ENGINEERED CONSTRUCTS FOR ENHANCED STABILITY OR LOCALIZATION

OF RNA PAYLOADS

CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63/415,917, entitled “ENGINEERED CONSTRUCTS WITH STABLE STRUCTURES FOR ENHANCED STABILITY OF RNA PAYLOADS,” filed October 13, 2022, and U.S. Provisional Application No. 63/471,335, entitled “ENGINEERED CONSTRUCTS FOR ENHANCED STABILITY OR LOCALIZATION OF RNA PAYLOADS,” filed June 6, 2023, each of which applications are herein incorporated by reference in their entireties for all purposes.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in extensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 5, 2023, is named “421688- 716021_SL.xml” and is 605 kilobytes in size.

BACKGROUND

[0003] A wide variety of diseases and disorders are caused by mutations, deletions, altered expression, or altered splicing of genes. RNAs can serve as a mechanism for gene therapy, such as by editing a mutated RNA sequence associated with a disease. There is a need for recombinant polynucleotides to increase or modulate expression of RNA payloads. Additionally, there is a need for RNA payloads with enhanced stability.

SUMMARY

[0004] In various aspects, the present disclosure provides a polynucleotide encoding an RNA, wherein the RNA comprises: a target-binding sequence capable of hybridizing to a target sequence, and a stability element comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO: 42; b) SEQ ID NO: 36; c) SEQ ID NO: 57; d) SEQ ID NO: 22; e) SEQ ID NO: 19; f) SEQ ID NO: 425; or g) SEQ ID NO: 35.

[0005] In some aspects, the stability element comprises a sequence having at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of: a) SEQ ID NO: 42; b) SEQ ID NO: 36; c) SEQ ID NO: 57; d) SEQ ID NO: 22; e) SEQ ID NO: 19; f) SEQ ID NO: 425; or g) SEQ ID NO: 35. In some aspects, the stability element is encoded by a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO: 478; b) SEQ ID NO: 472; c) SEQ ID NO: 493; d) SEQ ID NO: 458; e) SEQ ID NO: 455; f) SEQ ID NO: 527; or g) SEQ ID NO: 471. In some aspects, the stability element is encoded by a sequence having at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of: a) SEQ ID NO: 478; b) SEQ ID NO: 472; c) SEQ ID NO: 493; d) SEQ ID NO: 458; e) SEQ ID NO: 455; f) SEQ ID NO: 527; or g) SEQ ID NO: 471.

[0006] In some aspects, the stability element comprises a secondary structure. In some aspects, the secondary structure is a tetraloop or a stem loop.

[0007] In various aspects, the present disclosure provides polynucleotide encoding an RNA, wherein the RNA comprises: a target-binding sequence capable of hybridizing to a target sequence, and a stability element comprising a sequence having at least 80% sequence identity to any one of: SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426.

[0008] In some aspects, the stability element comprises a sequence of any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some aspects, the stability element is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 444 - SEQ ID NO: 528. In some aspects, the stability element is encoded by a sequence comprising any one of SEQ ID NO: 444 - SEQ ID NO: 528. In some aspects, the stability element comprises a sequence of: a) SEQ ID NO: 19, b) SEQ ID NO: 20, c) SEQ ID NO: 21, d) SEQ ID NO: 22, e) SEQ ID NO: 23, f) SEQ ID NO: 24, g) SEQ ID NO: 25, h) SEQ ID NO: 26, i) SEQ ID NO: 27, j) SEQ ID NO: 28, k) SEQ ID NO: 29, 1) SEQ ID NO: 30, m) SEQ ID NO: 31, n) SEQ ID NO: 32, o) SEQ ID NO: 33, p) SEQ ID NO: 34, q) SEQ ID NO: 35, r) SEQ ID NO: 36, s) SEQ ID NO: 37, t) SEQ ID NO: 38, u) SEQ ID NO: 39, v) SEQ ID NO: 40, w) SEQ ID NO: 41, x) SEQ ID NO: 42, y) SEQ ID NO: 43, z) SEQ ID NO: 44, aa) SEQ ID NO: 45, ab) SEQ ID NO: 46, ac) SEQ ID NO: 47, ad) SEQ ID NO: 48, ae) SEQ ID NO: 49, af) SEQ ID NO: 50, ag) SEQ ID NO: 51, ah) SEQ ID NO: 52, ai) SEQ ID NO: 53, aj) SEQ ID NO: 54, ak) SEQ ID NO: 55, al) SEQ ID NO: 56, am) SEQ ID NO: 57, an) SEQ ID NO: 58, ao) SEQ ID NO: 59, ap) SEQ ID NO: 60, aq) SEQ ID NO: 61, ar) SEQ ID NO: 62, as) SEQ ID NO: 63, at) SEQ ID NO: 64, au) SEQ ID NO: 65, av) SEQ ID NO: 425, or aw) SEQ ID NO: 426.

[0009] In some aspects, the stability element is encoded by a sequence comprising: a) SEQ ID NO: 455, b) SEQ ID NO: 456, c) SEQ ID NO: 457, d) SEQ ID NO: 458, e) SEQ ID NO: 459, f) SEQ ID NO: 460, g) SEQ ID NO: 461, h) SEQ ID NO: 462, i) SEQ ID NO: 463, j) SEQ ID NO: 464, k) SEQ ID NO: 465, 1) SEQ ID NO: 466, m) SEQ ID NO: 467, n) SEQ ID NO: 468, o) SEQ ID NO: 469, p) SEQ ID NO: 470, q) SEQ ID NO: 471, r) SEQ ID NO: 472, s) SEQ ID NO: 473, t) SEQ ID NO: 474, u) SEQ ID NO: 475, v) SEQ ID NO: 476, w) SEQ ID NO: 477, x) SEQ ID NO: 478, y) SEQ ID NO: 479, z) SEQ ID NO: 480, aa) SEQ ID NO: 481, ab) SEQ ID NO: 482, ac) SEQ ID NO: 483, ad) SEQ ID NO: 484, ae) SEQ ID NO: 485, af) SEQ ID NO: 486, ag) SEQ ID NO: 487, ah) SEQ ID NO: 488, ai) SEQ ID NO: 489, aj) SEQ ID NO: 490, ak) SEQ ID NO: 491, al) SEQ ID NO: 492, am) SEQ ID NO: 493, an) SEQ ID NO: 494, ao) SEQ ID NO: 495, ap) SEQ ID NO: 496, aq) SEQ ID NO: 497, ar) SEQ ID NO: 498, as) SEQ ID NO: 499, at) SEQ ID NO: 500, au) SEQ ID NO: 501, av) SEQ ID NO: 527, or aw) SEQ ID NO: 528.

[0010] In some aspects, the stability element comprises a secondary structure. In some aspects, the secondary structure comprises an aptamer, a tetraloop, a G-quadruplex, a stem-loop, a multi-loop, a 3 -way junction, a knot, or a pseudoknot. In some aspects, the pseudoknot is a zika pseudoknot. In some aspects, the stability element comprises a viral RNA sequence. In some aspects, the viral RNA sequence is a flavivirus RNA sequence. In some aspects, the viral RNA sequence is from Murray Valley encephalitis virus, West Nile virus, Zika virus, Dengue virus, or Yellow Fever virus. In some aspects, the stability element is located 5’ of the targetbinding sequence.

[0011] In some aspects, the stability element is located 3’ of the target-binding sequence. In some aspects, the RNA further comprises a localization element. In some aspects, the localization element alters the subcellular localization of the RNA. In some aspects, the RBP- binding element comprises one or more, two or more, or three or more RBP-binding motifs. In some aspects, the RBP-binding motifs are a sequence each independently selected from any one of SEQ ID NO: 322 - SEQ ID NO: 424. In some aspects, the RBP-binding motifs are encoded by a sequence each independently selected from any one of SEQ ID NO: 756 - SEQ ID NO: 858. In some aspects, the RBP-binding motifs are a sequence each independently selected from: a) AACUGC (SEQ ID NO: 322), b) CAACCA (SEQ ID NO: 335), c) CCAACC (SEQ ID NO: 342), d) CCAUCC (SEQ ID NO: 344), e) CGUGCC (SEQ ID NO: 352), f) CUGACA (SEQ ID NO: 358), g) GCAGCA (SEQ ID NO: 371), h) GCAGGC (SEQ ID NO: 372), i) GCGCGG (SEQ ID NO: 375), j) GCUUGC (SEQ ID NO: 377), k) GGAUGU (SEQ ID NO: 382), 1) UAAUUU (SEQ ID NO: 394), m) UAUCAA (SEQ ID NO: 397), n) UCCCUG (SEQ ID NO: 402), o) UUCUGU (SEQ ID NO: 417), p) UUGUGA (SEQ ID NO: 419), or q) UUUUAC (SEQ ID NO: 424). In some aspects, the RBP-binding motifs are encoded by a sequence each independently selected from: a) AACTGC (SEQ ID NO: 756), b) CAACCA (SEQ ID NO: 769), c) CCAACC (SEQ ID NO: 776), d) CCATCC (SEQ ID NO: 778), e) CGTGCC (SEQ ID NO: 786), f) CTGACA (SEQ ID NO: 792), g) GCAGCA (SEQ ID NO: 805), h) GCAGGC (SEQ ID NO: 806), i) GCGCGG (SEQ ID NO: 809), j) GCTTGC (SEQ ID NO: 811), k) GGATGT (SEQ ID NO: 816), 1) TAATTT (SEQ ID NO: 828), m) TATCAA (SEQ ID NO: 831), n) TCCCTG (SEQ ID NO: 836), o) TTCTGT (SEQ ID NO: 851), p) TTGTGA (SEQ ID NO: 853), or q) TTTTAC (SEQ ID NO: 858).

[0012] In some aspects, the RBP-binding element comprises a sequence of: SEQ ID NO: 428, SEQ ID NO: 100, SEQ ID NO: 306, SEQ ID NO: 167, SEQ ID NO: 219, or SEQ ID NO: 142. In some aspects, the RBP binding element is encoded by a sequence comprising: SEQ ID NO: 427, SEQ ID NO: 538, SEQ ID NO: 744, SEQ ID NO: 605, SEQ ID NO: 657, or SEQ ID NO: 580.

[0013] In various aspects, the present disclosure provides a polynucleotide encoding an RNA, wherein the RNA comprises: a first target-binding sequence capable of hybridizing to a target sequence, and a second sequence having at least 80% sequence identity to any one of: a) SEQ ID NO: 42; b) SEQ ID NO: 36; c) SEQ ID NO: 57; d) SEQ ID NO: 22; e) SEQ ID NO: 19; f) SEQ ID NO: 425; or g) SEQ ID NO: 35.

[0014] In some aspects, the polynucleotide as described herein comprises a second sequence having at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of: a) SEQ ID NO: 42; b) SEQ ID NO: 36; c) SEQ ID NO: 57; d) SEQ ID NO: 22; e) SEQ ID NO: 19; f) SEQ ID NO: 425; or g) SEQ ID NO: 35. In some aspects, the second sequence is encoded by a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO: 478; b) SEQ ID NO: 472; c) SEQ ID NO: 493; d) SEQ ID NO: 458; e) SEQ ID NO: 455; f) SEQ ID NO: 527; or g) SEQ ID NO: 471. In some aspects, the second sequence is encoded by a sequence having at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of: a) SEQ ID NO: 478; b) SEQ ID NO: 472; c) SEQ ID NO: 493; d) SEQ ID NO: 458; e) SEQ ID NO: 455; f) SEQ ID NO: 527; or g) SEQ ID NO: 471. In some aspects, the second sequence comprises a secondary structure. In some aspects, the secondary structure is a tetraloop or a stem loop.

[0015] In various aspects, the present disclosure provides a polynucleotide encoding an RNA, wherein the RNA comprises: a target-binding sequence capable of hybridizing to a target sequence, and a localization element, wherein the localization element is an RNA binding protein (RBP)-binding element comprising a sequence having at least 80% sequence identity to: SEQ ID NO: 428, SEQ ID NO: 100, SEQ ID NO: 306, SEQ ID NO: 167, SEQ ID NO: 219, or SEQ ID NO: 142.

[0016] In some aspects, the RBP binding element is encoded by a sequence comprising: SEQ ID NO: 427, SEQ ID NO: 538, SEQ ID NO: 744, SEQ ID NO: 605, SEQ ID NO: 657, or SEQ ID NO: 580. In some aspects, the localization element alters the subcellular localization of the RNA. [0017] In some aspects, the polynucleotide as described herein further comprises a stability element comprising a sequence having at least 80% sequence identity to any one of: SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some aspects, the stability element comprises a sequence of any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some aspects, the stability element is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 444 - SEQ ID NO: 528. In some aspects, the stability element is encoded by a sequence comprising any one of SEQ ID NO: 444 - SEQ ID NO: 528.

[0018] In various aspects, the present disclosure provides a polynucleotide encoding an RNA, wherein the RNA comprises: a target-binding sequence capable of hybridizing to a target sequence, and an RNA accessory element, wherein the RNA accessory element increases the stability of the RNA, alters subcellular localization of the RNA, or both.

[0019] In some aspects, the RNA accessory element comprises a stability element, a localization element, or combinations thereof. In some aspects, the localization element alters the subcellular localization of the RNA. In some aspects, the localization element is an RNA binding protein (RBP)-binding element. In some aspects, the RBP-binding element is capable of binding an RNA binding protein. In some aspects, the RNA binding protein is CELF1, CNOT4, CPEB1, CPEB2, CPEB4, DAZ3, ELAVL1, ESRP1, ESRP2, EWSR1, FUBP1, FUBP3, FUS, FXR2, HNRNPA0, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPC, HNRNPCL1, HNRNPD, HNRNPF, HNRNPH2, HNRNPK, HNRNPL, IGF2BP2, ILF2, KHDRBS3, LIN28A, MBNL1, MSI1, NOVAI, NUPL2, PABPC1, PABPC4, PABPN1, PCBP2, PPRC1, QK1, RALY, RALYL, RBFOX2, RBFOX3, RBM22, RBM23, RBM24, RBM3, RBM4, RBM42, RBM45, RBM47, RBM5, RBM6, RBM8A, RBMS1, RBMS2, SART3, SF1, SFPQ, SNRNP70, SRSF1, SRSF10, SRSF8, TAF15, TARDBP, TRA2A, TRNAU1AP, U2AF2, YBX2, or ZFP36. [0020] In some aspects, the RBP-binding element comprises a first RBP-binding motif. In some aspects, the first RBP-binding motif comprises a sequence having at least 80% sequence identity to any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some aspects, the first RBP-binding motif comprises a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some aspects, the first RBP-binding motif is encoded by a sequence comprising at least 80% sequence identity to any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). In some aspects, the first RBP-binding motif is encoded by a sequence of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858).

[0021] In some aspects, the first RBP-binding motif comprises a sequence of: a) AACUGC (SEQ ID NO: 322), b) CAACCA (SEQ ID NO: 335), c) CCAACC (SEQ ID NO: 342), d) CCAUCC (SEQ ID NO: 344), e) CGUGCC (SEQ ID NO: 352), f) CUGACA (SEQ ID NO: 358), g) GCAGCA (SEQ ID NO: 371), h) GCAGGC (SEQ ID NO: 372), i) GCGCGG (SEQ ID NO: 375), j) GCUUGC (SEQ ID NO: 377), k) GGAUGU (SEQ ID NO: 382), 1) UAAUUU (SEQ ID NO: 394), m) UAUCAA (SEQ ID NO: 397), n) UCCCUG (SEQ ID NO: 402), o) UUCUGU (SEQ ID NO: 417), p) UUGUGA (SEQ ID NO: 419), or q) UUUUAC (SEQ ID NO: 424). In some aspects, the first RBP-binding motif is encoded by a sequence comprising: a) AACTGC (SEQ ID NO: 756), b) CAACCA (SEQ ID NO: 769), c) CCAACC (SEQ ID NO: 776), d) CCATCC (SEQ ID NO: 778), e) CGTGCC (SEQ ID NO: 786), f) CTGACA (SEQ ID NO: 792), g) GCAGCA (SEQ ID NO: 805), h) GCAGGC (SEQ ID NO: 806), i) GCGCGG (SEQ ID NO: 809), j) GCTTGC (SEQ ID NO: 811), k) GGATGT (SEQ ID NO: 816), 1) TAATTT (SEQ ID NO: 828), m) TATCAA (SEQ ID NO: 831), n) TCCCTG (SEQ ID NO: 836), o) TTCTGT (SEQ ID NO: 851), p) TTGTGA (SEQ ID NO: 853), or q) TTTTAC (SEQ ID NO: 858).

[0022] In some aspects, the RBP-binding element comprises a second RBP-binding motif. In some aspects, the second RBP-binding motif comprises a sequence having at least 80% sequence identity to any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some aspects, the second RBP-binding motif comprises a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some aspects, the second RBP-binding motif is encoded by a sequence comprising at least 80% sequence identity to any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). In some aspects, the second RBP-binding motif is encoded by a sequence of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858).

[0023] In some aspects, the RBP-binding element comprises a third RBP-binding motif. In some aspects, the third RBP-binding motif comprises a sequence having at least 80% sequence identity to any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some aspects, the third RBP- binding motif comprises a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some aspects, the third RBP-binding motif is encoded by a sequence comprising at least 80% sequence identity to any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). In some aspects, the third RBP-binding motif is encoded by a sequence of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). [0024] In some aspects, the RBP-binding element comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 91 - SEQ ID NO: 317. In some aspects, the RBP-binding element comprises a sequence of any one of SEQ ID NO: 91 - SEQ ID NO: 317. In some aspects, the RBP-binding element is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 529 - SEQ ID NO: 755. In some aspects, the RBP-binding element is encoded by a sequence comprising any one of SEQ ID NO: 529 - SEQ ID NO: 755.

[0025] In some aspects, the RBP-binding element comprises a sequence of: a) SEQ ID NO: 91, b) SEQ ID NO: 92, c) SEQ ID NO: 93, d) SEQ ID NO: 95, e) SEQ ID NO: 96, f) SEQ ID NO: 100, g) SEQ ID NO: 108, h) SEQ ID NO: 115, i) SEQ ID NO: 124, j) SEQ ID NO: 125, k) SEQ ID NO: 132, 1) SEQ ID NO: 136, m) SEQ ID NO: 142, n) SEQ ID NO: 162, o) SEQ ID NO: 167, p) SEQ ID NO: 168, q) SEQ ID NO: 176, r) SEQ ID NO: 179, s) SEQ ID NO: 182, t) SEQ ID NO: 188, u) SEQ ID NO: 190, v) SEQ ID NO: 199, w) SEQ ID NO: 215, x) SEQ ID NO: 219, y) SEQ ID NO: 227, z) SEQ ID NO: 236, aa) SEQ ID NO: 238, ab) SEQ ID NO: 247, ac) SEQ ID NO: 248, ad) SEQ ID NO: 255, ae) SEQ ID NO: 269, af) SEQ ID NO: 275, ag) SEQ ID NO: 283, ah) SEQ ID NO: 295, ai) SEQ ID NO: 304, or aj) SEQ ID NO: 306. In some aspects, the RBP-binding element is encoded by a sequence comprising: a) SEQ ID NO: 529, b) SEQ ID NO: 530, c) SEQ ID NO: 531, d) SEQ ID NO: 533, e) SEQ ID NO: 534, f) SEQ ID NO: 538, g) SEQ ID NO: 546, h) SEQ ID NO: 553, i) SEQ ID NO: 562, j) SEQ ID NO: 563, k) SEQ ID NO: 570, 1) SEQ ID NO: 574, m) SEQ ID NO: 580, n) SEQ ID NO: 600, o) SEQ ID NO: 605, p) SEQ ID NO: 606, q) SEQ ID NO: 614, r) SEQ ID NO: 617, s) SEQ ID NO: 620, t) SEQ ID NO: 626, u) SEQ ID NO: 628, v) SEQ ID NO: 637, w) SEQ ID NO: 653, x) SEQ ID NO: 657, y) SEQ ID NO: 665, z) SEQ ID NO: 674, aa) SEQ ID NO: 676, ab) SEQ ID NO: 685, ac) SEQ ID NO: 686, ad) SEQ ID NO: 693, ae) SEQ ID NO: 707, af) SEQ ID NO: 713, ag) SEQ ID NO: 721, ah) SEQ ID NO: 733, ai) SEQ ID NO: 742, or aj) SEQ ID NO: 744. [0026] In some aspects, the localization element is positioned 3’ of the target-binding sequence. In some aspects, the localization element is positioned 5’ of the target-binding sequence. In some aspects, the localization element comprises a length of not less than 2 and not more than 500 nucleotides. In some aspects, the localization element comprises a length of not less than 20 and not more than 400, not less than 20 or not more than 300, not less than 20 and not more than 200, or not less than 20 or not more than 100 nucleotides. In some aspects, the localization element comprises a length of not less than 25 and not more than 55 nucleotides. [0027] In some aspects, the stability element increases the stability of the RNA. In some aspects, the stability element comprises an exonuclease-resistant structure. In some aspects, the exonuclease-resistant structure and/or stability element comprises a secondary structure. In some aspects, the secondary structure comprises an aptamer, a tetraloop, a G-quadruplex, a stem-loop, a multi-loop, a 3 -way junction, a knot, or a pseudoknot. In some aspects, the pseudoknot is a zika pseudoknot. In some aspects, the exonuclease-resistant structure comprises a viral RNA sequence. In some aspects, the viral RNA sequence is a flavivirus RNA sequence. In some aspects, the viral RNA sequence is from Murray Valley encephalitis virus, West Nile virus, Zika virus, Dengue virus, or Yellow Fever virus.

[0028] In some aspects, the exonuclease-resistant structure comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some aspects, the exonuclease-resistant structure comprises a sequence of any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some aspects, the exonuclease-resistant structure is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 444 - SEQ ID NO: 528. In some aspects, the exonuclease-resistant structure is encoded by a sequence comprising any one of SEQ ID NO: 444 - SEQ ID NO: 528.

[0029] In some aspects, the exonuclease-resistant structure comprises a sequence of: a) SEQ ID NO: 19, b) SEQ ID NO: 20, c) SEQ ID NO: 21, d) SEQ ID NO: 22, e) SEQ ID NO: 23, f) SEQ ID NO: 24, g) SEQ ID NO: 25, h) SEQ ID NO: 26, i) SEQ ID NO: 27, j) SEQ ID NO: 28, k) SEQ ID NO: 29, 1) SEQ ID NO: 30, m) SEQ ID NO: 31, n) SEQ ID NO: 32, o) SEQ ID NO: 33, p) SEQ ID NO: 34, q) SEQ ID NO: 35, r) SEQ ID NO: 36, s) SEQ ID NO: 37, t) SEQ ID NO: 38, u) SEQ ID NO: 39, v) SEQ ID NO: 40, w) SEQ ID NO: 41, x) SEQ ID NO: 42, y) SEQ ID NO: 43, z) SEQ ID NO: 44, aa) SEQ ID NO: 45, ab) SEQ ID NO: 46, ac) SEQ ID NO: 47, ad) SEQ ID NO: 48, ae) SEQ ID NO: 49, af) SEQ ID NO: 50, ag) SEQ ID NO: 51, ah) SEQ ID NO: 52, ai) SEQ ID NO: 53, aj) SEQ ID NO: 54, ak) SEQ ID NO: 55, al) SEQ ID NO: 56, am) SEQ ID NO: 57, an) SEQ ID NO: 58, ao) SEQ ID NO: 59, ap) SEQ ID NO: 60, aq) SEQ ID NO: 61, ar) SEQ ID NO: 62, as) SEQ ID NO: 63, at) SEQ ID NO: 64, au) SEQ ID NO: 65, av) SEQ ID NO: 425, or aw) SEQ ID NO: 426. In some aspects, the exonuclease-resistant structure is encoded by a sequence comprising: a) SEQ ID NO: 455, b) SEQ ID NO: 456, c) SEQ ID NO: 457, d) SEQ ID NO: 458, e) SEQ ID NO: 459, f) SEQ ID NO: 460, g) SEQ ID NO: 461, h) SEQ ID NO: 462, i) SEQ ID NO: 463, j) SEQ ID NO: 464, k) SEQ ID NO: 465, 1) SEQ ID NO: 466, m) SEQ ID NO: 467, n) SEQ ID NO: 468, o) SEQ ID NO: 469, p) SEQ ID NO: 470, q) SEQ ID NO: 471, r) SEQ ID NO: 472, s) SEQ ID NO: 473, t) SEQ ID NO: 474, u) SEQ ID NO: 475, v) SEQ ID NO: 476, w) SEQ ID NO: 477, x) SEQ ID NO: 478, y) SEQ ID NO: 479, z) SEQ ID NO: 480, aa) SEQ ID NO: 481, ab) SEQ ID NO: 482, ac) SEQ ID NO: 483, ad) SEQ ID NO: 484, ae) SEQ ID NO: 485, af) SEQ ID NO: 486, ag) SEQ ID NO: 487, ah) SEQ ID NO: 488, ai) SEQ ID NO: 489, aj) SEQ ID NO: 490, ak) SEQ ID NO: 491, al) SEQ ID NO: 492, am) SEQ ID NO: 493, an) SEQ ID NO: 494, ao) SEQ ID NO: 495, ap) SEQ ID NO: 496, aq) SEQ ID NO: 497, ar) SEQ ID NO: 498, as) SEQ ID NO: 499, at) SEQ ID NO: 500, au) SEQ ID NO: 501, av) SEQ ID NO: 527, or aw) SEQ ID NO: 528. In some aspects, the stability element is located 5’ of the target-binding sequence. In some aspects, the stability element is located 5’ of the targetbinding sequence.

[0030] In some aspects, particular stability element and 6-mer RBP-binding motif combinations may include:

(i) a stability element of UGAUAUGGU and a RBP-binding motif sequence of AACUGC;

(ii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CAACCA;

(iii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CCAACC;

(iv) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CCAUCC;

(v) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CGUGCC;

(vi) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CUGACA;

(vii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCAGCA;

(viii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCAGGC;

(ix) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCGCGG; (x) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCUUGC;

(xi) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GGAUGU;

(xii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UAAUUU;

(xiii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UAUCAA;

(xiv) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UCCCUG;

(xv) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UUCUGU;

(xvi) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UUGUGA;

(xvii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UUUUAC;

(xviii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of AACUGC;

(xix) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CAACCA;

(xx) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CCAACC;

(xxi) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CCAUCC;

(xxii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CGUGCC;

(xxiii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CUGACA;

(xxiv) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCAGCA;

(xxv) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCAGGC;

(xxvi) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCGCGG;

(xxvii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCUUGC;

(xxviii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GGAUGU;

(xxix) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UAAUUU; (xxx) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UAUCAA;

(xxxi) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UCCCUG;

(xxxii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UUCUGU;

(xxxiii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UUGUGA;

(xxxiv) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UUUUAC;

(xxxv) a stability element of UGAAAG and a RBP-binding motif sequence of AACUGC; (xxxvi) a stability element of UGAAAG and a RBP-binding motif sequence of CAACCA; (xxxvii) a stability element of UGAAAG and a RBP-binding motif sequence of CCAACC; (xxxviii) a stability element of UGAAAG and a RBP-binding motif sequence of CCAUCC; (xxxix) a stability element of UGAAAG and a RBP-binding motif sequence of CGUGCC;

(xl) a stability element of UGAAAG and a RBP-binding motif sequence of CUGACA;

(xli) a stability element of UGAAAG and a RBP-binding motif sequence of GCAGCA; (xlii) a stability element of UGAAAG and a RBP-binding motif sequence of GCAGGC; (xliii) a stability element of UGAAAG and a RBP-binding motif sequence of GCGCGG; (xliv) a stability element of UGAAAG and a RBP-binding motif sequence of GCUUGC; (xlv) a stability element of UGAAAG and a RBP-binding motif sequence of GGAUGU; (xlvi) a stability element of UGAAAG and a RBP-binding motif sequence of UAAUUU; (xlvii) a stability element of UGAAAG and a RBP-binding motif sequence of UAUCAA; (xlviii) a stability element of UGAAAG and a RBP-binding motif sequence of UCCCUG; (xlix) a stability element of UGAAAG and a RBP-binding motif sequence of UUCUGU;

(1) a stability element of UGAAAG and a RBP-binding motif sequence of UUGUGA;

(li) a stability element of UGAAAG and a RBP-binding motif sequence of UUUUAC;

(lii) a stability element of UGAAAAG and a RBP-binding motif sequence of AACUGC;

(liii) a stability element of UGAAAAG and a RBP-binding motif sequence of CAACCA; (liv) a stability element of UGAAAAG and a RBP-binding motif sequence of CCAACC; (Iv) a stability element of UGAAAAG and a RBP-binding motif sequence of CCAUCC;

(Ivi) a stability element of UGAAAAG and a RBP-binding motif sequence of CGUGCC; (Ivii) a stability element of UGAAAAG and a RBP-binding motif sequence of CUGACA; (Iviii) a stability element of UGAAAAG and a RBP-binding motif sequence of GCAGCA; (lix) a stability element of UGAAAAG and a RBP-binding motif sequence of GCAGGC;

(lx) a stability element of UGAAAAG and a RBP-binding motif sequence of GCGCGG;

(Ixi) a stability element of UGAAAAG and a RBP-binding motif sequence of GCUUGC;

(Ixii) a stability element of UGAAAAG and a RBP-binding motif sequence of GGAUGU;

(Ixiii) a stability element of UGAAAAG and a RBP-binding motif sequence of UAAUUU;

(Ixiv) a stability element of UGAAAAG and a RBP-binding motif sequence of UAUCAA;

(Ixv) a stability element of UGAAAAG and a RBP-binding motif sequence of UCCCUG;

(Ixvi) a stability element of UGAAAAG and a RBP-binding motif sequence of UUCUGU;

(Ixvii) a stability element of UGAAAAG and a RBP-binding motif sequence of UUGUGA;

(Ixviii) a stability element of UGAAAAG and a RBP-binding motif sequence of UUUUAC;

(Ixix) a stability element of CUAACG and a RBP-binding motif sequence of AACUGC;

(Ixx) a stability element of CUAACG and a RBP-binding motif sequence of CAACCA;

(Ixxi) a stability element of CUAACG and a RBP-binding motif sequence of CCAACC;

(Ixxii) a stability element of CUAACG and a RBP-binding motif sequence of CCAUCC;

(Ixxiii) a stability element of CUAACG and a RBP-binding motif sequence of CGUGCC;

(Ixxiv) a stability element of CUAACG and a RBP-binding motif sequence of CUGACA;

(Ixxv) a stability element of CUAACG and a RBP-binding motif sequence of GCAGCA;

(Ixxvi) a stability element of CUAACG and a RBP-binding motif sequence of GCAGGC;

(Ixxvii) a stability element of CUAACG and a RBP-binding motif sequence of GCGCGG;

(Ixxviii) a stability element of CUAACG and a RBP-binding motif sequence of GCUUGC;

(Ixxix) a stability element of CUAACG and a RBP-binding motif sequence of GGAUGU;

(Ixxx) a stability element of CUAACG and a RBP-binding motif sequence of UAAUUU;

(Ixxxi) a stability element of CUAACG and a RBP-binding motif sequence of UAUCAA;

(Ixxxii) a stability element of CUAACG and a RBP-binding motif sequence of UCCCUG;

(Ixxxiii) a stability element of CUAACG and a RBP-binding motif sequence of UUCUGU;

(Ixxxiv) a stability element of CUAACG and a RBP-binding motif sequence of UUGUGA;

(Ixxxv) a stability element of CUAACG and a RBP-binding motif sequence of UUUUAC;

(Ixxxvi) a stability element of UUAAAUA and a RBP-binding motif sequence of AACUGC;

(Ixxxvii) a stability element of UUAAAUA and a RBP-binding motif sequence of CAACCA;

(Ixxxviii) a stability element of UUAAAUA and a RBP-binding motif sequence of CCAACC;

(Ixxxix) a stability element of UUAAAUA and a RBP-binding motif sequence of CCAUCC;

(xc) a stability element of UUAAAUA and a RBP-binding motif sequence of CGUGCC; (xci) a stability element of UUAAAUA and a RBP-binding motif sequence of CUGACA; (xcii) a stability element of UUAAAUA and a RBP-binding motif sequence of GCAGCA; (xciii) a stability element of UUAAAUA and a RBP-binding motif sequence of GCAGGC; (xciv) a stability element of UUAAAUA and a RBP-binding motif sequence of GCGCGG; (xcv) a stability element of UUAAAUA and a RBP-binding motif sequence of GCUUGC;

(xcvi) a stability element of UUAAAUA and a RBP-binding motif sequence of GGAUGU; (xcvii) a stability element of UUAAAUA and a RBP-binding motif sequence of UAAUUU; (xcviii) a stability element of UUAAAUA and a RBP-binding motif sequence of UAUCAA; (xcix) a stability element of UUAAAUA and a RBP-binding motif sequence of UCCCUG;

(c) a stability element of UUAAAUA and a RBP-binding motif sequence of UUCUGU;

(ci) a stability element of UUAAAUA and a RBP-binding motif sequence of UUGUGA; (cii) a stability element of UUAAAUA and a RBP-binding motif sequence of UUUUAC; (ciii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of AACUGC;

(civ) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CAACCA; (cv) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CCAACC; (cvi) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CCAUCC; (cvii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CGUGCC;

(cviii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CUGACA;

(cix) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCAGCA; (ex) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCAGGC; (cxi) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCGCGG; (cxii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCUUGC;

(cxiii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GGAUGU;

(cxiv) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UAAUUU;

(cxv) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UAUCAA;

(cxvi) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UCCCUG; (cxvii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UUCUGU;

(cxviii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UUGUGA; or

(cxix) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UUUUAC.

[0031] In some aspects, particular stability element and RBP-binding element combinations may include:

(i) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 91;

(ii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 92;

(iii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 93;

(iv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 95;

(v) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 96;

(vi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 100;

(vii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 108;

(viii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 115;

(ix) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 124;

(x) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 125;

(xi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 132;

(xii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 136;

(xiii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 142; (xiv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 162;

(xv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 167;

(xvi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 168;

(xvii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 176;

(xviii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 179;

(xix) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 182;

(xx) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 188;

(xxi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 190;

(xxii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 199;

(xxiii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 215;

(xxiv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 219;

(xxv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 227;

(xxvi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 236;

(xxvii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 238;

(xxviii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 247;

(xxix) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 248;

(xxx) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 255; (xxxi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 269;

(xxxii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 275;

(xxxiii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 283;

(xxxiv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 295;

(xxxv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 304;

(xxxvi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 306;

(xxxvii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 91;

(xxxviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 92;

(xxxix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 93;

(xl) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 95;

(xli) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 96;

(xlii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 100;

(xliii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ

ID NO: 108;

(xliv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 115;

(xlv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 124;

(xlvi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ

ID NO: 125;

(xlvii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 132; (xlviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 136;

(xlix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 142;

(1) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 162;

(li) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 167;

(lii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 168;

(liii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 176;

(liv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 179;

(Iv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 182;

(Ivi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 188;

(Ivii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 190;

(Iviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 199;

(lix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 215;

(lx) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 219;

(Ixi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 227;

(Ixii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 236;

(Ixiii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 238;

(Ixiv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 247; (Ixv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 248;

(Ixvi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 255;

(Ixvii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 269;

(Ixviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 275;

(Ixix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 283;

(Ixx) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 295;

(Ixxi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 304;

(Ixxii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 306;

(Ixxiii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 91;

(Ixxiv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 92;

(Ixxv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 93;

(Ixxvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 95;

(Ixxvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 96;

(Ixxviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 100;

(Ixxix) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 108;

(Ixxx) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 115;

(Ixxxi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 124; (Ixxxii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 125;

(Ixxxiii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 132;

(Ixxxiv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 136;

(Ixxxv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 142;

(Ixxxvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 162;

(Ixxxvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 167;

(Ixxxviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 168;

(Ixxxix) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 176;

(xc) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 179;

(xci) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 182;

(xcii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 188;

(xciii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 190;

(xciv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 199;

(xcv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 215;

(xcvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 219;

(xcvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 227;

(xcviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 236; (xcix) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 238;

(c) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 247;

(ci) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 248;

(cii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 255;

(ciii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 269;

(civ) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 275;

(cv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 283;

(cvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 295;

(cvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 304;

(cviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 306;

(cix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 91;

(ex) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 92;

(cxi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 93;

(cxii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 95;

(cxiii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 96;

(cxiv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 100;

(cxv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 108; (cxvi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 115;

(cxvii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 124;

(cxviii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 125;

(cxix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 132;

(cxx) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 136;

(cxxi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 142;

(cxxii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 162;

(cxxiii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 167;

(cxxiv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 168;

(cxxv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 176;

(cxxvi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 179;

(cxxvii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 182;

(cxxviii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 188;

(cxxix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 190;

(cxxx) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 199;

(cxxxi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 215;

(cxxxii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 219; (cxxxiii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 227;

(cxxxiv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 236;

(cxxxv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 238;

(cxxxvi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 247;

(cxxxvii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 248;

(cxxxviii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 255;

(cxxxix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 269;

(cxl) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 275;

(cxli) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 283;

(cxlii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 295;

(cxliii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 304;

(cxliv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 306;

(cxlv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 91;

(cxlvi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 92;

(cxlvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 93;

(cxlviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 95;

(cxlix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 96; (cl) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 100;

(cli) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 108;

(clii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 115;

(cliii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 124;

(cliv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 125;

(civ) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 132;

(clvi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 136;

(clvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 142;

(clviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 162;

(clix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 167;

(clx) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 168;

(clxi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 176;

(clxii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 179;

(clxiii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 182;

(clxiv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 188;

(clxv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 190;

(clxvi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 199; (clxvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 215;

(clxviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 219;

(clxix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 227;

(clxx) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 236;

(clxxi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 238;

(clxxii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 247;

(clxxiii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 248;

(clxxiv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 255;

(clxxv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 269;

(clxxvi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 275;

(clxxvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 283;

(clxxviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 295;

(clxxix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 304;

(clxxx) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 306;

(clxxxi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 91;

(clxxxii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 92;

(clxxxiii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 93; (clxxxiv) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ ID NO: 95;

(clxxxv) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ ID NO: 96;

(clxxxvi) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ

ID NO: 100;

(clxxxvii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 108;

(clxxxviii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 115;

(clxxxix) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 124;

(cxc) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 125;

(cxci) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 132;

(cxcii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 136;

(cxciii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 142;

(cxciv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 162;

(cxcv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 167;

(cxcvi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 168;

(cxcvii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 176;

(cxcviii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 179;

(cxcix) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 182;

(cc) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 188; (cci) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ ID NO: 190;

(ccii) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ ID NO: 199;

(cciii) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ ID NO: 215;

(cciv) a stability element of UUAAAUA and a RBP-b inding element sequence of SEQ ID NO: 219;

(ccv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 227;

(ccvi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 236;

(ccvii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 238;

(ccviii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 247;

(ccix) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 248;

(ccx) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 255;

(ccxi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 269;

(ccxii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 275;

(ccxiii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 283;

(ccxiv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 295;

(ccxv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 304;

(ccxvi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 306;

(ccxvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 91; (ccxviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 92;

(ccxix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 93;

(ccxx) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 95;

(ccxxi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 96;

(ccxxii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 100;

(ccxxiii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 108;

(ccxxiv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 115;

(ccxxv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 124;

(ccxxvi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 125;

(ccxxvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 132;

(ccxxviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 136;

(ccxxix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 142;

(ccxxx) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 162;

(ccxxxi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 167;

(ccxxxii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 168;

(ccxxxiii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 176;

(ccxxxiv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 179; (ccxxxv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 182;

(ccxxxvi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 188;

(ccxxxvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 190;

(ccxxxviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 199;

(ccxxxix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 215;

(ccxl) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 219;

(ccxli) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 227;

(ccxlii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 236;

(ccxliii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 238;

(ccxliv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 247;

(ccxlv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 248;

(ccxlvi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 255;

(ccxlvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 269;

(ccxlviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 275;

(ccxlix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 283;

(ccl) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 295;

(ccli) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 304; or (cclii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 306.

[0032] The sequence identity of the stability element sequence and the RBP-binding element sequence may be as described herein. Corresponding combinations of the DNA sequences of stability elements and DNA RBP-binding elements are also contemplated.

[0033] In some aspects, the RNA further comprises a hairpin, an Sm binding sequence, or both. In some aspects, the Sm binding sequence is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 6. In some aspects, the Sm binding sequence comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 7. In some aspects, the Sm binding sequence is located at a 3 ’ end of the RNA.

[0034] In some aspects, the hairpin comprises a sequence derived from an snRNA family. In some aspects, the hairpin comprises a sequence having at least 80% sequence identity to a U1 sequence or a U7 sequence. In some aspects, the U1 sequence is a mouse U1 sequence or a human U1 sequence. In some aspects, the U7 sequence is a mouse U7 sequence or a human U7 sequence. In some aspects, the hairpin is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO:

4, or SEQ ID NO: 6. In some aspects, the hairpin comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 3, SEQ ID NO:

5, or SEQ ID NO: 7. In some aspects, the hairpin is located 5’ of the Sm binding sequence. In some aspects, the hairpin is located immediately 5’ of the Sm binding sequence.

[0035] In some aspects, the RNA comprises an engineered guide RNA capable of hybridizing to the target sequence. In some aspects, the engineered guide RNA comprises the target-binding sequence. In some aspects, the target-binding sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to the target sequence. In some aspects, the target-binding sequence comprises at least one base pair mismatch relative to the target sequence. In some aspects, the target-binding sequence is 100% reverse complementary to the target sequence.

[0036] In some aspects, the target sequence comprises an adenosine residue. In some aspects, the target sequence is a target RNA sequence. In some aspects, the target RNA sequence is an mRNA or a pre-mRNA. In some aspects, the target sequence comprises a G to A mutation relative to a wild type sequence. In some aspects, the target sequence comprises a missense mutation or a nonsense mutation relative to a wild type sequence. In some aspects, the target sequence is a wild type sequence. In some aspects, the target sequence is an untranslated region. [0037] In some aspects, the target sequence comprises a portion of a gene encoding a- synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of the PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-b inding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha- 1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2). In some aspects, the RNA comprises an antisense oligonucleotide, an siRNA, an shRNA, a miRNA, or a tracrRNA.

[0038] In some aspects, the RNA is not less than 20 nucleotide residues and not more than 500 nucleotide residues long. In some aspects, the RNA is not less than 60 and not more than 100 residues long. In some aspects, the RNA is not less than 80 and not more than 120 residues long. In some aspects, the RNA is not less than 100 and not more than 140 residues long. In some aspects, the RNA is not less than 130 and not more than 170 residues long. In some aspects, the polynucleotide is not less than 1300 nucleotide residues and not more than 4600 residues long. In some aspects, the target-binding sequence is 20 to 400 nucleotide residues long. In some aspects, the target-binding sequence is 50 to 200 nucleotide residues long. In some aspects, the target-binding sequence is 80 to 150 nucleotide residues long.

[0039] In some aspects, the RNA payload (the polynucleotide encoding an RNA as disclosed herein) is capable of forming a guide-target RNA scaffold comprising a structural feature upon hybridization of the RNA payload to a target sequence. In some aspects, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or combinations thereof. In some aspects, the structural feature comprises the bulge, and wherein the bulge is a symmetric bulge. In some aspects, the structural feature comprises the bulge, and wherein the bulge is an asymmetric bulge. In some aspects, the structural feature comprises the internal loop, and wherein the internal loop is a symmetric internal loop. In some aspects, the structural feature comprises the internal loop, and wherein the internal loop is an asymmetric internal loop. In some aspects, the structural feature comprises the hairpin, and wherein the hairpin is a recruitment hairpin or a non-recruitment hairpin. In some aspects, the guide-target RNA scaffold comprises a Wobble base pair.

[0040] In some aspects, the polynucleotide encodes two or more copies of the RNA. In some aspects, the polynucleotide encodes three or more copies of the RNA. In some aspects, the polynucleotide encodes not less than one and not more than three copies of the RNA. In some aspects, the polynucleotide as described herein further comprises a promoter sequence, a transcription termination sequence, and a sequence encoding the polynucleotide, wherein the sequence encoding the polynucleotide is under transcriptional control of the promoter sequence. [0041] In various aspects, the present disclosure provides a recombinant polynucleotide encoding a polynucleotide as described herein.

[0042] In some aspects, the recombinant polynucleotide comprises a promoter sequence, a transcription termination sequence, and a sequence encoding the polynucleotide, wherein the sequence encoding the polynucleotide is under transcriptional control of the promoter sequence. [0043] In various aspects, the present disclosure provides a non- viral vector encoding a polynucleotide as described herein or a recombinant polynucleotide as described herein.

[0044] In various aspects, the present disclosure provides a viral vector encoding a polynucleotide as described herein or a recombinant polynucleotide as described herein.

[0045] In some aspects, the viral vector is an adeno-associated viral vector. In some aspects, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.

[0046] In various aspects, the present disclosure provides a pharmaceutical composition comprising a polynucleotide as described herein, a recombinant polynucleotide as described herein, a non-viral vector as described herein, or a viral vector as described herein and a pharmaceutically acceptable excipient, carrier, diluent, or combination thereof.

[0047] In various aspects, the present disclosure provides a method of expressing an RNA in a cell, the method comprising delivering a recombinant polynucleotide encoding a polynucleotide as described herein or a recombinant polynucleotide as described herein to a cell and expressing the RNA encoded by the polynucleotide in the cell. In various aspects, the method of expressing an RNA in a cell is conducted in vitro.

[0048] In various aspects, the present disclosure provides a method of treating a condition in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide as described herein or a recombinant polynucleotide as described herein; delivering the polynucleotide to a cell of the subject; and expressing an RNA encoded by the polynucleotide in the cell, thereby treating the condition. In various aspects, the method of editing a target sequence is conducted in vitro.

[0049] In some aspects, the RNA comprises an engineered guide RNA that hybridizes to a target sequence, and wherein the cell encodes the target sequence. In some aspects, the method further comprises forming a guide-target RNA scaffold upon hybridization of the engineered guide RNA to the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme.

[0050] In some aspects, the target sequence comprises a mutation relative to a wild type sequence. In some aspects, editing the target sequence corrects the mutation in the target sequence. In some aspects, the mutation is a missense mutation. In some aspects, the mutation is a nonsense mutation. In some aspects, the mutation is a G to A mutation. In some aspects, editing the target sequence results in a reduction in a level of a protein or an RNA of the target sequence. In some aspects, editing the target sequence modifies a protein-protein interaction. In some aspects, the target sequence is a wild type sequence. In some aspects, the target sequence is an untranslated region. In some aspects, the target sequence is associated with a disease. [0051] In some aspects, the mutation is associated with the condition. In some aspects, the condition is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. In some aspects, the target sequence comprises a portion of a gene encoding a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of the PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2). In some aspects, treating the condition comprises preventing the condition or delaying onset of the condition. [0052] In various aspects, the present disclosure provides a method of editing a target sequence, the method comprising: delivering a polynucleotide as described herein or a recombinant polynucleotide as described herein to a cell encoding the target sequence; expressing the RNA encoded by the polynucleotide in the cell, wherein the RNA comprises an engineered guide RNA capable of hybridizing to the target sequence; forming a guide-target RNA scaffold upon hybridization of the RNA to the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme. In various aspects, the method of editing a target sequence is conducted in vitro.

[0053] In some aspects, the target sequence comprises a mutation relative to a wild type sequence. In some aspects, editing the target sequence corrects the mutation in the target sequence. In some aspects, the mutation is a missense mutation. In some aspects, the mutation is a nonsense mutation. In some aspects, the mutation is a G to A mutation. In some aspects, the target sequence is a wild type sequence. In some aspects, the target sequence is an untranslated region. In some aspects, editing the target sequence results in a reduction in a level of a protein or an RNA of the target sequence. In some aspects, editing the target sequence modifies a protein-protein interaction.

[0054] In some aspects, the target sequence is associated with a disease. In some aspects, the mutation is associated with a disease. In some aspects, the disease is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. In some aspects, the target sequence comprises a portion of a gene encoding a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of PMP22 associated with Charcot-Marie-Tooth disease type 1 A (CMT1 A), ATP-b inding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2).

[0055] In some aspects, the guide-target RNA scaffold comprises a structural feature. In some aspects, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or combinations thereof. In some aspects, the structural feature comprises the bulge, and wherein the bulge is a symmetric bulge. In some aspects, the structural feature comprises the bulge, and wherein the bulge is an asymmetric bulge. In some aspects, the structural feature comprises the internal loop, and wherein the internal loop is a symmetric internal loop. In some aspects, the structural feature comprises the internal loop, and wherein the internal loop is an asymmetric internal loop. In some aspects, the structural feature comprises the hairpin, and wherein the hairpin is a recruitment hairpin or a non-recruitment hairpin. In some aspects, the guide-target RNA scaffold comprises a Wobble base pair.

[0056] In some aspects, the editing enzyme comprises an ADAR, an APOBEC, or a Cas nuclease. In some aspects, the ADAR comprises AD ARI, ADAR2, or combinations thereof. In some aspects, the target sequence comprises RNA or DNA. In some aspects, editing the target sequence comprises deamidating a nucleotide of the target sequence. In some aspects, the target sequence is edited with an efficiency of at least 10%, at least 20%, or at least 25%. In some aspects, the target sequence is a non-coding RNA, an mRNA or a pre-mRNA.

[0057] In some aspects, the recombinant polynucleotide is delivered to the cell via a viral vector. In some aspects, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentivector. In some aspects, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV1 1, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof. In some aspects, the recombinant polynucleotide is delivered to the cell via a non-viral vector.

INCORPORATION BY REFERENCE

[0058] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0060] FIG. 1 shows a legend of various exemplary structural features present in guide-target RNA scaffolds formed upon hybridization of a latent guide RNA of the present disclosure to a target RNA. Example structural features shown include an 8/7 asymmetric loop (i., 8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2/2 symmetric bulge (ii., 2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1/1 mismatch (iii., 1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5/5 symmetric internal loop (iv., 5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (v., 24 nucleotides on the target RNA side base paired to 24 nucleotides on the guide RNA side), and a 2/3 asymmetric bulge (vi., 2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Figure discloses SEQ ID NO: 875 and SEQ ID NO: 876, respectively, in order of appearance.

[0061] FIG. 2A shows a bar graph illustrating the number of unique protein-binding motifs that bind to selected RNA binding proteins including ESRP1, ESRP2, FUBP1, HNRNPA0, HNRNPCL1, KHDRBS3, NO VAI, PPRC1, RALY, RBM23, RBM47, RBM5, RBM6, RBMS2, SF1, SRSF8, and U2AF2.

[0062] FIG. 2B shows logo plots of protein-binding sequence motifs that bind to each of the

RNA binding proteins of ESRP1, ESRP2, FUBP1, HNRNPA0, HNRNPCL1, KHDRBS3, NO VAI, PPRC1, RALY, RBM23, RBM47, RBM5, RBM6, RBMS2, SF1, SRSF8, and U2AF2. [0063] FIG. 3A shows a bar graph illustrating the number of unique protein-binding motifs that bind to selected RNA binding proteins including CELF1, CNOT4, CPEB1, CPEB2, CPEB4, DAZ3, ELAVL1, ESRP1, ESRP2, EWSR1, FUBP1, FUBP3, FUS, FXR2, HNRNPA0, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPC, HNRNPCL1, HNRNPD, HNRNPF, HNRNPH2, HNRNPK, HNRNPL, IGF2BP2, ILF2, KHDRBS3, LIN28A, MBNL1, MSI1, NOVAI, NUPL2, PABPC1, PABPC4, PABPN1, PCBP2, PPRC1, QK1, RALY, RALYL, RBFOX2, RBFOX3, RBM22, RBM23, RBM24, RBM3, RBM4, RBM42, RBM45, RBM47, RBM5, RBM6, RBM8A, RBMS1, RBMS2, SART3, SF1, SFPQ, SNRNP70, SRSF1, SRSF10, SRSF8, TAF15, TARDBP, TRA2A, TRNAU1AP, U2AF2, YBX2, and ZFP36. [0064] FIG. 3B shows logo plots of protein-binding sequence motifs that bind to each of the RNA binding proteins of CELF1, CNOT4, CPEB1, CPEB2, CPEB4, DAZ3, ELAVL1, ESRP1, ESRP2, EWSR1, FUBP1, FUBP3, FUS, FXR2, HNRNPAO, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPC, HNRNPCL1, HNRNPD, HNRNPF, HNRNPH2, HNRNPK, HNRNPL, IGF2BP2, ILF2, KHDRBS3, LIN28A, MBNL1, MSI1, NOVAI, NUPL2, PABPC1, PABPC4, PABPN1, PCBP2, PPRC1, QK1, RALY, RALYL, RBFOX2, RBFOX3, RBM22, RBM23, RBM24, RBM3, RBM4, RBM42, RBM45, RBM47, RBM5, RBM6, RBM8A, RBMS1, RBMS2, SART3, SF1, SFPQ, SNRNP70, SRSF1, SRSF10, SRSF8, TAF15, TARDBP, TRA2A, TRNAU1AP, U2AF2, YBX2, and ZFP36.

[0065] FIG. 4 shows a bar graph illustrating the effect of various RNA structural elements on stability of a gRNA targeting SERPINA1 relative to a guide RNA lacking a structural element (no motif guide). Structural elements were identified by screening an in vitro transcribed (IVT) library. SEQ ID NO: 66 corresponds to an aptamer; SEQ ID NO: 67 corresponds to a pseudoknot; SEQ ID NO: 68 corresponds to a G-quadruplex; SEQ ID NO: 69 corresponds to a G-quadruplex; CCAAAUA (SEQ ID NO: 71) corresponds to a structural motif; SEQ ID NO: 73 corresponds to a G-quadruplex; SEQ ID NO: 74 corresponds to a stem-loop; SEQ ID NO: 77 corresponds to a G-quadruplex; SEQ ID NO: 83 corresponds to a pseudoknot; and SEQ ID NO: 89 corresponds to a G-quadruplex.

[0066] FIG. 5 shows a bar graph illustrating the effect of various RNA structural elements on stability of a gRNA targeting ABCA4 relative to a guide RNA lacking a structural element (no motif ABCA4 guide). SEQ ID NO: 66 corresponds to an aptamer; SEQ ID NO: 67 corresponds to a pseudoknot; SEQ ID NO: 68 corresponds to a G-quadruplex; SEQ ID NO: 69 corresponds to a G-quadruplex; CCAAAUA (SEQ ID NO: 71) corresponds to a structural motif; SEQ ID NO: 73 corresponds to a G-quadruplex; SEQ ID NO: 74 corresponds to a stem-loop; SEQ ID NO: 77 corresponds to a G-quadruplex; SEQ ID NO: 83 corresponds to a pseudoknot; and SEQ ID NO: 89 corresponds to a G-quadruplex.

[0067] FIG. 6 shows a plot comparing the levels of gRNAs targeting either ABCA4 or SERPINA1 when containing various structural elements. SEQ ID NO: 66 corresponds to an aptamer; SEQ ID NO: 67 corresponds to a pseudoknot; SEQ ID NO: 68 corresponds to a G- quadruplex; CCAAAUA (SEQ ID NO: 71) corresponds to a structural motif; SEQ ID NO: 74 corresponds to a stem-loop; SEQ ID NO: 77 corresponds to a G-quadruplex; and SEQ ID NO: 83 corresponds to a pseudoknot.

[0068] FIG. 7 shows a bar graph illustrating editing efficiency of an ABCA4 cDNA using ADAR editing facilitated by guide RNAs with a structural element of SEQ ID NO: 66 (aptamer), SEQ ID NO: 67 (pseudoknot), SEQ ID NO: 68 (G-quadruplex), SEQ ID NO: 69 (G- quadruplex), CCAAAUA (SEQ ID NO: 71) (structural motif), SEQ ID NO: 73 (G-quadruplex), SEQ ID NO: 74 (stem-loop), SEQ ID NO: 77 (G-quadruplex), SEQ ID ON: 83 (pseudoknot), SEQ ID NO: 89 (G-quadruplex), or no structural element. Editing was measured at the target site (black bars) and the +1 site (gray bars).

[0069] FIG. 8A shows a bar graph illustrating the effect of various RNA structural elements on stability of a gRNA targeting SERPINA1 relative to a guide RNA lacking a structural element (no motif guide). Structural elements were identified by screening a vector encoded library. SEQ ID NO: 24 corresponds to a multi-loop; UGAAAAG (SEQ ID NO: 22) corresponds to a structural motif; CUAACG (SEQ ID NO: 19) corresponds to a structural motif; SEQ ID NO: 64 corresponds to two G-quadruplexes; SEQ ID NO: 21 corresponds to a stemloop; SEQ ID NO: 56 corresponds to a small stem-loop; SEQ ID NO: 51 corresponds to two G- quadruplexes; SEQ ID NO: 40 corresponds to a stem-loop; SEQ ID NO: 20 corresponds to a small stem-loop; SEQ ID NO: 59 corresponds to a 3 -way junction; SEQ ID NO: 35 corresponds to a stem-loop; SEQ ID NO: 34 corresponds to a structural motif; SEQ ID NO: 63 corresponds to a structural motif; SEQ ID NO: 49 corresponds to a pseudoknot and stem-loop; SEQ ID NO: 38 corresponds to a stem-loop; SEQ ID NO: 47 corresponds to multiple stem-loops;

CUGCGAAAG (SEQ ID NO: 48) corresponds to a G-quadruplex; and SEQ ID NO: 30 corresponds to a G-quadruplex. Stability was compared after 48 hours and 96 hours.

[0070] FIG. 8B shows a bar graph illustrating editing efficiency of a target SERPINA1 polynucleotide using ADAR editing facilitated by guide RNAs with a structural element of SEQ ID NO: 24 (multi-loop), UGAAAAG (SEQ ID NO: 22) (structural motif), CUAACG (SEQ ID NO: 19) (structural motif), SEQ ID NO: 64 (two G-quadruplexes), SEQ ID NO: 21 (stem-loop), SEQ ID NO: 56 (small stem-loop), SEQ ID NO: 51 (two G-quadruplexes), SEQ ID NO: 40 (stem-loop), SEQ ID NO: 20 (small stem-loop), SEQ ID NO: 59 (3 -way junction), SEQ ID NO: 35 (stem-loop), SEQ ID NO: 34 (structural motif), SEQ ID NO: 63 (structural motif), SEQ ID NO: 49 (pseudoknot and stem-loop), SEQ ID NO: 38 (stem-loop), SEQ ID NO: 47 (multiple stem-loops), CUGCGAAAG (SEQ ID NO: 48) (G-quadruplex), SEQ ID NO: 30 (G- quadruplex), or no structural element (no motif guide). Editing efficiency was compared after 48 hours, 96 hours, or 144 hours.

[0071] FIG. 9A shows a bar graph illustrating the effect of various RNA structural elements on stability of a gRNA targeting ABCA4 relative to a guide RNA lacking a structural element (no motif guide). SEQ ID NO: 63 corresponds to a structural motif; CUAACG (SEQ ID NO: 19) corresponds to a structural motif; SEQ ID NO: 21 corresponds to a stem-loop; SEQ ID NO: 64 corresponds to two G-quadruplexes; SEQ ID NO: 59 corresponds to a 3 -way junction; SEQ ID NO: 47 corresponds to multiple stem-loops; SEQ ID NO: 56 corresponds to a small stem-loop; SEQ ID NO: 35 corresponds to a stem-loop; SEQ ID NO: 49 corresponds to a pseudoknot and stem-loop; and SEQ ID NO: 51 corresponds to two G-quadruplexes.

[0072] FIG. 9B shows a bar graph illustrating editing efficiency of an ABCA4 cDNA using ADAR editing facilitated by guide RNAs with a structural element of SEQ ID NO: 63 (structural motif), CUAACG (SEQ ID NO: 19) (structural motif), SEQ ID NO: 21 (stem-loop), SEQ ID NO: 64 (two G-quadruplexes), SEQ ID NO: 59 (3-way junction), SEQ ID NO: 47 (multiple stem-loops), SEQ ID NO: 56 (small stem-loop), SEQ ID NO: 35 (stem-loop), SEQ ID NO: 49 (pseudoknot and stem-loop), SEQ ID NO: 51 (two G-quadruplexes) or no structural element (no motif guide). Editing efficiency was compared after 48 hours and 96 hours.

[0073] FIG. 10A shows a bar graph illustrating the effect of various RNA structural elements on stability of a gRNA targeting LRRK2 relative to a guide RNA lacking a structural element. SEQ ID NO: 63 corresponds to a structural motif; CUAACG (SEQ ID NO: 19) corresponds to a structural motif; SEQ ID NO: 21 corresponds to a stem-loop; SEQ ID NO: 64 corresponds to two G-quadruplexes; SEQ ID NO: 59 corresponds to a 3 -way junction; SEQ ID NO: 47 corresponds to multiple stem-loops; SEQ ID NO: 56 corresponds to a small stem-loop; SEQ ID NO: 35 corresponds to a stem-loop; SEQ ID NO: 49 corresponds to a pseudoknot and stemloop; and SEQ ID NO: 51 corresponds to two G-quadruplexes. Stability was compared after 48 hours and 96 hours.

[0074] FIG. 10B shows a bar graph illustrating editing efficiency of an LRRK2 polynucleotide using ADAR editing facilitated by guide RNAs with a structural element of SEQ ID NO: 63 (structural motif), CUAACG (SEQ ID NO: 19) (structural motif), SEQ ID NO: 21 (stem-loop), SEQ ID NO: 64 (two G-quadruplexes), SEQ ID NO: 59 (3-way junction), SEQ ID NO: 47 (multiple stem-loops), SEQ ID NO: 56 (small stem-loop), SEQ ID NO: 35 (stem-loop), SEQ ID NO: 49 (pseudoknot and stem-loop), SEQ ID NO: 51 (two G-quadruplexes), or no structural element.

[0075] FIG. 11 schematically illustrates examples of secondary structures formed by guidetarget RNA scaffolds upon hybridization of a guide RNA payload containing a stem-loop exonuclease-resistant structure (SEQ ID NO: 21) and an Sm-binding sequence SmOPT (SEQ ID NO: 7) to a target sequence of SERPINA1 (SEQ ID NO: 431), LRRK2 (SEQ ID NO: 433), or ABCA4 (SEQ ID NO: 435). For each target sequence context, the predicted targetguide complex structure (top) and guide secondary structure (bottom; SEQ ID NO: 877 - SEQ ID NO: 879, respectively, in order of appearance) are shown. [0076] FIG. 12 illustrates the design of RBP-binding motifs by combining multiple 6-mer RBP-b inding motifs (“Rational Design #1”), inserting RBP-binding motifs into a secondary structure (“Rational Design #2”), or identification of physiological motifs (“physiological motifs”). Figure discloses SEQ ID NO: 880.

[0077] FIG. 13 illustrates the design of constructs with a structural motif placed at the 5 ’ or 3 ’ end of a guide RNA and the placement of a bar code sequence between a first part of a guide sequence and a second part of a guide sequence.

[0078] FIG. 14 shows a bar graph of the percent SNCA 3’UTR editing after 48 hours by payload sequences including an SNCA-targeted guide sequence and an exonuclease-resistant element of one of SEQ ID NO: 19 - SEQ ID NO: 65, SEQ ID NO: 425, or SEQ ID NO: 426 introduced through transient transfection.

[0079] FIG. 15 shows a bar graph of the percent SNCA 3’UTR editing by payload sequences including an SNCA-targeted gRNA sequence and an exonuclease-resistant element of one of SEQ ID NO: 19 - SEQ ID NO: 65, SEQ ID NO: 425, and SEQ ID NO: 426 that were expressed under control of either a mouse U7 promoter (shaded bars) or a human U 1 promoter (white bars). A control with an RBA7 targeting guide RNA was also included (RNA: GAACCCUGUUUGGAUUGCAGAGUGUUACUCAGAAUUGGGAAAUCCAGCUAGCGG CAGUAUUCUGUACAGUAGACACAAGAAUUAUGUACGCCUUUUAUCA, SEQ ID NO: 437; DNA:

GAACCCTGTTTGGATTGCAGAGTGTTACTCAGAATTGGGAAATCCAGCTAGCGGCA GTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCA, SEQ ID NO: 436). In this experiment, gRNAs were transfected via single-locus genomic integration and stable expression.

[0080] FIG. 16A shows a bar graph of a first biological replicate measuring the percent SNCA 3’UTR editing by payload sequences including an SNCA-targeted guide sequence and select exonuclease-resistant structure elements of UGAAAAG (SEQ ID NO: 22), SEQ ID NO: 35, SEQ ID NO: 36, and UGAAAG (SEQ ID NO: 57) that were expressed under control of either a mouse U7 promoter (shaded bars) or a human U1 promoter (white bars) and were also compared to a payload without an exonuclease-resistant element under control of a mouse U7 promoter (shaded bar).

[0081] FIG. 16B shows a bar graph of a second biological replicate measuring the percent SNCA 3’UTR editing by payload sequences including an SNCA-targeted guide sequence and select exonuclease-resistant structure elements of UGAAAAG (SEQ ID NO: 22), SEQ ID NO: 35, SEQ ID NO: 36, and UGAAAG (SEQ ID NO: 57) that were expressed under control of either a mouse U7 promoter (shaded bars) or a human U1 promoter (white bars) and were also compared to a payload without an exonuclease-resistant element under control of a mouse U7 promoter (shaded bar).

[0082] FIG. 16C shows a bar graph of the percent SNCA 3’UTR editing by payload sequences including an SNCA-targeted guide sequence and select exonuclease-resistant structure elements of UGAAAAG (SEQ ID NO: 22), SEQ ID NO: 35, SEQ ID NO: 36, and UGAAAG (SEQ ID NO: 57) that were expressed under control of a mouse U7 promoter (shaded bars) and were also compared to a payload without an exonuclease-resistant element under control of a mouse U7 promoter (shaded bar).

[0083] FIG. 17A shows a bar graph of the GFP fluorescence resulting from RNA editing via ADAR of a broken GFP gene in a HEK293 cell line, facilitated by a payload including a GFP- targeted guide RNA sequence and select RBP-binding sequences disclosed in TABLE 8.

[0084] FIG. 17B shows a bar graph of percent RNA editing of GFP in the same cells as FIG. 17A.

[0085] FIG. 17C shows a graph of GFP fluorescence (data from FIG. 17A) versus GFP editing (data from FIG. 17B).

[0086] FIG. 18 shows a bar graph of MAPT RNA editing via ADAR facilitated by polynucleotides of the present disclosure that comprise stability elements and RBP-binding elements. Polynucleotides encoding guide RNAs for MAPT editing were tested and included control polynucleotides with no motifs (no motif control 1 and no motif control 2) and hnRNP elements (hnRNP control 1 and hnRNP control 2); polynucleotides with RBP-binding elements (SEQ ID NO: 100, SEQ ID NO: 132, SEQ ID NO: 142, SEQ ID NO: 161, SEQ ID NO: 219, SEQ ID NO: 867, SEQ ID NO: 303, SEQ ID NO: 167, SEQ ID NO: 255, SEQ ID NO: 242), a polynucleotide with a scrambled RBP-binding motif as a control, polynucleotides with stability elements (CUAACG (SEQ ID NO: 19), UGAAAAG (SEQ ID NO: 22), SEQ ID NO: 35, SEQ ID NO: 36, UGAUAUGGU (SEQ ID NO: 42), or a sequence of UUAAAUA (SEQ ID NO: 425), UGAAAG (SEQ ID NO: 57)), and a polynucleotide with a scrambled stability element as a control. MAPT editing was also compared to editing by a non-MAPT guide RNA (a guide RNA instead designed to target a sequence of RAB7A RNA; “RAB7A”), as a control.

[0087] FIG. 19A shows a graph of SNCA RNA editing via ADAR facilitated by polynucleotides encoding various guide RNAs with two copies of hnRNP Al (having a sequence of UAUGAUAGGGACUUAGGGUG; SEQ ID NO: 428), including a guide RNA with two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA (“hnRNPAl Double”) and a guide RNA with two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA with 1 copy of a RBP-binding element (UUGUGAGAUCUUGUGAGAUCUUGUGA; SEQ ID NO: 100) at the 3’ end (“hnRNPAl Double with SEQ ID NO: 100”), control guide RNAs (that do not bind the target RNA; labeled as “Control Guide RNA 1” and “Control Guide RNA 2”), and guide RNAs with no appended RBP elements (“no motif’ controls). The ability of several guide RNAs to facilitate ADAR editing was tested (Guide RNA 1-12 on the x- axis).

[0088] FIG. 19B shows a graph of SNCA RNA editing via ADAR facilitated by polynucleotides encoding guide RNAs coupled with various stability elements SEQ ID NO: 36, UGAAAG (SEQ ID NO: 57), UGAAAAG (SEQ ID NO: 22), UGAUAUGGU (SEQ ID NO: 42), CUAACG (SEQ ID NO: 19), or various RBP-binding elements (SEQ ID NO: 100, SEQ ID NO: 306, SEQ ID NO: 219, SEQ ID NO: 142, SEQ ID NO: 167). The ability of two different guide RNAs to facilitate ADAR editing was tested (Guide RNA 1 and Guide RNA 2 on the x- axis).

[0089] FIG. 20 shows a graph of parameter effects on target SNCA RNA editing via ADAR facilitated by polynucleotides encoding a guide RNA coupled with various stability elements UGAUAUGGU (SEQ ID NO: 42), CUAACG (SEQ ID NO: 19), SEQ ID NO: 36, UGAAAG (SEQ ID NO: 57), UGAAAAG (SEQ ID NO: 22), RBP-binding elements (SEQ ID NO: 167, SEQ ID NO: 142, SEQ ID NO: 100, SEQ ID NO: 219), two copies of hnRNPAl (having a sequence of UAUGAUAGGGACUUAGGGUG; SEQ ID NO: 428), or two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA and 1 copy of an RBP-binding element (UUGUGAGAUCUUGUGAGAUCUUGUGA; SEQ ID NO: 100) at the 3’ end, all relative to a guide RNA with no appended RBP elements (“no-motif control”). Two biological replicates were run to evaluate precision, and as shown by the “Replicate 2 rel. to Replicate 1” group, the biological replicates are not statistically different from each other.

DETAILED DESCRIPTION

[0090] The present disclosure provides recombinant polynucleotides for expressing RNA payloads. Also described herein are RNA payloads expressed by a recombinant polynucleotide. The recombinant polynucleotides described herein may be engineered for enhanced stability of the RNA payload, increased expression of the encoded RNA payload sequence, or both. In some embodiments, a recombinant polynucleotide of the present disclosure may contain a stability element to enhance stability of the RNA payload. In some embodiments, the stability element is part of the RNA payload. These stability elements may comprise exonuclease resistant structures to enhance stability of the RNA payload. In some embodiments, a stability element may direct the payload to the nucleus, increasing the efficacy of an RNA payload that act in the nucleus (e.g., a guide RNA for RNA or DNA editing). The individual stability elements of the recombinant polynucleotide may be engineered to increase stability, enhance expression of the RNA payload, increase nuclear localization, or a combination thereof.

Recombinant Polynucleotides Encoding RNA Payloads

[0091] A recombinant polynucleotide of the present disclosure may include a promoter sequence, an RNA payload coding sequence, and a termination sequence. The promoter may recruit transcription factors, polymerases (e.g., RNA polymerase II or RNA polymerase III), or other transcriptional machinery to promote transcription of the RNA payload. For example, the recombinant polynucleotide may promote transcription of a guide RNA for RNA editing, a guide RNA for DNA editing, a tracrRNA, an siRNA, an shRNA, or a miRNA, or an antisense oligonucleotide). The recombinant polynucleotide may further comprise a stability element (e.g., an exonuclease-resistant structure), a localization motif (e.g., an RNA binding protein (RBP)- binding motif), or combinations thereof. In some embodiments, the stability element may be transcribed as part of the RNA payload encoded by the recombinant polynucleotide. The recombinant polynucleotide may be part of an engineered expression cassette to express a small RNA payload.

Stability Elements

[0092] A recombinant polynucleotide of the present disclosure may include a stability element (e.g., an exonuclease-resistant structure) that enhances the stability of an RNA payload encoded by the recombinant polynucleotide. In some embodiments, the stability element is part of the RNA payload. For example, the stability element may be included at the 5’ end, the 3’ end, or both of the transcribed RNA payload (e.g., 5’ or 3’ of a guide RNA portion of the RNA payload). The stability element may also be downstream of an additional engineered guide RNA component (e.g., a U7 hairpin or a Sm-binding sequence (SmOPT)). There may be multiple copies of a stability element or multiple stability elements in the RNA payload. The stability element may be non-complementary to the target RNA sequence and therefore may not hybridize to the target RNA sequence. The stability element may be transcribed as part of the RNA payload and may enhance the stability of the transcribed payload. For example, the stability element may be included at the 5’ end or the 3’ end, or at both ends, of a guide RNA payload and may enhance the stability of the guide RNA. In some embodiments, a stability element may comprise an exonuclease-resistant structure. The inclusion of said stability element may result in better therapeutic efficacy of the payload. For example, any stability element disclosed herein can be linked to an engineered guide RNA designed to facilitate ADAR- mediated RNA editing. Said guide RNA linked to the stability element may exhibit enhanced stability and, thereby, may also exhibit increased residence time after administration resulting in potentially higher levels of RNA editing.

Exonuclease-Resistant Structures

[0093] In some embodiments, a stability element comprises an exonuclease-resistant structure. The exonuclease-resistant structure may be a natural exonuclease-resistant structure, such as an RNA structure derived from a viral RNA. For example, the exonuclease-resistant structure may comprise an RNA structure from a virus (e.g., a flavivirus). Inclusion of an exonuclease-resistant structure in an RNA payload may enhance the stability of the RNA payload by preventing degradation of the RNA payload by exonucleases. The exonucleaseresistant structure may block exonucleases from accessing the 5 ’ end or the 3 ’ end of the RNA payload, preventing degradation. The exonuclease-resistant structure may comprise an RNA structure from a Murray Valley encephalitis virus, a West Nile virus, a Zika virus, a Dengue virus, or a Yellow Fever virus. The exonuclease-resistant structure may form an RNA secondary structure, such as an aptamer, a G-quadruplex, a stem-loop, a multi-loop, a 3 -way junction, a knot, a pseudoknot, a tetraloop motif, or combinations thereof. For example, the exonucleaseresistant structure may form a zika pseudoknot. An exonuclease-resistant structure may be included at the 5’ end, the 3’ end, or both ends of an RNA payload to enhance the stability of the RNA payload. In some embodiments, the exonuclease-resistant structure may enhance the stability of the RNA payload by preventing degradation of the RNA payload by an exonuclease (e.g., 5 ’-3’ exoribonuclease 1 (Xrnl) or 5 ’-3’ Exoribonuclease 2 (Xm2)). The exonucleaseresistant structure may enhance the stability of an RNA payload, such as a U6 RNA payload. In some embodiments, the exonuclease-resistant structure may enhance the stability of an ADAR- recruiting gRNA.

[0094] In some embodiments, a stability element may comprise a sequence of an exonuclease-resistant structure. Example sequences of stability elements (e.g., exonucleaseresistant structures) are provided in TABLE 1.

TABLE 1 - Stability Element RNA Sequences

[0095] In some embodiments, an exonuclease-resistant structure may comprise a sequence of any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CUAACG (SEQ ID NO: 19). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 20. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 21. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UGAAAAG (SEQ ID NO: 22). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 23. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 24. In some embodiments, an exonucleaseresistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CCUUGUG (SEQ ID NO: 25). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CUAAUUA (SEQ ID NO: 26). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UGUAACAA (SEQ ID NO: 27). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGCAAG (SEQ ID NO: 28). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGUAAG (SEQ ID NO: 29). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 30. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGUAUAG (SEQ ID NO: 31). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CUGAGAUG (SEQ ID NO: 32). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UGCAAG (SEQ ID NO: 33). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 34. In some embodiments, an exonucleaseresistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 35. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 36. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGUAACAG (SEQ ID NO: 37). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 38. In some embodiments, an exonucleaseresistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 39. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 40. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CUGGAAAG (SEQ ID NO: 41). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UGAUAUGGU (SEQ ID NO: 42). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 43. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 44. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGGCGAAAG (SEQ ID NO: 45). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 46. In some embodiments, an exonucleaseresistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 47. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CUGCGAAAG (SEQ ID NO: 48). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 49. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 50. In some embodiments, an exonucleaseresistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 51. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 52. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGAUAACG (SEQ ID NO: 53). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 54. In some embodiments, an exonuclease- resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UUAGCAG (SEQ ID NO: 55). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 56. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UGAAAG (SEQ ID NO: 57). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 58. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 59. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 60. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 61. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 62. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 63. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 64. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 65. In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to UUAAAUA (SEQ ID NO: 425). In some embodiments, an exonuclease-resistant structure may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to GUGACAGCC (SEQ ID NO: 426).

[0096] In some embodiments, a sequence encoding a stability element may encode an exonuclease-resistant structure. Examples of sequences encoding stability elements (e.g., exonuclease-resistant structures) are provided in TABLE 2.

TABLE 2 - Stability Element DNA Sequences

[0097] In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising any one of SEQ ID NO: 444 - SEQ ID NO: 528. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NO: 444 - SEQ ID NO: 528. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CTAACG (SEQ ID NO: 455). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 456. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 457. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TGAAAAG (SEQ ID NO: 458). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 459. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 460. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CCTTGTG (SEQ ID NO: 461). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CTAATTA (SEQ ID NO: 462). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TGTAACAA (SEQ ID NO: 463). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGCAAG (SEQ ID NO: 464). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGTAAG (SEQ ID NO: 465). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 466. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGTATAG (SEQ ID NO: 467). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CTGAGATG (SEQ ID NO: 468). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TGCAAG (SEQ ID NO: 469). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 470. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 471. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 472. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGTAACAG (SEQ ID NO: 473). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 474. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 475. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 476. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CTGGAAAG (SEQ ID NO: 477). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TGATATGGT (SEQ ID NO: 478). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 479. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 480. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGGCGAAAG (SEQ ID NO: 481). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 482. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 483. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CTGCGAAAG (SEQ ID NO: 484). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 485. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 486. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 487. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 488. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to CGATAACG (SEQ ID NO: 489). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 490. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TTAGCAG (SEQ ID NO: 491). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 492. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TGAAAG (SEQ ID NO: 493). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 494. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 495. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 496. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 497. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 498. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 499. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 500. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 501. In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to TTAAATA (SEQ ID NO: 527). In some embodiments, an exonuclease-resistant structure may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to GTGACAGCC (SEQ ID NO: 528).

[0098] A stability element (e.g., an exonuclease-resistant structure) or a sequence encoding a stability element (e.g., a sequence encoding an exonuclease-resistant structure) may have a sequence length of not less than 5 and not more than 150, not less than 5 and not more than 140, not less than 5 and not more than 130, not less than 5 and not more than 120, not less than 5 and not more than 110, not less than 5 and not more than 100, not less than 5 and not more than 90, not less than 5 and not more than 80, not less than 5 and not more than 70, not less than 5 and not more than 60, not less than 5 and not more than 50, not less than 10 and not more than 150, not less than 10 and not more than 140, not less than 10 and not more than 130, not less than 10 and not more than 120, not less than 10 and not more than 110, not less than 10 and not more than 100, not less than 10 and not more than 90, not less than 10 and not more than 80, not less than 10 and not more than 70, not less than 10 and not more than 60, not less than 10 and not more than 50, not less than 20 and not more than 150, not less than 20 and not more than 140, not less than 20 and not more than 130, not less than 20 and not more than 120, not less than 20 and not more than 110, not less than 20 and not more than 100, not less than 20 and not more than 90, not less than 20 and not more than 80, not less than 20 and not more than 70, not less than 20 and not more than 60, not less than 20 and not more than 50, not less than 30 and not more than 150, not less than 30 and not more than 140, not less than 30 and not more than 130, not less than 30 and not more than 120, not less than 30 and not more than 110, not less than 30 and not more than 100, not less than 30 and not more than 90, not less than 30 and not more than 80, not less than 30 and not more than 70, not less than 30 and not more than 60, not less than 30 and not more than 50, not less than 30 and not more than 40, not less than 40 and not more than 150, not less than 40 and not more than 140, not less than 40 and not more than 130, not less than 40 and not more than 120, not less than 40 and not more than 110, not less than 40 and not more than 100, not less than 40 and not more than 90, not less than 40 and not more than 80, not less than 40 and not more than 70, not less than 40 and not more than 60, not less than 40 and not more than 50, not less than 50 and not more than 150, not less than 50 and not more than 140, not less than 50 and not more than 130, not less than 50 and not more than 120, not less than 50 and not more than 110, not less than 50 and not more than 100, not less than 50 and not more than 90, not less than 50 and not more than 80, not less than 50 and not more than 70, or not less than 50 and not more than 60 nucleotides. [0099] A stability element (e.g., an exonuclease-resistant structure) may be on the 3’ end of a targeting sequence. A stability element (e.g., an exonuclease-resistant structure) may be on the 5’ end of a targeting sequence.

Subcellular Localization Elements

[0100] A recombinant polynucleotide of the present disclosure may include a localization element that enhances the sub-cellular localization (e.g., nuclear localization) of an RNA payload encoded by the recombinant polynucleotide. In some embodiments, the localization element is part of the RNA payload. For example, the localization element may be included at the 5’ end or the 3’ end, or at both ends, of the transcribed RNA payload (e.g., 5’ or 3’ of a guide RNA portion of the RNA payload). The localization element may also be downstream (e.g., 3’ end) of an additional engineered guide RNA component (e.g., a U7 hairpin or a Sm-binding sequence (SmOPT)). There may be multiple copies of a localization element or multiple localization elements in the RNA payload. A localization element may comprise one or more localization motifs. The localization element may be non-complementary to the target RNA sequence and therefore may not hybridize to the target RNA sequence. The localization element may be transcribed as part of the RNA payload and may enhance nuclear localization of the transcribed payload in a preferred location (e.g., the nucleus of a cell). For example, the localization element may be included at the 5 ’ end or the 3 ’ end, or at both ends of a guide RNA payload and may enhance nuclear localization of the guide RNA. In some embodiments, a localization element may comprise protein binding motif. The inclusion of said localization element may result in better therapeutic efficacy of the payload. For example, any localization element disclosed herein can be linked to an engineered guide RNA designed to facilitate ADAR-mediated RNA editing. Said guide RNA linked to the localization element may exhibit enhanced nuclear localization and, thereby, may also exhibit increased residence time after administration resulting in potentially higher levels of RNA editing.

Protein-Binding Motifs

[0101] In some embodiments, a localization element comprises a protein-binding motif that binds to an RNA binding protein (RBP). Inclusion of a protein-binding motif in an RNA payload may enhance the nuclear localization of the RNA payload by binding to an RNA- binding protein. Binding of an RBP to the RNA payload may enhance the nuclear localization and retention of the RNA payload in the nucleus. Binding of an RBP may also enhance stability of the RNA payload. In some embodiments, the RBP is CELF1, CNOT4, CPEB1, CPEB2, CPEB4, DAZ3, ELAVL1, ESRP1, ESRP2, EWSR1, FUBP1, FUBP3, FUS, FXR2, HNRNPA0, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPC, HNRNPCL1, HNRNPD, HNRNPF, HNRNPH2, HNRNPK, HNRNPL, IGF2BP2, ILF2, KHDRBS3, LIN28A, MBNL1, MSI1, N0VA1, NUPL2, PABPC1, PABPC4, PABPN1, PCBP2, PPRC1, QK1, RALY, RALYL, RBFOX2, RBFOX3, RBM22, RBM23, RBM24, RBM3, RBM4, RBM42, RBM45, RBM47, RBM5, RBM6, RBM8A, RBMS1, RBMS2, SART3, SF1, SFPQ, SNRNP70, SRSF1, SRSF10, SRSF8, TAF15, TARDBP, TRA2A, TRNAU1AP, U2AF2, YBX2, ZFP36. In some embodiments, the RBP is a double stranded RNA binding protein (dsRBP) that binds to double stranded RNA. The protein-binding motif may bind to a dsRBP that competes for ADAR binding (e.g., ADAD1/2, CDKN2AIP, DGCR8, DHX9, DICER, DROSHA, ILF3, MRLP44, PKR, SON, STAU1/2, STRBP, or TARBP2). RBPs may have roles in various RNA related biological processes, such as innate immune response, micro-RNA processing, apoptosis, and cell cycle. Some RBPs may act with ADAR, either synergistically or antagonistically. In some embodiments, the protein-binding motif may enhance the nuclear localization of the RNA payload by binding to an RBP. A protein-binding motif may be included at the 5’ end or the 3’ end, or at both ends, of an RNA payload to enhance the stability of the RNA payload. The protein-binding motif may enhance the nuclear localization of an RNA payload, such as a U6 RNA payload. In some embodiments, the protein-binding motif may enhance the nuclear localization of an ADAR-recruiting gRNA.

[0102] In some embodiments, a localization element may comprise a localization motif that is able to bind to an RBP. A localization motif may be a 6-mer nucleotide sequence that binds to an RBP. Example sequences of 6-mer localization motifs (e.g., RBP-binding motifs) are provided in TABLE 3.

TABLE 3 - 6-mer Motif RNA Sequences

[0103] In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of AACUGC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to AACUGC. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of CAACCA. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to CAACCA. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of CCAACC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to CCAACC. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of CCAUCC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to CCAUCC. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of CGUGCC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to CGUGCC. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of CUGACA. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to CUGACA. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of GCAGCA. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to GCAGCA. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of GCAGGC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to GCAGGC. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of GCGCGG. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to GCGCGG. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of GCUUGC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to GCUUGC. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of GGAUGU. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to GGAUGU. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of UAAUUU. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to UAAUUU. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of UAUCAA. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to UAUCAA. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of UCCCUG. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to UCCCUG. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of UUCUGU. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to UUCUGU. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of UUGUGA. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to UUGUGA. In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of UUUUAC. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to UUUUAC.

[0104] In some embodiments, a localization motif (e.g., RBP-binding motifs) may comprise a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 80% or at least about 83% sequence identity to any of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424).

[0105] In some embodiments, a sequence encoding a localization element (e.g., an RBP- binding element) may encode a localization motif (e.g., an RBP-binding motif) that is able to bind to an RBP. A sequence encoding a localization motif (e.g., an RBP-binding motif) may encode a 6-mer nucleotide sequence that binds to an RBP. Examples of sequences encoding 6- mer localization motifs (e.g., RBP-binding motifs) are provided in TABLE 4.

TABLE 4 - 6-mer Motif DNA Sequences

[0106] In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of AACTGC. In some embodiments, a localization motif (e.g., an RBP- binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to AACTGC. In some embodiments, a localization motif (e.g., an RBP- binding motif) may be encoded by a sequence of CAACCA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to CAACCA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence CCAACC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to CCAACC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of CCATCC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to CCATCC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of CGTGCC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to CGTGCC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of CTGACA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to CTGACA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of GCAGCA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to GCAGCA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of GCAGGC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to GCAGGC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of GCGCGG. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to GCGCGG. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of GCTTGC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to GCTTGC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of GGATGT. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to GGATGT. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of TAATTT. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to TAATTT. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of TATCAA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to TATCAA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of TCCCTG. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to TCCCTG. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of TTCTGT. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to TTCTGT. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of TTGTGA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to TTGTGA. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence of TTTTAC. In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to TTTTAC.

[0107] In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). In some embodiments, a localization motif (e.g., an RBP-binding motif) may be encoded by a sequence comprising at least about 80% or at least about 83% sequence identity to any of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858).

[0108] A localization motif (e.g., an RBP-binding motif) or a sequence encoding a localization motif (e.g., an RBP-binding motif) may have a length of not less than 4 and not more than 20, not less than 4 and not more than 15, not less than 4 and not more than 10, not less than 4 and not more than 8, not less than 5 and not more than 20, not less than 5 and not more than 15, not less than 5 and not more than 10, or not less than 5 and not more than 8 nucleotides. In some embodiments, a protein-binding motif has a length of not less than 5 and not more than 7 nucleotides. In some embodiments, a protein-binding motif (e.g., an RBP-binding motif) has a length of about 6 nucleotides.

[0109] In some embodiments, a localization element may comprise a sequence of a protein binding motif (e.g., an RBP-binding element). A localization element (e.g., an RBP-binding element) may comprise one or more 6-mer motifs (e.g., any one of the 6-mer motif sequences in TABLE 3). A localization element (e.g., an RBP-binding element) may comprise two or more 6-mer motifs (e.g., any one of the 6-mer motif sequences in TABLE 3). A localization element (e.g., an RBP-binding element) may comprise three or more 6-mer motifs (e.g., any one of the 6- mer motif sequences in TABLE 3). Example sequences of localization elements (e.g., RBP- binding elements) are provided in TABLE 5.

TABLE 5 - Localization Element RNA Sequences

[0110] In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 91. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 92. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 93. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 95. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 96. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 100. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 108. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 115. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 124. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 125. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 132. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 136. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 142. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 162. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 167. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 168. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 176. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 179. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 182. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 188. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 190. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 199. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 215. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 219. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 227. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 236. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 238. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 247. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 248. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 255. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 269. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 275. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 283. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 295. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 304. In some embodiments, a localization element (e.g., an RBP- binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 306.

[0111] In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence of any one of SEQ ID NO: 91 - SEQ ID NO: 317. In some embodiments, a localization element (e.g., an RBP-binding element) may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NO: 91 - SEQ ID NO: 317.

[0112] In some embodiments, a localization element may be encoded by a sequence encoding a protein binding motif (e.g., an RBP-binding element). A localization element (e.g., an RBP-binding element) may comprise one or more sequences encoding 6-mer motifs (e.g., any one of the 6-mer motif encoding sequences in TABLE 4). Examples of sequences encoding localization elements are provided in TABLE 6.

TABLE 6 - Localization Element DNA Sequences

[0113] In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 529. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 530. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 531. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 533. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 534. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 538. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 546. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 553. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 562. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 563. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 570. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 574. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 580. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 600. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 605. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 606. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 614. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 617. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 620. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 626. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 628. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 637. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 653. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 657. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 665. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 674. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 676. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 685. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 686. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 693. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 707. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 713. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 721. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 733. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 742. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 744.

[0114] In some embodiments, a localization element may be encoded by a sequence comprising any one of SEQ ID NO: 529 - SEQ ID NO: 755. In some embodiments, a localization element may be encoded by a sequence comprising at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NO: 529 - SEQ ID NO: 755.

[0115] A localization element (e.g., an RBP-binding element) may have a length of not less than 10 and not more than 30, not less than 10 and not more than 40, not less than 10 and not more than 50, not less than 10 and not more than 50, not less than 10 and not more than 60, not less than 20 and not more than 30, not less than 20 and not more than 40, not less than 20 and not more than 50, not less than 20 and not more than 60, not less than 30 and not more than 40, not less than 30 and not more than 50, not less than 30 and not more than 60, not less than 40 and not more than 50, not less than 40 and not more than 60, not less than 40 and not more than 70, not less than 50 and not more than 60, or not less than 50 and not more than 70 nucleotides. In some embodiments, a localization element has a length of 26 nucleotides. In some embodiments, a localization element has a length of not less than 25 and not more than 55 nucleotides. In some embodiments, a localization element has a length of 46 nucleotides. In some embodiments, a localization element has a length of 53 nucleotides.

[0116] A localization element (e.g., an RBP-binding element) may be on the 3’ end of a targeting sequence. A localization element (e.g., an RBP-binding element) may be on the 5’ end of a targeting sequence.

Payloads

[0117] The recombinant polynucleotides of the present disclosure may encode an RNA payload under transcriptional control of a promoter (e.g., an engineered promoter). In some embodiments, the RNA payload may encode a small RNA payload such as a guide sequence (e.g., for RNA or DNA editing), a tracrRNA, an siRNA, an shRNA, or an miRNA, an antisense oligonucleotide (e.g., for expression knockdown), a structural element (e.g., an RNA hairpin), or combinations thereof. For example, the RNA payload may encode a guide RNA for ADAR editing. The RNA payload may further comprise a stability element (e.g., an exonucleaseresistant structure, an RBP-b inding sequence, or a combination thereof). Provided herein are engineered RNA payloads and polynucleotides encoding the same; as well as compositions comprising said engineered RNA payloads or said polynucleotides. As used herein, the term “engineered” in reference to an RNA payload or polynucleotide encoding the same refers to a non-naturally occurring RNA or polynucleotide encoding the same. For example, the present disclosure provides for engineered polynucleotides encoding engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0118] In some embodiments, particular stability element and 6-mer RBP-binding motif combinations may include: (i) a stability element of UGAUAUGGU and a RBP-binding motif sequence of AACUGC; (ii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CAACCA; (iii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CCAACC; (iv) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CCAUCC; (v) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CGUGCC; (vi) a stability element of UGAUAUGGU and a RBP-binding motif sequence of CUGACA; (vii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCAGCA; (viii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCAGGC; (ix) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCGCGG; (x) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GCUUGC; (xi) a stability element of UGAUAUGGU and a RBP-binding motif sequence of GGAUGU; (xii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UAAUUU; (xiii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UAUCAA; (xiv) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UCCCUG; (xv) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UUCUGU; (xvi) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UUGUGA; (xvii) a stability element of UGAUAUGGU and a RBP-binding motif sequence of UUUUAC; (xviii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of AACUGC; (xix) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CAACCA; (xx) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CCAACC; (xxi) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CCAUCC; (xxii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CGUGCC; (xxiii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of CUGACA; (xxiv) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCAGCA; (xxv) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCAGGC; (xxvi) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCGCGG; (xxvii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GCUUGC; (xxviii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of GGAUGU; (xxix) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UAAUUU; (xxx) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UAUCAA; (xxxi) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UCCCUG; (xxxii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UUCUGU; (xxxiii) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UUGUGA; (xxxiv) a stability element of SEQ ID NO: 36 and a RBP-binding motif sequence of UUUUAC; (xxxv) a stability element of UGAAAG and a RBP-binding motif sequence of AACUGC; (xxxvi) a stability element of UGAAAG and a RBP-binding motif sequence of CAACCA; (xxxvii) a stability element of UGAAAG and a RBP-binding motif sequence of CCAACC; (xxxviii) a stability element of UGAAAG and a RBP-binding motif sequence of CCAUCC; (xxxix) a stability element of UGAAAG and a RBP-binding motif sequence of CGUGCC; (xl) a stability element of UGAAAG and a RBP-binding motif sequence of CUGACA; (xli) a stability element of UGAAAG and a RBP-binding motif sequence of GCAGCA; (xlii) a stability element of UGAAAG and a RBP-binding motif sequence of GCAGGC; (xliii) a stability element of UGAAAG and a RBP-binding motif sequence of GCGCGG; (xliv) a stability element of UGAAAG and a RBP-binding motif sequence of GCUUGC; (xlv) a stability element of UGAAAG and a RBP-binding motif sequence of GGAUGU; (xlvi) a stability element of UGAAAG and a RBP-binding motif sequence of UAAUUU; (xlvii) a stability element of UGAAAG and a RBP-binding motif sequence of UAUCAA; (xlviii) a stability element of UGAAAG and a RBP-binding motif sequence of UCCCUG; (xlix) a stability element of UGAAAG and a RBP-binding motif sequence of UUCUGU; (1) a stability element of UGAAAG and a RBP-binding motif sequence of UUGUGA; (li) a stability element of UGAAAG and a RBP-binding motif sequence of UUUUAC; (lii) a stability element of UGAAAAG and a RBP-binding motif sequence of AACUGC; (liii) a stability element of UGAAAAG and a RBP-binding motif sequence of CAACCA; (liv) a stability element of UGAAAAG and a RBP-binding motif sequence of CCAACC; (Iv) a stability element of UGAAAAG and a RBP-binding motif sequence of CCAUCC; (Ivi) a stability element of UGAAAAG and a RBP-binding motif sequence of CGUGCC; (Ivii) a stability element of UGAAAAG and a RBP-binding motif sequence of CUGACA; (Iviii) a stability element of UGAAAAG and a RBP-binding motif sequence of GCAGCA; (lix) a stability element of UGAAAAG and a RBP-binding motif sequence of GCAGGC; (lx) a stability element of UGAAAAG and a RBP-binding motif sequence of GCGCGG; (Ixi) a stability element of UGAAAAG and a RBP-binding motif sequence of GCUUGC; (Ixii) a stability element of UGAAAAG and a RBP-binding motif sequence of GGAUGU; (Ixiii) a stability element of UGAAAAG and a RBP-binding motif sequence of UAAUUU; (Ixiv) a stability element of UGAAAAG and a RBP-binding motif sequence of UAUCAA; (Ixv) a stability element of UGAAAAG and a RBP-binding motif sequence of UCCCUG; (Ixvi) a stability element of UGAAAAG and a RBP-binding motif sequence of UUCUGU; (Ixvii) a stability element of UGAAAAG and a RBP-binding motif sequence of UUGUGA; (Ixviii) a stability element of UGAAAAG and a RBP-binding motif sequence of UUUUAC; (Ixix) a stability element of CUAACG and a RBP-binding motif sequence of AACUGC; (Ixx) a stability element of CUAACG and a RBP-binding motif sequence of CAACCA; (Ixxi) a stability element of CUAACG and a RBP-binding motif sequence of CCAACC; (Ixxii) a stability element of CUAACG and a RBP-binding motif sequence of CCAUCC; (Ixxiii) a stability element of CUAACG and a RBP-binding motif sequence of CGUGCC; (Ixxiv) a stability element of CUAACG and a RBP-binding motif sequence of CUGACA; (Ixxv) a stability element of CUAACG and a RBP-binding motif sequence of GCAGCA; (Ixxvi) a stability element of CUAACG and a RBP-binding motif sequence of GCAGGC; (Ixxvii) a stability element of CUAACG and a RBP-binding motif sequence of GCGCGG; (Ixxviii) a stability element of CUAACG and a RBP-binding motif sequence of GCUUGC; (Ixxix) a stability element of CUAACG and a RBP-binding motif sequence of GGAUGU; (Ixxx) a stability element of CUAACG and a RBP-binding motif sequence of UAAUUU; (Ixxxi) a stability element of CUAACG and a RBP-binding motif sequence of UAUCAA; (Ixxxii) a stability element of CUAACG and a RBP-binding motif sequence of UCCCUG; (Ixxxiii) a stability element of CUAACG and a RBP-binding motif sequence of UUCUGU; (Ixxxiv) a stability element of CUAACG and a RBP-binding motif sequence of UUGUGA; (Ixxxv) a stability element of CUAACG and a RBP-binding motif sequence of UUUUAC; (Ixxxvi) a stability element of UUAAAUA and a RBP-binding motif sequence of AACUGC; (Ixxxvii) a stability element of UUAAAUA and a RBP-binding motif sequence of CAACCA; (Ixxxviii) a stability element of UUAAAUA and a RBP-binding motif sequence of CCAACC; (Ixxxix) a stability element of UUAAAUA and a RBP-binding motif sequence of CCAUCC; (xc) a stability element of UUAAAUA and a RBP-binding motif sequence of CGUGCC; (xci) a stability element of UUAAAUA and a RBP-binding motif sequence of CUGACA; (xcii) a stability element of UUAAAUA and a RBP-binding motif sequence of GCAGCA; (xciii) a stability element of UUAAAUA and a RBP-binding motif sequence of GCAGGC; (xciv) a stability element of UUAAAUA and a RBP-binding motif sequence of GCGCGG; (xcv) a stability element of UUAAAUA and a RBP-binding motif sequence of GCUUGC; (xcvi) a stability element of UUAAAUA and a RBP-binding motif sequence of GGAUGU; (xcvii) a stability element of UUAAAUA and a RBP-binding motif sequence of UAAUUU; (xcviii) a stability element of UUAAAUA and a RBP-binding motif sequence of UAUCAA; (xcix) a stability element of UUAAAUA and a RBP-binding motif sequence of UCCCUG; (c) a stability element of UUAAAUA and a RBP-binding motif sequence of UUCUGU; (ci) a stability element of UUAAAUA and a RBP-binding motif sequence of UUGUGA; (cii) a stability element of UUAAAUA and a RBP-binding motif sequence of UUUUAC; (ciii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of AACUGC; (civ) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CAACCA; (cv) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CCAACC; (cvi) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CCAUCC; (cvii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CGUGCC; (cviii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of CUGACA; (cix) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCAGCA; (ex) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCAGGC; (cxi) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCGCGG; (cxii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GCUUGC; (cxiii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of GGAUGU; (cxiv) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UAAUUU; (cxv) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UAUCAA; (cxvi) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UCCCUG; (cxvii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UUCUGU; (cxviii) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence of UUGUGA; or (cxix) a stability element of SEQ ID NO: 35 and a RBP-binding motif sequence ofUUUUAC.

[0119] In some aspects, particular stability element and RBP-binding element combinations may include: (i) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 91; (ii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 92; (iii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 93; (iv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 95; (v) a stability element of UGAUAUGGU and a RBP- binding element sequence of SEQ ID NO: 96; (vi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 100; (vii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 108; (viii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 115; (ix) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 124; (x) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 125; (xi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 132; (xii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 136; (xiii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 142; (xiv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 162; (xv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 167; (xvi) a stability element of UGAUAUGGU and a RBP- binding element sequence of SEQ ID NO: 168; (xvii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 176; (xviii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 179; (xix) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 182; (xx) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 188; (xxi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 190; (xxii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 199; (xxiii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 215; (xxiv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 219; (xxv) a stability element of UGAUAUGGU and a RBP- binding element sequence of SEQ ID NO: 227; (xxvi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 236; (xxvii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 238; (xxviii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 247; (xxix) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 248; (xxx) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 255; (xxxi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 269; (xxxii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 275; (xxxiii) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 283; (xxxiv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 295; (xxxv) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 304; (xxxvi) a stability element of UGAUAUGGU and a RBP-binding element sequence of SEQ ID NO: 306; (xxxvii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 91; (xxxviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 92; (xxxix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 93; (xl) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 95; (xli) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 96; (xlii) a stability element of SEQ ID NO: 36 and a RBP- binding element sequence of SEQ ID NO: 100; (xliii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 108; (xliv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 115; (xlv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 124; (xlvi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 125; (xlvii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 132; (xlviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 136; (xlix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 142; (1) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 162; (li) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 167; (lii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 168; (liii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 176; (liv) a stability element of SEQ ID NO: 36 and a RBP- binding element sequence of SEQ ID NO: 179; (Iv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 182; (Ivi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 188; (Ivii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 190; (Iviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 199; (lix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 215; (lx) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 219; (Ixi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 227; (Ixii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 236; (Ixiii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 238; (Ixiv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 247; (Ixv) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 248; (Ixvi) a stability element of SEQ ID NO: 36 and a RBP- binding element sequence of SEQ ID NO: 255; (Ixvii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 269; (Ixviii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 275; (Ixix) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 283; (Ixx) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 295; (Ixxi) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 304; (Ixxii) a stability element of SEQ ID NO: 36 and a RBP-binding element sequence of SEQ ID NO: 306; (Ixxiii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 91; (Ixxiv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 92; (Ixxv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 93; (Ixxvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 95; (Ixxvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 96; (Ixxviii) a stability element of UGAAAG and a RBP- binding element sequence of SEQ ID NO: 100; (Ixxix) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 108; (Ixxx) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 115; (Ixxxi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 124; (Ixxxii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 125; (Ixxxiii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 132; (Ixxxiv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 136;

(Ixxxv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 142; (Ixxxvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 162; (Ixxxvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 167; (Ixxxviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 168; (Ixxxix) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 176; (xc) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 179; (xci) a stability element of UGAAAG and a RBP- binding element sequence of SEQ ID NO: 182; (xcii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 188; (xciii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 190; (xciv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 199; (xcv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 215; (xcvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 219; (xcvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 227; (xcviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 236; (xcix) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 238; (c) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 247; (ci) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 248; (cii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 255;

(ciii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 269; (civ) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 275; (cv) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 283; (cvi) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 295; (cvii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 304; (cviii) a stability element of UGAAAG and a RBP-binding element sequence of SEQ ID NO: 306; (cix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 91; (ex) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 92; (cxi) a stability element of UGAAAAG and a RBP- binding element sequence of SEQ ID NO: 93; (cxii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 95; (cxiii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 96; (cxiv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 100; (cxv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 108; (cxvi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 115; (cxvii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 124;

(cxviii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 125; (cxix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 132; (exx) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 136; (exxi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 142; (cxxii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 162; (cxxiii) a stability element of UGAAAAG and a RBP-binding

-I l l- element sequence of SEQ ID NO: 167; (cxxiv) a stability element of UGAAAAG and a RBP- binding element sequence of SEQ ID NO: 168; (cxxv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 176; (cxxvi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 179; (cxxvii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 182; (cxxviii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 188; (cxxix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 190; (cxxx) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 199; (cxxxi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 215; (cxxxii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 219; (cxxxiii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 227; (cxxxiv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 236; (cxxxv) a stability element of UGAAAAG and a RBP- binding element sequence of SEQ ID NO: 238; (cxxxvi) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 247; (cxxxvii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 248; (cxxxviii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 255; (cxxxix) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 269; (cxl) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 275; (cxli) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 283; (cxlii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 295; (cxliii) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 304; (cxliv) a stability element of UGAAAAG and a RBP-binding element sequence of SEQ ID NO: 306; (cxlv) a stability element of SEQ ID NO: 19 and a RBP- binding element sequence of SEQ ID NO: 91; (cxlvi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 92; (cxlvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 93; (cxlviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 95; (cxlix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 96; (cl) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 100; (cli) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 108; (clii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 115; (cliii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 124; (cliv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 125; (civ) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 132; (clvi) a stability element of SEQ ID NO: 19 and a RBP- binding element sequence of SEQ ID NO: 136; (clvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 142; (clviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 162; (clix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 167; (clx) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 168; (clxi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 176; (clxii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 179; (clxiii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 182; (clxiv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 188; (clxv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 190; (clxvi) a stability element of SEQ ID NO: 19 and a RBP- binding element sequence of SEQ ID NO: 199; (clxvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 215; (clxviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 219; (clxix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 227; (clxx) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 236; (clxxi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 238; (clxxii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 247; (clxxiii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 248; (clxxiv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 255; (clxxv) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 269; (clxxvi) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 275; (clxxvii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 283; (clxxviii) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 295; (clxxix) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 304; (clxxx) a stability element of SEQ ID NO: 19 and a RBP-binding element sequence of SEQ ID NO: 306; (clxxxi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 91; (clxxxii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 92; (clxxxiii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 93; (clxxxiv) a stability element of UUAAAUA and a RBP- binding element sequence of SEQ ID NO: 95; (clxxxv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 96; (clxxxvi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 100; (clxxxvii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 108; (clxxxviii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 115; (clxxxix) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 124; (cxc) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 125; (cxci) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 132; (cxcii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 136; (cxciii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 142; (cxciv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 162; (cxcv) a stability element of UUAAAUA and a RBP- binding element sequence of SEQ ID NO: 167; (cxcvi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 168; (cxcvii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 176; (cxcviii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 179; (cxcix) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 182; (cc) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 188; (cci) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 190; (ccii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 199; (cciii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 215; (cciv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 219; (ccv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 227; (ccvi) a stability element of UUAAAUA and a RBP- binding element sequence of SEQ ID NO: 236; (ccvii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 238; (ccviii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 247; (ccix) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 248; (ccx) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 255; (ccxi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 269; (ccxii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 275; (ccxiii) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 283; (ccxiv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 295; (ccxv) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 304; (ccxvi) a stability element of UUAAAUA and a RBP-binding element sequence of SEQ ID NO: 306; (ccxvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 91; (ccxviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 92; (ccxix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 93; (ccxx) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 95; (ccxxi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 96; (ccxxii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 100; (ccxxiii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 108; (ccxxiv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 115; (ccxxv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 124; (ccxxvi) a stability element of SEQ ID NO: 35 and a RBP- binding element sequence of SEQ ID NO: 125; (ccxxvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 132; (ccxxviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 136; (ccxxix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 142; (ccxxx) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 162; (ccxxxi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 167; (ccxxxii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 168; (ccxxxiii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 176; (ccxxxiv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 179; (ccxxxv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 182; (ccxxxvi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 188; (ccxxxvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 190; (ccxxxviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 199; (ccxxxix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 215; (ccxl) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 219; (ccxli) a stability element of SEQ ID NO: 35 and a RBP- binding element sequence of SEQ ID NO: 227; (ccxlii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 236; (ccxliii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 238; (ccxliv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 247; (ccxlv) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 248; (ccxlvi) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 255; (ccxlvii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 269; (ccxlviii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 275; (ccxlix) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 283; (ccl) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 295; (ccli) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 304; or (cclii) a stability element of SEQ ID NO: 35 and a RBP-binding element sequence of SEQ ID NO: 306.

[0120] The sequence identity of the stability element sequence and the RBP-binding element sequence in a particular combination may be as described herein. Corresponding combinations of the DNA sequences of stability elements and DNA RBP-binding elements are also contemplated.

Guide RNA Pay loads for RNA Editing

[0121] The recombinant polynucleotides described herein may be used to enhance stability of engineered guide RNAs for site-specific, selective editing of a target RNA via an RNA editing entity or a biologically active fragment thereof. An engineered guide RNA of the present disclosure can comprise latent structures, such that when the engineered guide RNA is hybridized to the target RNA to form a guide-target RNA scaffold, at least a portion of the latent structure manifests as at least a portion of a structural feature as described herein.

[0122] An engineered guide RNA, as described herein, may comprise a targeting domain with complementarity to a target RNA described herein. As such, a guide RNA can be engineered to site-specifically/selectively target and hybridize to a particular target RNA, thus facilitating editing of specific nucleotide in the target RNA via an RNA editing entity or a biologically active fragment thereof. The targeting domain can include a nucleotide that is positioned such that, when the guide RNA is hybridized to the target RNA, the nucleotide opposes a base to be edited by the RNA editing entity or biologically active fragment thereof and does not base pair, or does not fully base pair, with the base to be edited. This mismatch can help to localize editing of the RNA editing entity to the desired base of the target RNA.

However, in some instances there can be some, and in some cases significant, off target editing in addition to the desired edit.

Hybridization of the target RNA and the targeting domain of the guide RNA may produce specific secondary structures in the guide-target RNA scaffold that manifest upon hybridization, which are referred to herein as “latent structures.” Latent structures, when manifested, may become structural features described herein, including mismatches, bulges, internal loops, and hairpins. Without wishing to be bound by theory, the presence of structural features described herein that are produced upon hybridization of the guide RNA with the target RNA configure the guide RNA to facilitate a specific, or selective, targeted edit of the target RNA via the RNA editing entity or biologically active fragment thereof. Further, the structural features in combination with the mismatch described above generally facilitate an increased amount of editing of a target residue (e.g., an adenosine residue), fewer off target edits, or both, as compared to a construct comprising the mismatch alone or a construct having perfect complementarity to a target RNA. Accordingly, rational design of latent structures in engineered guide RNAs of the present disclosure to produce specific structural features in a guide-target RNA scaffold can be a powerful tool to promote editing of the target RNA with high specificity, selectivity, and robust activity.

[0123] In some examples, the engineered guides provided herein comprise an engineered guide that can be configured, upon hybridization to a target RNA molecule, to form, at least in part, a guide-target RNA scaffold with at least a portion of the target RNA molecule, wherein the guide-target RNA scaffold comprises at least one structural feature, and wherein the guidetarget RNA scaffold recruits an RNA editing entity and facilitates a chemical modification of a base of a nucleotide in the target RNA molecule by the RNA editing entity.

[0124] In some examples, a target RNA of an engineered guide RNA of the present disclosure can be a pre-mRNA or mRNA. In some embodiments, the engineered guide RNA of the present disclosure hybridizes to a sequence of the target RNA. In some embodiments, part of the engineered guide RNA (e.g., a targeting domain) hybridizes to the sequence of the target RNA. The part of the engineered guide RNA that hybridizes to the target RNA is of sufficient complementary to the sequence of the target RNA for hybridization to occur.

Targeting Domain

[0125] In some embodiments, the engineered guide RNA comprises, or is part of the targetbinding sequence. In some embodiments, the target-binding sequence is 20 to 400 nucleotide residues long. In some embodiments, the target-binding sequence is 50 to 200 nucleotide residues long. In some embodiments, the target-binding sequence is 80 to 150 nucleotide residues long.

[0126] Engineered guide RNAs disclosed herein can be engineered in any way suitable for facilitating ADAR RNA editing. In some examples, an engineered guide RNA generally comprises at least a targeting sequence that allows it to hybridize to a region of a target RNA molecule. A targeting sequence can also be referred to as a “targeting domain” or a “targeting region.” [0127] In some cases, a targeting domain of an engineered guide allows the engineered guide to target an RNA sequence through base pairing, such as Watson Crick base pairing. In some examples, the targeting sequence can be located at either the N-terminus or C-terminus of the engineered guide. In some cases, the targeting sequence can be located at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,

28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,

54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,

80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,

104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122,

123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141,

142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length. In some cases, the targeting sequence can be no greater than about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,

14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,

40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,

66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,

92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,

113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,

132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides in length. In some examples, an engineered guide comprises a targeting sequence that can be from about 60 to about 500, from about 60 to about 200, from about 75 to about 100, from about 80 to about 200, from about 90 to about 120, or from about 95 to about 115 nucleotides in length. In some examples, an engineered guide RNA comprises a targeting sequence that can be about 100 nucleotides in length.

[0128] In some cases, a targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA. In some cases, a targeting sequence comprises less than 100% complementarity to a target RNA sequence. For example, a targeting sequence and a region of a target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0129] The targeting sequence can have sufficient complementarity to a target RNA to allow for hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to non-contiguous stretches of sequence. In some embodiments, antisense complementarity refers to contiguous stretches of sequence.

[0130] In some embodiments, hybridization of the targeting sequence to the target RNA to form a guide-target RNA scaffold may manifest a latent structural feature. For example, a latent structural feature may comprise a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, or combinations thereof. In some embodiments, the latent structural feature may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 unpaired nucleotides on the target RNA side. In some embodiments, the latent structural feature may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 unpaired nucleotides on the guide RNA side.

Engineered Guide RNAs Having a Recruitment Domain

[0131] In some examples, a subject engineered guide RNA comprises a recruiting domain that recruits an RNA editing entity (e.g., ADAR), where in some instances, the recruiting domain is formed and present in the absence of binding to the target RNA. A “recruiting domain” can be referred to herein as a “recruiting sequence” or a “recruiting region”. In some examples, a subject engineered guide can facilitate editing of a base of a nucleotide of in a target sequence of a target RNA that results in modulating the expression of a polypeptide encoded by the target RNA. In some instances, modulation can be increased or decrease expression of the polypeptide. In some cases, an engineered guide can be configured to facilitate an editing of a base of a nucleotide or polynucleotide of a region of an RNA by an RNA editing entity (e.g., ADAR or APOBEC). In order to facilitate editing, an engineered polynucleotide of the disclosure can recruit an RNA editing entity (e.g., ADAR or APOBEC). Various RNA editing entity recruiting domains can be utilized. In some examples, a recruiting domain comprises: Glutamate ionotropic receptor AMPA type subunit 2 (GluR2), an Alu sequence, or, in the case of recruiting APOBEC, an APOBEC recruiting domain.

[0132] In some examples, more than one recruiting domain can be included in an engineered guide of the disclosure. In examples where a recruiting domain can be present, the recruiting domain can be utilized to position the RNA editing entity to effectively react with a subject target RNA after the targeting sequence hybridizes to a target sequence of a target RNA. In some cases, a recruiting domain can allow for transient binding of the RNA editing entity to the engineered guide. In some examples, the recruiting domain allows for permanent binding of the RNA editing entity to the engineered guide. A recruiting domain can be of any length. In some cases, a recruiting domain can be from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,

43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,

69, 70, 71, 72, 73, 74, 75, up to about 80 nucleotides in length. In some cases, a recruiting domain can be no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,

46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,

72, 73, 74, 75, or 80 nucleotides in length. In some cases, a recruiting domain can be about 45 nucleotides in length. In some cases, at least a portion of a recruiting domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of a recruiting domain comprises about 45 nucleotides to about 60 nucleotides.

[0133] In some embodiments, a recruiting domain comprises a GluR2 sequence or functional fragment thereof. In some cases, a GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR or biologically active fragment thereof. In some embodiments, a GluR2 sequence can be a non-naturally occurring sequence. In some cases, a GluR2 sequence can be modified, for example for enhanced recruitment. In some embodiments, a GluR2 sequence can comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

[0134] In some examples, a recruiting domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and/or length to: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 1). In some examples, a recruiting domain comprises a sequence encoding a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and/or length to: GTGGAATAGTATAACAATATGCTAAATGTTGTTATAGTATCCCAC (SEQ ID NO: 443). In some cases, a recruiting domain can comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 1. In some examples, a recruiting domain can comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and/or length to SEQ ID NO: 1. In some cases, a sequence encoding a recruiting domain can comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 443. In some examples, a sequence encoding a recruiting domain can comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and/or length to SEQ ID NO: 443.

[0135] Additional, RNA editing entity recruiting domains are also contemplated. In an embodiment, a recruiting domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) domain. In some cases, an APOBEC domain can comprise a non-naturally occurring sequence or naturally occurring sequence. In some embodiments, an APOBEC-domain-encoding sequence can comprise a modified portion. In some cases, an APOBEC-domain-encoding sequence can comprise a portion of a naturally occurring APOBEC- domain-encoding-sequence. In another embodiment, a recruiting domain can be from an Alu domain.

[0136] Any number of recruiting domains can be found in an engineered guide of the present disclosure. In some examples, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruiting domains can be included in an engineered guide. Recruiting domains can be located at any position of engineered guide RNAs. In some cases, a recruiting domain can be on an N- terminus, middle, or C-terminus of an engineered guide RNA. A recruiting domain can be upstream or downstream of a targeting sequence. In some cases, a recruiting domain flanks a targeting sequence of a subject guide. A recruiting sequence can comprise all ribonucleotides or deoxyribonucleotides, although a recruiting domain comprising both ribo- and deoxyribonucleotides can in some cases not be excluded.

Engineered Guide RNAs with Latent Structure

[0137] In some examples, an engineered guide disclosed herein useful for facilitating editing of a target RNA by an RNA editing entity can be an engineered latent guide RNA. An “engineered latent guide RNA” refers to an engineered guide RNA that comprises latent structure. “Latent structure” refers to a structural feature that substantially forms upon hybridization of a guide RNA to a target RNA. For example, the sequence of a guide RNA provides one or more structural features, but these structural features substantially form only upon hybridization to the target RNA, and thus the one or more latent structural features manifest as structural features upon hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, the structural feature is formed, and the latent structure provided in the guide RNA is, thus, unmasked.

[0138] A double stranded RNA (dsRNA) substrate may be formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The resulting dsRNA substrate is also referred to herein as a “guide -target RNA scaffold.” [0139] FIG. 1 shows a legend of various exemplary structural features present in guide-target RNA scaffolds formed upon hybridization of a latent guide RNA of the present disclosure to a target RNA. Example structural features shown include an 8/7 asymmetric loop (i., 8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2/2 symmetric bulge (ii., 2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1/1 mismatch (iii., 1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5/5 symmetric internal loop (iv., 5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (v., 24 nucleotides on the target RNA side base paired to 24 nucleotides on the guide RNA side), and a 2/3 asymmetric bulge (vi., 2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side).

[0140] Unless otherwise noted, the number of participating nucleotides in a given structural feature is indicated as the nucleotides on the target RNA side over nucleotides on the guide RNA side. Also shown in this legend is a key to the positional annotation of each figure. For example, the target nucleotide to be edited is designated as the 0 position. Downstream (3’) of the target nucleotide to be edited, each nucleotide is counted in increments of +1. Upstream (5’) of the target nucleotide to be edited, each nucleotide is counted in increments of -1. Thus, the example 2/2 symmetric bulge in this legend is at the +12 to +13 position in the guide-target RNA scaffold. Similarly, the 2/3 asymmetric bulge in this legend is at the -36 to-37 position in the guide-target RNA scaffold. As used herein, positional annotation is provided with respect to the target nucleotide to be edited and on the target RNA side of the guide-target RNA scaffold. As used herein, if a single position is annotated, the structural feature extends from that position away from position 0 (target nucleotide to be edited). For example, if a latent guide RNA is annotated herein as forming a 2/3 asymmetric bulge at position -36, then the 2/3 asymmetric bulge forms from -36 position to the -37 position with respect to the target nucleotide to be edited (position 0) on the target RNA side of the guide-target RNA scaffold. As another example, if a latent guide RNA is annotated herein as forming a 2/2 symmetric bulge at position +12, then the 2/2 symmetric bulge forms from the +12 to the +13 position with respect to the target nucleotide to be edited (position 0) on the target RNA side of the guide-target RNA scaffold.

[0141] In some examples, the engineered guides disclosed herein lack a recruiting region and recruitment of the RNA editing entity can be effectuated by structural features of the guidetarget RNA scaffold formed by hybridization of the engineered guide RNA and the target RNA. In some examples, the engineered guide, when present in an aqueous solution and not bound to the target RNA molecule, does not comprise structural features that recruit the RNA editing entity (e.g., ADAR or APOBEC). The engineered guide RNA, upon hybridization to a target RNA, form with the target RNA molecule, one or more structural features that recruits an RNA editing entity (e.g., ADAR or APOBEC).

[0142] In cases where a recruiting sequence can be absent, an engineered guide RNA can be still capable of associating with a subject RNA editing entity (e.g., ADAR or APOBEC) to facilitate editing of a target RNA and/or modulate expression of a polypeptide encoded by a subject target RNA. This can be achieved through structural features formed in the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA and the target RNA. Structural features can comprise any one of a: mismatch, symmetrical bulge, asymmetrical bulge, symmetrical internal loop, asymmetrical internal loop, hairpins, wobble base pairs, or any combination thereof.

[0143] Described herein are structural features which can be present in a guide-target RNA scaffold of the present disclosure. Examples of features include a mismatch, a bulge (symmetrical bulge or asymmetrical bulge), an internal loop (symmetrical internal loop or asymmetrical internal loop), or a hairpin (a recruiting hairpin or a non-recruiting hairpin). Engineered guide RNAs of the present disclosure can have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from latent structure in an engineered latent guide RNA upon hybridization of the engineered latent guide RNA to a target RNA and, thus, formation of a guide-target RNA scaffold. In some embodiments, structural features are not formed from latent structures and are, instead, pre-formed structures (e.g., a GluR2 recruitment hairpin or a hairpin from U7 snRNA).

[0144] A guide-target RNA scaffold may be formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a mismatch refers to a single nucleotide in a guide RNA that is unpaired to an opposing single nucleotide in a target RNA within the guide-target RNA scaffold. A mismatch can comprise any two single nucleotides that do not base pair. Where the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1 , the resulting structure is no longer considered a mismatch, but rather, is considered a bulge or an internal loop, depending on the size of the structural feature. In some embodiments, a mismatch is an A/C mismatch. An A/C mismatch can comprise a C in an engineered guide RNA of the present disclosure opposite an A in a target RNA. An A/C mismatch can comprise an A in an engineered guide RNA of the present disclosure opposite a C in a target RNA. A G/G mismatch can comprise a G in an engineered guide RNA of the present disclosure opposite a G in a target RNA.

[0145] In some embodiments, a mismatch positioned 5 ’ of the edit site can facilitate baseflipping of the target A to be edited. A mismatch can also help confer sequence specificity. Thus, a mismatch can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0146] In another aspect, a structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair of the present disclosure can refer to a G paired with a U. Thus, a wobble base pair can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0147] Guide RNAs of the present disclosure can further comprise a macro-footprint. In some embodiments, the macro-footprint comprises a barbell macro-footprint. A micro-footprint can serve to guide an RNA editing enzyme and direct its activity towards the target adenosine to be edited. A “barbell” as described herein refers to a pair of internal loop latent structures that manifest upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is positioned towards the 5' end or the 3' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some embodiments, each internal loop flanks opposing sides of the micro-footprint sequence. Insertion of a barbell macrofootprint sequence flanking opposing sides of the micro-footprint sequence, upon hybridization of the guide RNA to the target RNA, results in formation of barbell internal loops on opposing sides of the micro-footprint. In some cases, barbell internal loops can comprise at least one structural feature that facilitates editing of a specific target RNA.

[0148] A dumbbell design in an engineered guide RNA comprises two symmetrical internal loops, wherein the target A to be edited is positioned between the two symmetrical loops for selective editing of the target A. The two symmetrical internal loops are each formed by 6 nucleotides on the guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a dumbbell can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0149] As disclosed herein, a “macro-footprint” sequence can be positioned such that it flanks a micro-footprint sequence. Further, while a macro-footprint sequence can flank a microfootprint sequence, additional latent structures can be incorporated that flank either end of the macro-footprint as well. In some embodiments, such additional latent structures are included as part of the macro-footprint. In some embodiments, such additional latent structures are separate, distinct, or both separate and distinct from the macro-footprint.

[0150] In some embodiments, a macro-footprint sequence can comprise a barbell macrofootprint sequence comprising latent structures that, when manifested, produce a first internal loop and a second internal loop.

[0151] In some embodiments, the first internal loop of the barbell or the second internal loop of the barbell is positioned at least about 5 bases (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) away from the A/C mismatch with respect to the base of the first internal loop or the second internal loop that is the most proximal to the A/C mismatch. In some embodiments, the first internal loop of the barbell or the second internal loop of the barbell is positioned at most about 50 bases away from the A/C mismatch (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5) with respect to the base of the first internal loop or the second internal loop that is the most proximal to the A/C mismatch.

[0152] In some embodiments, a first internal loop or a second internal loop independently comprises a number of bases of at least about 5 bases or greater (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or fewer (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19- 80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the engineered guide RNA and a number of bases of at least about 5 bases or greater (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or fewer (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10- 125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the target RNA.

[0153] In some embodiments, the presence of barbells flanking the micro-footprint can improve one or more aspects of editing. For example, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a higher amount of on target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Additionally, and or alternatively, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Further, while the effect of various micro-footprint structural features can vary on a target-by-target basis based on selection in a high throughput screen, the increase in the one or more aspects of editing provided by the barbell macro-footprint structures can be independent of the particular target RNA. For example, macro-footprints (e.g., barbell macro-footprints) and micro-footprints can provide an increased amount of on target adenosine editing relative to an otherwise comparable guide RNA lacking the barbells. In other embodiments, the presence of the barbell macro-footprint in addition to the micro-footprint described here can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA, upon hybridization of the guide RNA and target RNA to form a guide-target RNA scaffold lacking the barbells.

[0154] In some cases, a structural feature can be a hairpin. As disclosed herein, a hairpin includes an RNA duplex wherein a portion of a single RNA strand has folded in upon itself to form the RNA duplex. The portion of the single RNA strand folds upon itself due to having nucleotide sequences that base pair to each other, where the nucleotide sequences are separated by an intervening sequence that does not base pair with itself, thus forming a base-paired portion and non-base paired, intervening loop portion. A hairpin can have from 10 to 500 nucleotides in length of the entire duplex structure. The loop portion of a hairpin can be from 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have from 1 to 10 hairpins, in some embodiments, the engineered guide RNAs disclosed herein have 1 hairpin. In some embodiments, the engineered guide RNAs disclosed herein have 2 hairpins. As disclosed herein, a hairpin can include a recruitment hairpin or a non-recruitment hairpin. A hairpin can be located anywhere within the engineered guide RNAs of the present disclosure. In some embodiments, one or more hairpins is proximal to or present at the 3 ’ end of an engineered guide RNA of the present disclosure, proximal to or at the 5 ’ end of an engineered guide RNA of the present disclosure, proximal to or within the targeting domain of the engineered guide RNAs of the present disclosure, or any combination thereof.

[0155] In some aspects, a structural feature comprises a non-recruitment hairpin. A nonrecruitment hairpin, as disclosed herein, does not have a primary function of recruiting an RNA editing entity. A non-recruitment hairpin, in some instances, does not recruit an RNA editing entity. In some instances, a non-recruitment hairpin has a dissociation constant for binding to an RNA editing entity under physiological conditions that is insufficient for binding. For example, a non-recruitment hairpin has a dissociation constant for binding an RNA editing entity at 25 °C that is greater than about 1 mM, 10 mM, 100 mM, or 1 M, as determined in an in vitro assay. A non-recruitment hairpin can exhibit functionality that improves localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruitment hairpin improves nuclear retention. In some embodiments, the non-recruitment hairpin comprises a hairpin from U7 snRNA. Thus, a non-recruitment hairpin such as a hairpin from U7 snRNA is a pre-formed structural feature that can be present in constructs comprising engineered guide RNA constructs, not a structural feature formed by latent structure provided in an engineered latent guide RNA. [0156] A hairpin of the present disclosure can be of any length. In an aspect, a hairpin can be from about 10-500 or more nucleotides. In some cases, a hairpin can comprise about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,

39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,

65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,

91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111,

112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130,

131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149,

150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,

169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187,

188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206,

207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225,

226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244,

245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,

264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282,

283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301,

302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320,

321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339,

340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358,

359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377,

378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396,

397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415,

416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434,

435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453,

454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472,

473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491,

492, 493, 494, 495, 496, 497, 498, 499, 500 or more nucleotides. In other cases, a hairpin can also comprise 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 10 to 110, 10 to 120, 10 to 130, 10 to 140, 10 to 150, 10 to 160, 10 to 170, 10 to 180, 10 to

190, 10 to 200, 10 to 210, 10 to 220, 10 to 230, 10 to 240, 10 to 250, 10 to 260, 10 to 270, 10 to

280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to

370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to

460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0157] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a bulge refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where contiguous nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can change the secondary or tertiary structure of the guide-target RNA scaffold. A bulge can independently have from 0 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the target RNA side of the guide-target RNA scaffold or a bulge can independently have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge, as used herein, does not refer to a structure where a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair - a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA that do not base pair is referred to herein as a mismatch. Further, where the number of participating nucleotides on either the guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but rather, is considered an internal loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has 2 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 3 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 4 bulges. Thus, a bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0158] In some embodiments, the presence of a bulge in a guide-target RNA scaffold can position or can help to position ADAR to selectively edit the target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in a guide-target RNA scaffold can recruit or help recruit additional amounts of ADAR. Bulges in guide-target RNA scaffolds disclosed herein can recruit other proteins, such as other RNA editing entities. In some embodiments, a bulge positioned 5’ of the edit site can facilitate base-flipping of the target A to be edited. A bulge can also help confer sequence specificity for the A of the target RNA to be edited, relative to other A(s) present in the target RNA. For example, a bulge can help direct ADAR editing by constraining it in an orientation that yields selective editing of the target A.

[0159] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge can be a symmetrical bulge or an asymmetrical bulge. A symmetrical bulge is formed when the same number of nucleotides is present on each side of the bulge. For example, a symmetrical bulge in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 2 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0160] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge can be a symmetrical bulge or an asymmetrical bulge. An asymmetrical bulge is formed when a different number of nucleotides is present on each side of the bulge. For example, an asymmetrical bulge in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guidetarget RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide -target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0161] In some cases, a structural feature can be an internal loop. As disclosed herein, an internal loop refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand and where one side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guidetarget RNA scaffold, has 5 nucleotides or more. Where the number of participating nucleotides on both the guide RNA side and the target RNA side drops below 5, the resulting structure is no longer considered an internal loop, but rather, is considered a bulge or a mismatch, depending on the size of the structural feature. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. Internal loops present in the vicinity of the edit site can help with base flipping of the target A in the target RNA to be edited.

[0162] One side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, can be formed by from 5 to 150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides therebetween. One side of the internal loop can be formed by 5 nucleotides. One side of the internal loop can be formed by 10 nucleotides. One side of the internal loop can be formed by 15 nucleotides. One side of the internal loop can be formed by 20 nucleotides. One side of the internal loop can be formed by 25 nucleotides. One side of the internal loop can be formed by 30 nucleotides. One side of the internal loop can be formed by 35 nucleotides. One side of the internal loop can be formed by 40 nucleotides. One side of the internal loop can be formed by 45 nucleotides. One side of the internal loop can be formed by 50 nucleotides. One side of the internal loop can be formed by 55 nucleotides. One side of the internal loop can be formed by 60 nucleotides. One side of the internal loop can be formed by 65 nucleotides. One side of the internal loop can be formed by 70 nucleotides. One side of the internal loop can be formed by 75 nucleotides. One side of the internal loop can be formed by 80 nucleotides. One side of the internal loop can be formed by 85 nucleotides. One side of the internal loop can be formed by 90 nucleotides. One side of the internal loop can be formed by 95 nucleotides. One side of the internal loop can be formed by 100 nucleotides. One side of the internal loop can be formed by 110 nucleotides. One side of the internal loop can be formed by 120 nucleotides. One side of the internal loop can be formed by 130 nucleotides. One side of the internal loop can be formed by 140 nucleotides. One side of the internal loop can be formed by 150 nucleotides. One side of the internal loop can be formed by 200 nucleotides. One side of the internal loop can be formed by 250 nucleotides. One side of the internal loop can be formed by 300 nucleotides. One side of the internal loop can be formed by 350 nucleotides. One side of the internal loop can be formed by 400 nucleotides. One side of the internal loop can be formed by 450 nucleotides. One side of the internal loop can be formed by 500 nucleotides. One side of the internal loop can be formed by 600 nucleotides. One side of the internal loop can be formed by 700 nucleotides. One side of the internal loop can be formed by 800 nucleotides. One side of the internal loop can be formed by 900 nucleotides. One side of the internal loop can be formed by 1000 nucleotides. Thus, an internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0163] An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. A symmetrical internal loop is formed when the same number of nucleotides is present on each side of the internal loop. For example, a symmetrical internal loop in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide -target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 15 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 20 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 30 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 40 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 60 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 70 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 80 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 90 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 110 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 120 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 130 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 140 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 250 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 350 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 450 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 600 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 700 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 800 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 900 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0164] An asymmetrical internal loop is formed when a different number of nucleotides is present on each side of the internal loop. For example, an asymmetrical internal loop in a guidetarget RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0165] An asymmetrical internal loop of the present disclosure can be formed by from 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the different on the engineered side of the guide-target RNA scaffold target than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by from 5 to 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 1000 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the different on the engineered side of the guide-target RNA scaffold target than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide- target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA. [0166] As described herein, a “micro-footprint” sequence refers to a sequence with latent structures that, when manifested, facilitate editing of the adenosine of a target RNA via an adenosine deaminase enzyme. A macro-footprint can serve to guide or focus an RNA editing entity (e.g., ADAR) and direct its activity towards a micro-footprint. In some embodiments, included within the micro-footprint sequence is a nucleotide that is positioned such that, when the guide RNA is hybridized to the target RNA, said nucleotide is opposite the adenosine to be edited by the ADAR enzyme and does not base pair with the adenosine to be edited. This nucleotide is referred to herein as the “mismatched position” or “mismatch” and can be a cytosine. Micro-footprint sequences as described herein have, upon hybridization of the engineered guide RNA and target RNA, at least one structural feature selected from the group consisting of: a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. Engineered guide RNAs with superior micro-footprint sequences can be selected based on their ability to facilitate editing of a specific target RNA. Engineered guide RNAs selected for their ability to facilitate editing of a specific target are capable of adopting various micro-footprint latent structures, which can vary on a target-by -target basis.

[0167] Guide RNAs of the present disclosure may further comprise a macro-footprint. In some embodiments, the macro-footprint comprises a barbell macro-footprint. A micro-footprint can serve to guide or focus an RNA editing enzyme and direct its activity towards the target adenosine to be edited. A “barbell” as described herein refers to a pair of internal loop latent structural features that manifest upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is positioned towards the 5' end or the 3' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some embodiments, each internal loop flanks opposing sides of the micro-footprint sequence. Insertion of a barbell macro-footprint sequence flanking opposing sides of the micro-footprint sequence, upon hybridization of the guide RNA to the target RNA, results in formation of barbell internal loops on opposing sides of the micro-footprint, which in turn comprises at least one structural feature that facilitates editing of a specific target RNA.

[0168] In some embodiments, the presence of barbells flanking the micro-footprint can improve one or more aspects of editing. For example, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a higher amount of on target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Additionally, and or alternatively, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Further, while the effect of various micro-footprint structural features can vary on a target-by-target basis based on selection in a high throughput screen, the increase in the one or more aspects of editing provided by the barbell macro-footprint structures can be independent of the particular target RNA. Thus, inclusion of barbell structures can provide a facile method of improving editing of guide RNAs previously selected to facilitate editing of a target RNA of interest. For example, macro-footprints (e.g., barbell macrofootprints) and micro-footprints can provide an increased amount of on target adenosine editing relative to an otherwise comparable guide RNA lacking the barbells. In other embodiments, the presence of the barbell macro-footprint in addition to the micro-footprint can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA, upon hybridization of the guide RNA and target RNA to form a guide -target RNA scaffold lacking the barbells.

[0169] As disclosed herein, a “macro-footprint” sequence can be positioned such that it flanks a micro-footprint sequence. Further, while a macro-footprint sequence can flank a microfootprint sequence, additional latent structures can be incorporated that flank either end of the macro-footprint as well. In some embodiments, such additional latent structures are included as part of the macro-footprint. In some embodiments, such additional latent structures are separate, distinct, or both separate and distinct from the macro-footprint. In some embodiments, a macrofootprint sequence can comprise a barbell macro-footprint sequence comprising latent structures that, when manifested, produce a first internal loop and a second internal loop.

[0170] As disclosed herein, a “base paired (bp) region” refers to a region of the guide-target RNA scaffold in which bases in the guide RNA are paired with opposing bases in the target RNA. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to the other end of the guide-target RNA scaffold. Base paired regions can extend between two structural features. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to a structural feature. Base paired regions can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, a base paired region has from 1 bp to 100 bp, from 1 bp to 90 bp, from 1 bp to 80 bp, from 1 bp to 70 bp, from 1 bp to 60 bp, from 1 bp to 50 bp, from 1 bp to 45 bp, from 1 bp to 40 bp, from 1 bp to 35 bp, from 1 bp to 30 bp, from 1 bp to 25 bp, from 1 bp to 20 bp, from 1 bp to 15 bp, from 1 bp to 10 bp, from 1 bp to 5 bp, from 5 bp to 10 bp, from 5 bp to 20 bp, from 10 bp to 20 bp, from 10 bp to 50 bp, from 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp, at least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.

Additional Engineered Guide RNA Components

[0171] The present disclosure provides for engineered guide RNAs with additional structural features and components. For example, an engineered guide RNA described herein can be circular. Additional structural features may include RNA hairpins (e.g., a U7 hairpin). Alternatively, or in addition, structural features may include an Sm-b inding sequence (SmOPT). For example, an engineered guide RNA described herein can comprise a U7, an SmOPT sequence, or a combination of both sequences. In some embodiments, an additional structural feature or component may increase localization of the payload to a nucleus of a cell expressing the payload. For example, an engineered guide RNA may comprise an SmOPT sequence, an hnRNPAl localization signal, or a BORG localization signal.

[0172] In some cases, an engineered guide RNA can be circularized. In some cases, an engineered guide RNA provided herein can be circularized or in a circular configuration. In some aspects, an at least partially circular guide RNA lacks a 5’ hydroxyl or a 3’ hydroxyl. [0173] In some examples, an engineered guide RNA can comprise a backbone comprising a plurality of sugar and phosphate moieties covalently linked together. In some examples, a backbone of an engineered guide RNA can comprise a phosphodiester bond linkage between a first hydroxyl group in a phosphate group on a 5 ’ carbon of a deoxyribose in DNA or ribose in RNA and a second hydroxyl group on a 3 ’ carbon of a deoxyribose in DNA or ribose in RNA. [0174] In some embodiments, a backbone of an engineered guide RNA can lack a 5 ’ reducing hydroxyl, a 3’ reducing hydroxyl, or both, capable of being exposed to a solvent. In some embodiments, a backbone of an engineered guide can lack a 5 ’ reducing hydroxyl, a 3 ’ reducing hydroxyl, or both, capable of being exposed to nucleases. In some embodiments, a backbone of an engineered guide can lack a 5 ’ reducing hydroxyl, a 3 ’ reducing hydroxyl, or both, capable of being exposed to hydrolytic enzymes. In some instances, a backbone of an engineered guide can be represented as a polynucleotide sequence in a circular 2-dimensional format with one nucleotide after the other. In some instances, a backbone of an engineered guide can be represented as a polynucleotide sequence in a looped 2-dimensional format with one nucleotide after the other. In some cases, a 5’ hydroxyl, a 3’ hydroxyl, or both, can be joined through a phosphorus-oxygen bond. In some cases, a 5’ hydroxyl, a 3’ hydroxyl, or both, can be modified into a phosphoester with a phosphorus-containing moiety.

[0175] As described herein, an engineered guide can comprise a circular structure. An engineered polynucleotide can be circularized from a precursor engineered polynucleotide. Such a precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, a precursor engineered linear polynucleotide can be a precursor for a circular engineered guide RNA. For example, a precursor engineered linear polynucleotide can be a linear mRNA transcribed from a plasmid, which can be configured to circularize within a cell using the techniques described herein. A precursor engineered linear polynucleotide can be constructed with domains such as a ribozyme domain and a ligation domain that allow for circularization when inserted into a cell. A ribozyme domain can include a domain that is capable of cleaving the linear precursor RNA at specific sites (e.g., adjacent to the ligation domain). A precursor engineered linear polynucleotide can comprise, from 5’ to 3’: a 5’ ribozyme domain, a 5 ’ ligation domain, a circularized region, a 3 ’ ligation domain, and a 3 ’ ribozyme domain. In some cases, a circularized region can comprise a guide RNA described herein. In some cases, the precursor polynucleotide can be specifically processed at both sites by the 5’ and the 3’ ribozymes, respectively, to free exposed ends on the 5’ and 3’ ligation domains. The free exposed ends can be ligation competent, such that the ends can be ligated to form a mature circularized structure. For instance, the free ends can include a 5 ’-OH and a 2’, 3 ’-cyclic phosphate that are ligated via RNA ligation in the cell. The linear polynucleotide with the ligation and ribozyme domains can be transfected into a cell where it can circularize via endogenous cellular enzymes. In some cases, a polynucleotide can encode an engineered guide RNA comprising the ribozyme and ligation domains described herein, which can circularize within a cell. Circular guide RNAs are described in PCT/US2021/034301, which is incorporated by reference in its entirety.

[0176] An engineered polynucleotide as described herein (e.g., a circularized guide RNA) can include spacer domains. As described herein, a spacer domain can refer to a domain that provides space between other domains. A spacer domain can be used to between a region to be circularized and flanking ligation sequences to increase the overall size of the mature circularized guide RNA. Where the region to be circularized includes a targeting domain as described herein that is configured to associate to a target sequence, the addition of spacers can provide improvements (e.g., increased specificity, enhanced editing efficiency, etc.) for the engineered polynucleotide to the target polynucleotide, relative to a comparable engineered polynucleotide that lacks a spacer domain. In some instances, the spacer domain is configured to not hybridize with the target RNA. In some embodiments, a precursor engineered polynucleotide or a circular engineered guide, can comprise, in order of 5’ to 3’: a first ribozyme domain; a first ligation domain; a first spacer domain; a targeting domain that can be at least partially complementary to a target RNA, a second spacer domain, a second ligation domain, and a second ribozyme domain. In some cases, the first spacer domain, the second spacer domain, or both are configured to not bind to the target RNA when the targeting domain binds to the target RNA.

[0177] The compositions and methods of the present disclosure provide engineered polynucleotides encoding for guide RNAs that are operably linked to a portion of a small nuclear ribonucleic acid (snRNA) sequence. The engineered polynucleotide can include at least a portion of a small nuclear ribonucleic acid (snRNA) sequence. The U7 and U1 small nuclear RNAs, whose natural role is in spliceosomal processing of pre-mRNA, have for decades been re-engineered to alter splicing at desired disease targets. Replacing a portion of the U7 snRNA which naturally hybridizes to the spacer element of histone pre-mRNA (e.g., the first 18 nucleotides of the U7 snRNA) with a short targeting (or antisense) sequence of a disease gene, may redirect the splicing machinery to alter splicing around that target site. Furthermore, converting the wild type U7 Sm-domain binding site to an optimized consensus Sm-binding sequence (SmOPT) can increase the expression level, activity, and subcellular localization of the artificial antisense-engineered U7 snRNA. Many subsequent groups have adapted this modified U7 SmOPT snRNA chassis with antisense sequences of other genes to recruit spliceosomal elements and modify RNA splicing for additional disease targets.

[0178] An snRNA is a class of small RNA molecules found within the nucleus of eukaryotic cells. They are involved in a variety of important processes such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintaining the telomeres. They are always associated with specific proteins, and the resulting RNA-protein complexes are referred to as small nuclear ribonucleoproteins (snRNP) or sometimes as snurps. There are many snRNAs, which are denominated U1 , U2, U3, U4, U5, U6, U7, U8, U9, and U10.

[0179] The snRNA of the U7 type is normally involved in the maturation of histone mRNA. This snRNA has been identified in a great number of eukaryotic species (56 so far) and the U7 snRNA of each of these species should be regarded as equally convenient for this disclosure. [0180] Wild-type U7 snRNA includes a stem-loop structure, the U7-specific Sm sequence, and a sequence antisense to the 3’ end of histone pre-mRNA.

[0181] In addition to the SmOPT domain, U7 comprises a sequence antisense to the 3 ’ end of histone pre-mRNA. When this sequence is replaced by a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Accordingly, the stable expression of modified U7 snRNAs containing the SmOPT domain and a targeting antisense sequence has resulted in specific alteration of mRNA splicing. While AAV-2/1 based vectors expressing an appropriately modified murine U7 gene along with its natural promoter and 3 ’elements have enabled high efficiency gene transfer into the skeletal muscle and complete dystrophin rescue by covering and skipping mouse Dmd exon 23, the engineered polynucleotides as described herein (whether directly administered or administered via, for example, AAV vectors) can facilitate editing of target RNA by a deaminase.

[0182] The engineered polynucleotide can comprise at least in part an snRNA sequence. The snRNA sequence can be Ul, U2, U3, U4, U5, U6, U7, U8, U9, or a U10 snRNA sequence.

[0183] In some instances, an engineered polynucleotide that comprises at least a portion of an snRNA sequence (e.g., an snRNA promoter, an snRNA hairpin, and the like) can have superior properties for treating or preventing a disease or condition, relative to a comparable polynucleotide lacking such features. For example, as described herein an engineered polynucleotide that comprises at least a portion of an snRNA sequence can facilitate exon skipping of an exon at a greater efficiency than a comparable polynucleotide lacking such features. Further, as described herein an engineered polynucleotide that comprises at least a portion of an snRNA sequence can facilitate an editing of a base of a nucleotide in a target RNA (e.g., a pre-mRNA or a mature RNA) at a greater efficiency than a comparable polynucleotide lacking such features. Promoters and snRNA components are described in PCT/US2021/028618, which is incorporated by reference in its entirety.

[0184] Disclosed herein are engineered RNAs comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, a SmOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 Hairpin sequence, or a mouse U7 hairpin sequence. In some cases, a human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 2) or RNA: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 3). In some cases, a mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 4) or RNA: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 5). In some embodiments, the SmOPT sequence has a sequence of AATTTTTGGAG (SEQ ID NO: 6) or RNA: AAUUUUUGGAG (SEQ ID NO: 7). In some embodiments, an RNA payload may comprise a guide RNA, a U7 hairpin sequence (e.g., a human or a mouse U7 hairpin sequence), an SmOPT sequence, or a combination thereof. In some cases, a combination of a U7 hairpin sequence and a SmOPT sequence can comprise a SmOPT U7 hairpin sequence, wherein the SmOPT sequence is linked to the U7 sequence. In some cases, a U7 hairpin sequence, an SmOPT sequence, or a combination thereof is downstream (e.g., 3’) of the engineered guide RNA disclosed herein. Guide RNA Pay loads for DNA Editing

[0185] The recombinant polynucleotides described herein may be used to enhance stability of RNA components for site-specific, selective editing of a target DNA via a DNA editing entity or a biologically active fragment thereof. An RNA component for site-specific DNA editing may comprise a guide RNA, a transactivating CRISPR RNA (tracrRNA), a single guide RNA, or engineered polynucleotides encoding the same. An engineered guide RNA, as described herein, may comprise a sequence with complementarity to a target DNA described herein. As such, a guide RNA can be engineered to site-specifically/selectively target and hybridize to a particular target DNA, thus facilitating editing of specific nucleotide in the target DNA via a DNA editing entity or a biologically active fragment thereof. DNA editing may be facilitated by a nuclease, such as a Cas nuclease. In some embodiments, the Cas nuclease may be a Cas9, a Casl2, or a Casl4.

[0186] In some embodiments, an engineered guide RNA hybridizes to a sequence of the target DNA. In some embodiments, part of the engineered guide RNA hybridizes to the sequence of the target DNA. The part of the engineered guide RNA that hybridizes to the target DNA is of sufficient complementary to the sequence of the target DNA for hybridization to occur. In some embodiments, the guide RNA may comprise a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to a target DNA. A guide RNA encoded by a recombinant polynucleotide of the present disclosure may comprise a length of from about 15 to about 70 nucleotides, from about 40 to about 70 nucleotides, or from about 70 to about 100 nucleotides. In some embodiments, the region of the guide RNA that hybridizes to the target may comprise a length of from about 18 to about 44 nucleotides.

[0187] In some examples, an engineered guide RNA can facilitate editing of a base of a nucleotide of in a target sequence of a target DNA that results in modulating the expression of a gene encoded by the target DNA. In some instances, modulation can be increased or decrease expression of the gene. In some cases, an engineered guide can be configured to facilitate an editing of a base of a nucleotide or polynucleotide of a region of an DNA by a DNA editing entity (e.g., a Cas nuclease).

[0188] In some embodiments, the recombinant polynucleotides described herein may be used to enhance stability of transactivating crRNAs (tracrRNAs) and engineered polynucleotides encoding the same for editing of a target DNA via a DNA editing entity or a biologically active fragment thereof. The tracrRNA may bind to and activate a DNA editing enzyme (e.g., a Cas nuclease). A tracrRNA encoded by a recombinant polynucleotide of the present disclosure may comprise a length of from about 75 to about 100 nucleotides.

[0189] In some embodiments, the recombinant polynucleotides described herein may be used to enhance stability of a single guide RNA and engineered polynucleotides encoding the same for editing of a target DNA via a DNA editing entity or a biologically active fragment thereof. The single guide RNA may comprise a region that binds to and activates a DNA editing enzyme (e.g., a Cas nuclease) and a region that hybridizes to the sequence of the target DNA. The part of the single guide RNA that hybridizes to the target DNA is of sufficient complementary to the sequence of the target DNA for hybridization to occur. In some embodiments, the single guide RNA may comprise a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to a target DNA. A single guide RNA encoded by a recombinant polynucleotide of the present disclosure may comprise a length of from about 80 to about 120 nucleotides. In some embodiments, the region of the single guide RNA that hybridizes to the target may comprise a length of from about 18 to about 44 nucleotides.

Other RNA-Targeting Oligonucleotides

[0190] The recombinant polynucleotides described herein may be used to enhance stability of other engineered RNA-targeting oligonucleotides, including antisense oligonucleotides, siRNAs, shRNAs, and miRNAs, and engineered polynucleotides encoding the same that hybridizes to a target RNA (e.g., a target mRNA or a target pre-mRNA). An engineered oligonucleotide, as described herein, may comprise a targeting domain with complementarity to a target RNA described herein. As such, an oligonucleotide can be engineered to target and hybridize to a particular target RNA, thus altering expression of a polypeptide encoded by the target RNA.

[0191] In some embodiments, the engineered oligonucleotide (e.g., antisense oligonucleotide, siRNA, shRNA, or miRNA) of the present disclosure hybridizes to a sequence of the target RNA. In some embodiments, part of the engineered oligonucleotide (e.g., a targeting domain) hybridizes to the sequence of the target RNA. The part of the engineered oligonucleotide that hybridizes to the target RNA is of sufficient complementary to the sequence of the target RNA for hybridization to occur. A targeting sequence can also be referred to as a “targeting domain” or a “targeting region.” In some embodiments, binding of the engineered oligonucleotide to the target RNA may recruit additional components, such as RISC components.

[0192] In some cases, a targeting domain of an engineered oligonucleotide allows the engineered oligonucleotide to target an RNA sequence through base pairing, such as Watson Crick base pairing. In some examples, the targeting sequence can be located at either the N- terminus or C-terminus of the engineered oligonucleotide. In some cases, the targeting sequence can be located at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,

19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,

45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,

71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,

97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135,

136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length. In some cases, the targeting sequence can be no greater than about: 1, 2, 3,

4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,

32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,

58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,

84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106,

107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125,

126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144,

145, 146, 147, 148, 149, 150, or 200 nucleotides in length. In some examples, an engineered oligonucleotide comprises a targeting sequence that can be from about 60 to about 500, from about 60 to about 200, from about 75 to about 100, from about 80 to about 200, from about 90 to about 120, or from about 95 to about 115 nucleotides in length. In some examples, an engineered oligonucleotide comprises a targeting sequence that can be about 100 nucleotides in length.

[0193] In some cases, a targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA. In some cases, a targeting sequence comprises less than 100% complementarity to a target RNA sequence. For example, a targeting sequence and a region of a target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0194] The targeting sequence can have sufficient complementarity to a target RNA to allow for hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to non-contiguous stretches of sequence. In some embodiments, antisense complementarity refers to contiguous stretches of sequence.

Therapeutic Applications

[0195] The recombinant polynucleotides of the present disclosure (e.g., encoding an RNA payload comprising a stability element) may have a variety of therapeutic applications. The stability elements described herein may facilitate the therapeutic use by increasing payload stability and enhancing a therapeutic effect produced by the payload. For example, increased guide RNA payload stability may enhance editing efficiency of a target DNA or RNA by preventing degradation of the guide RNA payload. In another example, increased antisense oligonucleotide stability may enhance target knockdown efficiency by preventing degradation of the antisense oligonucleotide.

RNA Editing

[0196] RNA editing can refer to a process by which RNA can be enzymatically modified post synthesis at specific nucleosides. RNA editing can comprise any one of an insertion, deletion, or substitution of a nucleotide(s). Examples of RNA editing include chemical modifications, such as pseudouridylation (the isomerization of uridine residues) and deamination (removal of an amine group from: cytidine to give rise to uridine, or C-to-U editing; or from adenosine to inosine, or A-to-I editing). RNA editing can be used to correct mutations (e.g., correction of a missense mutation) to restore protein expression, or to introduce mutations or edit coding or non-coding regions of RNA to inhibit RNA translation and effect protein knockdown. A recombinant polynucleotide of the present disclosure may be used to express an engineered guide RNA to facilitate RNA editing by an RNA entity (e.g., an adenosine Deaminase Acting on RNA (ADAR)) or biologically active fragments thereof.

[0197] Described herein are engineered guide RNAs that facilitate RNA editing by an RNA editing entity (e.g., an adenosine Deaminase Acting on RNA (ADAR)) or biologically active fragments thereof. In some instances, ADARs can be enzymes that catalyze the chemical conversion of adenosines to inosines in RNA. Because the properties of inosine mimic those of guanosine (inosine will form two hydrogen bonds with cytosine, for example), inosine can be recognized as guanosine by the translational cellular machinery. “Adenosine-to-inosine (A-to-I) RNA editing”, therefore, effectively changes the primary sequence of RNA targets. In general, ADAR enzymes share a common domain architecture comprising a variable number of aminoterminal dsRNA binding domains (dsRBDs) and a single carboxy-terminal catalytic deaminase domain. Human ADARs possess two or three dsRBDs. Evidence suggests that ADARs can form homodimer as well as heterodimer with other ADARs when bound to double-stranded RNA, however it can be currently inconclusive if dimerization is needed for editing to occur. The engineered guide RNAs disclosed herein can facilitate RNA editing by any of or any combination of the three human ADAR genes that have been identified (ADARs 1-3). ADARs have a typical modular domain organization that includes at least two copies of a dsRNA binding domain (dsRBD; ADARlwith three dsRBDs; ADAR2 and ADAR3 each with two dsRBDs) in their N-terminal region followed by a C-terminal deaminase domain.

[0198] The engineered guide RNAs of the present disclosure facilitate RNA editing by endogenous ADAR enzymes. In some embodiments, exogenous ADAR can be delivered alongside the engineered guide RNAs disclosed herein to facilitate RNA editing. In some embodiments, the ADAR is human AD ARI . In some embodiments, the ADAR is human ADAR2. In some embodiments, the ADAR is human ADAR3. In some embodiments, the ADAR is human AD ARI, human ADAR2, human ADAR2, or any combination thereof.

[0199] The present disclosure, in some embodiments, provides engineered guide RNAs that facilitate edits at particular regions in a target RNA (e.g., mRNA or pre-mRNA). For example, the engineered guide RNAs disclosed herein can target a coding sequence or a non-coding sequence of an RNA. For example, a target region in a coding sequence of an RNA can be a translation initiation site (TIS). In some embodiments, the target region in a non-coding sequence of an RNA can be a polyadenylation (poly A) signal sequence.

[0200] Missense Mutations. In some embodiments, the engineered guide RNAs of the present disclosure may target a missense mutation in a target RNA sequence. The engineered guide RNAs may facilitate ADAR-mediated RNA editing of a target adenosine (A) to convert to an inosine (I), which may be read as a guanosine (G). Conversion of A to I via ADAR-mediated RNA editing may correct G to A missense mutations. For example, ADAR-mediated editing may correct a valine to isoleucine or valine to methionine mutation by converting an isoleucine codon (AUU, AUC, or AU A) or methionine codon (AUG) to a valine codon (AUA, GUC, GUU, or GUG). In another example, ADAR-mediated editing may correct a cysteine to tyrosine or mutation by converting a tyrosine codon (AUA or UAC) to a cysteine codon (UGU or UGC). Alternatively, or in addition, the engineered guide RNAs may facilitate APOBEC-mediated RNA editing of a target cytosine (C) to convert to a uracil (U). Conversion of C to U via APOBEC-mediated RNA editing may correct U to C missense mutations. Engineered guide RNAs of the present disclosure can target one or any combination of missense mutations of a target sequence (e.g., SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2).

[0201] Nonsense Mutations. In some embodiments, the engineered guide RNAs of the present disclosure may target a nonsense mutation in a target RNA sequence. The engineered guide RNAs may facilitate ADAR-mediated RNA editing of a target adenosine (A) to convert to an inosine (I), which may be read as a guanosine (G). Conversion of A to I via ADAR-mediated RNA editing may correct G to A nonsense mutations. For example, ADAR-mediated editing may correct a tryptophan to stop nonsense mutation by converting a UAG stop codon to a tryptophan codon (UGG). In another example, ADAR-mediated editing may correct a tryptophan to stop nonsense mutation by converting a UGA stop codon to a tryptophan codon (UGG). Correction of nonsense mutations via ADAR-mediated editing may increase expression of the target sequence. Engineered guide RNAs of the present disclosure can target one or any combination of missense mutations of a target sequence (e.g., SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2).

[0202] TIS. In some embodiments, the engineered guide RNAs of the present disclosure target the adenosine at a translation initiation site (TIS). The engineered guide RNAs may facilitate ADAR-mediated RNA editing of the TIS (AUG) to GUG. This results in inhibition of RNA translation and, thereby, protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. Engineered guide RNAs of the present disclosure can target one or any combination of the TISs of a target sequence (e.g., SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2).

[0203] 3’UTR. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the 3’ untranslated region (3’UTR). In some embodiments, an engineered guide RNA facilitates ADAR-mediated RNA editing of the one or more adenosines in the 3 ’UTR, thereby reducing mRNA export from the nucleus and inhibiting translation, thereby resulting protein knockdown. In some embodiments, the target sequence may be SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.

[0204] PolyA Signal Sequence. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the polyA signal sequence. In some embodiments, an engineered guide RNA facilitates ADAR-mediated RNA editing of the one or more adenosines in the polyA signal sequence, thereby resulting in disruption of RNA processing and degradation of the target mRNA and, thereby, protein knockdown. In some embodiments, a target can have one or more polyA signal sequences. In these instances, one or more engineered guide RNAs, varying in their respective sequences, of the present disclosure can be multiplexed to target adenosines in the one or more polyA signal sequences. In both cases, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of adenosines to inosines (read as guanosines by cellular machinery) in the polyA signal sequence, resulting in protein knockdown. In some embodiments, the target sequence may be SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.

DNA Editing

[0205] DNA editing can refer to a process by which DNA can be enzymatically (e.g., by an RNA-guided endonuclease). DNA editing can comprise any one of an insertion, deletion, or substitution of a nucleotide(s). DNA editing can be used to correct mutations (e.g., correction of a missense mutation) to restore protein expression, or to introduce mutations or edit coding or non-coding regions of DNA to inhibit DNA transcription and effect protein knockdown. A recombinant polynucleotide of the present disclosure may be used to express an engineered guide RNA to facilitate DNA editing by a DNA entity (e.g., CRISPR/Cas endonuclease) or biologically active fragments thereof. Described herein are engineered guide RNAs that facilitate DNA editing by a DNA editing entity (e.g., CRISPR/Cas endonuclease) or biologically active fragments thereof.

[0206] The engineered guide RNAs of the present disclosure may facilitate DNA editing by endogenous Cas enzymes. In some embodiments, exogenous Cas enzymes can be delivered alongside the engineered guide RNAs disclosed herein to facilitate DNA editing. In some embodiments, the Cas nuclease is Cas9. In some embodiments, the Cas nuclease is Casl2. In some embodiments, the Cas nuclease is Casl4.

[0207] The present disclosure, in some embodiments, provides engineered guide RNAs that facilitate edits at particular regions in a target DNA. For example, the engineered guide RNAs disclosed herein can target a coding sequence or a non-coding sequence of a DNA.

[0208] An engineered guide RNA of the present disclosure may recruit a CRISPR/Cas endonuclease (e.g., a Cas9 nuclease) to form a ribonucleoprotein (RNP) complex that is targeted to a particular site in a target polynucleotide (e.g., a target DNA) via base pairing between the guide RNA and a target region within the target polynucleotide. The engineered guide RNA may include a targeting sequence that is complementary to a target site of the target polynucleotide. Thus, an engineered guide RNA forms a complex with a Cas nuclease, and the guide RNA provides sequence specificity to the RNP complex via the targeting sequence. Upon recruitment to the target polynucleotide, the Cas nuclease may site-specifically edit the target polynucleotide (e.g., the target DNA). In some embodiments, the target polynucleotide may encode SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.

Expression Knockdown

[0209] A recombinant polynucleotide of the present disclosure may be used to express an engineered RNA-targeting oligonucleotide (e.g., an antisense oligonucleotide, an siRNA, an shRNA, or an miRNA) to facilitate knockdown expression of the target RNA. In some embodiments, binding of the RNA-targeting oligonucleotide to the target RNA may recruit additional components (e.g., RISC complex components) to the target RNA that may reduce expression of a peptide encoded by the target RNA. For example, binding of an siRNA may recruit RISC and facilitate cleavage of the target RNA. In another example, binding of an miRNA or an shRNA may recruit RISC and inhibit translation of the target RNA. In some embodiments, the target RNA may encode SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.

Targets and Methods of Treatment

[0210] A small RNA payload, such as an engineered guide RNA, of the present disclosure can be used in a method of treating a disorder in a subject in need thereof. A disorder can be a disease, a condition, a genotype, a phenotype, or any state associated with an adverse effect. In some embodiments, treating a disorder can comprise preventing, slowing progression of, reversing, or alleviating symptoms of the disorder. A method of treating a disorder can comprise delivering an engineered polynucleotide encoding an engineered guide RNA to a cell of a subject in need thereof and expressing the engineered guide RNA in the cell. In some embodiments, an engineered guide RNA of the present disclosure can be used to treat a genetic disorder (e.g., a Tauopathy such as AD, FTD, Parkinson’s disease). In some embodiments, an engineered guide RNA of the present disclosure can be used to treat a condition associated with one or more mutations.

[0211] The present disclosure provides for compositions of recombinant polynucleotides encoding engineered payloads (e.g., engineered guide RNAs) and methods of use thereof, such as methods of treatment. In some embodiments, the recombinant polynucleotides of the present disclosure encode guide RNAs targeting a coding sequence of an RNA (e.g., e.g., an RNA encoding a-synuclein, PMP22, DUX4, LRRK2, tau, progranulin, ABCA4, amyloid precursor protein, or alpha- 1 antitrypsin). In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs targeting a non-coding sequence of an RNA (e.g., a polyA sequence). In some embodiments, the present disclosure provides compositions of one or more than one engineered polynucleotides encoding more than one engineered guide RNAs targeting the TIS, the polyA sequence, or any other part of a coding sequence or non-coding sequence. In some embodiments, a polynucleotide may encode two or more copies of an RNA payload comprising an engineered guide RNA. In some embodiments, a polynucleotide may encode three or more copies of an RNA payload comprising an engineered guide RNA. In some embodiments, a polynucleotide may encode not less than one and not more than three copies of an RNA payload comprising an engineered guide RNA. In some embodiments, a polynucleotide may encode four or more copies of an RNA payload comprising an engineered guide RNA. The engineered guide RNAs disclosed herein facilitate ADAR-mediated RNA editing of adenosines in the TIS, the polyA sequence, any part of a coding sequence of an RNA, any part of a noncoding sequence of an RNA, or any combination thereof.

[0212] Examples of target genes that may be targeted by engineered RNA payloads encoded by the recombinant polynucleotides of the present disclosure are provided in TABLE 7. The target gene may be a wild type gene, or the target gene may be a mutated gene. Targeting the gene using an engineered RNA payload may treat a condition associated with the target gene.

TABLE 7 - Exemplary Gene Targets and Associated Conditions

[0213] The recombinant polynucleotides of the present disclosure may express payloads to target, modify, and/or express any sequence of interest. Select targets of interest that may be targeted by the payloads described herein for treatment of an associated condition are discussed below by way of example.

MAPT

[0214] The present disclosure provides for recombinant polynucleotides encoding engineered guide RNAs that facilitate RNA editing MAPT to knockdown expression of Tau protein. Tau pathology can be a key driver of a broad spectrum of neurodegenerative diseases, collectively known as Tauopathies. For example, diseases where Tau can play a primary role include, but are not limited to, Alzheimer’s disease (AD), frontotemporal dementia (FTD), Parkinson’s disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and chronic traumatic encephalopathy. Tauopathies are characterized by the intracellular accumulation of neurofibrillary tangles (NFTs) composed of aggregated, misfolded Tau (MAPT gene). Thus, engineered guide RNAs of the present disclosure targeting MAPT RNA for ADAR-mediated editing to knockdown Tau protein can be capable of preventing or ameliorating disease progression in a number of diseases, including, but not limited to, AD, FTD, autism, traumatic brain injury, Parkinson’s disease, and Dravet syndrome.

[0215] Thus, the engineered guide RNAs of the present disclosure can target MAPT for RNA editing, thereby, driving a reduction in Tau protein expression. In some embodiments, Tau protein expression is reduced in human neurons. In some embodiments, the present disclosure provides compositions of engineered guide RNAs that target MAPT and facilitated ADAR- mediated RNA editing of M APT to reduce pathogenic levels of Tau by targeting key adenosines for deamination that are present in the translational initiation sites (TISs). In some embodiments, the engineered guide RNAs of the present disclosure target a coding sequence in MAPT. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of MAPT, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG.

Engineered guide RNAs of the present disclosure can target one or more of the TISs in MAPT to reduce or completely inhibit Tau protein expression.

[0216] For example, in some embodiments, an engineered guide RNA targets the AUG at the 18 ^th nucleotide in Exon 1 (c.l, Nm_005910.5; GRCh37/Hgl9; also referred to as “c.l” for coding nucleotide 1), referred to as the conventional TIS. In some embodiments, an engineered guide RNA targets the AUG at the 48 ^th nucleotide in Exon 1 (c.31). In some embodiments, an engineered guide RNA targets the AUG at the 6 ^th nucleotide in Exon 5 (c.379). With reference to the 2N4R Tau isoform containing 441 amino acids (Np_005901; GRCh37/Hgl9), these three TISs correspond to methionines (Met) 1, 11 and 127, respectively. In some embodiments, an engineered guide RNA targets the AUG at the 108 ^th nucleotide in Exon 1 (c.91). In some embodiments, one or more than one engineered guide RNAs of the present disclosure target any one or any combination of said four TISs. For example, a single engineered guide RNA of the present disclosure can be designed to target more than one of the above four TISs. In some embodiments, more than one engineered guide RNAs are designed to each independently target more than one of the above four TISs. In some embodiments, engineered guide RNAs of the present disclosure can target any one or any combination of the TISs in Exon 1 (c.l, c.31, and c.91). Targeting these sites in MAPT facilitate edits that result in inhibition of translation and a reduction in expression of the Tau protein. In some embodiments, the ratio of 3R to 4R isoforms of Tau can be measured by protein analysis (e.g., using an ELISA or flow cytometry) to evaluate the effect of RNA editing, with a 1 to 1 ratio representing the ratio in healthy adult brain. In some embodiments, any of the engineered guide RNAs disclosed herein are packaged in an AAV vector and are virally delivered.

[0217] In some embodiments, the engineered guide RNAs target a non-coding sequence in MAPT. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of MAPT. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in MAPT. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in MAPT. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in MAPT. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of MAPT, thereby, effecting protein knockdown.

[0218] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0219] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of MAPT, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of the Tau protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% Tau protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% Tau protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% Tau protein knockdown. Tau protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA. A-Synuclein

[0220] The alpha-synuclein gene is made up of 5 exons and encodes a 140 amino-acid protein with a predicted molecular mass of -14.5 kDa. The encoded product is an intrinsically disordered protein with unknown functions. Usually, Alpha-synuclein is a monomer. Under certain stress conditions or other unknown causes, a-synuclein self-aggregates into oligomers. Lewy-related pathology (LRP), primarily comprised of Alpha-synuclein in more than 50% of autopsy- confirmed Alzheimer’s disease patients’ brains. While the molecular mechanism of how Alpha- synuclein affects the development of Alzheimer’s disease is unclear, experimental evidence has shown that Alpha-synuclein interacts with Tau-p and may seed the intracellular aggregation of Tau-p. Moreover, Alpha-synuclein could regulate the activity of GSK3P, which can mediate Tau- hyperphosphorylation. Alpha-synuclein can also self-assemble into pathogenic aggregates (Lewy bodies). Both Tau and a-synuclein can be released into the extracellular space and spread to other cells. Vascular abnormalities impair the supply of nutrients and removal of metabolic byproducts, cause micro infarcts, and promote the activation of glial cells. Therefore, a multiplex strategy to substantially reduce Tau formation, alpha-synuclein formation, or a combination thereof can be important in effectively treating neurodegenerative diseases.

[0221] The domain structure of alpha-synuclein comprises an N-terminal A2 lipid-binding alpha-helix domain, a non-amyloid P component (NAC) domain, and a C-terminal acidic domain. Molecularly, Alpha-synuclein is suggested to play a role in neuronal transmission and DNA repair. In some cases, a region of Alpha-synuclein can be targeted utilizing compositions provided herein. In some cases, a region of the Alpha-synuclein mRNA can be targeted with the engineered polynucleotides disclosed herein for knockdown. In some cases, a region of the exon or intron of the Alpha-synuclein mRNA can be targeted. In some embodiments, a region of the non-coding sequence of the Alpha-synuclein mRNA, such as the 5’UTR and 3’UTR, can be targeted. In other cases, a region of the coding sequence of the Alpha-synuclein mRNA can be targeted. Suitable regions include but are not limited to a N-terminal A2 lipid-binding alphahelix domain, a Non-amyloid P component (NAC) domain, or a C-terminal acidic domain.

[0222] In some aspects, an alpha-synuclein mRNA sequence is targeted. In some cases, any one of the 3,177 residues of the sequence may be targeted utilizing the compositions and method provided herein. In some cases, a target residue may be located among residues 1 to 100, from 99 to 200, from 199 to 300, from 299 to 400, from 399 to 500, from 499 to 600, from 599 to 700, from 699 to 800, from 799 to 900, from 899 to 1000, from 999 to 1100, from 1099 to 1200, from 1199 to 1300, from 1299 to 1400, from 1399 to 1500, from 1499 to 1600, from 1599 to 1700, from 1699 to 1800, from 1799 to 1900, from 1899 to 2000, from 1999 to 2100, from 2099 to 2200, from 2199 to 2300, from 2299 to 2400, from 2399 to 2500, from 2499 to 2600, from 2599 to 2700, from 2699 to 2800, from 2799 to 2900, from 2899 to 3000, from 2999 to 3100, from 3099 to 3177, or any combination thereof.

[0223] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target SNCA. The engineered guide RNAs may target SNCA to modify or alter expression of SNCA. In some embodiments, targeting SNCA with the engineered guide RNAs of the present disclosure may treat a disease associated with SNCA, such as synucleinopathies, Parkinson’s disease, Lewy body dementia, or multiple system atrophy. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of SNCA to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in SNCA. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of SNCA. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional SNCA protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of SNCA protein.

[0224] In some embodiments, the engineered guide RNAs target a non-coding sequence in SNCA. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of SNCA. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in SNCA. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in SNCA. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in SNCA. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of SNCA, thereby, affecting protein knockdown.

[0225] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in SNCA. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0226] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of SNCA, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0227] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of SNCA, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

PMP22

[0228] Peripheral myelin protein 22, encoded by PMP22, is involved in myelinating Schwann cells of the peripheral nervous system. Duplication or deletion of PMP22, and corresponding alteration of gene expression levels, is associated with a variety of diseases, including Charcot-Marie-Tooth type 1A (CMT1A), Dejerine-Sottas disease, and Hereditary Neuropathy with Liability to Pressure Palsy (HNPP). Described herein are methods of editing or modifying expression of PMP22 using a recombinant polynucleotide encoding an engineered RNA payload to treat a disease (e.g., Charcot-Marie-Tooth disease, Dejerine-Sottas disease, or hereditary neuropathy).

[0229] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target PMP22. The engineered guide RNAs may target PMP22 to modify or alter expression of PMP22. In some embodiments, targeting PMP22 with the engineered guide RNAs of the present disclosure may treat a disease associated with PMP22, such as Charcot-Marie-Tooth disease, Dejerine-Sottas disease, or hereditary neuropathy. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of PMP22 to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in PMP22. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of PMP22. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional PMP22 protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of PMP22 protein.

[0230] In some embodiments, the engineered guide RNAs target a non-coding sequence in PMP22. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of PMP22. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in PMP22. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in PMP22. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in PMP22. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of PMP22, thereby, affecting protein knockdown.

[0231] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in PMP22. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0232] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of PMP22, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0233] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of PMP22, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

LRRK2

[0234] Leucine-rich repeat kinase 2 (LRRK2) has been associated with familial and sporadic cases of Parkinson’s Disease and immune-related disorders like Crohn’s disease. Its aliases include LRRK2, AURA17, DARDARIN, PARK8, RIPK7, ROCO2, or leucine- rich repeat kinase 2. The LRRK2 gene is made up of 51 exons and encodes a 2527 amino acid protein with a predicted molecular mass of about 286 kDa. The encoded product is a multi-domain protein with kinase and GTPase activities. LRRK2 can be found in various tissues and organs including but not limited to adrenal, appendix, bone marrow, brain, colon, duodenum, endometrium, esophagus, fat, gall bladder, heart, kidney, liver, lung, lymph node, ovary, pancreas, placenta, prostate, salivary gland, skin, small intestine, spleen, stomach, testis, thyroid, and urinary bladder. LRRK2 can be ubiquitously expressed but is generally more abundant in the brain, kidney, and lung tissue. Cellularly, LRRK2 has been found in astrocytes, endothelial cells, microglia, neurons, and peripheral immune cells. [0235] Over 100 mutations have been identified in LRRK2; six of them — G2019S, R1441C/G/H, Y1699C, and I2020T — have been shown to cause Parkinson’s Disease through segregation analysis. G2019S and R1441C are the most common disease-causing mutations in inherited cases. In sporadic cases, these mutations have shown age-dependent penetrance: The percentage of individuals carrying the G2019S mutation that develops the disease jumps from 17% to 85% when the age increases from 50 to 70 years old. In some cases, mutation carrying individuals never develop the disease.

[0236] At its catalytic core, LRRK2 contains the Ras of complex proteins (Roc), C- terminal of ROC (COR), and kinase domains. Multiple protein-protein interaction domains flank this core: an armadillo repeats (ARM) region, an ankyrin repeat (ANK) region, a leucine-rich repeat (LRR) domain are found in the N-terminus joined by a C-terminal WD40 domain. The G2019S mutation is located within the kinase domain. It has been shown to increase the kinase activity; for R1441C/G/H and Y1699C, these mutations can decrease the GTPase activity of the Roc domain. Genome-wide association study has found that common variations in LRRK2 increase the risk of developing sporadic Parkinson’s Disease. While some of these variations are nonconservative mutations that affect the protein’s binding or catalytic activities, others modulate its expression. These results suggest that specific alleles or haplotypes can regulate LRRK2 expression.

[0237] Pro-inflammatory signals upregulate LRRK2 expression in various immune cell types, suggesting that LRRK2 is a critical regulator in the immune response. Studies have found that both systemic and central nervous system (CNS) inflammation are involved in Parkinson’s Disease’s symptoms. Moreover, LRRK2 mutations associated with Parkinson’s Disease modulate its expression levels in response to inflammatory stimuli. Many mutations in LRRK2 are associated with immune-related disorders such as inflammatory bowel disease such as Crohn’s Disease. For example, both G2019S and N2081D increase LRRK2’s kinase activity and are over-represented in Crohn’s Disease patients in specific populations. Because of its critical role in these disorders, LRRK2 is an important therapeutic target for Parkinson’s Disease and Crohn’s Disease. In particular, many mutations, such as point mutations including G2019S, play roles in developing these diseases, making LRRK2 an attractive for therapeutic strategy such as RNA editing.

[0238] In some embodiments, the present disclosure provides recombinant polynucleotides encoding guide RNAs that are capable of facilitating RNA editing of LRRK2. In some embodiments, a guide RNA of the present disclosure can target the following mutations in LRRK2: E10L, A30P, S52F, E46K, A53T, LI 19P, A21 IV, C228S, E334K, N363S, V366M, A419V, R506Q, N544E, N551K, A716V, M712V, I723V, P755L, R793M, I810V, K871E, Q923H, Q930R, R1067Q, S1096C, QI 111H, Il 122V, Al 151T, LI 165P, Il 192V, H1216R, S1228T, P1262A, R1325Q, I1371V, R1398H, T1410M, D1420N, R1441G, R1441H, A1442P, P1446L, V1450I, K1468E, R1483Q, R1514Q, P1542S, V1613A, R1628P, M1646T, S1647T, Y1699C, R1728H, R1728L, L1795F, M1869V, M1869T, L1870F, E1874X, R1941H, Y2006H, I2012T, G2019S, I2020T, T2031S, N2081D, T2141M, R2143H, Y2189C, T2356I, G2385R, V2390M, E2395K, M2397T, L2466H, or Q2490NfsX3. Said guide RNAs targeting a site in LRRK2 can be encoded by an engineered polynucleotide construct of the present disclosure. [0239] In some examples, hybridization of a latent guide RNA targeting LRRK2 to a target LRRK2 mRNA produces a guide-target RNA scaffold that comprises a structural features selected from the group consisting of: (i) one or more X1/X2 bulges, wherein Xi is the number of nucleotides of the target RNA in the bulge and X2 is the number of nucleotides of the engineered guide RNA in the bulge, and wherein the one or more bulges is a 0/1 asymmetric bulge, a 2/2 symmetric bulge, a 3/3 symmetric bulge, or a 4/4 symmetric bulge; (ii) one or more X1/X2 internal loops, wherein Xi is the number of nucleotides of the target RNA in the internal loop and X2 is the number of nucleotides of the engineered guide RNA in the internal loop, and wherein the one or more internal loops is a 5/0 asymmetric internal loop, a 5/4 asymmetric internal loop, a 5/5 symmetric internal loop, a 6/6 symmetric internal loop, a 7/7 symmetric internal loop, or a 10/10 symmetric internal loop; (iii) one or more mismatches, wherein the one or more mismatches is an A/C mismatch, an A/G mismatch, a C/U mismatch, a G/A mismatch, or a C/C mismatch, (iv) a G/U wobble base pair or a U/G wobble base pair, and (v) any combination thereof. Said engineered guide RNAs can be delivered via viral vector (e.g., encoded for and delivered via AAV) as disclosed herein and can be administered via any route of administration disclosed herein to a subject in need thereof. The subject can be human and may be at risk of developing or has developed a disease or condition associated with mutations in LRRK2 (e.g., diseases of the central nervous system (CNS) or gastrointestinal (GI) tract). For example, such diseases of conditions can include Crohn’s disease or Parkinson’s disease. Such CNS or GI tract diseases (e.g., Crohn’s disease or Parkinson’s disease) can be at least partially caused by a mutation of LRRK2, for which an engineered guide RNA described herein can facilitate editing in, thus correcting the mutation in LRRK2 and reducing the incidence of the CNS or GI tract disease in the subject. Thus, the guide RNAs of the present disclosure can be used in a method of treatment of diseases such as Crohn’s disease or Parkinson’s disease.

[0240] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target LRRK2. The engineered guide RNAs may target LRRK2 to modify or alter expression of LRRK2. In some embodiments, targeting LRRK2 with the engineered guide RNAs of the present disclosure may treat a disease associated with LRRK2, such as Parkinson’s disease or Crohn’s disease. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of LRRK2 to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in LRRK2. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of LRRK2. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional LRRK2 protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of LRRK2 protein.

[0241] In some embodiments, the engineered guide RNAs target a non-coding sequence in LRRK2. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of LRRK2. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in LRRK2. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in LRRK2. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in LRRK2. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of LRRK2, thereby, affecting protein knockdown.

[0242] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in LRRK2. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0243] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of LRRK2, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0244] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of LRRK2, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

DUX4

[0245] Double homeobox, 4 (DUX4) functions as a transcriptional activator of a variety of genes, including PITX1, and regulates expression of small RNAs in muscle cells. In some embodiments, overexpression of DUX4 can cause B-cell leukemia. Described herein are methods of editing or modifying expression of DUX4 using a recombinant polynucleotide encoding an engineered RNA payload to treat a disease (e.g., B-cell leukemia or facioscapulohumeral muscular dystrophy).

[0246] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target DUX4. The engineered guide RNAs may target DUX4 to modify or alter expression of DUX4. In some embodiments, targeting DUX4 with the engineered guide RNAs of the present disclosure may treat a disease associated with DUX4, such as B-cell leukemia or facioscapulohumeral muscular dystrophy. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of DUX4 to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in DUX4. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of DUX4. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional DUX4 protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of DUX4 protein.

[0247] In some embodiments, the engineered guide RNAs target a non-coding sequence in DUX4. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of DUX4. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in DUX4. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in DUX4. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in DUX4. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of DUX4, thereby, affecting protein knockdown. [0248] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in DUX4. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0249] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of DUX4, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0250] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of DUX4, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

Progranulin

[0251] Progranulin, encoded by GRN, is a precursor protein cleaved to form granulin. GRN is expressed in peripheral and central nervous system tissues and is upregulated in microglia following injury. Both granulin and progranulin are implicated in a wide variety of functions, including development, inflammation, cell proliferation. And protein homeostasis. Mutations in GRN are implicated in frontotemporal dementia. Described herein are methods of editing or modifying expression of GRN using a recombinant polynucleotide encoding an engineered RNA payload to treat a disease (e.g., frontotemporal dementia).

[0252] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target GRN. The engineered guide RNAs may target GRN to modify or alter expression of GRN. In some embodiments, targeting GRN with the engineered guide RNAs of the present disclosure may treat a disease associated with GRN, such as frontotemporal dementia. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of GRN to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in GRN. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of GRN. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional GRN protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of GRN protein.

[0253] In some embodiments, the engineered guide RNAs target a non-coding sequence in GRN. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of GRN. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in GRN. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in GRN. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in GRN. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of GRN, thereby, affecting protein knockdown.

[0254] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in GRN. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0255] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of GRN, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0256] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of GRN, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

ABCA4

[0257] In some embodiments, the present disclosure provides recombinant polynucleotides encoding guide RNAs that are capable of facilitating RNA editing of ATP binding cassette subfamily A member 4 (ABCA4). In some examples, the disease or condition can be associated with a mutation in an ABCA4 gene. In some examples, the disease or condition can be Stargardt macular degeneration. In some examples, the Stargardt macular degeneration can be caused, at least in part, by a mutation in an ABCA4 gene. In some examples, the mutation comprises a substitution of a G with an A at nucleotide position 5882 in a wildtype ABCA4 gene. In some examples, the mutation comprises a G with an A at nucleotide position 5714 in a wildtype ABCA4 gene. In some examples, the mutation comprises a substitution of a G with an A at nucleotide position 6320 in a wildtype ABCA4 gene. In some examples, the double stranded substrate mimics one or more structural features of the naturally occurring ADAR substrate and comprises a target mRNA molecule encoded by the ABCA4 gene and an engineered guide that can be complementary, at least in part, to a portion of the target mRNA molecule.

[0258] In some examples, hybridization of a latent guide RNA targeting ABCA4 to a target ABCA4 mRNA produces a guide-target RNA scaffold that comprises a structural features selected from the group consisting of: (i) one or more X1/X2 bulges, wherein Xi is the number of nucleotides of the target RNA in the bulge and X2 is the number of nucleotides of the engineered guide RNA in the bulge, and wherein the one or more bulges is a 2/1 asymmetric bulge, a 1/0 asymmetric bulge, a 2/2 symmetric bulge, a 3/3 symmetric bulge, or a 4/4 symmetric bulge; (ii) an X1/X2 internal loop, wherein Xi is the number of nucleotides of the target RNA in the internal loop and X2 is the number of nucleotides of the engineered guide RNA in the internal loop, and wherein the internal loop is a 5/5 symmetric loop (iii) one or more mismatches, wherein the one or more mismatches is a G/G mismatch, an A/C mismatch, or a G/A mismatch, (iv) a G/U wobble base pair or a U/G wobble base pair, and (v) any combination thereof. In some embodiments, the guide-target RNA scaffold comprises a 2/1 asymmetric bulge, a 1/0 asymmetric bulge, a G/G mismatch, an A/C mismatch, and a 3/3 symmetric bulge. In some instances, the engineered latent guide RNA targeting ABCA4 comprises a G/G mismatch, a U/U mismatch, and a G/G mismatch. Said engineered guide RNAs can be delivered via viral vector (e.g., encoded for and delivered via AAV) as disclosed herein and can be administered via any route of administration disclosed herein to a subject in need thereof. The subject can be human and may be at risk of developing or has developed Stargardt macular degeneration (or Stargardt’s disease). Such Stargardt macular degeneration can be at least partially caused by a mutation of ABCA4, for which an engineered guide RNA described herein can facilitate editing in, thus correcting the mutation in ABCA4 and reducing the incidence of Stargardt macular degeneration in the subject. Thus, the guide RNAs of the present disclosure can be used in a method of treatment of Stargardt macular degeneration.

[0259] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target ABCA4. The engineered guide RNAs may target ABCA4 to modify or alter expression of ABCA4. In some embodiments, targeting ABCA4 with the engineered guide RNAs of the present disclosure may treat a disease associated with ABCA4, such as Stargardt disease. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of ABCA4 to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in ABCA4. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of ABCA4. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional ABCA4 protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of ABCA4 protein.

[0260] In some embodiments, the engineered guide RNAs target a non-coding sequence in ABCA4. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of ABCA4. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in ABCA4. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in ABCA4. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in ABCA4. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of ABCA4, thereby, affecting protein knockdown.

[0261] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in ABCA4. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0262] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of ABCA4, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0263] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of ABCA4, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA. Amyloid Precursor Protein

[0264] A recombinant polynucleotide of the present disclosure can be used to express an engineered polynucleotide sequence targeting an amyloid precursor protein (APP). In some embodiments, the engineered polynucleotides can target a secretase enzyme cleavage site in APP and edit said cleavage site in order to modulate processing and cleavage of APP by secretase enzymes (e.g., a beta secretase such as BACE1, cathepsin B or Meprin beta). In some embodiments, the engineered polynucleotides can modulate the expression of APP. In some cases, the engineered polynucleotides can modulate the transcription or post- transcriptional regulation of the APP mRNA or pre-mRNA. In other cases, the engineered polynucleotides can correct aberrant expression of splice variants generated by a mutation in APP. In some cases, the engineered polynucleotides can modulate the gene or protein translation of APP. In some embodiments, the engineered polynucleotides can decrease, down- regulate, or knock down the expression of APP by decreasing the abundance of the APP transcript. In some instances, the engineered polynucleotides can decrease or down-regulate the processing, splicing, turnover or stability of the APP transcript; or the accessibility of the APP transcript by translational machinery such as ribosome. In some cases, an engineered polynucleotide can facilitate a knockdown of APP. A knockdown can reduce the expression of APP. In some cases, a knockdown can be accompanied by editing of the APP mRNA or pre- mRNA. In some cases, a knockdown can occur with substantially little to no editing of the APP mRNA or pre-mRNA. In some instances, a knockdown can occur by targeting an untranslated region of the APP mRNA or pre-mRNA, such as a 3 ’ UTR, a 5 ’ UTR or both. In some cases, a knockdown can occur by targeting a coding region of the APP mRNA or pre-mRNA.

[0265] Compositions described herein can edit the cleavage site in APP, so that (3/y secretases exhibit reduced cleavage of APP or can no longer cut APP, and therefore reduced levels of Abeta 40/Abeta 42 or no Abetas can be produced. Compositions consistent with the present disclosure may combine compositions for target APP cleavage site editing with compositions for Tau (e.g., a microtubule-associated protein Tau (MAPT) encoded from a MAPT gene) knockdown or compositions for Alpha-synuclein (SNCA) knockdown and can have synergistic effects to prevent and/or cure a neurodegenerative disease. The compositions and methods disclosed herein can yield results in editing and/or knockdown of targets without any of the resulting issues seen in small molecule or antibody therapy. Compositions can knockdown APP (instead of target cleavage site editing). Editing at the target cleavage site in APP and knockdown can be deployed singly or in combination. [0266] In some cases, a targeting sequence of an engineered polynucleotide provided herein can at least partially hybridize to a region of a target RNA. A region of a target RNA can comprise: (a) a sequence that at least partially encodes for a suitable target provided herein, (b) a sequence that is proximal to a sequence that at least partially encodes for a suitable target provided herein, (c) comprises (a) and (b). For example, a region of a target RNA can comprise (a) a sequence that at least partially encodes for an APP, (b) a sequence that is proximal to a sequence that at least partially encodes for an APP, or (c) comprises (a) and (b). Other suitable targets can be targeted with engineered polynucleotides disclosed herein. Amyloid precursor protein (APP)

[0267] Pathogenic cleavage of amyloid precursor protein (APP) can create Amyloid beta (Abeta) fragments, which has been implicated in Alzheimer’s disease. The accumulation of Abeta fragments can: impair synaptic functions and related signaling pathways, change neuronal activities, trigger the release of neurotoxic mediators from glial cells, or any combination thereof. Abeta can alter kinase function, leading to Tau hyperphosphorylation.

[0268] The generation of Abeta by enzymatic cleavages of the fl-amyloid precursor protein (APP) is an important player in Alzheimer’s disease. The non- amyloidogenic APP processing pathway involves cleavages by alpha- and gamma-secretase. The cleavage by alpha-secretase generates a long form of secreted APP (APPs alpha) and a C- terminal fragment (alpha-CTF). Further processing of alpha-CTF by gamma-secretase generates a p3 and AICD fragment. The amyloidogenic APP processing pathway instead involves cleavages by beta- and gamma- secretase. The cleavage by beta-secretase generates a short form of secreted APP (APPs beta) and a C-terminal fragment (beta-CTF). Further processing of beta- CTF by gamma-secretase generates an Abeta and AICD fragment. The oligomerization and fibrillization of Abeta fragments lead to AD pathology. In some cases, amyloid precursor protein (APP) can be cut by a beta secretase (e.g., BACE1, cathepsin B or Meprin beta) or gamma secretase, and the fragment resulting from such cuts can be Abeta peptides of 36-43 amino acids. Certain Abeta peptide metabolites of this cleavage can be crucially involved in Alzheimer’s disease pathology and progression.

[0269] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target APP. The engineered guide RNAs may facilitate ADAR-mediated RNA editing of APP to correct G to A mutations by targeting adenosines for deamination. In some embodiments, the engineered guide RNAs of the present disclosure target a coding sequence in APP. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of APP. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional AAP protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of AAP protein.

[0270] In some embodiments, the engineered guide RNAs target a non-coding sequence in APP. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of APP. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in APP. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in APP. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in APP. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of APP, thereby, affecting protein knockdown.

[0271] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in APP. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine.

[0272] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of APP, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0273] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of APP, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1- fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10- fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

SERPINA1

[0274] In some embodiments, the present disclosure provides recombinant polynucleotides encoding guide RNAs that are capable of facilitating RNA editing of serpin family A member 1 (SERPINA1). In some examples, the disease or condition can be an AAT deficiency or an associated lung or liver pathology (e.g., chronic obstructive pulmonary disease, cirrhosis, hepatocellular carcinoma) caused, at least in part, by a mutation in a SERPINA1 gene. In some examples, the mutation can be a substitution of a G with an A at nucleotide position 9989 within a wildtype SERPINA1 gene. In some examples, administration of the engineered guides disclosed herein restores expression of a normal AAT protein (e.g., as compared to an inactive or defective AAT protein) in a subject with an AAT deficiency. In some examples, a double stranded RNA (dsRNA) substrate (a guide -target RNA scaffold) is formed upon hybridization of an engineered guide of the present disclosure to a target RNA. In some examples, the target RNA forming the double stranded substrate comprises a portion of an mRNA or pre-mRNA molecule encoded by the SERPINA1 gene. In some examples the targeting region of the engineered guide forming the double stranded substrate is, at least in part, complementary to a portion of an mRNA or pre-mRNA molecule encoded by the SERPINA1 gene. In some examples the double stranded substrate comprises a single mismatch. In some examples, the engineered substrate additionally comprises one or two bulges. In some examples, the double stranded substrate can be formed by a target RNA comprising an mRNA or pre-mRNA encoded by the SERPINA1 gene and an engineered guide complementary to a portion of the mRNA encoded by the SERPINA1 gene, wherein the engineered substrate comprises a single mismatch. In some examples, the double stranded substrate can be formed by a target RNA comprising an mRNA or pre-mRNA encoded by the SERPINA1 gene and an engineered guide complementary to a portion of the mRNA or pre- mRNA encoded by the SERPINA1 gene, wherein the engineered substrate comprises a single mismatch, and wherein the engineered substrate comprises two additional bulges.

[0275] Guide RNAs can facilitate correction of a G to A mutation at nucleotide position 9989 of a SERPINA1 gene. In some embodiments, a guide RNA of the present disclosure can target, for example, E342K of SERPINA1. Said guide RNAs targeting a site in SERPINA1 can be encoded for by an engineered polynucleotide construct of the present disclosure.

[0276] In some embodiments, the present disclosure provides recombinant polynucleotides encoding engineered guide RNAs that target SERPINA1. The engineered guide RNAs may target SERPINA1 to modify or alter expression of SERPINA1. In some embodiments, targeting SERPINA1 with the engineered guide RNAs of the present disclosure may treat a disease associated with SERPINA1, such as alpha- 1 antitrypsin deficiency. In some embodiments, the engineered guide RNAs may facilitate ADAR-mediated RNA editing of SERPINA1 to correct G to A mutations by targeting adenosines for deamination. The engineered guide RNAs of the present disclosure may target a coding sequence in SERPINA1. For example, the coding sequence can be a translation initiation site (TIS) (AUG) of AUG, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. Editing of the TIS may affect protein knockdown of SERPINA1. In another example, the guide RNA can facilitate ADAR-mediated correction of missense mutations in the coding sequence. Correcting a missense mutation may increase expression of functional SERPINA1 protein. In another example, the guide RNA can facilitate ADAR-mediated correction of nonsense mutations in the coding sequence. Correcting a nonsense mutation may increase expression of SERPINA1 protein.

[0277] In some embodiments, the engineered guide RNAs target a non-coding sequence in SERPINA1. The non-coding sequence can be a polyA signal sequence and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of SERPINA1. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target more than one polyA signal sequences in SERPINA1. In some embodiments, engineered guide RNAs of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences in SERPINA1. In some embodiments, engineered guide RNAs can be multiplexed to target a non-coding sequence and a coding sequence in SERPINA1. The engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of SERPINA1, thereby, affecting protein knockdown.

[0278] In some embodiments, the engineered guide RNAs of the present disclosure facilitated ADAR-mediated RNA editing of from 1 to 100% of a target adenosine in SERPINA1. The engineered guide RNAs of the present disclosure can facilitate from 40 to 90% editing of a target adenosine. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, from 5 to 20%, from 20 to 40%, from 40 to 60%, from 60 to 80%, from 80 to 100%, from 60 to 80%, from 70 to 90%, or up to 90% or more RNA editing of a target adenosine.

Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of an off-target adenosine. Optionally, additionally, the engineered guide RNAs of the present disclosure can facilitate these levels of on- target RNA editing while maintaining less than less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% editing of an off-target adenosine. [0279] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of SERPINA1, which results in knockdown of protein levels. The knockdown in protein levels is quantitated as a reduction in expression of protein. The engineered guide RNAs of the present disclosure can facilitate from 1% to 100% protein knockdown. The engineered guide RNAs of the present disclosure can facilitate from 1% to 10%, from 10% to 20%, from 20% to 30%, from 30% to 40%, from 40% to 50%, from 50% to 60%, from 60% to 70%, from 70% to 80%, from 80% to 90%, from 90% to 100%, from 20% to 40%, from 30% to 50%, from 40% to 60%, from 50% to 70%, from 60% to 80%, from 20% to 50%, from 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% protein knockdown. In some embodiments, the engineered guide RNAs of the present disclosure facilitate from 30% to 60% protein knockdown. Protein knockdown can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0280] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of SERPINA1, which results in increased protein expression levels. The knockdown in protein levels is quantitated as an increase in expression of the target protein. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold increased protein expression. The engineered guide RNAs of the present disclosure can facilitate from 1.1 -fold to 1000-fold, from 1.5-fold to 1000-fold, from 2-fold to 1000-fold, from 5-fold to 1000-fold, from 10-fold to 1000-fold, from 20-fold to 1000-fold, from 50-fold to 1000-fold, from 100-fold to 1000-fold, from 200-fold to 1000-fold, from 500-fold to 1000-fold, from 1.1 -fold to 10-fold, from 1.5-fold to 10-fold, from 2-fold to 10-fold, from 5-fold to 10-fold, from 10-fold to 100-fold, from 20-fold to 100-fold, or from 50-fold to 100-fold increased protein expression. In some embodiments, the engineered guide RNAs of the present disclosure facilitate at least 1.1-fold, at least 1.5-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, or at least 500-fold increased expression. Increase in protein expression can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

Recombinant Polynucleotides, Vectors and Delivery

[0281] In some embodiments, a recombinant polynucleotide may comprise a polynucleotide payload (e.g., a polynucleotide encoding an RNA payload) of the present disclosure. A polynucleotide payload (e.g., an RNA payload or a polynucleotide encoding an RNA payload) may comprise a stability element (e.g., an exonuclease-resistant structure), a localization element (e.g., an RBP-binding element), a promoter, a target-binding sequence, and a termination sequence. In some embodiments, a recombinant polynucleotide may comprise one or more polynucleotide payloads (e.g., one or more polynucleotides encoding an RNA payload). In some embodiments, a recombinant polynucleotide may comprise two, three, or four polynucleotide payloads (e.g., polynucleotides encoding an RNA payload).

[0282] In some embodiments, a recombinant polynucleotide may comprise two or more polynucleotide payloads. The two or more polynucleotide payloads may have different nucleotide sequences (e.g., comprise different stability elements, localization elements, promoters, target-binding sequences, termination sequences, or combinations thereof). In some embodiments, a recombinant polynucleotide may comprise a first polynucleotide payload comprising a first stability element of a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426 and a second polynucleotide payload comprising a second stability element of a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426, wherein the second stability element is a different sequence from the first stability element. In another embodiment, a recombinant polynucleotide may comprise a first polynucleotide payload comprising a first stability element of a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35 and a second polynucleotide payload comprising a second stability element of a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35, wherein the second stability element is a different sequence from the first stability element. In some embodiments, a recombinant polynucleotide may comprise a first polynucleotide payload comprising a first RBP-binding element of a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424 and a second polynucleotide payload comprising a second RBP-binding element of a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424, wherein the second RBP-binding element is a different sequence from the first RBP-binding element. In another embodiment, a recombinant polynucleotide may comprise a first polynucleotide payload comprising a first RBP-binding element comprising a sequence of AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424) and a second polynucleotide payload comprising a second RBP-binding element comprising a sequence of AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424), wherein the second RBP-binding element is a different sequence from the first RBP-binding element. In some embodiments, a recombinant polynucleotide may comprise three or more polynucleotide payloads. The three or more polynucleotide payloads may have different nucleotide sequences (e.g., comprise different stability elements, localization elements, promoters, target-binding sequences, termination sequences, or combinations thereof). In some embodiments, a recombinant polynucleotide may comprise four or more polynucleotide payloads. The four or more polynucleotides may have different nucleotide sequences (e.g., comprise different stability elements, localization elements, promoters, target-binding sequences, termination sequences, or combinations thereof). In some embodiments, a first polynucleotide payload of the recombinant polynucleotide may be different from a second polynucleotide payload of the recombinant polynucleotide if the first polynucleotide payload and the second polynucleotide payload share not more than 99%, not more than 98%, not more than 97%, not more than 96%, not more than 95%, not more than 94%, not more than 93%, not more than 92%, not more than 91%, not more than 90%, not more than 85%, not more than 80%, or not more than 75% sequence identity.

[0283] In some embodiments, a recombinant polynucleotide (e.g., encoding a small RNA payload, such as an engineered guide RNA) of the present disclosure is introduced into a subject via a delivery vehicle. In some embodiments, the delivery vehicle is a vector. In some embodiments the vector is a plasmid, a viral vector, a recombinant polynucleotide, or a transformed cell. A vector can facilitate delivery of the engineered polynucleotide into a cell to genetically modify the cell. In some examples, the vector comprises DNA, such as double stranded or single stranded DNA. In some examples, the delivery vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector or plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette comprising the recombinant polynucleotide. In some embodiments, a viral vector comprises a viral capsid, an inverted terminal repeat sequence, and the engineered polynucleotide can be used to deliver the small RNA payload to a cell.

[0284] In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentivirus vector (e.g., human or porcine), a Herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vectors, a pox virus vector, or a combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0285] In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. Adeno-associated virus (AAV) vectors include vectors derived from any AAV serotype, including, but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, and AAVhu68.

[0286] In some embodiments, a polynucleotide is introduced into a subject by non- viral vector systems. In some embodiments, cationic lipids, polymers, hydrodynamic injection and/or ultrasound may be used in delivering a polynucleotide to a subject in the absence of virus.

[0287] In some examples, the vector may be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector) a viral vector, or any combination thereof. In some examples, the vector may be a viral vector. In some embodiments, the viral vector may be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentivirus vector (e.g., human or porcine), a Herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vectors, a pox virus vector, or a combination thereof. In some embodiments, the viral vector may be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a singlestranded vector, or any combination thereof.

[0288] In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be of a specific serotype. In some embodiments, the viral vector may be an AAV1 serotype, AAV2 serotype, AAV3 serotype, AAV4 serotype, AAV5 serotype, AAV6 serotype, AAV7 serotype, AAV8 serotype, AAV9 serotype, AAV10 serotype, AAV11 serotype, AAV 12 serotype, AAV 13 serotype, AAV 14 serotype, AAV 15 serotype, AAV 16 serotype, AAV-DJ serotype, AAV-DJ/8 serotype, AAV-DJ/9 serotype, AAV1/2 serotype, AAV.rh8 serotype, AAV.rhlO serotype, AAV.rh20 serotype, AAV.rh39 serotype, AAV.Rh43 serotype, AAV.Rh74 serotype, AAV.v66 serotype, AAV.OligoOOl serotype, AAV.SCH9 serotype, AAV.r3.45 serotype, AAV.RHM4-1 serotype, AAV.hu37 serotype, AAV.Anc80 serotype, AAV.Anc80L65 serotype, AAV.7m8 serotype, AAV.PhP.eB serotype, AAV.PhP.Vl serotype, AAV.PHP.B serotype, AAV.PhB.Cl serotype, AAV.PhB.C2 serotype, AAV.PhB.C3 serotype, AAV.PhB.C6 serotype, AAV.cy5 serotype, AAV2.5 serotype, AAV2tYF serotype, AAV3B serotype, AAV.LK03 serotype, AAV.HSC1 serotype, AAV.HSC2 serotype, AAV.HSC3 serotype, AAV.HSC4 serotype, AAV.HSC5 serotype, AAV.HSC6 serotype, AAV.HSC7 serotype, AAV.HSC8 serotype, AAV.HSC9 serotype, AAV.HSC10 serotype, AAV.HSC11 serotype, AAV.HSC12 serotype, AAV.HSC13 serotype, AAV.HSC14 serotype, AAV.HSC15 serotype, AAV.HSC16 serotype, AAV.HSC17 serotype, or AAVhu68 serotype, a derivative of any of these serotypes, or any combination thereof.

[0289] In some embodiments, the AAV vector may be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.

[0290] In some embodiments, the AAV vector may be a recombinant AAV (rAAV) vector. Methods of producing recombinant AAV vectors may be known in the art and generally involve, in some cases, introducing into a producer cell line: (1) DNA necessary for AAV replication and synthesis of an AAV capsid, (b) one or more helper constructs comprising the viral functions missing from the AAV vector, (c) a helper virus, and (d) the plasmid construct containing the genome of the AAV vector, e.g., ITRs, promoter and payload sequences, etc. In some examples, the viral vectors described herein may be engineered through synthetic or other suitable means by references to published sequences, such as those that may be available in the literature. For example, the genomic and protein sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits may be known in the art and may be found in the literature or in public databases such as GenBank or Protein Data Bank (PDB).

[0291] In some examples, methods of producing delivery vectors herein comprising packaging a polynucleotide of the present disclosure in an AAV vector. In some examples, methods of producing the delivery vectors described herein comprise, (a) introducing into a cell: (i) a polynucleotide disclosed herein; and (ii) a viral genome comprising a Replication (Rep) gene and Capsid (Cap) gene that encodes a wild type AAV capsid protein or modified version thereof; (b) expressing in the cell the wild type AAV capsid protein or modified version thereof;

(c) assembling an AAV particle; and (d) packaging the polynucleotide disclosed herein in the AAV particle, thereby generating an AAV delivery vector. In some examples, any polynucleotide disclosed herein may be packaged in the AAV vector. In some examples, the recombinant vectors comprise one or more inverted terminal repeats and the inverted terminal repeats comprise a 5 ’ inverted terminal repeat, a 3 ’ inverted terminal repeat, and a mutated inverted terminal repeat. In some examples, the mutated terminal repeat lacks a terminal resolution site, thereby enabling formation of a self-complementary AAV.

[0292] In some examples, a hybrid AAV vector may be produced by transcapsidation, e.g., packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, wherein the first and second serotypes may be not the same. In some examples, the Rep gene and ITR from a first AAV serotype (e.g., AAV2) may be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), wherein the first and second AAV serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising the AAV2 ITRs and AAV9 capsid protein may be indicated AAV2/9. In some examples, the hybrid AAV delivery vector comprises an AAV2/1, AAV2/2, AAV 2/4, AAV2/5, AAV2/8, or AAV2/9 vector.

[0293] In some examples, the AAV vector may be a chimeric AAV vector. In some examples, the chimeric AAV vector comprises an exogenous amino acid or an amino acid substitution, or capsid proteins from two or more serotypes. In some examples, a chimeric AAV vector may be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0294] In some examples, the AAV vector comprises a self-complementary AAV genome. Self-complementary AAV genomes may be generally known in the art and contain both DNA strands which can anneal together to form double-stranded DNA.

[0295] In some examples, the delivery vector may be a retroviral vector. In some examples, the retroviral vector may be a Moloney Murine Leukemia Virus vector, a spleen necrosis virus vector, or a vector derived from the Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or mammary tumor virus, or a combination thereof. In some examples, the retroviral vector may be transfected such that the majority of sequences coding for the structural genes of the virus (e.g., gag, pol, and env) may be deleted and replaced by the gene(s) of interest. [0296] In some examples, the delivery vehicle may be a non-viral vector. Examples of non- viral vectors may include plasmids, lipid nanoparticles, lipoplexes, polymersomes, polyplexes, dendrimers, nanoparticles, and cell-penetrating peptides. The non-viral vector may comprise a polynucleotide, such as a plasmid, encoding for a promoter (e.g., comprising a cell type- or cell state-specific response element and a switchable core promoter) and a payload sequence. In some examples, the delivery vehicle may be a plasmid. In some examples, the plasmid may be a minicircle plasmid. In some embodiments, a vector may comprise naked DNA (e.g., a naked DNA plasmid). In some embodiments, the non-viral vector comprises DNA. In some embodiments, the non-viral vector comprises RNA. In some examples, the non-viral vector comprises circular double-stranded DNA. In some examples, the non-viral vector may comprise a linear polynucleotide. In some examples, the non-viral vector comprises a polynucleotide encoding one or more genes of interest and one or more regulatory elements. In some examples, the non-viral vector comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the non-viral vector contains one or more genes that provide a selective marker to induce a target cell to retain a polynucleotide (e.g., a plasmid) of the non-viral vector. In some examples, the non-viral vector may be formulated for delivery through injection by a needle carrying syringe. In some examples, the non-viral vector may be formulated for delivery via electroporation. In some examples, a polynucleotide of the non-viral vector may be engineered through synthetic or other suitable means known in the art. For example, in some cases, the genetic elements may be assembled by restriction digest of the desired genetic sequence from a donor plasmid or organism to produce ends of the DNA which may then be readily ligated to another genetic sequence.

[0297] In some embodiments, the vector containing the recombinant polynucleotide is a non- viral vector system. In some embodiments, the non-viral vector system comprises cationic lipids, or polymers. For example, the non-viral vector system comprises can be a liposome or polymeric nanoparticle. In some embodiments, the small RNA payload or a non-viral vector comprising the small RNA payload is delivered to a cell by hydrodynamic injection or ultrasound.

Pharmaceutical Compositions

[0298] Methods for treatment of diseases or disorders characterized by genetic mutations or aberrant gene expression are also encompassed by the present disclosure. Said methods include administering a therapeutically effective amount of a payload sequence as part of a recombinant polynucleotide cassette. The recombinant polynucleotide cassette of the disclosure can be formulated in pharmaceutical compositions. These compositions can comprise, in addition to one or more of the recombinant polynucleotide cassettes, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material can depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.

[0299] The compositions described herein (e.g., compositions comprising an engineered guide RNA or an engineered polynucleotide) can be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or a non-human animal). A pharmaceutically acceptable carrier can include, but is not limited to, phosphate buffered saline solution, water, emulsions (e.g., an oil/water emulsion or a water/oil emulsions), glycerol, liquid polyethylene glycols, aprotic solvents such (e.g., dimethylsulfoxide, N-methylpyrrolidone, or mixtures thereof), and various types of wetting agents, solubilizing agents, anti-oxidants, bulking agents, protein carriers such as albumins, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. Additional examples of carriers, stabilizers and adjuvants consistent with the compositions of the present disclosure can be found in, for example, Remington ’s Pharmaceutical Sciences, 21 ^st Ed., Mack Publ. Co., Easton, Pa. (2005), incorporated herein by reference in its entirety.

[0300] In some examples, the pharmaceutical composition can be formulated in unit dose forms or multiple-dose forms. In some examples, the unit dose forms can be physically discrete units suitable for administration to human or non-human subjects (e.g., animals). In some examples, the unit dose forms can be packaged individually. In some examples, each unit dose contains a predetermined quantity of an active ingredient(s) that can be sufficient to produce the desired therapeutic effect in association with pharmaceutical carriers, diluents, excipients, or any combination thereof. In some examples, the unit dose forms comprise ampules, syringes, or individually packaged tablets and capsules, or any combination thereof. In some instances, a unit dose form can be comprised in a disposable syringe. In some instances, unit-dosage forms can be administered in fractions or multiples thereof. In some examples, a multiple-dose form comprises a plurality of identical unit dose forms packaged in a single container, which can be administered in segregated a unit dose form. In some examples, multiple dose forms comprise vials, bottles of tablets or capsules, or bottles of pints or gallons. In some instances, a multiple- dose forms comprise the same pharmaceutically active agents. In some instances, a multipledose forms comprise different pharmaceutically active agents.

[0301] In some examples, the pharmaceutical composition comprises a pharmaceutically acceptable excipient. In some examples, the excipient comprises a buffering agent, a cryopreservative, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a chelator, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, or a coloring agent, or any combination thereof.

[0302] In some examples, an excipient comprises a buffering agent. In some examples, the buffering agent comprises sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, calcium bicarbonate, or any combination thereof. In some examples, the buffering agent comprises sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium glucomate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium hydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, or calcium hydroxide and other calcium salts, or any combination thereof.

[0303] In some examples, an excipient comprises a cryopreservative. In some examples, the cryopreservative comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, a cryopreservative comprises a sucrose, a trehalose, a starch, a salt of any of these, a derivative of any of these, or any combination thereof. In some examples, an excipient comprises a pH agent (to minimize oxidation or degradation of a component of the composition), a stabilizing agent (to prevent modification or degradation of a component of the composition), a buffering agent (to enhance temperature stability), a solubilizing agent (to increase protein solubility), or any combination thereof. In some examples, an excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, an excipient comprises sodium carbonate, acetate, citrate, phosphate, poly-ethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerin, xanthan rubber, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof. In some examples, the excipient can be an excipient described in the Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986).

[0304] In some examples, the excipient comprises a preservative. In some examples, the preservative comprises an antioxidant, such as alpha-tocopherol and ascorbate, an antimicrobial, such as parabens, chlorobutanol, and phenol, or any combination thereof. In some examples, the antioxidant comprises EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxy anisole (BHA), sodium sulfite, p-amino benzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol or N- acetyl cysteine, or any combination thereof. In some examples, the preservative comprises validamycin A, TL-3, sodium ortho vanadate, sodium fluoride, N-a-tosyl-Phe- chloromethylketone, N-a-tosyl-Lys-chloromethylketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitor, phosphatase inhibitor, caspase inhibitor, granzyme inhibitor, cell adhesion inhibitor, cell division inhibitor, cell cycle inhibitor, lipid signaling inhibitor, protease inhibitor, reducing agent, alkylating agent, antimicrobial agent, oxidase inhibitor, or other inhibitors, or any combination thereof.

[0305] In some examples, the excipient comprises a binder. In some examples, the binder comprises starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, or any combination thereof.

[0306] In some examples, the binder can be a starch, for example a potato starch, com starch, or wheat starch; a sugar such as sucrose, glucose, dextrose, lactose, or maltodextrin; a natural and/or synthetic gum; a gelatin; a cellulose derivative such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose, methyl cellulose, or ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); a wax; calcium carbonate; calcium phosphate; an alcohol such as sorbitol, xylitol, mannitol, or water, or any combination thereof.

[0307] In some examples, the excipient comprises a lubricant. In some examples, the lubricant comprises magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, or light mineral oil, or any combination thereof. In some examples, the lubricant comprises metallic stearates (such as magnesium stearate, calcium stearate, aluminum stearate), fatty acid esters (such as sodium stearyl fumarate), fatty acids (such as stearic acid), fatty alcohols, glyceryl behenate, mineral oil, paraffins, hydrogenated vegetable oils, leucine, polyethylene glycols (PEG), metallic lauryl sulphates (such as sodium lauryl sulphate, magnesium lauryl sulphate), sodium chloride, sodium benzoate, sodium acetate or talc or a combination thereof.

[0308] In some examples, the excipient comprises a dispersion enhancer. In some examples, the dispersion enhancer comprises starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isomorphous silicate, or microcrystalline cellulose, or any combination thereof as high HLB emulsifier surfactants.

[0309] In some examples, the excipient comprises a disintegrant. In some examples, a disintegrant comprises a non-effervescent disintegrant. In some examples, a non-effervescent disintegrants comprises starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, or gums such as agar, guar, locust bean, karaya, pectin, and tragacanth, or any combination thereof. In some examples, a disintegrant comprises an effervescent disintegrant. In some examples, a suitable effervescent disintegrant comprises bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.

[0310] In some examples, the excipient comprises a sweetener, a flavoring agent or both. In some examples, a sweetener comprises glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as a sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, sylitol, and the like, or any combination thereof. In some cases, flavoring agents incorporated into a composition comprise synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; or any combination thereof. In some embodiments, a flavoring agent comprises a cinnamon oil; oil of wintergreen; peppermint oils; clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oil such as lemon oil, orange oil, grape and grapefruit oil; and fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot, or any combination thereof.

[0311] In some examples, the excipient comprises a pH agent (e.g., to minimize oxidation or degradation of a component of the composition), a stabilizing agent (e.g., to prevent modification or degradation of a component of the composition), a buffering agent (e.g., to enhance temperature stability), a solubilizing agent (e.g., to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient comprises sodium carbonate, acetate, citrate, phosphate, poly-ethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerine, xanthan rubber, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof. In some examples, the excipient comprises a cryo-preservative. In some examples, the excipient comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the excipient comprises a sucrose, a trehalose, a starch, a salt of any of these, a derivative of any of these, or any combination thereof.

[0312] In some examples, the pharmaceutical composition comprises a diluent. In some examples, the diluent comprises water, glycerol, methanol, ethanol, or other similar biocompatible diluents, or any combination thereof. In some examples, a diluent comprises an aqueous acid such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid, or any combination thereof. In some examples, a diluent comprises an alkaline metal carbonates such as calcium carbonate; alkaline metal phosphates such as calcium phosphate; alkaline metal sulphates such as calcium sulphate; cellulose derivatives such as cellulose, microcrystalline cellulose, cellulose acetate; magnesium oxide, dextrin, fructose, dextrose, glyceryl palmitostearate, lactitol, choline, lactose, maltose, mannitol, simethicone, sorbitol, starch, pregelatinized starch, talc, xylitol and/or anhydrates, hydrates and/or pharmaceutically acceptable derivatives thereof or combinations thereof.

[0313] In some examples, the pharmaceutical composition comprises a carrier. In some examples, the carrier comprises a liquid or solid filler, solvent, or encapsulating material. In some examples, the carrier comprises additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldolic acids, esterified sugars and the like; and polysaccharides or sugar polymers), alone or in combination.

Administration

[0314] Administration can refer to methods that can be used to enable the delivery of a composition described herein (e.g., comprising an engineered guide RNA or an engineered polynucleotide encoding the same) to the desired site of biological action. For example, an engineered guide RNA or a recombinant polynucleotide can be comprised in a DNA construct, a viral vector, or both and be administered by intravenous administration. Administration disclosed herein to an area in need of treatment or therapy can be achieved by, for example, and not by way of limitation, oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. In some embodiments, delivery can include inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebroventricular, intracisternal, intracorneal, intracoronal, intracoronary, intracorpous cavemaosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic, or any combination thereof. Delivery can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion), oral administration, inhalation administration, intraduodenal administration, rectal administration, or a combination thereof. Delivery can include direct application to the affected tissue or region of the body. In some cases, topical administration can comprise administering a lotion, a solution, an emulsion, a cream, a balm, an oil, a paste, a stick, an aerosol, a foam, a jelly, a foam, a mask, a pad, a powder, a solid, a tincture, a butter, a patch, a gel, a spray, a drip, a liquid formulation, an ointment to an external surface of a surface, such as a skin. Delivery can include a parenchymal injection, an intra-thecal injection, an intra-ventricular injection, or an intra-cisternal injection. A composition provided herein can be administered by any method. A method of administration can be by intra-arterial injection, intracisternal injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intraspinal injection, intrathecal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection, epidural, or any combination thereof. Delivery can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion administration). In some embodiments, delivery can comprise a nanoparticle, a liposome, an exosome, an extracellular vesicle, an implant, or a combination thereof. In some cases, delivery can be from a device. In some instances, delivery can be administered by a pump, an infusion pump, or a combination thereof. In some embodiments, delivery can be by an enema, an eye drop, a nasal spray, or any combination thereof. In some instances, a subject can administer the composition in the absence of supervision. In some instances, a subject can administer the composition under the supervision of a medical professional (e.g., a physician, nurse, physician’s assistant, orderly, hospice worker, etc.). In some embodiments, a medical professional can administer the composition.

[0315] In some cases, administering can be oral ingestion. In some cases, delivery can be a capsule or a tablet. Oral ingestion delivery can comprise a tea, an elixir, a food, a drink, a beverage, a syrup, a liquid, a gel, a capsule, a tablet, an oil, a tincture, or any combination thereof. In some embodiments, a food can be a medical food. In some instances, a capsule can comprise hydroxymethylcellulose. In some embodiments, a capsule can comprise a gelatin, hydroxypropylmethyl cellulose, pullulan, or any combination thereof. In some cases, capsules can comprise a coating, for example, an enteric coating. In some embodiments, a capsule can comprise a vegetarian product or a vegan product such as a hypromellose capsule. In some embodiments, delivery can comprise inhalation by an inhaler, a diffuser, a nebulizer, a vaporizer, or a combination thereof.

[0316] In some embodiments, disclosed herein can be a method, comprising administering a composition disclosed herein to a subject (e.g., a human) in need thereof. In some instances, the method can treat (including prevent) a disease in the subject.

[0317] In some examples, a pharmaceutical composition disclosed herein can be administered at dosage levels sufficient to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about 0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about 0.05 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about 0.05 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic, diagnostic, or prophylactic, effect.

[0318] The appropriate dosage and treatment regimen for the methods of treatment described herein vary with respect to the particular disease being treated, the gRNA and/or ADAR (or a vector encoding the gRNA and/or ADAR) being delivered, and the specific condition of the subject. In some examples, the administration can be over a period of time until the desired effect (e.g., reduction in symptoms can be achieved). In some examples, administration can be 1, 2, 3, 4, 5, 6, or 7 times per week. In some examples, administration or application of a composition disclosed herein can be performed for a treatment duration of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or more. In some examples, administration can be over a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In some examples, administration can be over a period of 2, 3, 4, 5, 6 or more months. In some examples, administration can be performed repeatedly over a lifetime of a subject, such as once a month or once a year for the lifetime of a subject. In some examples, administration can be performed repeatedly over a substantial portion of a subject’s life, such as once a month or once a year for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years, or more. In some examples, treatment can be resumed following a period of remission.

[0319] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder, or liquid form. A tablet can include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol can be included.

[0320] For intravenous, cutaneous, or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen- free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringe’s Injection, Lactated Ringe’s Injection. Preservatives, stabilizers, buffers, antioxidants and/or other additives can be included, as required.

[0321] In some embodiments, the polynucleotide of the present disclosure or recombinant polynucleotide cassette of the present disclosure may be administered to cells via a lipid nanoparticle. In some embodiments, the lipid nanoparticle may be administered at the appropriate concentration according to standard methods appropriate for the target cells.

[0322] In some embodiments, the polynucleotide of the present disclosure or recombinant polynucleotide cassette of the present disclosure may be administered to cells via a viral vector. In some embodiments, the viral vector may be administered at the appropriate multiplicity of infection according to standard transduction methods appropriate for the target cells. Titers of the virus vector or capsid to administer can vary depending on the target cell type or cell state and number and can be determined by those of skill in the art. In some embodiments, at least about 10 ² infections units are administered. In some embodiments, at least about 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ^s , 10 ⁹ , 1 O ¹⁰ , 10 ¹¹ , 10 ¹² , or 10 ¹³ infectious units are administered.

[0323] In some embodiments, the polynucleotide or recombinant polynucleotide cassette is introduced to cells of any type or state, including, but not limited to neural cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), lung cells, epithelial cells, skeletal muscle cells, dendritic cells, hepatic cells, pancreatic cells, bone cells, hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, and heart cells.

[0324] In some embodiments, the polynucleotide or the disclosure or the recombinant polynucleotide cassette of the disclosure may be introduced to cells in vitro via a viral vector for administration of modified cells to a subject. In some embodiments, a viral vector encoding the polynucleotide of the disclosure or the recombinant polynucleotide cassette of the disclosure is introduced to cells that have been removed from a subject. In some embodiments, the modified cells are placed back in the subject following introduction of the viral vector.

[0325] In some embodiments, a dose of modified cells is administered to a subject according to the age and species of the subject, disease or disorder to be treated, as well as the cell type or state and mode of administration. In some embodiments, at least about 10 ² - 10 ⁸ cells are administered per dose. In some embodiments, cells transduced with viral vector are administered to a subject in an effective amount.

[0326] In some embodiments, the dose of viral vector administered to a subject will vary according to the age of the subject, the disease or disorder to be treated, and mode of administration. In some embodiments, the dose for achieving a therapeutic effect is a virus titer of at least about 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ or more transducing units.

[0327] Administration of the pharmaceutically useful polynucleotide of the present disclosure or the polynucleotide cassette of the present disclosure is preferably in a “therapeutically effective amount” or “prophylactically effective amount” (as the case can be, although prophylaxis can be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of protein aggregation disease being treated. Prescription of treatment, e.g., decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington ’s Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.

[0328] A composition can be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.

[0329] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein is intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0330] The term “complementary” or “complementarity” refers to the ability of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence by, for example, hydrogen bonding (e.g., traditional Watson-Crick), covalent bonding, or other similar methods. In Watson-Crick base pairing, a double hydrogen bond forms between nucleobases T and A, whereas a triple hydrogen bond forms between nucleobases C and G. For example, the sequence A-G-T can be complementary to the sequence T-C-A. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson- Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). “Perfectly complementary” can mean that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein can refer to a degree of complementarity that can be at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides, or can refer to two nucleic acids that hybridize under stringent conditions (i.e., stringent hybridization conditions). Nucleic acids can include nonspecific sequences. As used herein, the term “nonspecific sequence” or “not specific” can refer to a nucleic acid sequence that contains a series of residues that can be not designed to be complementary to or can be only partially complementary to any other nucleic acid sequence.

[0331] The terms “determining,” “measuring,” “evaluating,” “assessing,” “assaying,” and “analyzing” can be used interchangeably herein to refer to forms of measurement. The terms include determining if an element is present or not (for example, detection). These terms can include quantitative, qualitative, or quantitative and qualitative determinations. Assessing can be relative or absolute. “Detecting the presence of’ can include determining the amount of something present in addition to determining whether it is present or absent depending on the context.

[0332] The term “encode,” as used herein, refers to an ability of a polynucleotide to provide information or instructions sequence sufficient to produce a corresponding gene expression product. In a non-limiting example, mRNA can encode a polypeptide during translation, whereas DNA can encode an mRNA molecule during transcription.

[0333] As used herein, the term “facilitates RNA editing” by an engineered guide RNA refers to the ability of the engineered guide RNA when associated with an RNA editing entity and a target RNA to provide a targeted edit of the target RNA by the RNA edited entity. In some instances, the engineered guide RNA can directly recruit or position/orient the RNA editing entity to the proper location for editing of the target RNA. In other instances, the engineered guide RNA when hybridized to the target RNA forms a guide-target RNA scaffold with one or more structural features as described herein, where the guide-target RNA scaffold with structural features recruits or positions/orients the RNA editing entity to the proper location for editing of the target RNA.

[0334] As used herein, the term “engineered guide RNA” can be used interchangeably with “guide RNA” and refers to a designed polynucleotide that is at least partially complementary to a target RNA. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA. Modification of the target RNA includes alteration of RNA splicing, reduction or enhancement of protein translation, target RNA knockdown, target RNA degradation, and/or ADAR mediated RNA editing of the target RNA. In some cases, guide RNAs facilitate ADAR mediated RNA editing for the purpose of target mRNA knockdown, downstream protein translation reduction or inhibition, downstream protein translation enhancement, correction of mutations (including correction of any G to A mutation, such as missense or nonsense mutations), introduction of mutations (e.g., introduction of an A to I (read as a G by cellular machinery) substitution), or alter the function of any adenosine containing a regulatory motif (e.g., polyadenylation signal, miRNA binding site, etc.). In some cases, a guide RNA can effect a functional outcome (e.g., target RNA modulation, downstream protein translation) via a combination of mechanisms, for example, ADAR-mediated RNA editing and binding and/or degrading target RNA. In some cases, a guide RNA can facilitate introduction of mutations at sites targeted by enzymes in order to modify the affinity of such enzymes for targeting and cleaving such sites. The guide RNAs of this disclosure can contain one or more structural features. A structural feature can be formed from latent structure in latent (unbound) guide RNA upon hybridization of the engineered latent guide RNA to a target RNA. Latent structure refers to a structural feature that substantially forms only upon hybridization of a guide RNA to a target RNA. For example, the sequence of a guide RNA provides one or more structural features, but these structural features substantially form only upon hybridization to the target RNA, and thus the one or more latent structural features manifest as structural features upon hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, the structural feature is formed, and the latent structure provided in the guide RNA is, thus, unmasked. The formation and structure of a latent structural feature upon binding to the target RNA depends on the guide RNA sequence. For example, formation and structure of the latent structural feature may depend on a pattern of complementary and mismatched residues in the guide RNA sequence relative to the target RNA. The guide RNA sequence may be engineered to have a latent structural feature that forms upon binding to the target RNA. In other instances, a structural feature can be a pre-formed structure (e.g., a GluR2 recruitment hairpin, or a hairpin from U7 snRNA).

[0335] A “guide -target RNA scaffold,” as disclosed herein, is the resulting double stranded RNA formed upon hybridization of a guide RNA, with latent structure, to a target RNA. A guide-target RNA scaffold has one or more structural features formed within the double stranded RNA duplex upon hybridization. For example, the guide-target RNA scaffold can have one or more structural features selected from a bulge, mismatch, internal loop, hairpin, or wobble base pair.

[0336] As used herein, the term “targeting sequence” can be used interchangeably with “targeting domain” or “targeting region” and refers to a polynucleotide sequence within an engineered guide RNA sequence that is at least partially complementary to a target polynucleotide. The target polynucleotide (e.g., a target RNA or a target DNA) may be a region of a polynucleotide of interest, such as a gene or a messenger RNA. As used herein, a “complementary” sequence refers to a sequence that is a reverse complement relative to a second sequence.

[0337] A targeting sequence of an engineered guide RNA allows the engineered guide RNA to hybridize to a target polynucleotide (e.g., a target RNA) through base pairing, such as Watson Crick base pairing. A targeting sequence can be located at either the N-terminus or C-terminus of the engineered guide RNA, or both, or the targeting sequence can be within the engineered guide RNA. The targeting sequence can be of any length sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence is at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,

130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148,

149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167,

168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186,

187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or up to about 200 nucleotides in length. In an embodiment, an engineered polynucleotide comprises a targeting sequence that is about 25 to 200, 50 to 150, 75 to 100, 80 to 110, 90 to 120, 95 to 115, 60 to 200, 60 to 180, 60 to 160, 60 to 140, 70 to 200, 70 to 180, 70 to 160, 70 to 140, 80 to 200, 80 to 190, 80 to 170, 80 to 160, 80 to 150, 80 to 140, 80 to 130, 80 to 120, 90 to 200, 90 to 190, 90 to 180, 90 to 170, 90 to 160, 90 to 150, 90 to 140, 90 to 130, 90 to 120, 100 to 200, 100 to 190, 100 to 180, 100 to

170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 110 to 200, 110 to 190, 110 to

180, 110 to 170, 110 to 160, 110 to 150, 110 to 140, 110 to 120, 120 to 200, 120 to 190, 120 to

180, 120 to 170, 120 to 160, 120 to 150, 120 to 140, 130 to 200, 130 to 190, 130 to 180, 130 to

170, 130 to 160, 130 to 150, 140 to 200, 140 to 190, 140 to 180, 140 to 170, 140 to 160, 150 to

200, 150 to 190, 150 to 180, 150 to 170, 160 to 200, 160 to 190 or 160 to 180 nucleotides in length.

[0338] A targeting sequence comprises at least partial sequence complementarity to a target polynucleotide. The targeting sequence may have a degree of sequence complementarity to the target polynucleotide sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target polynucleotide. In some cases, the targeting sequence comprises less than 100% complementarity to the target polynucleotide sequence. For example, the targeting sequence may have a single base mismatch relative to the target polynucleotide when bound to the target polynucleotide. In other cases, the targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 20, 30, 40 or up to about 50 base mismatches relative to the target polynucleotide when bound to the target polynucleotide. In some aspects, nucleotide mismatches can be associated with structural features provided herein. In some aspects, a targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or up to about 15 nucleotides that differ in complementarity from a wildtype polynucleotide of a subject target polynucleotide.

[0339] A targeting sequence comprises nucleotide residues having complementarity to a target polynucleotide. The targeting sequence may have a number of residues with complementarity to the target polynucleotide sufficient to hybridize with the target polynucleotide. The complementary residues may be contiguous or non-contiguous. In some cases, the targeting sequence comprises at least 50 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 150 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 200 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 250 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 300 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,

130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148,

149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167,

168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195,

196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214,

215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233,

234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 250, 251, 252, 253, 254, 255,

256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274,

275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293,

294, 295, 296, 297, 298, 299, or 300 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises more than 50 nucleotides total and has at least 50 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 150 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 200 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 250 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 300 nucleotides having complementarity to the target polynucleotide. In some cases, the at least 50 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 150 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 200 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 250 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 300 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. For example, a targeting sequence comprises a total of 54 nucleotides wherein, sequentially, 25 nucleotides are complementarity to the target polynucleotide, 4 nucleotides form a bulge, and 25 nucleotides are complementarity to the target polynucleotide. As another example, a targeting sequence comprises a total of 118 nucleotides wherein, sequentially, 25 nucleotides are complementarity to the target polynucleotide, 4 nucleotides form a bulge, 25 nucleotides are complementarity to the target polynucleotide, 14 nucleotides form a loop, and 50 nucleotides are complementary to the target polynucleotide. [0340] “Messenger RNA” or “mRNA” are RNA molecules comprising a sequence that encodes a polypeptide or protein. In general, RNA can be transcribed from DNA. In some cases, precursor mRNA containing non-protein coding regions in the sequence can be transcribed from DNA and then processed to remove all or a portion of the non-coding regions (introns) to produce mature mRNA. As used herein, the term “pre-mRNA” can refer to the RNA molecule transcribed from DNA before undergoing processing to remove the non-protein coding regions. [0341] As disclosed herein, a base paired (bp) region refers to a region of the guide-target RNA scaffold in which bases in the guide RNA (e.g., the bases in the targeting sequence of the guide RNA) are paired with opposing bases in the target polynucleotide. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to the other end of the guide-target RNA scaffold. Base paired regions can extend between two structural features. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to a structural feature. Base paired regions can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, a base paired region has from 1 to 50, 1 to 75, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 225, 1 to 250, 1 to 275, 1 to 300, 50 to 75, 50 to 100, 50 to 125, 50 to 150, 50 to 175, 50 to 200, 50 to 225, 50 to 250, 50 to 275, 50 to 300, 60 to 75, 60 to 100, 60 to 125, 60 to 150, 60 to 175, 60 to 200, 60 to 225, 60 to 250, 60 to 275, 60 to 300, 70 to 100, 70 to 125, 70 to 150, 70 to 175, 70 to 200, 70 to 225, 70 to 250, 70 to 275, 70 to 300, 80 to 100, 80 to 125, 80 to 150, 80 to 175, 80 to 200, 80 to 225, 80 to 250, 80 to 275, 80 to 300, 90 to 125, 90 to 150, 90 to 175, 90 to 200, 90 to 225, 90 to 250, 90 to 275, 90 to 300, 100 to 125, 100 to 150, 100 to 175, 100 to 200, 100 to 225, 100 to 250, 100 to 275, 100 to 300, 150 to 200, 150 to 225, 150 to 250, 150 to 275, or 150 to 300 base pairs. In some embodiments, a base paired region has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192,

193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211,

212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230,

231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 250, 251, 252,

253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271,

272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290,

291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 base pairs.

[0342] As disclosed herein, a “mismatch” refers to a single nucleotide in a guide RNA that is unpaired to an opposing single nucleotide in a target RNA within the guide-target RNA scaffold. A mismatch can comprise any two single nucleotides that do not base pair. Where the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1 , the resulting structure is no longer considered a mismatch, but rather, is considered a “bulge” or an “internal loop,” depending on the size of the structural feature.

[0343] The term “structured motif’ refers to a combination of two or more structural features in a guide-target RNA scaffold.

[0344] The terms “subject,” “individual,” or “patient” can be used interchangeably herein. A “subject” refers to a biological entity containing expressed genetic materials. The biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa. The subject can be tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro. The subject can be a mammal. The mammal can be a human. The subject can be diagnosed or suspected of being at high risk for a disease. In some cases, the subject may not be necessarily diagnosed or suspected of being at high risk for the disease [0345] The term “z/z vivo” refers to an event that takes place in a subject’s body. [0346] The term “ex vivo” refers to an event that takes place outside of a subject’s body. An ex vivo assay may not be performed on a subject. Rather, it can be performed upon a sample separate from a subject. An example of an ex vivo assay performed on a sample can be an “in vitro” assay.

[0347] The term “in vitro” refers to an event that takes places contained in a container for holding laboratory reagent such that it can be separated from the biological source from which the material can be obtained. In vitro assays can encompass cell-based assays in which living or dead cells can be employed. In vitro assays can also encompass a cell-free assay in which no intact cells can be employed.

[0348] The term “wobble base pair” refers to two bases that weakly pair. For example, a wobble base pair can refer to a G paired with a U.

[0349] The term “substantially forms” as described herein, when referring to a particular secondary structure, refers to formation of at least 80% of the structure under physiological conditions (e.g., physiological pH, physiological temperature, physiological salt concentration, etc.).

[0350] As used herein, the term “therapeutic polynucleotide” may to a polynucleotide that is introduced into a cell and is capable of being expressed in the cell or to a polynucleotide that may, in itself, have a therapeutic activity, such as a gRNA or a tRNA.

[0351] As used herein, the term “polynucleotide” refers to a single or double-stranded polymer of deoxyribonucleotide (DNA) or ribonucleotide (RNA) bases read from the 5 ’ to the 3’ end. The term “RNA” is inclusive of dsRNA (double stranded RNA), snRNA (small nuclear RNA), IncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (microRNA) RNAi (inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (small nucleolar RNA), and cRNA (complementary RNA). The term DNA is inclusive of cDNA, genomic DNA, and DNA-RNA hybrids. A sequence of a polynucleotide may be provided interchangeably as an RNA sequence (containing U) or a DNA sequence (containing T). A sequence provided as an RNA sequence is intended to also cover the corresponding DNA sequence and the reverse complement RNA sequence or DNA sequence. A sequence provided as a DNA sequence is intended to also cover the corresponding RNA sequence and the reverse complement RNA sequence or DNA sequence. As used herein, the term “polynucleotide” is intended to encompass “recombinant polynucleotides”, and vice versa. The present disclosure provides recombinant polynucleotides for expressing RNA payloads. Also described herein are RNA payloads expressed by a recombinant polynucleotide. [0352] In some embodiments, a polynucleotide may be a polynucleotide payload. As used herein, the term “polynucleotide payload” refers to an RNA payload or a nucleotide sequence encoding an RNA payload. An RNA payload of the present disclosure may comprise a small RNA payload such as an engineered guide RNA. A polynucleotide payload (e.g., an RNA payload or a polynucleotide encoding an RNA payload) of the present disclosure may comprise a stability element (e.g., an exonuclease-resistant structure), a localization element (e.g., an RBP-binding element), a promoter, a target-binding sequence, a termination sequence, or combinations thereof.

[0353] The term “protein”, “peptide” and “polypeptide” can be used interchangeably and in their broadest sense can refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits can be linked by peptide bonds. In another embodiment, the subunit can be linked by other bonds, e.g., ester, ether, etc. A protein or peptide can contain at least two amino acids and no limitation can be placed on the maximum number of amino acids which can comprise a protein’s or peptide’s sequence. As used herein the term “amino acid” can refer to either natural amino acids, unnatural amino acids, or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics. As used herein, the term “fusion protein” can refer to a protein comprised of domains from more than one naturally occurring or recombinantly produced protein, where generally each domain serves a different function. In this regard, the term “linker” can refer to a protein fragment that can be used to link these domains together - optionally to preserve the conformation of the fused protein domains, prevent unfavorable interactions between the fused protein domains which can compromise their respective functions, or both.

[0354] The term “ameliorating” refers to any therapeutically beneficial result in the treatment of a disease state, e.g., Rett syndrome, including prophylaxis, lessening in the severity or progression, remission, or cure thereof.

[0355] The term “mammal” as used herein includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0356] The term percent “identity,” in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent “identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

[0357] For sequence comparison, typically one sequence acts as a reference sequence (also called the subject sequence) to which test sequences (also called query sequences) are compared. The percent sequence identity is defined as a test sequence’s percent identity to a reference sequence. For example, when stated “Sequence A having a sequence identity of 50% to Sequence B,” Sequence A is the test sequence and Sequence B is the reference sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer program, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve the maximum alignment, based on the designated program parameters, introducing gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) relative to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from the aligned sequence is as follows:

[(Number of Identical Positions)/(Total Number of Positions in the Test Sequence)] x 100% [0358] For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/). The BLAST algorithm uses a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence) to search against, or in some cases, a database of multiple reference sequences to search against. The BLAST algorithm performs sequence alignment by finding high-scoring alignment regions between the test and the reference sequences by scoring alignment of short regions of the test sequence (termed “words”) to the reference sequence. The scoring of each alignment is determined by the BLAST algorithm and takes factors into account, such as the number of aligned positions, as well as whether introduction of gaps between the test and the reference sequences would improve the alignment. The alignment scores for nucleic acids can be scored by set match/mismatch scores. For protein sequences, the alignment scores can be scored using a substitution matrix to evaluate the significance of the sequence alignment, for example, the similarity between aligned amino acids based on their evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, the public default values of April 6, 2023 are used when using the BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output a “Percent Identity” output value and a “Query Coverage” output value. The overall percent sequence identity as used herein can then be calculated from the BLASTN or BLASTP output values as follows:

Percent Sequence Identity = (“Percent Identity” output value) x (“Query Coverage” output value)

[0359] The following non-limiting examples illustrate the calculation of percent identity between two nucleic acids sequences. The percent identity is calculated as follows: [(number of identical nucleotide positions)/(total number of nucleotides in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 1: AAAAAGGGGG (SEQ ID NO: 868) (length = 10 nucleotides) to reference sequence 2: AAAAAAAAAA (SEQ ID NO: 869) (length = 10 nucleotides). The percent identity between test sequence 1 and reference sequence 2 would be [(5)/(10)] xl00% = 50%. Test sequence 1 has 50% sequence identity to reference sequence 2. In another example, percent identity is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (SEQ ID NO: 870) (length = 20 nucleotides) to reference sequence 4: GGGGGGGGGG (SEQ ID NO: 871) (length = 10 nucleotides). The percent identity between test sequence 3 and reference sequence 4 would be [(10)/(20)J xl00% = 50%. Test sequence 3 has 50% sequence identity to reference sequence 4. In another example, percent identity is calculated to compare test sequence 5: GGGGGGGGGG (SEQ ID NO: 871) (length = 10 nucleotides) to reference sequence 6: CCCCCGGGGGGGGGGCCCCC (SEQ ID NO: 870) (length = 20 nucleotides). The percent identity between test sequence 5 and reference sequence 6 would be [(10)/(10)J xioo% = 100%. Test sequence 5 has 100% sequence identity to reference sequence 6.

[0360] The following non-limiting examples illustrate the calculation of percent identity between two protein sequences. The percent identity is calculated as follows: [(number of identical amino acid positions)/(total number of amino acids in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 7: FFFFFYYYYY (SEQ ID NO: 872) (length = 10 amino acids) to reference sequence 8: YYYYYYYYYY (SEQ ID NO: 873) (length = 10 amino acids). The percent identity between test sequence 7 and reference sequence 8 would be [(5)/(10)] xl00% = 50%. Test sequence 7 has 50% sequence identity to reference sequence 8. In another example, percent identity is calculated to compare test sequence 9: LLLLLFFFFFYYYYYLLLLL (SEQ ID NO: 874) (length = 20 amino acids) to reference sequence 10: FFFFFYYYYY (SEQ ID NO: 872)(length = 10 amino acids). The percent identity between test sequence 9 and reference sequence 10 would be [(10)/(20)J x ioo% = 50%. Test sequence 9 has 50% sequence identity to reference sequence 10. In another example, percent identity is calculated to compare test sequence 11: FFFFFYYYYY(SEQ ID NO: 872) (length = 10 amino acids) to reference sequence 12: LLLLLFFFFFYYYYYLLLLL (SEQ ID NO: 874) (length = 20 amino acids). The percent identity between test sequence 11 and reference sequence 12 would be [(10)/(l 0)] ><100% = 100%. Test sequence 11 has 100% sequence identity to reference sequence 12.

[0361] As used herein, the term “subject” broadly refers to any animal, including but not limited to, human and non-human animals (e.g., dogs, cats, cows, horses, sheep, pigs, poultry, fish, crustaceans, etc.).

[0362] As used herein, the term “effective amount” refers to the amount of a composition (e.g., a synthetic peptide) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.

[0363] As used herein, the term “therapeutically effective amount” is an amount that is effective to ameliorate a symptom of a disease. A therapeutically effective amount can be a “prophylactically effective amount” as prophylaxis can be considered therapy.

[0364] As used herein, the terms “administration” and “administering” refer to the act of giving a drug, prodrug, or other agent, or therapeutic treatment (e.g., peptide) to a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs. Exemplary routes of administration to the human body can be through space under the arachnoid membrane of the brain or spinal cord (intrathecal), the eyes (ophthalmic), mouth (oral), skin (topical or transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal or lingual), ear, rectal, vaginal, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.

[0365] As used herein, the term “treatment” or “treating” means an approach to obtaining a beneficial or intended clinical result. The beneficial or intended clinical result can include a therapeutic benefit and/or a prophylactic benefit, alleviation of symptoms, a reduction in the severity of the disease, inhibiting an underlying cause of a disease or condition, steadying diseases in a non-advanced state, delaying the progress of a disease, and/or improvement or alleviation of disease conditions. Also, a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement can be observed in the subject, notwithstanding that the subject can still be afflicted with the underlying disorder. A prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of one or more symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof. For prophylactic benefit, a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease can undergo treatment, even though a diagnosis of this disease may not have been made.

[0366] As used herein, the term “pharmaceutical composition” refers to the combination of an active ingredient with a carrier, inert or active, making the composition especially suitable for therapeutic or diagnostic use in vitro, in vivo or ex vivo.

[0367] The terms “pharmaceutically acceptable” or “pharmacologically acceptable,” as used herein, refer to compositions that do not substantially produce adverse reactions, e.g., toxic, allergic, or immunological reactions, when administered to a subject.

[0368] As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), glycerol, liquid polyethylene glycols, aprotic solvents such as dimethylsulfoxide, N-methylpyrrolidone and mixtures thereof, and various types of wetting agents, solubilizing agents, anti-oxidants, bulking agents, protein carriers such as albumins, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see, e.g., Martin, Remington ’s Pharmaceutical Sciences, 21 ^st Ed., Mack Publ. Co., Easton, Pa. (2005), incorporated herein by reference in its entirety.

[0369] Throughout this application, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0370] As used herein, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0371] As used herein, the terms “about” and “approximately,” in reference to a number, is used herein to include numbers that fall within a range of 10%, 5%, or 1% in either direction (greater than or less than) the number unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

Numbered Embodiments

[0372] The following embodiments recite non-limiting permutations of combinations of features disclosed herein. Other permutations of combinations of features are also contemplated. In particular, each of these numbered embodiments is contemplated as depending from or relating to every previous or subsequent numbered embodiment, independent of their order as listed. 1. A polynucleotide encoding an RNA, wherein the RNA comprises: a target-binding sequence capable of hybridizing to a target sequence, and an RNA accessory element, wherein the RNA accessory element increases the stability of the RNA, alters subcellular localization of the RNA, or both. 2. The polynucleotide of embodiment 1, wherein the RNA accessory element comprises a stability element, a localization element, or combinations thereof. 3. The polynucleotide of embodiment 2, wherein the localization element alters the subcellular localization of the RNA. 4. The polynucleotide of embodiment 2 or embodiment 3, wherein the localization element is an RNA binding protein (RBP)-binding element. 5. The polynucleotide of embodiment 4, wherein the RBP-binding element is capable of binding an RNA binding protein. 6. The polynucleotide of embodiment 5, wherein the RNA binding protein is CELF1, CNOT4, CPEB1, CPEB2, CPEB4, DAZ3, ELAVL1, ESRP1, ESRP2, EWSR1, FUBP1, FUBP3, FUS, FXR2, HNRNPAO, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPC, HNRNPCL1, HNRNPD, HNRNPF, HNRNPH2, HNRNPK, HNRNPL, IGF2BP2, ILF2, KHDRBS3, LIN28A, MBNL1, MSI1, NOVAI, NUPL2, PABPC1, PABPC4, PABPN1, PCBP2, PPRC1, QK1, RALY, RALYL, RBFOX2, RBFOX3, RBM22, RBM23, RBM24, RBM3, RBM4, RBM42, RBM45, RBM47, RBM5, RBM6, RBM8A, RBMS1, RBMS2, SART3, SF1, SFPQ, SNRNP70, SRSF1, SRSF10, SRSF8, TAF15, TARDBP, TRA2A, TRNAU1AP, U2AF2, YBX2, or ZFP36. 7. The polynucleotide of any one of embodiments 4-6, wherein the RBP-binding element comprises a first RBP-binding motif. 8. The polynucleotide of embodiment 7, wherein the first RBP-binding motif comprises a sequence having at least 80% sequence identity to any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). 9. The polynucleotide of embodiment 7 or embodiment 8, wherein the first RBP-binding motif comprises a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, AC AC AG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). 10. The polynucleotide of any one of embodiments 7-9, wherein the first RBP-binding motif is encoded by a sequence comprising at least 80% sequence identity to any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). 11. The polynucleotide of any one of embodiments 7-10, wherein the first RBP-binding motif is encoded by a sequence of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). 12. The polynucleotide of any one of embodiments 7-11, wherein the first RBP-binding motif comprises a sequence of: a) AACUGC (SEQ ID NO: 322), b) CAACCA (SEQ ID NO: 335), c) CCAACC (SEQ ID NO: 342), d) CCAUCC (SEQ ID NO: 344), e) CGUGCC (SEQ ID NO: 352), f) CUGACA (SEQ ID NO: 358), g) GCAGCA (SEQ ID NO: 371), h) GCAGGC (SEQ ID NO: 372), i) GCGCGG (SEQ ID NO: 375), j) GCUUGC (SEQ ID NO: 377), k) GGAUGU (SEQ ID NO: 382), 1) UAAUUU (SEQ ID NO: 394), m) UAUCAA (SEQ ID NO: 397), n) UCCCUG (SEQ ID NO: 402), o) UUCUGU (SEQ ID NO: 417), p) UUGUGA (SEQ ID NO: 419), or q) UUUUAC (SEQ ID NO: 424). 13. The polynucleotide of any one of embodiments 7-12, wherein the first RBP-binding motif is encoded by a sequence comprising: a) AACTGC (SEQ ID NO: 756), b) CAACCA (SEQ ID NO: 769), c) CCAACC (SEQ ID NO: 776), d) CCATCC (SEQ ID NO: 778), e) CGTGCC (SEQ ID NO: 786), f) CTGACA (SEQ ID NO: 792), g) GCAGCA (SEQ ID NO: 805), h) GCAGGC (SEQ ID NO: 806), i) GCGCGG (SEQ ID NO: 809), j) GCTTGC (SEQ ID NO: 811), k) GGATGT (SEQ ID NO: 816), 1) TAATTT (SEQ ID NO: 828), m) TATCAA (SEQ ID NO: 831), n) TCCCTG (SEQ ID NO: 836), o) TTCTGT (SEQ ID NO: 851), p) TTGTGA (SEQ ID NO: 853), or q) TTTTAC (SEQ ID NO: 858). 14. The polynucleotide of any one of embodiments 4-13, wherein the RBP-binding element comprises a second RBP-binding motif. 15. The polynucleotide of embodiment 14, wherein the second RBP-binding motif comprises a sequence having at least 80% sequence identity to any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). 16. The polynucleotide of embodiment 14 or embodiment 15, wherein the second RBP-binding motif comprises a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424).

17. The polynucleotide of any one of embodiments 14-16, wherein the second RBP-binding motif is encoded by a sequence comprising at least 80% sequence identity to any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). 18. The polynucleotide of any one of embodiments 14-17, wherein the second RBP-binding motif is encoded by a sequence of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). 19. The polynucleotide of any one of embodiments 4-18, wherein the RBP- binding element comprises a third RBP-binding motif. 20. The polynucleotide of embodiment 19, wherein the third RBP-binding motif comprises a sequence having at least 80% sequence identity to any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). 21. The polynucleotide of embodiment 19 or embodiment 20, wherein the third RBP-binding motif comprises a sequence of any one of AACUGC, AAUAUU, AAUUUU, ACAAAC, AC AC AG, ACC AC A, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424). 22. The polynucleotide of any one of embodiments 19-21, wherein the third RBP-binding motif is encoded by a sequence comprising at least 80% sequence identity to any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). 23. The polynucleotide of any one of embodiments 19-22, wherein the third RBP-binding motif is encoded by a sequence of any one of AACTGC, AATATT, AATTTT, ACAAAC, ACACAG, ACCACA, ACTAAG, AGACAA, AGCAGA, AGCTTT, ATACTA, ATCCCT, ATGTCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGTTA, CATCTA, CCAACC, CCACCG, CCATCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCTGC, CGTATC, CGTCTC, CGTGCC, CGTGGG, CTAATC, CTACCC, CTACTA, CTCCCG, CTGACA, CTGCGC, CTTAGA, CTTATC, CTTTTG, GAAAAT, GAAAGC, GAGGAA, GAGGAT, GAGGGA, GATCTG, GATGTG, GCAAGC, GCAGCA, GCAGGC, GCATGA, GCGCCC, GCGCGG, GCGGGC, GCTTGC, GGAGCA, GGAGGA, GGAGTG, GGATGG, GGATGT, GGCATG, GGGATG, GGGCAG, GGGGTT, GGTGGT, GGTTTT, GTAAGA, GTAATA, GTATGA, GTGGTG, GTTAAG, TAATTT, TACATT, TACTCA, TATCAA, TATCTG, TATGTA, TATTGT, TCCACC, TCCCTG, TCCTCA, TCCTCT, TGAAGA, TGATAG, TGATTT, TGGTGC, TGTCTG, TGTGTG, TGTTGA, TGTTTC, TTCAAG, TTCAGA, TTCCGA, TTCTCC, TTCTGT, TTGAAT, TTGTGA, TTGTTC, TTTAAC, TTTAAG, TTTATA, and/or TTTTAC (SEQ ID NO: 756 - SEQ ID NO: 858). 24. The polynucleotide of any one of embodiments 2-23, wherein the RBP-binding element comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 91 - SEQ ID NO: 317. 25. The polynucleotide of any one of embodiments 2-24, wherein the RBP-binding element comprises a sequence of any one of SEQ ID NO: 91 - SEQ ID NO: 317. 26. The polynucleotide of any one of embodiments 2-25, wherein the RBP-binding element is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 529 - SEQ ID NO: 755. 27. The polynucleotide of any one of embodiments 2-26, wherein the RBP-binding element is encoded by a sequence comprising any one of SEQ ID NO: 529 - SEQ ID NO: 755. 28. The polynucleotide of any one of embodiments 2-27, wherein the RBP-binding element comprises a sequence of: a) SEQ ID NO: 91, b) SEQ ID NO: 92, c) SEQ ID NO: 93, d) SEQ ID NO: 95, e) SEQ ID NO: 96, f) SEQ ID NO: 100, g) SEQ ID NO: 108, h) SEQ ID NO: 115, i) SEQ ID NO: 124, j) SEQ ID NO: 125, k) SEQ ID NO: 132, 1) SEQ ID NO: 136, m) SEQ ID NO: 142, n) SEQ ID NO: 162, o) SEQ ID NO: 167, p) SEQ ID NO: 168, q) SEQ ID NO: 176, r) SEQ ID NO: 179, s) SEQ ID NO: 182, t) SEQ ID NO: 188, u) SEQ ID NO: 190, v) SEQ ID NO: 199, w) SEQ ID NO: 215, x) SEQ ID NO: 219, y) SEQ ID NO: 227, z) SEQ ID NO: 236, aa) SEQ ID NO: 238, ab) SEQ ID NO: 247, ac) SEQ ID NO: 248, ad) SEQ ID NO: 255, ae) SEQ ID NO: 269, af) SEQ ID NO: 275, ag) SEQ ID NO: 283, ah) SEQ ID NO: 295, ai) SEQ ID NO: 304, or aj) SEQ ID NO: 306. 29. The polynucleotide of any one of embodiments 2-28, wherein the RBP-binding element is encoded by a sequence comprising: a) SEQ ID NO: 529, b) SEQ ID NO: 530, c) SEQ ID NO: 531, d) SEQ ID NO: 533, e) SEQ ID NO: 534, f) SEQ ID NO: 538, g) SEQ ID NO: 546, h) SEQ ID NO: 553, i) SEQ ID NO: 562, j) SEQ ID NO: 563, k) SEQ ID NO: 570, 1) SEQ ID NO: 574, m) SEQ ID NO: 580, n) SEQ ID NO: 600, o) SEQ ID NO: 605, p) SEQ ID NO: 606, q) SEQ ID NO: 614, r) SEQ ID NO: 617, s) SEQ ID NO: 620, t) SEQ ID NO: 626, u) SEQ ID NO: 628, v) SEQ ID NO: 637, w) SEQ ID NO: 653, x) SEQ ID NO: 657, y) SEQ ID NO: 665, z) SEQ ID NO: 674, aa) SEQ ID NO: 676, ab) SEQ ID NO: 685, ac) SEQ ID NO: 686, ad) SEQ ID NO: 693, ae) SEQ ID NO: 707, af) SEQ ID NO: 713, ag) SEQ ID NO: 721, ah) SEQ ID NO: 733, ai) SEQ ID NO: 742, or aj) SEQ ID NO: 744. 30. The polynucleotide of any one of embodiments 2-29, wherein the localization element is positioned 3’ of the targetbinding sequence. 31. The polynucleotide of any one of embodiments 2-30, wherein the localization element is positioned 5’ of the target-binding sequence. 32. The polynucleotide of any one of embodiments 2-31 , wherein the localization element comprises a length of not less than 2 and not more than 500 nucleotides. 33. The polynucleotide of any one of embodiments 2-

32, wherein the localization element comprises a length of not less than 20 and not more than 400, not less than 20 or not more than 300, not less than 20 and not more than 200, or not less than 20 or not more than 100 nucleotides. 34. The polynucleotide of any one of embodiments 2-

33, wherein the localization element comprises a length of not less than 25 and not more than 55 nucleotides. 35. The polynucleotide of any one of embodiments 2-34, wherein the stability element increases the stability of the RNA. 36. The polynucleotide any one of embodiments 2- 35, wherein the stability element comprises an exonuclease-resistant structure. 37. The polynucleotide of embodiment 36, wherein the exonuclease-resistant structure comprises a secondary structure. 38. The polynucleotide of embodiment 37, wherein the secondary structure comprises an aptamer, a G-quadruplex, a stem-loop, a multi-loop, a 3 -way junction, a knot, or a pseudoknot. 39. The polynucleotide of embodiment 38, wherein the pseudoknot is a zika pseudoknot. 40. The polynucleotide of any one of embodiments 36-39, wherein the exonucleaseresistant structure comprises a viral RNA sequence. 41. The polynucleotide of embodiment 40, wherein the viral RNA sequence is a flavivirus RNA sequence. 42. The polynucleotide of embodiment 40 or embodiment 41, wherein the viral RNA sequence is from Murray Valley encephalitis virus, West Nile virus, Zika virus, Dengue virus, or Yellow Fever virus. 43. The polynucleotide of any one of embodiments 36-42, wherein the exonuclease-resistant structure comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. 44. The polynucleotide of any one of embodiments 36-43, wherein the exonucleaseresistant structure comprises a sequence of any one of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. 45. The polynucleotide of any one of embodiments 36-44, wherein the exonuclease-resistant structure is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 444 - SEQ ID NO: 528. 46. The polynucleotide of any one of embodiments 36-45, wherein the exonuclease-resistant structure is encoded by a sequence comprising any one of SEQ ID NO: 444 - SEQ ID NO: 528. 47. The polynucleotide of any one of embodiments 36-46, wherein the exonuclease-resistant structure comprises a sequence of: a) SEQ ID NO: 19, b) SEQ ID NO: 20, c) SEQ ID NO: 21, d) SEQ ID NO: 22, e) SEQ ID NO: 23, f) SEQ ID NO: 24, g) SEQ ID NO: 25, h) SEQ ID NO: 26, i) SEQ ID NO: 27, j) SEQ ID NO: 28, k) SEQ ID NO: 29, 1) SEQ ID NO: 30, m) SEQ ID NO: 31, n) SEQ ID NO: 32, o) SEQ ID NO: 33, p) SEQ ID NO: 34, q) SEQ ID NO: 35, r) SEQ ID NO: 36, s) SEQ ID NO: 37, t) SEQ ID NO: 38, u) SEQ ID NO: 39, v) SEQ ID NO: 40, w) SEQ ID NO: 41, x) SEQ ID NO: 42, y) SEQ ID NO: 43, z) SEQ ID NO: 44, aa) SEQ ID NO: 45, ab) SEQ ID NO: 46, ac) SEQ ID NO: 47, ad) SEQ ID NO: 48, ae) SEQ ID NO: 49, af) SEQ ID NO: 50, ag) SEQ ID NO: 51, ah) SEQ ID NO: 52, ai) SEQ ID NO: 53, aj) SEQ ID NO: 54, ak) SEQ ID NO: 55, al) SEQ ID NO: 56, am) SEQ ID NO: 57, an) SEQ ID NO: 58, ao) SEQ ID NO: 59, ap) SEQ ID NO: 60, aq) SEQ ID NO: 61, ar) SEQ ID NO: 62, as) SEQ ID NO: 63, at) SEQ ID NO: 64, au) SEQ ID NO: 65, av) SEQ ID NO: 425, or aw) SEQ ID NO: 426. 48. The polynucleotide payload of any one of embodiments 36-47, wherein the exonuclease-resistant structure is encoded by a sequence comprising: a) SEQ ID NO: 455, b) SEQ ID NO: 456, c) SEQ ID NO: 457, d) SEQ ID NO: 458, e) SEQ ID NO: 459, f) SEQ ID NO: 460, g) SEQ ID NO: 461, h) SEQ ID NO: 462, i) SEQ ID NO: 463, j) SEQ ID NO: 464, k) SEQ ID NO: 465, 1) SEQ ID NO: 466, m) SEQ ID NO: 467, n) SEQ ID NO: 468, o) SEQ ID NO: 469, p) SEQ ID NO: 470, q) SEQ ID NO: 471, r) SEQ ID NO: 472, s) SEQ ID NO: 473, t) SEQ ID NO: 474, u) SEQ ID NO: 475, v) SEQ ID NO: 476, w) SEQ ID NO: 477, x) SEQ ID NO: 478, y) SEQ ID NO: 479, z) SEQ ID NO: 480, aa) SEQ ID NO: 481, ab) SEQ ID NO: 482, ac) SEQ ID NO: 483, ad) SEQ ID NO: 484, ae) SEQ ID NO: 485, af) SEQ ID NO: 486, ag) SEQ ID NO: 487, ah) SEQ ID NO: 488, ai) SEQ ID NO: 489, aj) SEQ ID NO: 490, ak) SEQ ID NO: 491, al) SEQ ID NO: 492, am) SEQ ID NO: 493, an) SEQ ID NO: 494, ao) SEQ ID NO: 495, ap) SEQ ID NO: 496, aq) SEQ ID NO: 497, ar) SEQ ID NO: 498, as) SEQ ID NO: 499, at) SEQ ID NO: 500, au) SEQ ID NO: 501, av) SEQ ID NO: 527, or aw) SEQ ID NO: 528. 49. The polynucleotide of any one of embodiments 2-48, wherein the stability element is located 5’ of the target-binding sequence. 50. The polynucleotide of any one of embodiments 2-49, wherein the stability element is located 3’ of the target-binding sequence. 51. The polynucleotide of any one of embodiments 1-50, wherein the RNA further comprises a hairpin, an Sm binding sequence, or both. 52. The polynucleotide of embodiment 51, wherein the Sm binding sequence is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 6. 53. The polynucleotide of embodiment 51 or embodiment 52, wherein the Sm binding sequence comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 7. 54. The polynucleotide payload of any one of embodiments 51-53, wherein the Sm binding sequence is located at a 3’ end of the RNA. 55. The polynucleotide payload of any one of embodiments 51- 54, wherein the hairpin comprises a sequence derived from an snRNA family. 56. The polynucleotide payload of any one of embodiments 51-55, wherein the hairpin comprises a sequence having at least 80% sequence identity to a U1 sequence or a U7 sequence. 57. The polynucleotide payload of embodiment 56, wherein the U1 sequence is a mouse U1 sequence or a human U1 sequence. 58. The polynucleotide payload of embodiment 56, wherein the U7 sequence is a mouse U7 sequence or a human U7 sequence. 59. The polynucleotide payload of any one of embodiments 51-58, wherein the hairpin is encoded by a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6. 60. The polynucleotide payload of any one of embodiments 51-59, wherein the hairpin comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7.

61. The polynucleotide payload of any one of embodiments 51-60, wherein the hairpin is located 5’ of the Sm binding sequence. 62. The polynucleotide payload of any one of embodiments 51- 61, wherein the hairpin is located immediately 5’ of the Sm binding sequence. 63. The polynucleotide payload of any one of embodiments 1-62, wherein the RNA comprises an engineered guide RNA capable of hybridizing to the target sequence. 64. The polynucleotide payload of embodiment 63, wherein the engineered guide RNA comprises the target-binding sequence. 65. The polynucleotide payload of any one of embodiments 1-64, wherein the targetbinding sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to the target sequence. 66. The polynucleotide payload of any one of embodiments 1-65, wherein the target-binding sequence comprises at least one base pair mismatch relative to the target sequence. 67. The polynucleotide payload of any one of embodiments 1-65, wherein the target-binding sequence is 100% reverse complementary to the target sequence. 68. The polynucleotide payload of any one of embodiments 1-67, wherein the target sequence comprises an adenosine residue. 69. The polynucleotide payload of any one of embodiments 1-68, wherein the target sequence is a target RNA sequence. 70. The polynucleotide payload of embodiment 69, wherein the target RNA sequence is an mRNA or a pre-mRNA. 71. The polynucleotide payload of any one of embodiments 1-70, wherein the target sequence comprises a G to A mutation relative to a wild type sequence. 72. The polynucleotide payload of any one of embodiments 1-71, wherein the target sequence comprises a missense mutation or a nonsense mutation relative to a wild type sequence. 73. The polynucleotide payload of any one of embodiments 1-71, wherein the target sequence is a wild type sequence. 74. The polynucleotide payload of any one of embodiments 1-73, wherein the target sequence is an untranslated region. 75. The polynucleotide payload of any one of embodiments 1-74, wherein the target sequence comprises a portion of a gene encoding a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of the PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2). 76. The polynucleotide payload of any one of embodiments 1-75, wherein the RNA comprises an antisense oligonucleotide, an siRNA, an shRNA, an miRNA, or a tracrRNA. 77. The polynucleotide payload of any one of embodiments 1-76, wherein the RNA is not less than 20 nucleotide residues and not more than 500 nucleotide residues long. 78. The polynucleotide payload of any one of embodiments 1-77, wherein the RNA is not less than 60 and not more than 100 residues long. 79. The polynucleotide payload of any one of embodiments 1-78, wherein the RNA is not less than 80 and not more than 120 residues long. 80. The polynucleotide payload of any one of embodiments 1-79, wherein the RNA is not less than 100 and not more than 140 residues long. 81. The polynucleotide payload of any one of embodiments 1-80, wherein the RNA is not less than 130 and not more than 170 residues long. 82. The polynucleotide payload of any one of embodiments 1-81, wherein the polynucleotide payload is not less than 1300 nucleotide residues and not more than 4600 residues long. 83. The polynucleotide payload of any one of embodiments 1-82, wherein the RNA payload is capable of forming a guide-target RNA scaffold comprising a structural feature upon hybridization of the RNA payload to a target sequence. 84. The polynucleotide payload of embodiment 83, wherein the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or combinations thereof. 85. The polynucleotide payload of embodiment 83 or embodiment 84, wherein the structural feature comprises the bulge, and wherein the bulge is a symmetric bulge. 86. The polynucleotide payload of any one of embodiments 83-85, wherein the structural feature comprises the bulge, and wherein the bulge is an asymmetric bulge. 87. The polynucleotide payload of any one of embodiments 83-86, wherein the structural feature comprises the internal loop, and wherein the internal loop is a symmetric internal loop. 88. The polynucleotide payload of any one of embodiments 83-87, wherein the structural feature comprises the internal loop, and wherein the internal loop is an asymmetric internal loop. 89. The polynucleotide payload of any one of embodiments 83-88, wherein the structural feature comprises the hairpin, and wherein the hairpin is a recruitment hairpin or a non-recruitment hairpin. 90. The polynucleotide payload of any one of embodiments 83-89, wherein the guide -target RNA scaffold comprises a Wobble base pair. 91. The polynucleotide payload of any one of embodiments 1-90, wherein the polynucleotide payload encodes two or more copies of the RNA. 92. The polynucleotide payload of any one of embodiments 1-91, wherein the polynucleotide payload encodes three or more copies of the RNA. 93. The polynucleotide payload of any one of embodiments 1-92, wherein the polynucleotide payload encodes not less than one and not more than three copies of the RNA. 94. A recombinant polynucleotide encoding the polynucleotide payload of any one of embodiments 1-93. 95. The recombinant polynucleotide of embodiment 94, comprising a promoter sequence, a transcription termination sequence, and a sequence encoding the polynucleotide payload, wherein the sequence encoding the polynucleotide payload is under transcriptional control of the promoter sequence. 96. A non-viral vector encoding the polynucleotide payload of any one of embodiments 1-93 or the recombinant polynucleotide of embodiment 94 or embodiment 95. 97. A viral vector encoding the polynucleotide payload of any one of embodiments 1-93 or the recombinant polynucleotide of embodiment 94 or embodiment 95. 98. The viral vector of embodiment 97, wherein the viral vector is an adeno- associated viral vector. 99. The viral vector of embodiment 98, wherein the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof. 100. A pharmaceutical composition comprising the polynucleotide payload of any one of embodiments 1-93, the recombinant polynucleotide of embodiment 94 or embodiment 95, the non- viral vector of embodiment 96, or the viral vector of any one of embodiments 97-99 and a pharmaceutically acceptable excipient, carrier, diluent, or combination thereof. 101. A method of expressing an RNA in a cell, the method comprising delivering a recombinant polynucleotide encoding the polynucleotide payload of any one of embodiments 1-93 or the recombinant polynucleotide of embodiment 94 or embodiment 95 to a cell and expressing the RNA encoded by the polynucleotide payload in the cell. 102. A method of treating a condition in a subject, the method comprising: administering to the subject a composition comprising the polynucleotide payload of any one of embodiments 1-93 or the recombinant polynucleotide of embodiment 94 or embodiment 95; delivering the polynucleotide payload to a cell of the subject; and expressing an RNA encoded by the polynucleotide payload in the cell, thereby treating the condition. 103. The method of embodiment 102, wherein the RNA comprises an engineered guide RNA that hybridizes to a target sequence, and wherein the cell encodes the target sequence. 104. The method of embodiment 103, further comprising forming a guide- target RNA scaffold upon hybridization of the engineered guide RNA to the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme. 105. The method of embodiment 103 or embodiment 104, wherein the target sequence comprises a mutation relative to a wild type sequence. 106. The method of embodiment 105, wherein editing the target sequence corrects the mutation in the target sequence. 107. The method of embodiment 105 or embodiment 106, wherein the mutation is a missense mutation. 108. The method of embodiment 105 or embodiment 106, wherein the mutation is a nonsense mutation. 109. The method of any one of embodiments 105-107, wherein the mutation is a G to A mutation. 110. The method of embodiment 103 or embodiment 104, wherein the target sequence is a wild type sequence. 111. The method of any one of embodiments 103-110, wherein the target sequence is an untranslated region. 112. The method of any one of embodiments 103-11, wherein the target sequence is associated with a disease. 113. The method of any one of embodiments 105-109, wherein the mutation is associated with the condition. 114. The method of any one of embodiments 102-113, wherein the condition is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. 115. The method of any one of embodiments 102-114, wherein the target sequence comprises a portion of a gene encoding a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of the PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2). 116. The method of any one of embodiments 102-115 wherein treating the condition comprises preventing the condition or delaying onset of the condition. 117. A method of editing a target sequence, the method comprising: delivering the polynucleotide payload of any one of embodiments 1-93 or the recombinant polynucleotide of embodiment 94 or embodiment 95 to a cell encoding the target sequence; expressing the RNA encoded by the polynucleotide payload in the cell, wherein the RNA comprises an engineered guide RNA capable of hybridizing to the target sequence; forming a guide-target RNA scaffold upon hybridization of the RNA to the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme. 118. The method of embodiment 117, wherein the target sequence comprises a mutation relative to a wild type sequence. 119. The method of embodiment 118, wherein editing the target sequence corrects the mutation in the target sequence. 120. The method of embodiment 117 or embodiment 118, wherein the mutation is a missense mutation. 121. The method of embodiment 117 or embodiment 118, wherein the mutation is a nonsense mutation. 122. The method of any one of embodiments 118-121, wherein the mutation is a G to A mutation. 123. The method of embodiment 117, wherein the target sequence is a wild type sequence. 124. The method of any one of embodiments 117-123, wherein the target sequence is an untranslated region. 125. The method of any one of embodiments 117-124, wherein the target sequence is associated with a disease. 126. The method of any one of embodiments 118-122, wherein the mutation is associated with a disease. 127. The method of embodiment 126, wherein the disease is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corti cobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. 128. The method of any one of embodiments 117- 127, wherein the target sequence comprises a portion of a gene encoding a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of PMP22 associated with Charcot- Marie-Tooth disease type 1A (CMT1A), ATP -binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2). 129. The method of any one of embodiments 104-128, wherein the guidetarget RNA scaffold comprises a structural feature. 130. The method of embodiment 129, wherein the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or combinations thereof. 131. The method of embodiment 129 or embodiment 130, wherein the structural feature comprises the bulge, and wherein the bulge is a symmetric bulge. 132. The method of any one of embodiments 129-131, wherein the structural feature comprises the bulge, and wherein the bulge is an asymmetric bulge. 133. The method of any one of embodiments 129-132, wherein the structural feature comprises the internal loop, and wherein the internal loop is a symmetric internal loop. 134. The method of any one of embodiments 129-133, wherein the structural feature comprises the internal loop, and wherein the internal loop is an asymmetric internal loop. 135. The method of any one of embodiments 129-134, wherein the structural feature comprises the hairpin, and wherein the hairpin is a recruitment hairpin or a non-recruitment hairpin. 136. The method of any one of embodiments 104-135, wherein the guide-target RNA scaffold comprises a Wobble base pair. 137. The method of any one of embodiments 104-136, wherein the editing enzyme comprises an ADAR, an APOBEC, or a Cas nuclease. 138. The method of embodiment 137, wherein the ADAR comprises AD ARI, ADAR2, or combinations thereof. 139. The method of any one of embodiments 103-138, wherein the target sequence comprises RNA or DNA. 140. The method of any one of embodiments 104-139, wherein editing the target sequence comprises deamidating a nucleotide of the target sequence. 141. The method of any one of embodiments 104-140, wherein the target sequence is edited with an efficiency of at least 10%, at least 20%, or at least 25%. 142. The method of any one of embodiments 103-141, wherein the target sequence is a non-coding RNA, an mRNA or a pre-mRNA. 143. The method of any one of embodiments 102-142, wherein the recombinant polynucleotide is delivered to the cell via a viral vector. 144. The method of embodiment 143, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentivector. 145. The method of embodiment 144, wherein the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof. 146. The method of any one of embodiments 102-145, wherein the recombinant polynucleotide is delivered to the cell via a non-viral vector.

EXAMPLES

[0373] The invention is further illustrated by the following non-limiting examples:

EXAMPLE 1

Identification of Motifs that Bind RNA Binding Proteins

[0374] This example describes identification of motifs that bind RNA binding proteins (RBPs). Nuclear RBPs and shuttling RBPs can facilitate transport of RNA payloads, such as guide RNAs, to the nucleus where stably expressed ADARs are present. A library of sequence motifs that bind nuclear RBPs or shuttling RBPs was generated to screen for protein-binding motifs that enhance stability of gRNAs and increase target editing via ADAR.

[0375] Nuclear RBPs and corresponding protein-binding motifs were identified from an ORNAment database. Twenty-one nuclear-specific RBPs were identified. FIG. 2A shows the number of unique protein-biding motifs for each of the 21 nuclear-specific RBPs of ESRP1, ESRP2, FUBP1, HNRNPAO, HNRNPCL1, KHDRBS3, NOVAI, PPRC1, RALY, RBM23, RBM47, RBM5, RBM6, RBMS2, SF1, SRSF8, and U2AF2. Logo plots illustrating the sequence preference for each of the 21 nuclear-specific RPBs identified from the ORNAment database are shown in FIG. 2B. [0376] Shuttling RBPs and corresponding protein-binding motifs were identified from an oRNAment database. Seventy-one RBPs present in the nucleus were identified. FIG. 3A shows the number of unique protein-biding motifs for each of the 71 nuclear RBPs of CELF1, CNOT4, CPEB1, CPEB2, CPEB4, DAZ3, ELAVL1, ESRP1, ESRP2, EWSR1, FUBP1, FUBP3, FUS, FXR2, HNRNPAO, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPC, HNRNPCL1, HNRNPD, HNRNPF, HNRNPH2, HNRNPK, HNRNPL, IGF2BP2, ILF2, KHDRBS3, LIN28A, MBNL1, MSI1, NOVAI, NUPL2, PABPC1, PABPC4, PABPN1, PCBP2, PPRC1, QK1, RALY, RALYL, RBFOX2, RBFOX3, RBM22, RBM23, RBM24, RBM3, RBM4, RBM42, RBM45, RBM47, RBM5, RBM6, RBM8A, RBMS1, RBMS2, SART3, SF1, SFPQ, SNRNP70, SRSF1, SRSF10, SRSF8, TAF15, TARDBP, TRA2A, TRNAU1AP, U2AF2, YBX2, and ZFP36. Logo plots illustrating the sequence preference for each of the 71 nuclear RPBs identified from the oRNAment database are shown in FIG. 3B.

[0377] A library of the identified nuclear protein-binding motifs was generated. The proteinbinding motif sequence library was screened to identify protein-binding sequences that enhance gRNA stability, nuclear localization, or editing efficiency, as described in EXAMPLE 3.

EXAMPLE 2

Identification of Exonuclease-Resistant RNA Structures

[0378] This example describes identification of exonuclease-resistant RNA structures.

Certain RNA sequence motifs can enhance stability of RNAs, such as gRNAs, by preventing degradation by 5’ exonucleases or 3’ exonucleases. A library of structural elements was generated from databases of RNA structural motifs, including G-quadruplexes, pseudoknots, tetraloop motifs and other structural motifs, to screen for structural elements that conferred exonuclease-resistance or enhanced stability to gRNAs. Approximately 900 unique structural motifs were screened in library format. The total library included evaluating each structural motif at either the 5’ end, the 3’ end, or the 5 ’end and the 3 ’end, as shown in FIG. 13. gRNAs were designed against a model target RNA. SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426 were selected for screening against a relevant target (SERPINA1, ABCA4, SNCA). Each of the constructs included a barcode inserted in between a first and second part of a guide sequence, as shown in FIG. 13. The first part of the guide sequence was either SEQ ID NO: 319 or SEQ ID NO: 321 and the second guide part of the guide sequence was SEQ ID NO: 320.

[0379] In a first screen, structural elements were screened using an in vitro transcribed (IVT) library. SEQ ID NO: 66, corresponding to an aptamer, SEQ ID NO: 67, corresponding to a pseudoknot, SEQ ID NO: 68, corresponding to a G-quadruplex, SEQ ID NO: 69, corresponding to a G-quadruplex, CCAAAUA (SEQ ID NO: 71), corresponding to a structural motif, SEQ ID NO: 73, corresponding to a G-quadruplex, SEQ ID NO: 74, corresponding to a stem-loop, SEQ ID NO: 77, corresponding to a G-quadruplex, SEQ ID NO: 83, corresponding to a pseudoknot, and SEQ ID NO: 89, corresponding to a G-quadruplex, were identified as sequence elements that enhanced gRNA stability or editing efficiency. As shown in FIG. 4, the structural element hits increased stability of a gRNA targeting SERPINA1 relative to a gRNA lacking a structural element (“no motif guide”). As shown in FIG. 5, the structural element hits increased stability of a gRNA targeting ABCA4 relative to a gRNA lacking a structural element (“no motif guide”). FIG. 6 shows the increase in guide levels for gRNAs containing a structural element hit for both SERPINA1 -targeting guides and ABCA4-targeting guides. The gRNAs with structural elements also facilitated increased on-target editing via ADAR relative to a gRNA lacking a structural element, as shown in FIG. 7. These results indicated that the identified structural elements functioned as exonuclease-resistant structures to enhance stability of gRNAs and facilitate increase target editing via ADAR.

[0380] In a second screen, structural elements were screened using a vector encoded library. Hits were identified that enhanced gRNA stability or editing efficiency. SEQ ID NO: 24, corresponding to a multi-loop, UGAAAAG (SEQ ID NO: 22), corresponding to a structural motif, CUAACG (SEQ ID NO: 19), corresponding to a structural motif, SEQ ID NO: 64, corresponding to two G-quadruplexes, SEQ ID NO: 21, corresponding to a stem-loop, SEQ ID NO: 56, corresponding to a small stem-loop, SEQ ID NO: 51, corresponding to two G- quadruplexes, SEQ ID NO: 40, corresponding to a stem-loop, SEQ ID NO: 20, corresponding to a small stem-loop, SEQ ID NO: 59, corresponding to a 3 -way junction, SEQ ID NO: 35, corresponding to a stem-loop, SEQ ID NO: 34, corresponding to a structural motif, SEQ ID NO: 63, corresponding to a structural motif, SEQ ID NO: 49, corresponding to a pseudoknot and stem-loop, SEQ ID NO: 38, corresponding to a stem-loop, SEQ ID NO: 47, corresponding to multiple stem-loops, CUGCGAAAG (SEQ ID NO: 48), corresponding to a G-quadruplex, and SEQ ID NO: 30, corresponding to a G-quadruplex, were identified as sequence elements that enhanced gRNA stability or editing efficiency. As shown in FIG. 8A, the structural element hits increased stability of a gRNA targeting SERPINA1 relative to a gRNA lacking a structural element (“no motif guide”). Select hits also increased editing efficiency of SERPINA1, as shown in FIG. 8B. FIG. 9 A shows the effect of the structural element hits on stability of a gRNA targeting ABCA4 relative to a gRNA lacking a structural element (“no motif guide”). Select hits increased editing efficiency of ABCA4, as shown in FIG. 9B. As shown in FIG. 10 A, select structural element hits increased stability of a gRNA targeting LRRK2 relative to a gRNA lacking a structural element (“no motif guide”). Select hits also increased editing efficiency of LRRK2, as shown in FIG. 10B. These results indicated that the identified structural elements functioned as exonuclease-resistant structures to enhance stability of certain gRNAs and facilitate increased target editing of certain targets via ADAR.

[0381] The exonuclease-resistant structures identified from screening the vector encoded library were further tested for a-synuclein (SNCA) 3’ untranslated region (UTR) editing by SNCA-targeted guide sequence (SEQ ID NO: 429;

GAUUGAAGCCACAAAAUCCACAGCACACAAAGACCCUGCCACCAUGUAUUCACUU CAGUGAAAGGGAAGCACCGAAAUGC). Payload sequences including an SNCA-targeted guide sequence and an exonuclease-resistant element of one of SEQ ID NO: 19 - SEQ ID NO: 65, SEQ ID NO: 425, or SEQ ID NO: 426 were tested for editing activity. Payload sequences were introduced by either transient transfection (FIG. 14) or single copy selection (FIG. 15). Editing was compared to payloads lacking an exonuclease-resistant structure (“No motif’). The effect of exonuclease-resistant elements of SEQ ID NO: 19 - SEQ ID NO: 65 on SNCA 3’ UTR editing efficiency was further evaluated in FIG. 15. As shown in FIG. 15, payloads were expressed under control of either a mouse U7 promoter (shaded bars) or a human U 1 promoter (white bars).

[0382] The effect of select exonuclease-resistant structure elements of UGAAAAG (SEQ ID

NO: 22), SEQ ID NO: 35, SEQ ID NO: 36, and UGAAAG (SEQ ID NO: 57) on SNCA 3’ UTR editing efficiency compared to payloads with no exonuclease-resistant structure element (“no motif’) was further evaluated in FIG. 16A - FIG. 16C. Payloads were expressed under control of either a mouse U7 promoter (shaded bars) or a human U1 promoter (white bars). Replicates shown in FIG. 16A and FIG. 16B were expressed under control of a human U1 promoter (white bars) and were also compared to a payload without an exonuclease-resistant element under control of a mouse U7 promoter (shaded bar). As shown in FIG. 16C, payloads were expressed under control of a mouse U7 promoter (shaded bars).

[0383] The predicted secondary structure formed upon binding of a gRNA containing the identified exonuclease-resistant structure of SEQ ID NO: 21, predicted to form a stem-loop, and an SmOPT hairpin (SEQ ID NO: 7) to a target sequence of SERPINA1, LRRK2, or ABCA4 is illustrated in FIG. 11. The gRNA targeting SERPINA1 with the stem-loop (DNA: TAGACATGGGTATGGGGCAGTATTCCCATGGCCCCAGCAGCTTCAGTCCTTACTCGT CGATGGTCATAAGTTCCTTATGCACGGC (SEQ ID NO: 430); RNA: UAGACAUGGGUAUGGGGCAGUAUUCCCAUGGCCCCAGCAGCUUCAGUCCUUACU CGUCGAUGGUCAUAAGUUCCUUAUGCACGGC (SEQ ID NO: 431)) is predicted to have a Gibbs free energy (AG) of -31.8. kcal/mol. The gRNA targeting LRRK2 with the stem-loop (DNA: AAACCCTGGTGTGCCCTCTGTCCAAATTATCCCCATTCTACATCTGTAGTGAGCAAT TCCGTGCTCAGCTCAGAATGCAATGATGGCAGCATTGGGATAC (SEQ ID NO: 432); RNA: AAACCCUGGUGUGCCCUCUGUCCAAAUUAUCCCCAUUCUACAUCUGUAGUGAGCA AUUCCGUGCUCAGCUCAGAAUGCAAUGAUGGCAGCAUUGGGAUAC (SEQ ID NO: 433)) is predicted to have a AG of -32.01. kcal/mol. The gRNA targeting ABCA4 with the stem-loop (DNA: TGTGGTTGTTTTGCCGGCACCATAGTGAGCCAGGAGTAAAAAGCACTCTCCAGTGA GAACTCGGACACACAGCCTGAGTGAGCTGGGCTGGA (SEQ ID NO: 434); RNA: UGUGGUUGUUUUGCCGGCACCAUAGUGAGCCAGGAGUAAAAAGCACUCUCCAGU GAGAACUCGGACACACAGCCUGAGUGAGCUGGGCUGGA (SEQ ID NO: 435)) is predicted to have a AG of -40.04. kcal/mol.

EXAMPLE 3

High-Throughput Screen for RBP-Binding Motifs that Enhance Target Editing via ADAR [0384] This example describes a high-throughput screen to identify RNA-binding proteinbinding motifs (RBP-binding motifs) that enhance target editing via ADAR facilitated by polynucleotides encoding a guide RNA, by affecting localization. A library of about 16,000 RBP-binding motif sequences to be screened was generated. The library included sequences identified from RBP-binding motif databases, such as oRNAment, identified as described in EXAMPLE 1. Sequences were selected for diversity to include motifs that bind to different RBPs. Sequences contained identified RBP-binding 6-mer motifs of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424), identified as described in EXAMPLE 1, or RBP-binding motifs identified from physiological motifs. RBP-binding motifs were combined in an RBP-binding construct, such as by combining multiple 6-mer RBP-binding motifs of AACUGC, AAUAUU, AAUUUU, ACAAAC, ACACAG, ACCACA, ACUAAG, AGACAA, AGCAGA, AGCUUU, AUACUA, AUCCCU, AUGUCA, CAACCA, CAAGCA, CACCAG, CAGAAC, CAGCAA, CAGUUA, CAUCUA, CCAACC, CCACCG, CCAUCC, CCCGCC, CGCCCA, CGCGGA, CGCGGC, CGCUGC, CGUAUC, CGUCUC, CGUGCC, CGUGGG, CUAAUC, CUACCC, CUACUA, CUCCCG, CUGACA, CUGCGC, CUUAGA, CUUAUC, CUUUUG, GAAAAU, GAAAGC, GAGGAA, GAGGAU, GAGGGA, GAUCUG, GAUGUG, GCAAGC, GCAGCA, GCAGGC, GCAUGA, GCGCCC, GCGCGG, GCGGGC, GCUUGC, GGAGCA, GGAGGA, GGAGUG, GGAUGG, GGAUGU, GGCAUG, GGGAUG, GGGCAG, GGGGUU, GGUGGU, GGUUUU, GUAAGA, GUAAUA, GUAUGA, GUGGUG, GUUAAG, UAAUUU, UACAUU, UACUCA, UAUCAA, UAUCUG, UAUGUA, UAUUGU, UCCACC, UCCCUG, UCCUCA, UCCUCU, UGAAGA, UGAUAG, UGAUUU, UGGUGC, UGUCUG, UGUGUG, UGUUGA, UGUUUC, UUCAAG, UUCAGA, UUCCGA, UUCUCC, UUCUGU, UUGAAU, UUGUGA, UUGUUC, UUUAAC, UUUAAG, UUUAUA, and/or UUUUAC (SEQ ID NO: 322 - SEQ ID NO: 424), as shown in FIG. 12 (“Rational Design #1”). Examples of constructs generated by combining three 6-mer motifs include SEQ ID NO: 182, and SEQ ID NO: 210 - SEQ ID NO: 231. Alternatively, RBP-binding motifs were inserted into a secondary structure, such as a stem-loop, as shown in FIG. 12 (“Rational Design #2”). Examples of constructs generated by inserting a 6-mer motif into a secondary structure include SEQ ID NO: 183 - SEQ ID NO: 185 and SEQ ID NO: 232 - SEQ ID NO: 261. Additionally, the RBP-binding motifs were identified from physiological motifs using an eCLIP analysis, as shown in FIG 12 (“physiological motifs”). Examples of constructs identified from physiological motifs include SEQ ID NO: 186 - SEQ ID NO: 209 and SEQ ID NO: 262 - SEQ ID NO: 317. RBP-binding motif constructs were expressed at single copy levels in a HEK293 line expressing a non-fluorescent GFP-G67R reporter. The RBP- binding motif constructs encoded a guide RNA payload (DNA: GCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTGTACACGTCGGGGTAGC GGCTGAAGCACTGCACTCCGTAGGAGTCCCTCGTCACGAGGGTC, SEQ ID NO: 438; RNA: GCCUUCGGGCAUGGCGGACUUGAAGAAGUCGUGCUGCUUGUACACGUCGGGGUA GCGGCUGAAGCACUGCACUCCGUAGGAGUCCCUCGUCACGAGGGUC, SEQ ID NO: 318) that facilitates ADAR editing of the GFP-G67R reporter via deamination. ADAR editing facilitated by constructs with RBP-binding sequences at either 3 ’ or 5 ’ of the guide sequence, as shown in FIG. 12, was tested. Constructs containing an RBP-binding sequences of SEQ ID NO: 91 - SEQ ID NO: 185 at the 3’ end of the guide sequence were tested. Additionally, constructs containing an RBP-binding sequences of SEQ ID NO: 182 - SEQ ID NO: 317 at the 5’ end of the guide sequence were tested. Deamination of the 67 ^th codon of the reporter facilitated by the guide RNA payload reverts “AGA” to “GGA”, corresponding to an Arg to Gly amino acid change, and recovers GFP fluorescence. Fluorescence was positively correlated with editing of the target adenosine. The RBP-binding motifs were screened with one guide RNA payload, SEQ ID NO: 318, a 100.75 guide with -6 and +30 barbells.

[0385] The RBP-binding sequences shown below in TABLE 8 were selected for singleplex testing along with the negative controls of SEQ ID NO: 859 (GAAUCCGGGAAGGUGCCAGGGGACGCUGAUUCCCUCCUGGGAUAGCCAUGUGG), SEQ ID NO: 860 (CAUUAUAGGAAAUAAAGAGUGUUAGUAAAAUCCAUAAUGCUUUCUG), SEQ ID NO: 861 (CAAAUGGCAAGAACACUCAUUCCCCCUCAGCCCAGGAAGAGCAAGA), SEQ ID NO: 862 (GGAAUUGGUAAUUAAAGCCAAGGGGCUGGAUGAUGAUACCUAGGGA), SEQ ID NO: 863 (UUGAGCAGGCUCCCACGGCAGCCACCCCUUCCCAGCCCCCCAUGCC), SEQ ID NO: 864 (CCCUUGGAUCCCCUUGGAUCCCCUUG), SEQ ID NO: 865

(GAAUCCGGGAAGGUGCCAGGCUGCUCUGAUUCCCUCCUGGGAUAGCCAUGUGG), SEQ ID NO: 866 (GAAUUUGAUCGAAUUUGAUCGAAUUU), and SEQ ID NO: 867 (GAAUCCGGGAAGGUGCCAGUCUUGCCUGAUUCCCUCCUGGGAUAGCCAUGUGG) (6-mer motifs shown in bold underline). A gRNA not linked to any RBP-binding sequence was also used as a negative control (“no motif control").

TABLE 8 - RBP-binding Sequences Selected for Singleplex Testing

[0386] RBP-binding sequences from TABLE 8 were cloned and operably linked to a model guide RNA (SEQ ID NO: 318). Constructs were transfected into an HEK293 cell line via single copy integration, where the cells expressed a GFP-G67R reporter. This reporter system is a broken GFP reporter system that can be used to assess RNA editing. Successful editing of GFP by a guide RNA results in correction of the mutation in the GFP-G67R gene, resulting in restoration of wild type GFP and a corresponding increase in fluorescence that can be visualized and quantitated. Single copy integrated cells were enriched via puromycin selection.

[0387] Cells were analyzed by flow cytometry to evaluate the increase in GFP intensity as a phenotypic readout of RNA editing (FIG. 17A). A no motif guide was used as a control. Total RNA was also isolated from the same samples and percent editing of GFP was quantitated via Sanger sequencing (FIG. 17B).

[0388] Multiple RBP-binding sequences enhanced both GFP intensity and editing, as compared to no motif control (FIG. 17C). These candidates were selected for testing in context of disease relevant targets.

EXAMPLE 4

Target Editing via ADAR facilitated by RNA Constructs with RNA Accessory Elements [0389] This example describes the testing of ADAR-mediated target RNA editing facilitated by RNA constructs with guide RNAs operationally linked to RNA accessory elements including localization elements (e.g., RBP-binding elements) and stability elements. RBP-binding elements, including binding elements for NOVAI (SEQ ID NO: 100 and SEQ ID NO: 132), RBM5 (SEQ ID NO: 142), EWSR1 (SEQ ID NO: 161), hnRNPAB (SEQ ID NO: 219), CELF1 (SEQ ID NO: 867), FUBP3 (SEQ ID NO: 303), TARDBP (SEQ ID NO: 167), PPRC1 and RBM8A (SEQ ID NO: 255), FUS and RBM4 (SEQ ID NO: 242), and an RBP-binding motif of SEQ ID NO: 306, were tested for enhancement of target RNA editing via ADAR. HEK293 LP2.0 cells, were transfected with plasmids containing the RNA constructs followed by a 13 day selection to ensure incorporation into the genome to achieve single integration. Stability motifs, including tetraloop motifs CUAACG (SEQ ID NO: 19), UGAAAAG (SEQ ID NO: 22), SEQ ID NO: 36, UGAUAUGGU (SEQ ID NO: 42), UUAAAUA (SEQ ID NO: 425), and UGAAAG (SEQ ID NO: 57) and a stem-loop motif (SEQ ID NO: 35), were also tested for enhancement of target RNA editing via ADAR. Said target RNA editing was compared to target RNA editing via ADAR facilitated by RNA constructs with no motifs present for a control (e.g. , no motif controls in FIG. 18 - FIG. 20), scrambled RBP-binding motifs (e.g., “Scrambled RBP-binding motif’ in FIG. 18), and scrambled stability elements (e.g., “Scrambled stability element” in FIG. 18). As shown in FIG. 18, RNA constructs comprising stability elements including UGAUAUGGU (SEQ ID NO: 42), SEQ ID NO: 36, UGAAAG (SEQ ID NO: 57), UGAAAAG (SEQ ID NO: 22), and CUAACG (SEQ ID NO: 19) enhanced editing of an exemplary target RNA, MAPT, when compared to a no motif control (dashed line). UGAUAUGGU (SEQ ID NO: 42), SEQ ID NO: 36, UGAAAG (SEQ ID NO: 57), UGAAAAG (SEQ ID NO: 22), and CUAACG (SEQ ID NO: 19) are each tetraloop motifs and were attached on the 3’ end of the MAPT targeting sequence. Similarly, as seen in FIG. 19B, RNA constructs comprising SEQ ID NO: 36, UGAAAG (SEQ ID NO: 57), UGAAAAG (SEQ ID NO: 22), CUAACG (SEQ ID NO: 19), and UGAUAUGGU (SEQ ID NO: 42) facilitated greater editing of another exemplary target RNA, SNCA, with two guide RNAs (Guide RNA 1 and Guide RNA 2) than editing observed with RNA constructs comprising no motif (“no motif’ controls) and RNA constructs comprising a guide RNA with two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA (“hnRNPAl Double”) and a guide RNA with two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA with 1 copy of a RBP-binding element (UUGUGAGAUCUUGUGAGAUCUUGUGA; SEQ ID NO: 100) at the 3’ end (“hnRNPAl Double with SEQ ID NO: 100”), as shown in FIG. 19A. Also shown in FIG. 20, UGAUAUGGU (SEQ ID NO: 42), CUAACG (SEQ ID NO: 19), SEQ ID NO: 36, UGAAAG (SEQ ID NO: 57), and UGAAAAG (SEQ ID NO: 22) all facilitated increased editing of an exemplary target RNA, SNCA, relative to the no motif control and increased editing compared to RNA constructs comprising a guide RNA with two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA (“hnRNPAl Double”) and a guide RNA with two copies of the hnRNPAl (SEQ ID NO: 428) at the 5 ’end of the guide RNA with 1 copy of a RBP-binding element (UUGUGAGAUCUUGUGAGAUCUUGUGA; SEQ ID NO: 100) at the 3’ end (“hnRNPAl Double with SEQ ID NO: 100”).

EXAMPLE 5

Treatment of Parkinson’s Disease using a LRRK2-Tar eting Engineered Guide RNA Expression Construct

[0390] This example describes treatment of Parkinson’s disease in a subject using a LRRK2- targeting engineered guide RNA expression construct. The subject has a mutation in LRRK2 associated with Parkinson’s disease (e.g., a mutation that results in a G2019S substitution). A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to LRRK2 is delivered to a cell of the subject. The small RNA payload further comprises an exonuclease-resistant structure, an RBP-binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The LRRK2-targeting guide RNA is expressed in a cell of the subject having a mutant LRRK2. The expressed engineered guide RNA hybridizes to the mutant LRRK2 RNA in the cell and recruits ADAR editing enzyme to the mutant LRRK2 RNA. The ADAR enzyme edits the mutant LRRK2 RNA and corrects a mutation in the LRRK2 RNA associated with Parkinson’s disease, thereby treating the Parkinson’s disease.

EXAMPLE 6

Treatment of Muscular Dystrophy using a DUX4-Tar eting Engineered Guide RNA Expression Construct

[0391] This example describes treatment of muscular dystrophy in a subject using a DUX4- targeting engineered guide RNA expression construct. The muscular dystrophy is Facioscapulohumeral Muscular Dystrophy (FSHD). A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to DUX4 is delivered to a cell of the subject. The guide RNA targets the polyA tail of DUX4 and is engineered to edit one or more adenosines in the polyA tail. The small RNA payload further comprises an exonuclease-resistant structure, an RBP-binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The DUX4-targeting guide RNA is expressed in a cell of the subject having a mutant DUX4. The expressed engineered guide RNA hybridizes to the DUX4 RNA in the cell and recruits ADAR editing enzyme to the DUX4 RNA. The ADAR enzyme edits the DUX4 RNA and knocks down DUX4 protein, thereby treating the FSHD.

EXAMPLE 7

Treatment of a Synucleinopathy using a SNCA-Targeting Engineered Guide RNA Expression Construct

[0392] This example describes treatment of a synucleinopathy, such as Parkinson’s disease or

Lewy body dementia, in a subject using a SNC A- targeting engineered guide RNA expression construct. A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to SNC A is delivered to a cell of the subject. The guide RNA targets a translation initiation site or “TIS” sequence (AUG) in SNCA and is engineered to edit an adenosine in the TIS, thereby decreasing alpha-synuclein protein levels. The small RNA payload further comprises an exonuclease-resistant structure, an RBP-binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The SNCA -targeting guide RNA is expressed in a cell of the subject having a mutant SNCA. The expressed engineered guide RNA hybridizes to the mutant SNCA RNA in the cell and recruits ADAR editing enzyme to the mutant SNCA RNA. The ADAR enzyme edits the mutant SNCA RNA and corrects a mutation in the SNCA RNA associated with the synucleinopathy, thereby treating the synucleinopathy.

EXAMPLE 8

Treatment of Frontotemporal Dementia using a GRN-Targeting Engineered Guide RNA Expression Construct

[0393] This example describes treatment of frontotemporal dementia in a subject using a GRN-targeting engineered guide RNA expression construct. A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to GRN is delivered to a cell of the subject. The guide RNA targets a repressive TIS in GRN and is engineered to edit an adenosine in the repressive TIS, thereby increasing progranulin protein levels. The small RNA payload further comprises an exonuclease-resistant structure, an RBP- binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The GRN-targeting guide RNA is expressed in a cell of the subject having a mutant GRN. The expressed engineered guide RNA hybridizes to the mutant GRN RNA in the cell and recruits ADAR editing enzyme to the mutant GRN RNA. The ADAR enzyme edits the mutant GRN RNA and corrects a mutation in the GRN RNA associated with frontotemporal dementia, thereby treating the frontotemporal dementia.

EXAMPLE 9

Treatment of a Tauopathy using a MAPT-Targeting Engineered Guide RNA Expression Construct

[0394] This example describes treatment of a tauopathy, such as Alzheimer’s disease frontotemporal dementia, Parkinson’s disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy, in a subject using a MAPT-targeting engineered guide RNA expression construct. A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to MAPT is delivered to a cell of the subject. The guide RNA targets a TIS in MAPT and is engineered to edit an adenosine in the TIS, thereby decreasing Tau protein levels. The small RNA payload further comprises an exonuclease-resistant structure, an RBP-binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424).The MAPT -targeting guide RNA is expressed in a cell of the subject having a mutant MAPT. The expressed engineered guide RNA hybridizes to the mutant MAPT RNA in the cell and recruits ADAR editing enzyme to the mutant MAPT RNA. The ADAR enzyme edits the mutant MAPT RNA and corrects a mutation in the MAPT RNA associated with the tauopathy, thereby treating the tauopathy.

EXAMPLE 10

Treatment of Alpha-1 Antitrypsin Deficiency using a SERPINAl-Targeting Engineered Guide RNA Expression Construct

[0395] This example describes treatment of alpha- 1 antitrypsin deficiency in a subject using a

SERPINA1 -targeting engineered guide RNA expression construct. The subject has a mutation in SERPINA1 (e.g., a mutation that results in an E342K substitution) associated with alpha-1 antitrypsin deficiency. A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to SERPINA1 is delivered to a cell of the subject. The small RNA payload further comprises an exonuclease-resistant structure, an RBP- binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The SERPINA1 -targeting guide RNA is expressed in a cell of the subject having a mutant SERPINA1. The expressed engineered guide RNA hybridizes to the mutant SERPINA1 RNA in the cell and recruits ADAR editing enzyme to the mutant SERPINA1 RNA. The ADAR enzyme edits the mutant SERPINA1 RNA and corrects a mutation in the SERPINA1 RNA associated with alpha-1 antitrypsin deficiency, thereby treating the alpha-1 antitrypsin deficiency.

EXAMPLE 11

Treatment of Alzheimer’s Disease using an APP-Targeting Engineered Guide RNA Expression Construct

[0396] This example describes treatment of Alzheimer’s disease in a subject using an APP- targeting engineered guide RNA expression construct. A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to APP is delivered to a cell of the subject. The guide RNA targets a secretase cleavage site in the APP RNA transcript and is engineered to edit one or more adenosines in the secretase cleavage site, thereby reducing secretase cleavage of the transcript and the resulting APP cleavage products that may form amyloid plaques. The small RNA payload further comprises an exonuclease-resistant structure, an RBP-binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP- binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The APP-targeting guide RNA is expressed in a cell of the subject having a mutant APP. The expressed engineered guide RNA hybridizes to the mutant APP RNA in the cell and recruits ADAR editing enzyme to the mutant APP RNA. The ADAR enzyme edits the mutant APP RNA and corrects a mutation in the APP RNA associated with Alzheimer’s disease, thereby treating the Alzheimer’s disease. EXAMPLE 12

Treatment of Stargardt Disease using an ABCA4-Targeting Engineered Guide RNA Expression Construct

[0397] This example describes treatment of Stargardt disease in a subject using an ABC Ad- targeting engineered guide RNA expression construct. The subject has a mutation in ABCA4 (e.g., a mutation that results in a G1961E substitution) associated with Stargardt disease. A recombinant polynucleotide encoding a small RNA payload comprising an engineered guide RNA that hybridizes to ABCA4 is delivered to a cell of the subject. The small RNA payload further comprises an exonuclease-resistant structure, an RBP-binding sequence, or both. The exonuclease-resistant structure has a sequence of SEQ ID NO: 8 - SEQ ID NO: 90, SEQ ID NO: 425, or SEQ ID NO: 426. Optionally, the exonuclease-resistant structure has a sequence of SEQ ID NO: 42, SEQ ID NO: 36, SEQ ID NO: 57, SEQ ID NO: 22, SEQ ID NO: 19, SEQ ID NO: 425, or SEQ ID NO: 35. The RBP-binding sequence has a sequence of SEQ ID NO: 91 - SEQ ID NO: 317 or SEQ ID NO: 322 - SEQ ID NO: 424. Optionally, the RBP-binding sequence comprises AACUGC (SEQ ID NO: 322), CAACCA (SEQ ID NO: 335), CCAACC (SEQ ID NO: 342), CCAUCC (SEQ ID NO: 344), CGUGCC (SEQ ID NO: 352), CUGACA (SEQ ID NO: 358), GCAGCA (SEQ ID NO: 371), GCAGGC (SEQ ID NO: 372), GCGCGG (SEQ ID NO: 375), GCUUGC (SEQ ID NO: 377), GGAUGU (SEQ ID NO: 382), UAAUUU (SEQ ID NO: 394), UAUCAA (SEQ ID NO: 397), UCCCUG (SEQ ID NO: 402), UUCUGU (SEQ ID NO: 417), UUGUGA (SEQ ID NO: 419), or UUUUAC (SEQ ID NO: 424). The ABCA4-targeting guide RNA is expressed in a cell of the subject having a mutant ABCA4. The expressed engineered guide RNA hybridizes to the mutant ABCA4 RNA in the cell and recruits ADAR editing enzyme to the mutant ABCA4 RNA. The ADAR enzyme edits the mutant ABCA4 RNA and corrects a mutation in the ABCA4 RNA associated with Stargardt disease, thereby treating the Stargardt disease.

[0398] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.