Formulations suitable for parenteral administration include aqueous and non- aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, 31

bacteriostats, and solutes that render the formulation compatible with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. EXAMPLES [00169] The following examples are provided to further describe some of the embodiments disclosed herein. The examples are intended to illustrate, not to limit, the disclosed embodiments. Example 1. Dnm1 and Dnm3 are expressed in neurons of sensory ganglia and the spinal cord dorsal horn [00170] RNAScope® in situ hybridization was used to localize isoforms of Dnm1, Dnm2 and Dnm3 mRNAs in dorsal root ganglia (DRG), trigeminal ganglia (TG) and spinal cord of mice. Neurons were identified by Nissl staining and CGRP immunofluorescence. Satellite glial cells of sensory ganglia were identified by glutamine synthetase (GS) immunofluorescence. Dnm1 and Dnm3 mRNAs were expressed in neurons of DRG and TG (Fig. 1A; Fig. 9A). Dnm2 mRNA was detected in DRG and TG neurons at lower levels (Fig. 1A; Fig. 10A). Although Dnm1, Dnm2 and Dnm3 mRNAs were detected in CGRP+ve nociceptors (Figs. 10A-10C), Dnm isoforms were expressed in most neurons regardless of CGRP expression and diameter. Dnm isoforms were also found in non-neuronal cells within sensory ganglia, including GS+ve satellite glial cells (Fig. 1A). Dnm1 and Dnm3 mRNAs were mainly detected in neurons of deeper laminae of the dorsal horn of the spinal cord, although some neurons with cell bodies in the superficial laminae (LI, LII, LIII) also expressed Dnm1 and Dnm3 mRNAs (Fig. 1B). Fewer neurons in the spinal cord expressed Dnm2 mRNA. Analysis of extracts of DRG, TG and spinal cord by qRT-PCR confirmed the higher levels of expression of Dnm1 and Dnm3 compared to Dnm2 mRNA (Fig.1C, D; Fig.9B). Dnm1 and Dnm3 mRNAs were also localized to neurons of human DRG (Fig.1E), which adds translational relevance to these findings. 32

Example 2. Dnm knockdown in DRG reverses inflammatory and neuropathic pain [00171] To study the contribution of Dnm isoforms to nociception, intrathecal (i.t.) injections were made in mice of Dnm1, Dnm2, Dnm3 or control siRNAs. RNAScope® revealed that Dnm siRNA inhibited expression of Dnm1, Dnm2 and Dnm3 mRNA in DRG neurons after 48 h compared to control siRNA (Figs.2A-2B), while expression in the spinal cord was unaffected (Figs.11A-11B). [00172] The effects of Dnm knockdown were investigated in a preclinical model of chronic inflammatory pain in mice induced by intraplantar (i.pl.) injection of Complete Freund's Adjuvant (CFA) or vehicle (control) into the hindpaw (Fig. 2C). Dnm1, Dnm2, Dnm3 or control siRNA was administered by intrathecal injection 24 h after CFA. Withdrawal responses of the CFA-injected (left, ipsilateral) and non-injected (right, contralateral) hindpaws to stimulation with von Frey filaments and radiant heat were assessed daily to evaluate mechanical allodynia and thermal hyperalgesia, respectively. CFA-induced inflammation reduced both the withdrawal threshold to von Frey filaments and the withdrawal latency to heat in the ipsilateral paw for at least 4 d, consistent with mechanical allodynia and thermal hyperalgesia (Figs.2D-2E; Figs.12A-12B). Dnm1, Dnm2 or Dnm3 siRNAs partially reversed mechanical allodynia to a similar degree after 24 and 48 h, with a larger effect at 48 h when compared to control siRNA (Fig. 2D). When administered together, Dnm1+2+3 siRNAs reversed mechanical allodynia to 72 ^15% of baseline at 48 h (P<0.0001 compared to control siRNA). Dnm1, Dnm2 or Dnm3 siRNAs reversed thermal hyperalgesia after 24 and 48 h, with a larger effect at 24 h (Fig. 2E). Dnm1+2+3 siRNAs reversed thermal hyperalgesia by 100 ^0.6% at 24 h (P<0.0001). The anti-nociceptive actions of Dnm siRNA were lost after 72 h (Figs. 12A-12B). None of the treatments (intraplantar CFA, intrathecal siRNAs) affected withdrawal responses of the contralateral (non-injected) paw to mechanical stimuli (Figs.12C- 12F). [00173] Chronic neuropathic pain was induced by spared nerve injury (SNI) surgery of the hindpaw, which induces allodynia; control mice underwent sham surgery. Dnm1, Dnm2, Dnm3 or control siRNA was administrated intrathecally 10 days after surgery and withdrawal responses of the operated (ipsilateral) and non-operated (contralateral) hindpaws to von Frey filaments and cold were assessed daily to evaluate mechanical and cold allodynia, respectively (Fig. 3A). Dnm1 siRNA reversed mechanical and cold allodynia after 24 and 48 h when compared to control siRNA, although the inhibitory effects were lost after 72 h (Fig. 3B). Dnm1+2+3 siRNAs strongly inhibited mechanical and cold allodynia at 24, 48 and 72 h (Fig. 33

3C). The largest effect on mechanical allodynia was after 48 h, when the response was 42 ^5% of baseline (P<0.0001). The largest effect on cold allodynia was after 24 h, when the response was 71 ^0.2% of baseline (P<0.0001). None of the treatments (SNI surgery, intrathecal siRNA) affected withdrawal responses of the contralateral (non-operated) paw to mechanical stimuli (Fig.13A). [00174] Non-evoked behavior was assessed using a behavioral spectrometer, which quantifies activity of unrestrained mice and eliminates operator bias. Behavior was monitored for 20 min at 48 h after intrathecal injection of Dnm or control siRNA into SNI and sham mice. The effects of Dnm or control siRNAs on non-evoked nociceptive behavior in SNI mice and on normal behavior in sham mice were assessed. In mice receiving control siRNA, the number of visits to the center area was reduced in SNI compared to sham mice (Figs. 3D-3E). Dnm1+2+3 siRNAs normalized the number of visits to the center area in SNI mice but had no effects in sham mice. In sham mice, Dnm1+2+3 siRNAs did not affect average velocity, track length, total activity, ambulation, grooming or wall distance when compared with control siRNA (Fig. 13B). Example 3. AAK1 knockdown in DRG reverses inflammatory and neuropathic pain [00175] RNAScope® revealed Aak1 mRNA in neurons of DRG, TG and spinal cord dorsal horn (Fig.4A; Fig.9A). Aak1 mRNA detected in CGRP+ve DRG neurons but was expressed in most neurons (Fig. 4B). Aak1 mRNA was also detected in GS+ve satellite glial cells of sensory ganglia. qRT-PCR analyses confirmed expression of Aak1 mRNA in DRG, TG and spinal cord (Fig. 4C). AAK1 mRNA was also localized to neurons of human DRG neurons (Fig.4D). [00176] Intrathecal AAK1 siRNA depleted Aak1 mRNA in DRG neurons after 24 h compared to control siRNA, determined by RNAScope® (Figs. 5A-5B); Aak1 expression in the spinal cord was unaffected (Figs. 11A-11B). To evaluate effects on nociception, AAK1 or control siRNA was injected intrathecally to mice 24 h after intraplantar injection of CFA or 10 d after SNI surgery (Figs. 5C-5D). AAK1 siRNA partially reversed CFA-evoked mechanical allodynia and almost completely reversed thermal hyperalgesia when compared to control siRNA (Fig. 5C). AAK1 siRNA reversed mechanical allodynia to 52 ^9% of baseline (P<0.0001 compared to control siRNA) and thermal hyperalgesia to 89 ^0.8% of baseline (P<0.01) after 48 h. AAK1 siRNA partially reversed SNI-evoked mechanical and cold allodynia (Fig. 5D). AAK1 siRNA reversed mechanical allodynia to 28 ^4% of baseline at 48 h (P<0.01) and reversed cold allodynia to 54 ^0.3% of baseline at 24 h (P<0.01). AAK1 siRNA 34

did not affect withdrawal responses of the contralateral paw (Figs.14A-14B). In mice receiving control siRNA, the number of visits to the center area of the field was reduced in SNI compared to sham mice. AAK1 siRNA partially restored the number of visits to the center area in SNI mice, although this difference was not significant due to variability of these results (Figs.5E- 5F). In sham mice, AAK1 siRNA did not affect any measured behavior (Fig.14C). Example 4. Dnm and Aak1 inhibitors reverse inflammatory and neuropathic pain [00177] Since Dnm and AAK1 siRNAs reverse nociception, inhibitors of endocytosis offer a therapeutic approach for pain management. To investigate this hypothesis, the effects of inhibitors of Dnm (Dyngo4a) ¹⁷ , clathrin (PitStop2) ¹⁸ and AAK1 (LP935509 ¹⁵ , SGC-AAK1- 1 ¹⁹ ) on inflammatory and neuropathic pain were examined. [00178] Dyngo4a, PitStop2, inactive analogs (control) (5 µl, 50 µM, i.t.), LP935509, SGC- AAK1-1 (5 µl, 1 - 10 µg, i.t.) or vehicle (control) was administered 48 h after CFA (i.pl.) (Fig. 6A). Dyngo4a partially reversed mechanical allodynia and thermal hyperalgesia when compared to vehicle, with a maximum inhibitory effect at 1 h of 80±11% for mechanical allodynia (P<0.0001 compared to vehicle) and 75±0.8% for thermal hyperalgesia (P<0.05) (Fig. 6B). PitStop2 reversed CFA-evoked mechanical allodynia and thermal hyperalgesia similarly to Dyngo4a (Fig. 6B). LP935509 dose-dependently inhibited mechanical allodynia, with a maximal effect for 10 µg at 2 h of 78±8% of baseline (P<0.0001) (Fig.6C, left panel). LP935509 almost completely reversed thermal hyperalgesia, with a maximal effect for 10 µg at 2 h of 90±0.8% of baseline (P<0.0001) (Fig. 6D, left panel). Likewise, SGC-AAK1-1 reversed CFA-evoked mechanical allodynia and thermal hyperalgesia similarly to LP935509 (Fig.6C, right panel; Fig.6D, right panel). [00179] Inhibitors of Dnm, clathrin or AAK1 were administered 10 days after SNI surgery (Fig. 6E). Dyngo4a reversed SNI-evoked mechanical and cold allodynia with a maximum inhibitory effect at 1 h of 61±10% of baseline for mechanical and 69±0.3% of baseline for cold allodynia (P<0.01) (Fig. 6F). PitStop2 similarly reversed SNI-induced mechanical and cold allodynia (Fig. 6F). LP935509 and SGC-AAK1-1 partially reversed SNI-evoked mechanical and cold allodynia from 1- 4 h (Figs. 6G-6H). Maximal inhibitory effects of LP935509 (10 µg) were at 2 h for mechanical allodynia (79±9% of baseline, P<0.0001) and 1 h for cold allodynia (61±0.3% of baseline, P<0.0001). [00180] Inactive analogs of Dyngo4a and PitStop2 or vehicle did not affect CFA- or SNI- evoked allodynia or hyperalgesia. None of the treatments affected withdrawal responses of the contralateral paw to mechanical stimuli (Figs.15A-15F). 35

[00181] Thus, Dnm and AAK1 siRNA and inhibitors reverse nociception in preclinical models of chronic inflammatory and neuropathic pain without discernable effects on normal motor functions. Example 5. Dnm1 siRNA reduces the number of SVs in spinal cord synapses [00182] Transmission electron microscopy was used to examine the effects of knockdown of Dnm mRNA on SV recycling in the dorsal horn. A characteristic feature of synapses in mice treated with Dnm1 siRNA was a reduction in the number of SVs and an increase in the proportion of clathrin-coated vesicular profiles when compared to synapses in mice treated with control siRNA (Figs.7A-7H). Many of the coated profiles in Dnm1 siRNA-treated mice appeared to be interconnected clathrin-coated buds (Figs.7E-7F). These results are in line with the effects of Dnm1 deletion on the morphological appearance of synapses ⁶ . Example 6. Dnm siRNA attenuates activation of nociceptors [00183] In addition to inhibiting synaptic transmission, endocytosis inhibitors curtail signaling of GPCRs, including PAR ₂ , in nociceptors and thereby blunt persistent nociception ¹² . To examine the role of Dnm in GPCR-evoked nociception, Dnm or control siRNA was administered (i.t.) 48 h before intraplantar injection of trypsin (10 μL, 80 nM; PAR2 agonist). In mice receiving control siRNA, trypsin induced mechanical allodynia after 60 min (Fig.8A). Dnm1+2+3 siRNA inhibited trypsin-evoked allodynia. To ascertain whether these effects depend on disruption of trypsin-evoked sensitization of nociceptors, the rheobase (minimal input current to fire action potential) of small diameter DRG neurons was measured by patch- clamp recording. DRG were preincubated with trypsin (100 nM, 10 min), washed and rheobase was measured 0 or 30 min later (Fig.8B). In DRG from control siRNA mice, trypsin decreased the rheobase at 0 and 30 min (control 79±15 pA; 0 min 30±4 pA, P=0.002 vs. control; 30 min 26±4 pA, P=0.001 vs. control, 1-way ANOVA, Dunnett’s test, Fig. 8C). Dnm1+2+3 siRNA did not block the initial effects of trypsin (control 72±12 pA, 0 min 34±5 pA, P=0.003 vs. control) but prevented the sustained effects of trypsin (30 min, 68±8 pA, P=0.7 vs. control, Fig.8D). Thus, trypsin causes an immediate and a sustained hyperexcitability of nociceptors; the sustained effect requires PAR2 endosomal signaling. Example 7. Dnm1 and AAK1 shRNA knockdown induces long-lasting reversal of inflammatory and neuropathic pain [00184] To determine whether a more sustained knockdown of Dnm or AAK1 would have a larger and longer-lasting antinociceptive effect, Dnm1, AAK1 or CTR shRNA was administered to mice (i.t. injection). Dnm1 and AAK1 shRNA depleted Dnm1 mRNA by 36

42±6% and Aak1 mRNA by 28±4% (both P<0.01 to CTR), respectively, in DRG neurons after 72 h, determined by RNAScope®. Dnm1, AAK1 or CTR shRNA was administered to mice 24 h after CFA or 10 d after SNI surgery. Dnm1 and AAK1 shRNA caused a long-lasting reversal of CFA-evoked and SNI-evoked nociception that was fully sustained for at least 7 d (Figs. 16A-16B). In CFA-treated mice, Dnm1 and AAK1 shRNA, respectively, reversed mechanical allodynia to 78 ^8% and 71 ^6% of baseline (P<0.0001 compared to CTR shRNA) and thermal hyperalgesia to 86 ^4% and 83 ^4% of baseline (P=0.0001; P=0.001) after 72 h. In SNI mice, Dnm1 and AAK1 shRNA respectively reversed mechanical allodynia to 69 ^11% and 41 ^5% of baseline (P<0.0001 compared to CTR shRNA) and cold allodynia to 79 ^4% and 97 ^3% of baseline (P<0.0001) after 72 h. Dnm1 or AAK1 shRNA did not affect withdrawal responses of the contralateral paw to mechanical stimulation, heat or cold (Figs.17A-17B). [00185] Thus, Dnm and AAK1 siRNA, shRNA and inhibitors reverse nociception in preclinical models of inflammatory and neuropathic pain without discernable effects on normal motor functions or behavior. [00186] Results of the present disclosure reveal a major role for Dnm and AAK1 in synaptic transmission within nociceptive circuits in the dorsal horn of the spinal cord. Dnm1, Dnm3 and Aak1 mRNA were expressed in mouse and human DRG, including in peptidergic nociceptors. Intrathecal siRNA down-regulated Dnm and Aak1 mRNA in DRG neurons and reversed nociception in preclinical mouse models of chronic inflammatory and neuropathic pain. Inhibitors of Dnm, clathrin and AAK1 replicated the effects of siRNA, supporting selectivity. Dnm1 and AAK1 siRNA knockdown and inhibition blunted electrically-evoked synaptic transmission between primary sensory neurons and spinal neurons within the dorsal horn. These changes were coincident with the accumulation of SVs within presynaptic nerve terminals. The results support the hypothesis that Dnm and AAK1 mediate the endocytosis of SVs in nociceptive circuits and thereby sustain nociceptive transmission (Fig.8E). Disruption of this process ameliorates inflammatory and neuropathic pain. [00187] The conclusion that Dnm mediates synaptic transmission in nociceptive spinal circuits is supported by the prominent expression of Dnm1 and Dnm3 mRNA in DRG and spinal cord neurons. Dnm1 and Dnm3 mRNA were also expressed in human DRG neurons, raising the translational relevance of this study. Dnm1 and Dnm3 mRNA were coexpressed with CGRP in peptidergic nociceptors. Peptidergic nociceptors are sensitized during inflammatory and neuropathic pain and release neuropeptides that mediate pain transmission in the spinal cord ^{2, 21} . However, Dnm isoforms were expressed by most primary sensory 37

neurons as well as by satellite glial cells and thus participate in multiple processes. Intrathecal Dnm siRNA down-regulated Dnm mRNA in DRG neurons and reversed allodynia and hyperalgesia in mice with persistent inflammatory and neuropathic pain. Isoform-selective knockdown had anti-nociceptive actions, suggesting redundancy. Simultaneous knockdown of all isoforms was more efficacious and sustained and also normalized spontaneous nociceptive behavior in a model of neuropathic pain. The finding that intrathecal injection of Dnm and clathrin inhibitors replicated the effects of Dnm siRNA supports selectivity. [00188] Ultrastructural studies showed that Dnm1 mRNA knockdown reduced the number of SVs and caused an accumulation of CCPs in presynaptic nerve terminals of dorsal horn synapses. These morphological changes are consistent with the role of Dnm in SV endocytosis and are in accordance with reported changes in SVs and CCPs in neurons cultured from Dnm1 and Dnm1+3 knockout mice ^{6, 22} . Thus, behavioral and morphological studies support the conclusion that Dnm is necessary for endocytosis of SVs in presynaptic nerve terminals in nociceptive circuits in the dorsal horn of the spinal cord. This process enables SV recycling, which is required for ongoing neurotransmission that underlies chronic nociceptive signaling within the spinal cord. [00189] AAK1 participates in clathrin-mediated endocytosis ^{8, 9} and is a target for treatment of neuropathic pain ¹⁵ . Anatomical, behavioral and electrophysiological studies support the hypothesis that AAK1, like Dnm, mediates endocytosis of SVs in presynaptic neurons of nociceptive circuits in the dorsal horn and is thus necessary for ongoing synaptic transmission of nociceptive signals (Fig.8E). Aak1 mRNA was prominently expressed by primary sensory neurons of DRG, including peptidergic nociceptors, and in neurons of the spinal cord. In line with these results, the α-subunit isoform of the AP2 complex, which it is activated by the AAK1 phosphorylation, is preferentially expressed within CGRP+ve nociceptors ¹⁶ . Intrathecal AAK1 siRNA downregulated the Aak1 mRNA expression in DRG neurons, and reversed mechanical and thermal nociception in mice with chronic inflammatory and neuropathic pain. The observations that two distinct inhibitors of AAK1 replicated the effects of AAK1 siRNA by reversing nociceptive behavior supports selectivity. These results accord with genetic and pharmacological studies that revealed a major role of AAK1 in neuropathic pain through global deletion or systemic antagonism of AAK1 ¹⁵ . The current research identifies an anatomical site and mechanism of the pronociceptive actions of AAK1. The results support the hypothesis that AAK1 mediates SV endocytosis in presynaptic terminals of nociceptors in the dorsal horn of the spinal cord, which underlies SV recycling and sustained synaptic transmission of pain. 38

[00190] In addition to mediating endocytosis of SVs in presynaptic nerve terminals, Dnm and AAK1 may contribute to nociception by mediating endosomal signaling of pronociceptive GPCRs in primary afferent neurons and spinal neurons (Fig. 8E). Clathrin and Dnm mediate endocytosis of PAR ₂ by nociceptors and endocytosis of substance P and CGRP receptors by spinal neurons ^{10, 12, 14} . Endosomal signaling of these GPCRs activates kinases that mediate sustained activation of neurons, which is necessary for nociception. Accordingly, inhibitors of Dnm and lipid-conjugated or nanoparticle-encapsulated antagonists that target GPCRs in endosomes have sustained anti-nociceptive effects ^{10, 12, 14, 23, 24} . In the current study, intraplantar injection of trypsin evoked mechanical allodynia in mice, which is mediated by PAR ₂ ¹² . Trypsin caused an immediate and a sustained increase in excitability of nociceptors. Intrathecal Dnm1+2+3 siRNA inhibited mechanical allodynia and sustained hyperexcitability of nociceptors. These results are in agreement with the effects of Dyngo4a on trypsin-evoked nociception ¹² . These findings support the hypothesis that Dnm also contributes to nociception by mediating the endosomal signaling of PAR ₂ (and other GPCRs) that underlies neuronal hyperexcitability and pain. [00191] The present disclosure provides support for endocytosis in nociceptors as a target for the treatment of pain. An advantage is that targeting endocytosis may surmount the redundancy of pain mechanisms. A plethora of mediators initiate and maintain pain, which might explain the lack of efficacy of some highly selective inhibitors. Selectivity was enhanced herein by administering siRNA and antagonists into the intrathecal space, which preferentially targeted DRG neurons. Notably, Dnm and AAk1 siRNA and inhibitors did not affect normal motor functions and non-evoked behaviors. The systemic administration of Dnm inhibitors could disrupt essential cellular processes that depend upon endocytosis. Indeed, deletion of Dnm1 and Dnm3 is lethal in mice ^{6, 22} . However, global deletion of Aak1 and systemic administration of the AAK1 antagonist LP935509 inhibits nociception in mice and rats without effects on normal motor function ¹⁵ . The AAK1 antagonist LX9211 was safe and well tolerated in healthy subjects in phase 1 clinical trials ²⁵ . The AAK1 inhibitor SGC-AAK1-1 shows improved selectivity over the LX9211 ¹⁹ . [00192] This present disclosure has defined the contribution of Dnm and AAK1 to SV endocytosis in presynaptic terminals of nociceptive circuits in the spinal cord, which is necessary for sustained neurotransmission of nociceptive signals. Disruption of nociceptive neurotransmission offers a non-opioid approach to treat pain. 39

Example 8. Capsaicin-induced nociception was prevented by Synj1 and EndoA1 knockdown [00193] To determine whether knockdown of Synj1 and EndoA1 would prevent capsaicin- induced nociception, Synj1 siRNA, EndoA1 or control (CTR) siRNA was administered to mice. Figs. 18A-18B show the time course of the effects of Synj1, EndoA1 or CTR siRNA (intrathecal, i.t.) on capsaicin (CPS) (0.1nmol/10 µl, intraplantar, i.pl.) induced mechanical allodynia (Fig. 18A) and thermal hyperalgesia (Fig. 18B) in mice. In addition, it was shown that EndoA1 knockdown does not impair locomotor activity. Figs. 19A-19H summarize the findings that led to this conclusion. Example 9. GIPC1 knockdown prevents NGF-induced nociception and inhibits inflammatory pain [00194] To determine the effects of GIPC1 knockdown, GIPC1 or CTR siRNA was administered to mice. Figs. 20A-20C show the time course of the effects of GIPC1 or CTR siRNA (i.t.) on NGF (50 nM/10 µl, i.pl.) induced mechanical allodynia (Fig.20A) and thermal hyperalgesia (Fig. 20B) in mice. Figs. 21B-21E show the effects of intrathecal injection of GIPC1 or CTR siRNA on CFA-evoked mechanical allodynia (Figs. 21B-21C) and thermal hyperalgesia (Figs.21D-21E) in mice. GIPC1 knockdown in DRG neurons was verified using RNAScope® (Fig. 23). In addition, it was shown that GIPC1 knockdown does not impair locomotor activity. Figs.22A-22H summarize the findings that led to this conclusion. Example 10. Postoperative pain model [00195] To determine the role of Synj1 and EndoA1 in transmitting post-operative pain, Synj1, EndoA1 or CTR siRNA was administered (i.t.) 48 h before paw incision. The effect of Synj1 and EndoA1 knockdown was evaluated in a postoperative pain model. Mechanical allodynia and thermal hyperalgesia were assessed (Figs.24A-24C). Synj1 and EndoA1 siRNA inhibited mechanical allodynia (Fig.24A) and thermal hyperalgesia (Fig.24B). [00196] Below are the methods used in the Examples described above. [00197] Animals. All experiments and procedures were in accordance with the guidelines recommended by the National Institute of Health, the International Association for the study of Pain, the National Centre for the Replacement, Refinement, and Reduction of Animals in Research ARRIVE guidelines, and were approved by the New York University Institutional Animal Care and Use Committee and the Monash University Animal Ethics Committee. Male and female C57BL6 mice (8-10 weeks, Charles River) were housed four per cage at 22 ± 0.5°C under a controlled 14/10 h light/dark cycle with free access to food and water. Mice were 40

randomly assigned to experimental groups, and the group size was based on our previous similar studies. Investigators were blind to treatments. [00198] Human tissues. DRG recovery was reviewed by the University of Cincinnati IRB (#00003152, Study ID 2015-5302) and was exempted. L4 and L5 DRGs were recovered from donors withing 90 min of cross-clamp ²⁷ . For RNAScope, DRGs were immersion fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) overnight, cryoprotected in 30% sucrose, frozen in Optimal Cutting Temperature compound (Tissue Tek) and 14 µm sections were prepared. [00199] Collection of mouse tissues. Mice were anesthetized (5% isoflurane) and perfused through the ascending aorta with PBS and then 4% paraformaldehyde in PBS. DRG, trigeminal ganglia (TG) and spinal cord were removed, post-fixed in 4% paraformaldehyde in PBS at 4°C for 1 h or overnight, respectively, placed in 30% sucrose solution for 24 h at 4°C, and embedded in OCT. Frozen sections (10-12 µm) were mounted onto Superfrost Plus slides (Fisher), dried (15 min) and stored at -20°C. [00200] RNAScope® in situ hybridization and immunofluorescence. Mice were anesthetized (5% isoflurane) and perfused through the ascending aorta with PBS and then by 4% paraformaldehyde in PBS. DRG and spinal cord were removed, post-fixed in 4% paraformaldehyde in PBS for 1 hour or overnight at 4°C, respectively, placed in 30% sucrose solution for 24 h at 4 °C, and embedded in OCT. Frozen sections (10-12 µm) were mounted onto Superfrost Plus slides (Fisher). Slides were dried for 15 min at room temperature (RT) and stored at -20˚C. The RNAScope® system (Advanced Cell Diagnostics) was used per manufacturer’s directions for fresh-frozen tissue except for omission of the initial on-slide fixation step. Probe hybridization and detection using the Multiplex Fluorescent Kit v2 followed the manufacturer’s directions. Probes to Mm-Dnm1 (#446931-C3), Mm-Dnm2 (#451831-C1), Mm-Dnm3 (#451841-C2), Mm-Aak1 (#1097711-C1) (mouse), Hs-Dnm1 (#1099091-C1), Hs-Dnm2 (#821511-C1), Hs-Dnm3 (#1105961-C2) and Hs-AAK1 (#531971- C1) (human) were used. Sections were incubated with Opal 620 reagent (1:1000, cat#FP1495001KT, Akoya Biosciences) for detection. To detect neurons, hybridized slides were incubated with NeuroTrace™ 500/525 Green Fluorescent Nissl Stain (1:500, cat#N21480, Invitrogen) (10 min, RT). To detect satellite glial cells and peptidergic neurons, hybridized slides were incubated with rabbit anti-glutamine synthetase antibody (GS, 1:1000, cat#ab49873, Abcam, Cambridge, MA) or rabbit anti-calcitonin gene-related peptide (CGRP, 1:1000, cat#C8198, Sigma), respectively (overnight, 4°C). Slides were washed and incubated 41

with goat anti-rabbit Alexa Fluor® 488 (1:1000; cat#A21206, Invitrogen) (1 h, RT). Slides were washed and incubated with DAPI (1 µg/ml, 5 min) and mounted in ProLong® Gold Antifade (Thermo Fisher). Sections were observed using a Leica SP8 confocal microscope with HCX PL APO 40x (NA 1.30) oil objective. [00201] RNAScope® quantification. Dnm 1, 2 or 3 and Aak1 were localized by RNAScope®. Confocal images were analyzed using Fiji ImageJ (NIH) according to ACD Bio- Techne Technical Note. Regions of interest were defined by applying a threshold with the moments setting (Min & Max) and analyzing particles with size range from 0 to infinity. Regions of interest were overlaid on the original micrograph and the number of dots per area were quantified. Results are expressed as dots/mm ² tissue. A total of 3 images (20X magnification) were analyzed for each mouse (N=4 mice for control and treatment groups; 12 images analyzed per experimental group). [00202] qRT-PCR. RNA was isolated from snap frozen tissues using Direct-zol RNA MiniPrep kit (cat#R2051 Zymo Research). cDNA was prepared using MultiScribe Reverse Transcriptase (cat#4311235 Thermo Fisher). cDNA (50 ng) was amplified for 40 cycles by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) using Dnm1 (DNM1, Mn00802468_m1), Dnm2 (DNM2, Mn00514582_m1), Dnm3 (DNM3, Mn00554098_m1), AAK1 (Mn01183675_m1) and GAPDH (Mn99999915_g1) primers, QuantStudio 3 Real-Time PCR System, and TaqMan Fast Advanced PCR Mastermix (cat#4444556 Thermo Fisher). All samples were analyzed at least in duplicate and normalized by GAPDH expression. The relative expression ratio per condition was calculated based on the method described ²⁸ . [00203] Intrathecal siRNA in mice. Cationic liposome and adjuvant anionic polymer (polyglutamate) were used to deliver siRNA ²⁹ . The following siRNAs were used: ON- TARGETplus siRNA mouse Dnm1 siRNA (cat#L-043277-01-0005), mouse Dnm2 (cat#L- 044919-02-0005), mouse Dnm3 (cat#L-059061-01-0005), mouse AAK1 (cat#L-065639-00- 0005) or non-targeting control siRNA (cat#D-001810-10-05) (Dharmacon) (Table 1). [00204] Mouse Sh3gl2 siRNA (L-060213-01-0005), Synj1 siRNA (L-053808-00-0005), Gipc1 siRNA (L-062534-00-0005) or nontargeting control (CTR) siRNA (D-001810-10-05) were from Dharmacon. The Sh3gl2, Synj1, Gipc1 or CTR siRNA (1.25 µg) was mixed with polyethyleneimine-based transfection reagent (in vivo-jetPEI, 201-50 G; Polyplus) in an 8:1 N:P ratio (polyethyleneimine nitrogen to DNA phosphate ratio). The siRNA in vivo jetPEI 42

mixture were administered to conscious mice by i.t. injection (L4- L5, 5 µL). Gipc1 expression in DRG (L4-L5) were analyzed by RNAScope in situ hybridization, 48 h after siRNA injection. [00205] Exemplary siRNA sequences which may be used in the practice of the present disclosure are described in Table 1. 43

Table 1. Exemplary siRNA sequences Target siRNA Sequence mDnm1 GCGUGUACCCUGAGCGUGU (SEQ ID NO: 1), UGGUAUUGCUCCUGCGACA (SEQ ID NO: 2), GGGAGGAGAUGGAGCGAAU (SEQ ID NO: 3), GCUGAGACCGAUCGAGUCA (SEQ ID NO: 4). mDnm2 ACCAUGAGCUGCUGGCUUA (SEQ ID NO: 5), GAAGAGGGCCAUACCCAAU (SEQ ID NO: 6), AAAGUUCGGUGCUCGAGAA (SEQ ID NO: 7), GGAGCCCGCAUCAAUCGUA (SEQ ID NO: 8). mDnm3 CAACGAAGGCUGACGAUAA (SEQ ID NO: 9), GCUCAGAGUUCCUGCGAAA (SEQ ID NO: 10), GUGAAUGGAACUCGUAUAA (SEQ ID NO: 11), GCAGAAACAGACCGCGUAA (SEQ ID NO: 12). mAAK1 GAAGGUGGAUUCGCUCUUG (SEQ ID NO: 13), GGACUCAAAUCUCCUGACA (SEQ ID NO: 14), GCAGAUAUUUGGGCUCUAG (SEQ ID NO: 15), AAAUGUGCCUUGAAACGUA (SEQ ID NO: 16). Control UGGUUUACAUGUCGACUAA (SEQ ID NO: 17), UGGUUUACAUGUUGUGUGA (SEQ ID NO: 18), UGGUUUACAUGUUUUCUGA (SEQ ID NO: 19), UGGUUUACAUGUUUUCCUA (SEQ ID NO: 20). mSynj1 GGAAAGAGCUAUUAAAUCG (SEQ ID NO: 21), CCACUGAGUUUAUAUCAUU (SEQ ID NO: 22), CCAAAGUACUGGAUGCAUA (SEQ ID NO: 23), GAAGAUAAAAUGUGGGUUA (SEQ ID NO: 24). mSh3gl2 GCUGGAAGGCCGACGCUUA (SEQ ID NO: 25), CUUCAGAGGUUUAGCGUGC (SEQ ID NO: 26), GAAGGUGGGAGGAGCGGAA (SEQ ID NO: 27), GUAUAUACGUAGCCCGUUU (SEQ ID NO: 28). mGIPC1 GCAUCGAGGGCUUCACUAA (SEQ ID NO: 29), CGUCGGCCUUUGAGGAGAA (SEQ ID NO: 30), GUGGAUGACUUGCUAGAGA (SEQ ID NO: 31), GCUGAGGCCUUCCGACUAC (SEQ ID NO: 32). 44

[00206] siRNAs (50 ng, 0.5 μl of 100 ng/μl stock) were mixed with 0.5 μl of adjuvant polyglutamate (0.1 μg/μl stock) and 1.5 μl sterile 0.15 M NaCl. Liposome solution, cationic lipid 2-3-[bis-(3-amino-propyl)-amino]-propylamino-N-ditetradecylc arbamoylmethyl- acetamide (DMAPAP) and L-α-dioleoyl phosphatidylethanolamine (DOPE) (DMAPAP/DOPE, 1/1 M:M) (2.5 μl of 200 μM) was added to siRNA/adjuvant, vortexed for 1 min, and incubated (30 min, RT). The siRNA lipoplexes were administered to conscious mice by intrathecal injection (L4-L5, 5 μl), 24 h after CFA intraplantar injection or 10 days after SNI surgery. Dnm1, Dnm2, Dnm3 and Aak1 expression in DRGs and spinal cord (L4-L5) were analyzed by RNAScope® in situ hybridization, 24 or 48 h after siRNA injection. Intrathecal administration of shRNA to mice. [00207] Mouse Dnm1 (cat# TL500548), AAK1 (cat# TL508098) shRNA plasmids and noneffective 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector were from OriGene (Table 2). The Dnm1 shRNA or AAK1 shRNA (1.25 µg) was mixed with polyethyleneimine- based transfection reagent (in vivo-jetPEI®, 201-50G; Polyplus) in an 8:1 N:P ratio (polyethyleneimine nitrogen to DNA phosphate ratio) ³⁶ . The shRNAs in vivo-jetPEI® mixture were administered to conscious mice by i.t. injection (L4-L5, 5 μl), 24 h after CFA injection (i.pl.) or 10 d after SNI surgery. Dnm1 and Aak1 expression in DRG (L4-L5) were analyzed by RNAScope® in situ hybridization, 72 h after shRNA injection. Exemplary shRNA sequences which may be used in the practice of the present disclosure are described in Table 2. 45

Table 2. Exemplary shRNA sequences Target shRNA Sequence mDnm1 ACCACAGAATATGCCGAGTTCCTGCACTG (SEQ ID NO: 33); CTTCATAGGCTTTGCCAATGCTCAGCAGA (SEQ ID NO: 34); GTGTGGACATGGTTATCTCGGAGCTAATC (SEQ ID NO: 35); GCTGAGAATCTGTCCTGGTACAAGGATGA (SEQ ID NO: 36). mAAK1 TGTTGGCGGAAGGTGGATTCGCTCTTGTC (SEQ ID NO: 41); AGAGCCAGGTGGCGATTTGTGACGGAAGC (SEQ ID NO: 42); GGCACAGACGGATTCTCAGTGATGTAACC (SEQ ID NO: 43); GGCAGCACTTCTGATGCTGTTATTGACAA (SEQ ID NO: 44). 46

[00208] Intrathecal endocytosis inhibitors. Dyngo4a (Dnm inhibitor, 50 nM), PitStop2 (clathrin inhibitor, 50 nM), inactive analogs (trademarks of Children’s Medical Research Institute, Newcastle Innovation, and Freie Universitat Berlin), LP935509 (AAK1 inhibitor, cat#HY-117626, MedChemExpress; 1 – 10 µg/5µl) and SGC-AAK1-1 (AAK1 inhibitor, cat#6528, Tocris; 1 – 10 µg/5µl) or vehicle (PBS, 5%DMSO/PBS) were injected intrathecally (5 μl, L4/L5) into conscious mice. The inhibitors were injected 48 h after CFA or 10 d after SNI. [00209] Inflammatory pain. CFA (1 mg/ml) or vehicle (0.9% NaCl) was administered by intraplantar injection (10 µl) into the right hindpaw of sedated mice (2% isoflurane). siRNA or inhibitors were injected intrathecally 24 h or 48 h after CFA. Mechanical allodynia and thermal hyperalgesia were assessed. [00210] Neuropathic pain. The SNI (spared nerve injury) and sham surgeries were made as described ³⁰ . Briefly, mice were anesthetized with isoflurane. A skin and muscle incision were made in the thigh to expose the sciatic nerve innervating the left hindpaw. The tibial and common peroneal nerves were ligated and transected distal to the ligature. The third branch, the sural nerve, was left intact. For sham controls, the nerves were exposed but not ligated or transected. At day 10 d after surgery, Dnm and AAK1 siRNA or inhibitors were intrathecally injected. Mechanical and cold allodynia were assessed. [00211] Mechanical allodynia. Mechanical allodynia was assessed by measuring hindpaw withdrawal response to von Frey filament stimulation using the up-and-down method ³¹ . Mice were acclimatized to the testing apparatus, which comprised individual clear Plexiglass boxes on an elevated wire mesh platform to facilitate access to the plantar surface of the hindpaws, for 1 h/d for 2 days. A series of von Frey filaments (0.02, 0.07, 0.16, 0.4, 1.0, and 2 g; Stoelting) were applied perpendicular to the plantar surface of hindpaw. The test began with an application of 0.4 g filament. A positive response was defined as a clear paw withdrawal or shaking. Whenever a positive response occurred, the next lower filament was applied, and whenever a negative response occurred, the next higher filament was applied. The testing consisted of 6 stimuli, and the pattern of response was converted to a 50% von Frey threshold ³² . [00212] Thermal hyperalgesia. The Hargreaves apparatus was used to evaluate hypersensitivity to heat (Ugo Basile) ³³ . Mice were acclimatized to the testing apparatus, which comprised individual clear Plexiglass chambers and a radiant heat source, for 1 h/d for 2 days. The time between stimulus onset and paw withdrawal was measured automatically, giving an 47

index of the thermal nociceptive threshold. Significant decreases in paw withdrawal latency were interpreted as evidence of thermal hyperalgesia. The latency, expressed in seconds, was evaluated before (basal) and in different time points after the treatment. [00213] Cold allodynia. Cold allodynia was assessed by measuring the acute nociceptive response to the acetone evoked evaporative cooling ³⁴ . A droplet (50 μL) of acetone, formed on the flat-tip needle of a syringe, was gently touched to the plantar surface of the mouse hind paw, and the time spent in elevation and licking of the plantar region over a 60 s period was measured. The latency, expressed in seconds, was evaluated before (basal) and in different time points after the treatment. [00214] Spontaneous pain behavior. Non-evoked nociception was assessed using a behavioral spectrometer, which eliminates operator bias (Behavior Sequencer, Behavioral Instruments) ³⁵ . The spectrometer comprised a 40 cm ² arena with a CCD camera mounted in the center of the ceiling and a door aperture in the front area of the arena. Mouse movement was assessed by a floor mounted vibration sensor and 32 wall mounted infrared transmitter and receiver pairs. Mice were individually placed in the center of the behavioral spectrometer and their behavior was recorded, tracked, evaluated and analyzed using a computerized video tracking system (Viewer3, BiObserve) for 30 min. Total distance traveled in the open field, average velocity of locomotion, wall distance, ambulation and grooming were recorded and analyzed. Spontaneous pain and locomotor activity were assessed at the peak analgesic effects of siRNA or drugs. [00215] Spinal slice preparation. Adult C57BL/6J mice were anesthetized (5% isoflurane), decapitated and the lumbar region of the spinal cord with the dorsal root exposed by laminectomy was removed. Parasagittal spinal cord slices with the dorsal root attached (300 μm) were sectioned on a vibratome (Leica VT 1200s) in ice cold (0-4°C) oxygenated sucrose‐ based ACSF that contained (mM): 100 sucrose, 63 NaCl, 2.5 KCl, 1.2 NaH ₂ PO ₄ , 1.2 MgCl ₂ , 25 glucose, 25 NaHCO3 and 5 Na ascorbate. Slices were then incubated for 15 min at 34°C in NMDG‐based recovery ACSF composed of (mM): 93 NMDG, 2.5 KCl, 1.2 NaH ₂ PO ₄ , 30 NaHCO3, 20 HEPES, 25 glucose, 5 Na ascorbate, 2 thiourea, 3 Na pyruvate, 10 MgSO4 and 0.5 CaCl ₂ and adjusted to pH 7.4 with HCl. After the recovery incubation, slices were transferred to oxygenated ACSF with the following composition (mM): 125 NaCl, 2.5 KCl, 1.25 NaH ₂ PO ₄ , 1.2 MgCl ₂ , 2.5 CaCl ₂ , 25 glucose and 25 NaHCO ₃ for 45 min at 36°C and then maintained at RT prior to transfer to the recording chamber. All ACSF solutions were equilibrated with 95% O ₂ and 5% CO ₂ . Spinal cord slices were collected 48 h after 48

administration of siRNA (i.t.). Some slices were preincubated with inhibitors of Dnm (Dyngo4a, 30 µM) or AAK1 (SGC-AAK1-1, 100 nM; LP-935509, 1 µM) for 10 min. [00216] Spinal cord electrophysiology. Slices were transferred to the recording chamber and continuously superfused with ACSF equilibrated with 95% O ₂ /5% CO ₂ at a rate of 2ml/min at RT. Dodt-contrast optics were used to identify dorsal horn neurons in the translucent substantia gelatinosa layer of the superficial dorsal horn. Evoked and spontaneous excitatory post- synaptic currents (eEPSCs, sEPSCs respectively) were recorded in whole-cell voltage clamp using a CsCl-based internal solution composed of (mM): 140 CsCl, 10 EGTA, 5 HEPES, 2 CaCl2, 2 MgATP, 0.3 NaGTP, 5 QX-314.Cl and 0.1% biocytin (osmolarity 285–295 mosmol/l). Patch clamp electrodes had resistances between 3-5 MΩ and neurons were held at -65 mV (not corrected for the liquid junction potential of 4 mV). A bipolar stimulating electrode was placed in the dorsal root entry zone for electrical stimulation of evoked post-synaptic currents. For paired pulse experiments, evoked currents were elicited by two consecutive stimuli of identical strength separated by 40 ms. Paired pulse ratio (PPR) was calculated by dividing the second pulse by the first (PSC2/PSC1). All eEPSCs were recorded in gabazine (10 μM) and strychnine (0.5 μM). In experiments with endocytosis inhibitors, baseline recordings were made prior to superfusion of with inhibitors for 10 min, after which recordings were repeated in the presence of the inhibitor. In the inhibitor studies, the 1Hz protocol was reduced to 8 pulses to prevent plastic changes at the synapse occurring between the baseline recording and post-inhibitor recording. [00217] SV imaging. Lumbar spinal cord slices were incubated in Mg ²⁺ -free ACSF that contained (mM): 125 NaCl, 2.5 KCl, 1.25 NaH2PO4, 25 NaHCO3, 2.5 CaCl2, 10 glucose and 0.14-AP for 10 min to increase neuronal activity. Slices were transferred to Mg ²⁺ -free ACSF with 4-AP containing 8 μM FM1-43 (Abcam, Australia) for 3 min, washed with ACSF for 2 min, and then incubated in 1 mM ADVASEP-7 (Sigma) for 2 min. Slices were washed with ACSF for 2 min and the ADVASEP-7 incubation was repeated. Slices were placed in the recording chamber and washed for a further 15 min in ACSF prior to imaging. A bipolar stimulating electrode was placed in the dorsal root entry zone of the spinal cord and stimulated for 10 s at 1Hz, 4-6V to facilitate the release of vesicles from the presynaptic terminals. Optical recordings were completed on an upright fluorescence microscope (BX51W1, Olympus) under 40x magnification using a Cy3/TRITC filter set CCD camera (C11440 Orca Flash 4.0, Hamamatsu). Image sequences were analyzed using Fiji NIH image software. 49

[00218] Transmission electron microscopy. Adult C57BL/6 mice were treated with Dnm1 or CTR siRNA (i.t.). After 48 h, mice were anaesthetized (5% isoflurane), decapitated and the lumbar region of the spinal cord exposed by laminectomy and removed. Spinal cord slices were prepared, and a bipolar stimulating electrode was placed in the dorsal root entry zone for electrical stimulation of evoked post-synaptic currents. Spinal cord sections were fixed in 2% paraformaldehyde, 2.5% glutaraldehyde, 0.1M sucrose in 0.1M MBP (pH 7.4). Sections were post-fixed in 1% OsO4 and 1.5% K4Fe(CN)6 in ddH2O, dehydrated in graded series of ethanol and propylene oxide, and embedded in EMbed 812 (Electron Microscopy Sciences). Ultrathin sections (70 nm) were cut and stained with uranyl acetate and lead citrate. Stained grids were imaged with Talos120C transmission electron microscope (Thermo Fisher Scientific) and recorded using Gatan (4k x 4k) OneView Camera with software Digital Micrograph (Gatan Inc., Pleasanton, CA). Morphometry and measurements were made using Image J by an investigator blinded to the experimental conditions. For analysis of SV numbers, 10331 vesicles in total from 212 Dnm1 siRNA and 182 CTR siRNA synapses from 2 separate preparations. To eliminate bias that could arise from choosing synapses based on their size or SV number, synapses were selected based on the presence of an active zone. All SVs within the adjacent SV cluster were then counted. In experiments designed to assess the effects of Dnm1 siRNA treatment on the abundance of CCPs, 13276 vesicles (CCP + SV) in total were counted; results were expressed as the percentage of CCPs relative to the total of SVs + CCPs/synapse (n = 182 CTR siRNA and 212 Dnm1 siRNA synapses). [00219] Trypsin-evoked nociception. Mice were pre-treated with Dnm1+2+3 or CTR siRNA intrathecally. After 48 h, trypsin (10 µl, 80 nM) was injected into the right hindpaw. Mechanical allodynia was assessed 1 h after trypsin injection ¹² . [00220] Trypsin-evoked hyperexcitability of nociceptors. Mice were pre-treated with Dnm1+2+3 or CTR siRNA intrathecally. After 48 h, DRG (L3-L5) were dispersed by incubation in collagenase (4 mg/ml, Gibco) and dispase (4.7 mg/ml, Gibco) for 15 min at 37 °C and triturated with a 200 µL pipette tip. Neurons were plated onto coverslips coated with laminin (0.013 mg/ml) and poly-L-ornithine (0.1 mg/ml) in 12-well plates. Neurons were cultured in F12 medium (Sigma) containing 10% fetal bovine serum, penicillin and streptomycin and maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2 until retrieval (16 h) for patch clamp recordings. Small-diameter (<30 µm) neurons were selected for patch clamp recording. Changes in excitability were quantified by measuring rheobase. Whole-cell perforated patch-clamp recordings were made using Amphotericin B (240 μg/ml, 50

Sigma Aldrich) in current clamp mode at room temperature. The recording chamber was perfused with external solution at 2 ml/min. Recordings were made using Multiclamp 700B amplifiers, digitized by Digidata 1440A, and processed using pClamp 10.7 software (Molecular Devices). Solutions had the following composition (mM): pipette - K-gluconate 110, KCl 30, HEPES 10, MgCl21, CaCl22; pH 7.25 with 1 M KOH; external - NaCl 140, KCl 5, HEPES 10, glucose 10, MgCl ₂ 1, CaCl ₂ 2; pH to 7.3-7.4 with 1 M NaOH. Neurons were preincubated with trypsin (100 nM) for 10 min and washed. Rheobase was measured at T=0 or T=30 min after washing. [00221] Capsaicin-evoked nociception. Mice were pre-treated with Synj1, EndoA1 or CTR siRNA intrathecally. After 48 h, capsaicin (CPS, 0.1 nmol/10 µl) was administered by intraplantar injection (i.pl.) into the right hindpaw of mice. Mechanical allodynia and thermal hyperalgesia were assessed 1 up to 24 h after capsaicin injection. [00222] Plantar incision. Postoperative pain model was induced by plantar incision, according to the model previously described ³⁷ . The mice were anesthetized with 2% isoflurane, 100% 021 L/min via a nose cone. After antiseptic preparation of the right hind paw with 10% povidone–iodine solution (Betadine Solution, Purdue Frederick, Norwalk, CT), a 5-mm longitudinal incision was made with a no. 11 blade through the skin and fascia of the plantar foot. The incision was started 2 mm from the proximal edge of the heel and extended toward the toes, and the skin was closed with a single mattress suture. Control mice underwent a sham procedure involving anesthesia and antiseptic preparation without an incision. Synj1, EndoA1 or CTR siRNA was injected intrathecally 48 h before the plantar incision. Mechanical allodynia and thermal hyperalgesia were assessed on 1, 3, 6 and 24 h after the incision. [00223] NGF-evoked nociception. Mice were pre-treated with Gipc1 or CTR siRNA intrathecally. After 48 h, mouse NGF (mNGF, 50 ng/10 μl) was administered by intraplantar injection (i.pl.) into the right hindpaw of mice. Mechanical allodynia and thermal hyperalgesia were assessed 0.5 up to 24 h after NGF injection. [00224] Statistics. Data are presented as mean ± standard error of the mean (SEM). Groups of n=6 to 10 mice were studied. Differences were assessed using Student's two-tailed t test for two comparisons and 1- or 2-way ANOVA and Sídák, Tukey or Dunnett’s post-hoc test for multiple comparisons. P<0.05 was considered significant at the 95% confidence level. Sample sizes and statistical tests are specified in figure legends. 51

References 1. Shipton EA, Shipton EE, Shipton AJ. A Review of the Opioid Epidemic: What Do We Do About It? Pain Ther 7, 23-36 (2018). 2. Basbaum AI, Bautista DM, Scherrer G, Julius D. Cellular and molecular mechanisms of pain. Cell 139, 267-284 (2009). 3. Chanaday NL, Cousin MA, Milosevic I, Watanabe S, Morgan JR. The Synaptic Vesicle Cycle Revisited: New Insights into the Modes and Mechanisms. J Neurosci 39, 8209-8216 (2019). 4. Sudhof TC. The synaptic vesicle cycle. Annu Rev Neurosci 27, 509-547 (2004). 5. Ferguson SM, De Camilli P. Dynamin, a membrane-remodelling GTPase. Nat Rev Mol Cell Biol 13, 75-88 (2012). 6. Raimondi A, et al. Overlapping role of dynamin isoforms in synaptic vesicle endocytosis. Neuron 70, 1100-1114 (2011). 7. Lu W, Ma H, Sheng ZH, Mochida S. Dynamin and activity regulate synaptic vesicle recycling in sympathetic neurons. J Biol Chem 284, 1930-1937 (2009). 8. Conner SD, Schmid SL. Identification of an adaptor-associated kinase, AAK1, as a regulator of clathrin-mediated endocytosis. J Cell Biol 156, 921-929 (2002). 9. Ricotta D, Conner SD, Schmid SL, von Figura K, Honing S. Phosphorylation of the AP2 mu subunit by AAK1 mediates high affinity binding to membrane protein sorting signals. J Cell Biol 156, 791-795 (2002). 10. Jensen DD, et al. Neurokinin 1 receptor signaling in endosomes mediates sustained nociception and is a viable therapeutic target for prolonged pain relief. Sci Transl Med 9, (2017). 11. Jimenez-Vargas NN, et al. Endosomal signaling of delta opioid receptors is an endogenous mechanism and therapeutic target for relief from inflammatory pain. Proc Natl Acad Sci U S A 117, 15281-15292 (2020). 12. Jimenez-Vargas NN, et al. Protease-activated receptor-2 in endosomes signals persistent pain of irritable bowel syndrome. Proc Natl Acad Sci U S A 115, E7438- E7447 (2018). 13. Ramirez-Garcia PD, et al. A pH-responsive nanoparticle targets the neurokinin 1 receptor in endosomes to prevent chronic pain. Nat Nanotechnol 14, 1150-1159 (2019). 52

14. Yarwood RE, et al. Endosomal signaling of the receptor for calcitonin gene-related peptide mediates pain transmission. Proc Natl Acad Sci U S A 114, 12309-12314 (2017). 15. Kostich W, et al. Inhibition of AAK1 Kinase as a Novel Therapeutic Approach to Treat Neuropathic Pain. J Pharmacol Exp Ther 358, 371-386 (2016). 16. Powell R, et al. Inhibiting endocytosis in CGRP(+) nociceptors attenuates inflammatory pain-like behavior. Nat Commun 12, 5812 (2021). 17. Robertson MJ, Deane FM, Robinson PJ, McCluskey A. Synthesis of Dynole 34-2, Dynole 2-24 and Dyngo 4a for investigating dynamin GTPase. Nat Protoc 9, 851-870 (2014). 18. Robertson MJ, et al. Synthesis of the Pitstop family of clathrin inhibitors. Nat Protoc 9, 1592-1606 (2014). 19. Agajanian MJ, et al. WNT Activates the AAK1 Kinase to Promote Clathrin-Mediated Endocytosis of LRP6 and Establish a Negative Feedback Loop. Cell Rep 26, 79-93 e78 (2019). 20. Cousin MA, Robinson PJ. Mechanisms of synaptic vesicle recycling illuminated by fluorescent dyes. J Neurochem 73, 2227-2239 (1999). 21. Finnerup NB, Kuner R, Jensen TS. Neuropathic Pain: From Mechanisms to Treatment. Physiol Rev 101, 259-301 (2021). 22. Ferguson SM, et al. A selective activity-dependent requirement for dynamin 1 in synaptic vesicle endocytosis. Science 316, 570-574 (2007). 23. De Logu F, et al. Schwann cell endosome CGRP signals elicit periorbital mechanical allodynia in mice. Nat Commun 13, 646 (2022). 24. Latorre R, et al. Mice expressing fluorescent PAR2 reveal that endocytosis mediates colonic inflammation and pain. Proc Natl Acad Sci U S A 119, (2022). 25. Bundrant L, et al. Results of two Phase 1, Randomized, Double-blind, Placebo- controlled, Studies (Ascending Single-dose and Multiple-dose Studies) to Determine the Safety, Tolerability, and Pharmacokinetics of Orally Administered LX9211 in Healthy Participants. Clin Ther 43, 1029-1050 (2021). 26. Deuis JR, Dvorakova LS, Vetter I. Methods Used to Evaluate Pain Behaviors in Rodents. Front Mol Neurosci 10, 284 (2017). 53

27. Valtcheva MV, et al. Surgical extraction of human dorsal root ganglia from organ donors and preparation of primary sensory neuron cultures. Nat Protoc 11, 1877-1888 (2016). 28. Pfaffl MW. A new mathematical model for relative quantification in real-time RT- PCR. Nucleic Acids Res 29, e45 (2001). 29. Schlegel A, et al. Anionic polymers for decreased toxicity and enhanced in vivo delivery of siRNA complexed with cationic liposomes. J Control Release 152, 393- 401 (2011). 30. Pertin M, Gosselin RD, Decosterd I. The spared nerve injury model of neuropathic pain. Methods Mol Biol 851, 205-212 (2012). 31. Dixon WJ. Efficient analysis of experimental observations. Annu Rev Pharmacol Toxicol 20, 441-462 (1980). 32. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53, 55-63 (1994). 33. Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32, 77-88 (1988). 34. Tonello R, et al. The peptide Phalpha1beta, from spider venom, acts as a TRPA1 channel antagonist with antinociceptive effects in mice. Br J Pharmacol 174, 57-69 (2017). 35. Brodkin J, et al. Validation and implementation of a novel high-throughput behavioral phenotyping instrument for mice. J Neurosci Methods 224, 48-57 (2014). 36. Cheng CF, Cheng JK, Chen CY, Rau RH, Chang YC, Tsaur ML. Nerve growth factor-induced synapse-like structures in contralateral sensory ganglia contribute to chronic mirror-image pain. Pain 156(11), 2295-2309 (2015). 37. Pogatzki, E.M., Raja, S.N. A mouse model of incisional pain. Anesthesiology 99, 1023-1027 (2003). * * * [00225] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims. 54

[00226] All patents, applications, publications, test methods, literature, and other materials cited herein are hereby incorporated by reference in their entirety as if physically present in this specification. 55

List of Sequences SEQ ID NO: 1 mDnm1 siRNA 1 GCGUGUACCCUGAGCGUGU SEQ ID NO: 2 mDnm1 siRNA 2 UGGUAUUGCUCCUGCGACA SEQ ID NO: 3 mDnm1 siRNA 3 GGGAGGAGAUGGAGCGAAU SEQ ID NO: 4 mDnm1 siRNA 4 GCUGAGACCGAUCGAGUCA SEQ ID NO: 5 mDnm2 siRNA 1 ACCAUGAGCUGCUGGCUUA SEQ ID NO: 6 mDnm2 siRNA 2 GAAGAGGGCCAUACCCAAU SEQ ID NO: 7 mDnm2 siRNA 3 AAAGUUCGGUGCUCGAGAA SEQ ID NO: 8 mDnm2 siRNA 4 GGAGCCCGCAUCAAUCGUA SEQ ID NO: 9 mDnm3 siRNA 1 CAACGAAGGCUGACGAUAA SEQ ID NO: 10 mDnm3 siRNA 2 GCUCAGAGUUCCUGCGAAA SEQ ID NO: 11 mDnm3 siRNA 3 GUGAAUGGAACUCGUAUAA SEQ ID NO: 12 mDnm3 siRNA 4 GCAGAAACAGACCGCGUAA SEQ ID NO: 13 mAAK1 siRNA 1 GAAGGUGGAUUCGCUCUUG SEQ ID NO: 14 mAAK1 siRNA 2 GGACUCAAAUCUCCUGACA SEQ ID NO: 15 mAAK1 siRNA 3 GCAGAUAUUUGGGCUCUAG SEQ ID NO: 16 mAAK1 siRNA 4 AAAUGUGCCUUGAAACGUA 56

SEQ ID NO: 17 Control 1 UGGUUUACAUGUCGACUAA SEQ ID NO: 18 Control 2 UGGUUUACAUGUUGUGUGA SEQ ID NO: 19 Control 3 UGGUUUACAUGUUUUCUGA SEQ ID NO: 20 Control 4 UGGUUUACAUGUUUUCCUA SEQ ID NO: 21 Mouse Synj1 siRNA 1 GGAAAGAGCUAUUAAAUCG SEQ ID NO: 22 Mouse Synj1 siRNA 2 CCACUGAGUUUAUAUCAUU SEQ ID NO: 23 Mouse Synj1 siRNA 3 CCAAAGUACUGGAUGCAUA SEQ ID NO: 24 Mouse Synj1 siRNA 4 GAAGAUAAAAUGUGGGUUA SEQ ID NO: 25 Mouse Sh3gl2 siRNA 1 GCUGGAAGGCCGACGCUUA SEQ ID NO: 26 Mouse Sh3gl2 siRNA 2 CUUCAGAGGUUUAGCGUGC SEQ ID NO: 27 Mouse Sh3gl2 siRNA 3 GAAGGUGGGAGGAGCGGAA SEQ ID NO: 28 Mouse Sh3gl2 siRNA 4 GUAUAUACGUAGCCCGUUU SEQ ID NO: 29 Mouse Gipc1 siRNA 1 GCAUCGAGGGCUUCACUAA SEQ ID NO: 30 Mouse Gipc1 siRNA 2 CGUCGGCCUUUGAGGAGAA SEQ ID NO: 31 Mouse Gipc1 siRNA 3 GUGGAUGACUUGCUAGAGA SEQ ID NO: 32 Mouse Gipc1 siRNA 4 GCUGAGGCCUUCCGACUAC 57

SEQ ID NO: 33 mDnm1 shRNA 1 ACCACAGAATATGCCGAGTTCCTGCACTG SEQ ID NO: 34 mDnm1 shRNA 2 CTTCATAGGCTTTGCCAATGCTCAGCAGA SEQ ID NO: 35 mDnm1 shRNA 3 GTGTGGACATGGTTATCTCGGAGCTAATC SEQ ID NO: 36 mDnm1 shRNA 4 GCTGAGAATCTGTCCTGGTACAAGGATGA SEQ ID NO: 37 mDnm1 shRNA 1U ACCACAGAAUAUGCCGAGUUCCUGCACUG SEQ ID NO: 38 mDnm1 shRNA 2U CUUCAUAGGCUUUGCCAAUGCUCAGCAGA SEQ ID NO: 39 mDnm1 shRNA 3U GUGUGGACAUGGUUAUCUCGGAGCUAAUC SEQ ID NO: 40 mDnm1 shRNA 4U GCUGAGAAUCUGUCCUGGUACAAGGAUGA SEQ ID NO: 41 mAAK1 shRNA 1 TGTTGGCGGAAGGTGGATTCGCTCTTGTC SEQ ID NO: 42 mAAK1 shRNA 2 AGAGCCAGGTGGCGATTTGTGACGGAAGC SEQ ID NO: 43 mAAK1 shRNA 3 GGCACAGACGGATTCTCAGTGATGTAACC SEQ ID NO: 44 mAAK1 shRNA 4 GGCAGCACTTCTGATGCTGTTATTGACAA SEQ ID NO: 45 mAAK1 shRNA 1U UGUUGGCGGAAGGUGGAUUCGCUCUUGUC SEQ ID NO: 46 mAAK1 shRNA 2U AGAGCCAGGUGGCGAUUUGUGACGGAAGC SEQ ID NO: 47 mAAK1 shRNA 3U GGCACAGACGGAUUCUCAGUGAUGUAACC SEQ ID NO: 48 mAAK1 shRNA 4U GGCAGCACUUCUGAUGCUGUUAUUGACAA 58