Estrogens affect the development and function of a wide range of mammalian systems including reproductive, cardiovascular, liver, brain and bone tissues [1,2]. The majority of these actions are mediated through two estrogen receptor (ER) subtypes, ER alpha and ER beta, both of which act predominantly as ligand dependent transcription factors although ligand independent functions are coming to light [1]. Classically, these nuclear transcription factors mediate the actions of estrogen by binding directly to DNA response elements associated with target genes thereby up or down regulating expression in a cell and promoter specific context. The actions of these receptors are further modulated by an array of positive and negative acting co- regulators [3].

Disruption to the normal activities of estrogen, or its receptors, can result in considerable pathology in many disparate tissues. The effects of such disruption also varies according to the nature or type of the tissue. For example, it is known that reduced estrogen levels are associated with the development of osteoporosis, and that overactivity of this system may promote breast carcinoma. In view of the high incidence of these conditions, and the broad actions of estrogen, considerable interest has focussed on the development and activities of Selective Estrogen Receptor Modulators (SERMs) that specifically mimic or antagonise the actions of estrogen in discrete tissues.

Studies of ER have shown it adopts distinct conformations in the presence or absence of ligand [4], and that individual SERMs can induce ligand specific conformers [5,6]. It is postulated that by altering the structure of the ER in this manner, distinct subsets of co-factors are able to interact with the receptor thereby modulating its activities and mediating the tissue specificity of individual estrogen like compounds [7]. Elucidating these interactions is fundamental to furthering the understanding of SERM activity and for the development of pharmaceutical agents.

The present inventors have sought to identify factors which are involved in the responses of differing tissues treated with estrogen using subtractive hybridisation experiments observed in mice [8]. In the present invention, the inventors have been particularly concerned with the use of the marked osteogenic response to estrogen in bone tissue. This response is exploited for the treatment of bone disorders and particularly for the treatment of bone density disorders such as osteoporosis.

It is therefore an object of the present invention to provide a compound which modulates estrogen-induced transcription, thereby modifying cell metabolism.

In this respect, the present inventors have prepared a clone which codes for a novel protein containing a SAP/SAF Box DNA binding motif [9,10] and an RNA binding domain [11].

The sequence of this protein was found to show similarity with Heat shock protein 27-ERE-TATA box binding protein (HET) [12], also known as Scaffold Attachment Factor B (SAF-B) [13] and heterogeneous nuclear ribonuclear protein A1 associated protein (HAP) [14], hereinafter referred to as HET. While this molecule was originally identified due to its ability to bind Scaffold/Matrix Attachment Regions (S/MARs) of genomic DNA [13], the present inventors have recognised its ability to suppress estrogen receptor function [15] and therefore its use in such suppression. The inventors have found that the sequence they have isolated is a novel nuclear factor that acts as a modulator of estrogen induced transcription, which for the purposes of the following description will be referred to as MET.

Within the MET molecule the present inventors have identified a'number of putative functional domains which share some homology (up to one third) with previously described proteins. These shared domains include a SAF Box, RNA binding domain and region rich in glutamin and arginine residues. Data which suggest that MET acts as a suppressor of estrogen induced gene transcription include i) sequence analysis revealed significant homology with HET, a known suppressor of estrogen transcription [15]; ii) MET localises to the nucleus ; and iii) co-transfection studies demonstrate that MET inhibits estrogen induced stimulation of ERE-luciferase reporter gene expression in a similar manner to that observed for HET. However, MET has been shown not to bind to the estrogen receptor.

The putative functional domains identified in MET provide an insight as to how this molecule suppresses estrogen induced transcription. Within the amino terminus of MET resides a SAF Box [9,10]. This motif, present in DNA binding proteins from yeast through to mammalian species, has been demonstrated to bind genomic DNA at S/MARs [10]. Such domains are present throughout eukaryotic genomes but are frequently associated with transcription and chromatin regulatory domains [33, 34]. Scaffold attachment factors such as SAF- A [35] and HET [13], are proposed to form an integral part of the nuclear matrix, binding both S/MARs and RNA while interacting with the cell's transcriptional machinery [33]. The presence of a SAF Box and RNA binding domains in MET, along with its demonstrated nuclear distribution, support this novel factor acting as a transcription factor in a similar manner to other SAFs.

Without wishing to be bound by theory, the present inventors concluded that the presence of a DNA binding domain in MET raised the possibility it could suppress estrogen induced transcription by competing with the estrogen receptor for Estrogen Response Element (ERE) binding sites [36].

Accordingly, the present invention provides a modulator of estrogen induced transcription comprising a nucleic acid fragment selected from (a) an isolated nucleic acid fragment which encodes a protein containing a SAF Box DNA binding motif and an RNA binding domain; (b) an isolated nucleic acid fragment which hybridises to the isolated nucleic acid fragment of (a) above and which encodes a protein containing a SAF Box DNA binding motif and an RNA binding domain; (c) an isolated nucleic acid fragment differing from fragments of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a protein containing a SAF Box DNA binding motif and an RNA binding domain, which nucleic acid fragment does not bind to the estrogen receptor.

Such a mechanism has been described for the simian ERE-Binding Protein which has an affinity for both classical and ERE half-sites [37]. A half-site is herein defined as a sequence which has half the sequence of a classical estrogen response element. Such sites are commonly found and unless they are present as multiple half-sites in close proximity to one another or next to an Sp1 site they have little or no significance. Binding of HET or other SAF Box proteins to canonical estrogen response elements has not been demonstrated.

Studies have demonstrated that HET binds the DNA binding and hinge regions of the receptor, however, this does not appear to interfere with its binding EREs [15].

As both MET and HET contain SAF Boxes, and suppress estrogen induced transcription, their DNA binding specificities have been compared. HET has already been demonstrated to bind the HSP-27 promoter [12] and S/MAR elements from diverse eukaryotic species [13]. Other target sequences are yet to be reported however both MET and HET [14] have been shown to have a punctuate, nuclear distribution suggesting numerous interactions with the genome. It is notable that the original HET clone found to bind the HSP-27 promoter was only homologous to residues 210-375 of the published HET molecule [12]. This domain does not include a SAF Box. Also, rat SAF-B does not contain a SAF Box, but can specifically bind S/MAR DNA in gel retardation experiments suggesting a second DNA binding domain in this protein [25]. As MET and HET share marked homology (one third equality) throughout their length it is possible that both molecules may interact with DNA through two separate domains. Deletion experiments will be required to investigate this possibility. However, it is reiterated that MET and HET are different proteins with different binding and activity profiles.

For example, as has been mentioned above, HET binds to the estrogen receptor whereas MET does not. Additionally, MET stimulates the estrogen receptor in bone cells whereas HET does not. Hence, despite their similarity at a sequence level HET and MET show different activities within cells which highlights the fact that they are indeed different proteins.

As mentioned above, the present invention provides a modulator of estrogen induced transcription as hereinbefore defined.

In another aspect the present invention further provides a pharmaceutical composition comprising a therapeutical effective amount of the modulator of estrogen induced transcription of the invention. The pharmaceutical composition may also comprise binders, excipients, vehicles, adjuvants and other additives commonly used in formulation chemistry. The composition may be administered to the patient orally, parenterally, nasally, rectally, intravenously, subcutaneously, or by any other delivery method common in the art.

In a preferred embodiment of the invention the nucleic acid fragment is an isolated DNA molecule. More preferably, the nucleic acid fragment is a DNA molecule according to the sequence shown in Figure 1 or Figure 2. The term nucleic acid as used herein is intended to encompass polymorphisms, deletion mutations, substitution mutations, or insertion mutations thereof, fragments and homologues provided that the encode or otherwise provide the same function of the nucleic acid.

The present invention also provides the protein encoded by the above- mentioned nucleic acid fragments. That is, the present invention also provides an isolated protein containing an SAF box DNA binding motif and an RNA binding domain which is coded for by the above described nucleic acids of the invention.

The invention further provides the use of the above-mentioned protein in the modulation of estrogen induced transcription without binding to the estrogen receptor.

Therefore the present invention further provides a pharmaceutical composition comprising a therapeutical effective amount of the estrogen transcription modulator protein of the present invention.

The term protein as used herein is intended to refer to not only the nascent protein encoded by the nucleic acid sequence, but also to the secondary and tertiary forms of the protein and hence includes glycosylation, hydroxylation, sulfation and alkylation products thereof.

The present inventors have isolated and sequenced a novel DNA sequence, which is referred to herein as MET, which suppresses the actions of estrogen in some tissues, such as breast cancer cells. However, in contrast to its actions in breast cancer cells, MET increases the activation of an estrogen response element in bone cells (see Figure 8). Hence formulations containing MET are usable in therapies for bone disorders such as bone density disorders, for example osteoporosis, and in general for the stimulation of bone formation, for example to promote the growth of new bone accommodate a replacement hip joint.

In another aspect, the present invention provides the use of an estrogen transcription modulator compound, as hereindefined, for use in the modulation of estrogen response in a tissue sensitive to estrogen activity. Preferably, the tissue sensitive to estrogen activity is bone tissue.

Accordingly, the present invention also provides the use of an estrogen transcription modulator compound, as hereindefined, in the preparation of a medicament for the treatment or prophylaxis of bone disorders. Examples of bone disorders include fibrous dysplasia, Legg-Calve-Perthes disease (LCPD), myeloma, osteogenesis imperfecta, osteomyelitis, osteopenia, osteoporosis, Paget's disease and scoliosis.

Preferably, the bone disorder to be treated by the present invention is a bone density disorder. More preferably, the bone disorder is osteoporosis.

The invention further provides the use of an estrogen transcription modulator compound in the preparation of a medicament for the treatment or prophylaxis of hormone dysfunction.

Additionally, a method of diagnosing, bone disorders and hormone dysfunction is provided, the method comprising analysing an ex vivo sample for the presence of the above described MET nucleic acid sequence or the protein encoded thereby, together with polymorphisms, deletion mutations, substitution mutations, or insertion mutations thereof.

In a further aspect, the present invention also provides a method of screening compounds for estrogen induced modulation activity, the method comprising the steps of introducing a compound to the nucleic acid or its reverse complement or to the protein of the present invention and identifying any interactions therebetween. The term interaction as used herein is intended to include hybridisation, upregulation, downregulation, stimulation, transcription, translation, stasis, denaturation, binding, agonism, antagonism, competition, induction of conformational changes, activation or deactivation or other associations and interactions apparent to the person skilled in the art.

The method may be used with a library of known compounds or for the assessment of new compounds. The method may be used in the form of a multi-well plate or a so-called"smart-chip"for use in automated assay and screening techniques.

Compounds identified by such screens are usable in pharmaceutical compositions for the treatment or prophylaxis of diseases where estrogen activity is altered or in estrogen responsive or sensitive tissues. The present invention therefore also provides a pharmaceutical composition for the treatment or prophylaxis of a disease where estrogen activity is altered or in estrogen responsive or sensitive tissues, which composition comprises a compound identified by the above-mentioned screening method.

A method of treating or preventing bone diseases and hormone dysfunction in an animal in need of such treatment is also provided by the present invention.

Preferably, the animal is a mammal, more preferably the animal is a human.

Embodiments of the invention will now be described, by way of example only, with reference to the appended drawings of which : - Figure 1 shows the sequence of mouse MET; Figure 2 shows the alignment of the sequences of mouse MET, human MET an human HET; Figure 3 is a photograph showing the amplification of mouse MET cDNA from bone marrow mRNA ; Figure 4 shows the RNA binding and SAP/SAF Box domains of MET; Figure 5 is a photograph of gel showing translation of EYFP-MET; Figure 6 is a series of photographs showing the cellular localisation of MET; Figure 7 is a histogram showing inhibition of estrogen reporter activity by MET; Figure 8 is a histogram showing the potentiation of estrogen response element reporter activation by MET in bone cells, and Figure 9 is a photograph of a Northern analysis blot of MET and GAPDH.

Examples Animals CBA mice (8-12 weeks old) were obtained from the University of Bristol Medical School breeding colony. Groups of 10 animals were injected with 17p- estradiol (E2) dissolved in corn oil (Sigma) as a single subcutaneous injection at 5001lg/animal, or vehicle alone. Four days following injection, animals were killed by cervical dislocation and their tibiae removed for further analysis.

Throughout these experiments, mice received a standard diet (Rat and Mouse Standard Diet; B & K) and water ad libitum and were kept on a 12: 12-h light- dark cycle. All experimental procedures complied with the guiding principles in the Care and Use of Laboratory Animals.

Preparation of mRNA and Northern Analysis To isolate bone marrow tissue, tibiae were initially cleaned of all associated tissue and their epiphyses removed. A 25G needle was then used to repeatedly flush the marrow space with 1mL of PBS until the bone appeared blanched.

Total and poly A+ RNA were subsequently prepared from the isolated tissue using TRlzol LS reagent (GibcoBRL) and PolyAtract mRNA Isolation (Promega, WI, USA) systems as per manufacturers specifications. Following denaturing gel electrophoresis RNA samples were transferred to Hybond N membrane (Amersham Pharmacia Biotech) for Northern analysis : DNA fragments were labelled by Random primers DNA labelling Kit (GibcoBRL) incorporating 32p dCTP (Amersham). Hybridisation of labelled sequences were performed in Rapid Hyb solution (Amersham) for between 2 and 5 hours and blots were washed to a stringency of 0. 1x SSC/0. 1% SDS at 65°C. Hybridisation was visualised by Storm 840 phosphoimager and associated software (Molecular Dynamics).

Subtractive Hybridisation Starting with 2ig of. poly A'MRNA from estrogen treated and untreated animals, subtractive hybridisation analysis was performed using the PCR-Select cDNA Subtraction Kit (Clontech) as per suppliers instructions (13). PCR amplification during the subtraction process was conducted using Advantage 2 PCR system reagents (Clontech). Tertiary subtraction products were subcloned into pGEM-TEasy (Promega), sequenced by Oxford University DNA sequencing Facility (UK) using BigDye Terminator protocols (Applied Biosystems), and compared with non-redundant mammalian databases using the Blasts program [16]. See Figure 8 which shows Poly A+ mRNA (211g) isolated from the bone marrow of estrogen or vehicle treated animals (BM+E2 and BM-E2 respectively) along samples prepared from other tissues probed for MET and GAPDH transcription.

Rt-PCR of MET and Preparation of Expression Constructs Full length MET cDNA was amplified from a SuperScript II (RNase H' ; GibcBRL) reverse transcribed, Oligo dT primed, mouse bone marrow library using gene specific primers (5'BamMET aaaggatcctagctgcctcggcagcgcgt, 3'NotMET tttgcggccgcttttacagaatatgaaggtttatttcca). The resultant 3.7Kb fragment was subcloned into Bam HI/Not I digested pCR 3.1 (Invitrogen) and sequenced. A BamH I/Eco RV fragment form the resultant plasmid was . subcloned into Bgl ll/Sma I digested pEYFP-C1 (Clontech) to express amino EYFP tagged chimeric MET protein.

To express epitope tagged HET, the amino terminus of IMAGE clone 3611151 (GI 989737) was amplified by PCR using Pfu polymerase (Promega) and primers coding for the haemaglutinin epitope (5'HA HET aaaggatccaaaatggcatacccatacgacgtcccagactacgccatggcggagactctg tcaggcct, 3'mid HET gtcgtcacccttcttagcatca). The resultant 1.6Kb fragment was digested with BamH I and EcoR V and subcloned back into IMAGE clone 3611151. A BamH I/Pst I fragment of this construct was subsequently subcloned into similarly prepared pCR 3.1 to generate pHA-HET.

Western Analysis MCF-7 cells were obtained from the European Collection of Cell Cultures, and maintained in DMEM (Sigma) supplemented with 10% foetal calf serum (Gibco BRL), 2mM glutamin and penicillin-streptomycin. Cells seeded at 300,000 per 60mm diameter dish were transfected with zig of pEYFP-MET or pECFY-C1 using Fugene 6 transfection reagent (Roche). Following 48 hours of culture, protein lysates were prepared and resolved on a 5-20% gradient polyacrylamide gel. Proteins were transferred to Immobilon-P (Millipore) and the expression of EYFP proteins detected using an anti-GFP (Roche) antibody and ECL visualisation kit (Amersham).

ERE Reporter Assay MCF-7 cells were seeded in 24-well plates at 100,000 cells per well. The following day, cells were transiently transfected with 250ng of TK-ERE reporter plasmid per well, kindly provided by Dr M Parker (19), plus pEYFP-MET or pHA- HET plasmids (refer to figure legends for quantities) using Fugene 6 transfection reagent. For dose response experiments, pEYFP-C1 and pCR 3.1 plasmids were added to pEYFP-MET and pHA-HET samples respectively to ensure equal quantities of DNA were used per reaction. Following overnight incubation, cells were washed and cultured in serum-free medium (phenol red-free DMEM/F-12 mix (Gibco BRL) containing 0. 1mg/ml BSA and 10S1g/ml apo-transferrin) for a further 8 hours. Cells were subsequently exposed to 10-8M E2 for 18-20 hours prior to measurement of reporter gene activity by Luciferase Assay System (Promega) in a Microtitre Plate Luminometer (Dynex). Assays were performed in triplicate and the data presented are representative of at least 3 independent experiments.

Confocal Microscopy MCF-7 cells cultured overnight on glass cover slips in 12 well plates were transfected with 100ng of pEYFP-MET or pEYFP-C1. After 24 hours, cells were stained with Hoechst 33258 and mounted in Vectashield (Vector Laboratories).

Stained nuclei and EYFP expression were visualised with an inverted TCS-SP2 confocal scanning microscope using Ar-UV (? b364) and Ar (X514) lasers (Leica).

Isolation of MET To identify genes differentially expressed in the bone marrow of adult female mice in response to in vivo estrogen treatment, PCR based subtractive hybridisation analysis was employed [17]. Messenger RNA isolated from the tibiae of 4 day estrogen or vehicle treated animals of between 8 and 12 weeks of age were used to generate tester and driver material. The inventors have previously observed that the bone anabolic effects of estrogen are maximal in animals of this age [8]. During the course of this investigation a fragment, the inventors refer to as MET, was isolated and its sequence compared with non- redundant mammalian databases using the BlastX program [16]. No significant similarity with previously characterised sequences was observed however, a number of highly homologous EST sequences were identified and used to generate a contiguous virtual sequence of 3.7Kb coding for a 1031 amino acid open reading frame, initiated within a Kozak site [18] see Fig. 1 which shows full length cDNA and predicted amino acid sequence of mouse MET. Numbers left indicate nucleotide sequence while those right refer to the amino acid residues.

Predicted poly adenylation signal is underlined; putative nuclear localisation signals are highlighted in bold italic. A human peptide sequence of 1034 amino acids sharing 91% identity (98% similarity when conserved substitutions are taken into account) with the mouse sequence was also generated using human ESTs ( [19] ; see Fig. 2) which shows alignment of mouse (MuMET) and human (HuMET) MET with human HET (HuHET) proteins as predicted using the Clustal W program (19). Numbers right refer to amino acid sequence. *, identical residues in all sequences of alignment; :, conserved substitutions;., semi- <BR> <BR> conserved substitutions. -, spacer. A full length copy of the mouse gene was subsequently amplified from mouse bone marrow cDNA by RT-PCR, using primers designed from the EST sequence. A 3. 7Kb product was obtained see Fig. 3 which shows sequence specific primers were used to amplify a single 3.7Kb cDNA for mouse MET from reverse transcribed mouse bone marrow mRNA. No products were observed in the absence of template. Numbers left indicate the size of molecular weight markers in Kb, sequencing of which confirmed the validity of the virtual sequence.

Comparison of the predicted mouse and human MET nucleotide sequences with GenBank revealed no significant homology with any previously characterised genes, however a similar search comparing the protein sequences revealed that these peptides share 35% identity over 863 as with HET (Fig. 2), a known suppresser of estrogen induced transcription. Homology between these proteins is greatest in three discrete regions of the peptides that may represent putative functional domains. Between amino acids 22-56 of both MET sequences is a SAP/SAF Box [9, 10] (Fig. 4A). This motif is present in DNA binding proteins from yeast through to mammalian species and is structurally related to a homeodomain. SAF Box proteins have been shown to bind S/MARs and are thought to play a role in regulating chromatin structure and gene expression. It is significant to note that HET contains a SAF Box and is a known regulator of estrogen receptor function (Fig. 3A) [13-15]. See Fig. 4A which shows A) Alignment of putative mouse and human MET SAF Boxes with other proteins based on previously defined consensus [9]. Numbers left refer to position of the motifs. GenBank sequence identifiers are listed for each protein.

Conserved residues are highlighted in grey.., any residue; h, YFWLIVMA ; p, STQNEDRKH; b, KREQWFYLMI.

The second highly conserved functional domain identified in the MET sequence is an RNA binding motif beginning at residue 386 see Fig. 4B which shows B) Alignment of putative RNA binding domain of mouse and human MET based on previously defined consequence sequence [11]. Numbers left refer to the initiating residue of the motif. GenBank sequence identifiers are listed for each protein.., any residue; U, LIVAGFWYCM ; Z, U + ST. Conserved residues are highlighted in grey. Such domains are composed of approximately 80 amino acids within which are two well conserved sub-motifs RPN-1 (octamer) and RPN-2 (hexamer) [11]. One or more such motifs are found in a variety of RNA binding proteins, including heterogeneous nuclear ribonuclear proteins (hnRNPs), translation factors, and mRNA processing factors. Similar motifs are present within the SAF Box molecules AcinusL [20] and HET, the simian suppresser of estrogen receptor-directed transactivation ERE-BP [21], CBF-A transcriptional repressor [22] and PRC transcription factor [23]. The presence of this motif within MET suggests it may bind RNA modulating transcription.

Residues 652-740 of MET share 73% identity (83% similarity) with residues 638-724 of HET (Fig. 2). This region is extremely high in glutamin (26%) and arginine (31 %) residues with charged residues accounting for 78% of the bases in this domain. This sequence of HET resides within a larger region known to interact with hnRNP D which is proposed to play a role in HET's ability to suppress estrogen induced transcription [24]. Also, rat HET residues 493-759 (conserved with human HET 460-725) bind serine/arginine (SR) rich RNA processing factors and RNA pol 11 [25]. This interaction is proposed to facilitate the formation of"transcriptosomes"at S/MAR sites [25,26].

Three putative nuclear localization signals conforming to the consensus Lys-Arg/Lys-X-Arg/Lys, similar to that found in SV40 large T antigen [27], are present in carboxy terminus of MET beginning at residues 593,726 and 800.

The presence of these sequences suggests that MET is actively transported into the nucleus.

Cellular Localisation of MET The presence of a SAF Box and nuclear localisation signals within the MET protein suggests this molecule may function within the nucleus. To investigate this possibility an expression construct was prepared to express mouse MET cDNA as an amino terminally tagged chimeric protein with EYFP. The resultant plasmid, pEYFP-MET was transfected into MCF-7 breast cancer cells and its expression compared by western with those transfected with pEYFP-C1 see Fig. 5 which shows lysates from untransfected, pEYFP-C1 and pEYFP-MET transfected MCF-7 cells were prepared and probed for EYFP expression by Western analysis. Unique products of approximately 25 and 150 KDa are present in the pEYFP-C1 and pEYFP-MET lysates respectively. No products were detected in the control lysate. Numbers left indicate the approximate positions of molecular weight markers in KDa. Vector transfected cells expressed a 25KDa protein as expected. In the pEYFP-MET lysate a peptide of approximately 150 KDa was observed that was not present in either the non- transfected or vector only transfected lysats. The size of this chimeric molecule is consistent with the mouse MET cDNA coding for a 1031 amino acid protein.

The subcellular distribution of these expression constructs was then analysed by confocal microscopy. In cells transfected with pEYFP-C1 alone, EYFP staining was evenly distributed throughout the cells, while those transfected with pEYFP-MET showed a punctate, nuclear localisation pattern similar to that previously reported for HET [14] (Fig. 6) which shows MCF-7 cells transfected with either pEYFP-C1 or pEYFP-MET were stained with Hoechst 33258 and visualised by confocal microscopy. Hoescht stained cell nuclei (upper panels) and EYFP wild type or chimeric protein localisation patterns (middle panels) are overlayed (lower panel). White colouring in lower left pEYFP-MET panel indicates co-localisation EYFP-MET protein and nuclear stain. Such a distribution is consistent with that expected for a nuclear transcription factor.

MET Suppresses Estrogen Induced Transcription in Breast Cancer Cells The similarity of MET to HET suggests it may function in a similar manner, suppressing estrogen induced transcription. To address this question MCF-7 cells were co-transfected with an estrogen response element-luciferase reporter construct, pERE-TK-Luc [28] along with either pEYFP-MET or pEYFP-C1. Co- transfected cells were subsequently exposed to estrogen or vehicle and the levels of reporter gene compared by luminometry. Luciferase reporter expression was induced 2.6 fold in MCF-7 cells exposed to estrogen compared with untreated controls see Fig. 7 which shows MCF-7 cells were co-transfected with 250ng of ERE-tk-luc plus either pEYFP-MET (black columns), or pHA-HET (white columns) to a total of 100ng. Sixteen hours post transfection, cells were washed and incubated in serum free media for 8 hours then treated with either estrogen (+, 10-8M) or vehicle (-) for 16 hours prior to assessment of reporter gene expression. Luciferase activity is represented relative to the levels detected in the cells plus vehicle sample. Error bars show the standard deviation of triplicate wells. In contrast, co-transfection with increasing amounts of pEYFP- MET resulted in up to a 50% reduction in estrogen induced luciferase activity.

Consistent with data presented by [15], over expression of HET was also observed to suppress estrogen induced transcription. Together these results confirm that MET is a novel suppresser of estrogen induced transcription.

MET Stimulates Estrogen Induced Transcription in Bone Cells Figure 8 shows the effect of MET on bone cells. SMER bone (osteoblast) cells have the ability to respond to treatment with estrogen. This can be assessed using an estrogen response element reporter system. Within such a system, a background level of reporter is observed (-E2,0 MET). When estrogen is added, the level of reporter increases by approximately 2 fold (+E2, 0 MET). Addition of DNA expressing MET results in an increase in the level of reporter gene activity in either the absence of presence of estrogen. This effect increases with the amount of MET added to cells (25,50, 100,150, 200).

Tissue Distribution and Estrogen Responsiveness of MET To investigate the estrogen responsiveness of MET mRNA expression within bone marrow, and its organ distribution, northern analysis was employed.

As displayed in Fig. 9, equivalent amounts of MET mRNA were detected in bone marrow mRNA isolated from both untreated and 4 day estrogen treated animals. This message was approximately 3. 8Kb in size which is consistent with the length of the cloned MET cDNA. When the expression of MET in various tissues was compared, a near ubiquitous organ distribution was also observed although very little message was detected in muscle. These results indicate that MET is expressed in most tissues and does not appear to be regulated at the transcriptional level in response to estrogen treatment.

Chromosomal Localisation of MET Blast comparison of the MET nucleotide sequence with the draft human genome sequence places the gene at chromosome 15q21 within RefSeq NT010289 [16]. This domain is orthologous with mouse chromosome 9.

Karyotypic abnormalities in this region have been associated with cataract formation [29], dyslexia [30] and tumour development [31,32].

In conclusion, the present inventors have cloned a novel nuclear protein which has been termed MET. This molecule contains putative SAF Box and RNA binding domains and overall displays significant homology with HET, sharing the latter's ability to suppress estrogen induced gene transcription.

Taken together, the inventors'findings suggest that MET and HET are part of the same family of estrogen repressor molecules. Further studies are required to characterise these proteins in more detain and in particular analysing whether they regulate transcription in response to other steroids.

References <BR> <BR> [1] Hall, J. M. , Couse, J. F. and Korach, K. S. (2001) The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 17,17.

[2] Katzenellenbogen, B. S., Choi, I., Delage-Mourroux, R. , Ediger, T. R.,<BR> Martini, P. G. , Montano, M. , Sun, J. , Weis, K. and Katzenellenbogen, J. A.

(2000) Molecular mechanisms of estrogen action: selective ligands and receptor pharmacology. J Steroid Biochem Mol Biol 74,279-85.

[3] Xu, L., Glass, C. K. and Rosenfeld, M. G. (1999) Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 9,140-7.

[4] Brzozowski, A. M. , Pike, A. C. , Dauter, Z. , Hubbard, R. E. , Bonn, T.,<BR> Engstrom, O., Ohman, L. , Greene, G. L., Gustafsson, J. A. and Cariquist, M. (1997) Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389,753-8.

[5] Paige, L. A., Christensen, D. J. , Gron, H. , Norris, J. D., Gottlin, E. B.,<BR> Padilla, K. M. , Chang, C. Y., Ballas, L. M., Hamilton, P. T., McDonnell, D. P. and Fowlkes, D. M. (1999) Estrogen receptor (ER) modulators each induce distinct conformational changes in ER alpha and ER beta.

Proceedings of the National Academy of Sciences of the United States of America 96,3999-4004.

[6] Norris, J. D. , Paige, L. A., Christensen, D. J. , Chang, C. Y. , Huacani, M. R., Fan, D., Hamilton, P. T., Fowlkes, D. M. and McDonnell, D. P. (1999) Peptide antagonists of the human estrogen receptor. Science 285,744-6.

[7] Kraichely, D. M. , Sun, J., Katzenellenbogen, J. A. and Katzenellenbogen, B. S. (2000) Conformational changes and coactivator recruitment by novel ligands for estrogen receptor-alpha and estrogen receptor-beta: correlations with biological character and distinct differences among SRC coactivator family members. Endocrinology 141,3534-45.

[8] Samuel, A. , Perry, M. J. and Tobias, J. H. (1999) High-dose estrogen induces de novo medullary bone formation in female mice. J Bone Miner Res 14, 178-86.

[9] Aravind, L. and Koonin, E. V. (2000) SAP-a putative DNA-binding motif involved in chromosomal organization. Trends Biochem Sci 25,112-4. <BR> <BR> <P>[10] Kipp, M. , Gohring, F. , Ostendorp, T. , van Drunen, C. M. , van Driel, R. , Przybylski, M. and Fackelmayer, F. O. (2000) SAF-Box, a conserved protein domain that specifically recognizes scaffold attachment region DNA. Mol Cell Biol 20, 7480-9. <BR> <BR> <P>[11] Birney, E. , Kumar, S. and Krainer, A. R. (1993) Analysis of the RNA- recognition motif and RS and RGG domains: conservation in metazoan pre-mRNA splicing factors. Nucleic Acids Res 21,5803-16. <BR> <BR> <P>[12] Oesterreich, S. , Lee, A. V., Sullivan, T. M., Samuel, S. K. , Davie, J. R. and Fuqua, S. A. (1997) Novel nuclear matrix protein HET binds to and influences activity of the HSP27 promoter in human breast cancer cells. J Cell Biochem 67,275-86.

[13] Renz, A. and Fackelmayer, F. O. (1996) Purification and molecular cloning of the scaffold attachment factor B (SAF-B), a novel human nuclear protein that specifically binds to S/MAR-DNA. Nucleic Acids Res 24,843-9. <BR> <BR> <P>[14] Weighardt, F. , Cobianchi, F. , Cartegni, L., Chiodi, I., Villa, A. , Riva, S. and Biamonti, G. (1999) A novel hnRNP protein (HAP/SAF-B) enters a subset of hnRNP complexes and relocates in nuclear granules in response to heat shock. J Cell Sci 112, 1465-76. <BR> <BR> <P>[15] Oesterreich, S. , Zhang, Q. , Hopp, T. , Fuqua, S. A., Michaelis, M. , Zhao,<BR> H. H. , Davie, J. R. , Osborne, C. K. and Lee, A. V. (2000) Tamoxifen-bound estrogen receptor (ER) strongly interacts with the nuclear matrix protein HET/SAF-B, a novel inhibitor of ER-mediated transactivation. Mol Endocrinol 14, 369-81. <BR> <BR> <P>[16] Altschul, S. F. , Madden, T. L., Schaffer, A. A. , Zhang, J. , Zhang, Z., Miller, W. and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST : a new generation of protein database search programs. Nucleic Acids Res 25, 3389-402.

[17] Diatchenko, L., Lau, Y. F., Campbell, A. P. , Chenchik, A., Moqadam, F. ,<BR> Huang, B. , Lukyanov, S. , Lukyanov, K. , Gurskaya, N., Sverdlov, E. D. and Siebert, P. D. (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A 93,6025-30.

[18] Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol (am 266,19867-70. <BR> <BR> <P>[19] Thompson, J. D. , Higgins, D. G. and Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22,4673-80. <BR> <BR> <P>[20] Sahara, S. , Aoto, M. , Eguchi, Y., Imamoto, N. , Yoneda, Y. and Tsujimoto, Y. (1999) Acinus is a caspase-3-activated protein required for apoptotic chromatin condensation. Nature 401,168-73. <BR> <BR> <P>[21] Chen, H. , Hu, B. , Gacad, M. A. and Adams, J. S. (1998) Cloning and expression of a novel dominant-negative-acting estrogen response element-binding protein in the heterogeneous nuclear ribonucleoprotein family. J Biol Chem 273,31352-7.

[22] Kamada, S. and Miwa, T. (1992) A protein binding to CArG box motifs and to single-stranded DNA functions as a transcriptional repressor.

Gene 119,229-36.

[23] Andersson, U. and Scarpulla, R. C. (2001) Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1- dependent transcription in mammalian cells. Mot Cell Biol 21,3738-49. <BR> <BR> <P>[24] Arao, Y. , Kuriyama, R. , Kayama, F. and Kato, S. (2000) A nuclear matrix- associated factor, SAF-B, interacts with specific isoforms of AUF1/hnRNP D. Arch Biochem Biophys 380,228-36. <BR> <BR> <P>[253 Nayler, O., Stratling, W. , Bouquin, J. P., Stagljar, I., Lindemann, L. ,<BR> Jasper, H. , Hartmann, A. M., Fackelmayer, F. O. , Ullrich, A. and Stamm, S. (1998) SAF-B protein couples transcription and pre-mRNA splicing to SAR/MAR elements. Nucleic Acids Res 26,3542-9.

[26] Corden, J. L. and Patturajan, M. (1997) A CTD function linking transcription to splicing. Trends Biochem Sci 22,413-6. <BR> <BR> <P>[27] Kalderon, D. , Richardson, W. D. , Markham, A. F. and Smith, A. E. (1984) Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 311,33-8. <BR> <BR> <P>[28] White, R., Jobling, S. , Hoare, S. A. , Sumpter, J. P. and Parker, M. G.

(1994) Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135, 175-82. <BR> <BR> <P>[29] Vanita, Singh, J. R. , Sarhadi, V. K. , Singh, D. , Reis, A. , Rueschendorf, F.,<BR> Becker-Follmann, J. , Jung, M. and Sperling, K. (2001) A novel form of "central pouchlike"cataract, with sutural opacities, maps to chromosome 15q21-22. Am J Hum Genet 68,509-14. <BR> <BR> <P>[30] Nopola-Hemmi, J. , Taipale, M. , Haltia, T. , Lehesjoki, A. E., Voutilainen, A. and Kere, J. (2000) Two translocations of chromosome 15q associated with dyslexia. J Med Genet 37,771-5. <BR> <BR> <P>[31] Kersemaekers, A. M. , Kenter, G. G. , Hermans, J., Fleuren, G. J. and van de Vijver, M. J. (1998) Allelic loss and prognosis in carcinoma of the uterine cervix. Int J Cancer 79,411-7. <BR> <BR> <P>[32] Park, W. S. , Park, J. Y. , Oh, R. R. , Yoo, N. J. , Lee, S. H. , Shin, M. S. , Lee,<BR> H. K. , Han, S. , Yoon, S. K., Kim, S. Y. , Choi, C., Kim, P. J. , Oh, S. T. and Lee, J. Y. (2000) A distinct tumor suppressor gene locus on chromosome 15q21. 1 in sporadic form of colorectal cancer. Cancer Res 60,70-3.

[33] Boulikas, T. (1995) Chromatin domains and prediction of MAR sequences. Int Rev Cytol 162A, 279-388.

[34] van Drunen, C. M., Sewalt, R. G., Oosterling, R. W. , Weisbeek, P. J., Smeekens, S. C. and van Driel, R. (1999) A bipartite sequence element associated with matrix/scaffold attachment regions. Nucleic Acids Res 27,2924-30. <BR> <BR> <P>[35] Romig, H., Fackelmayer, F. O. , Renz, A. , Ramsperger, U. and Richter, A.

(1992) Characterization of SAF-A, a novel nuclear DNA binding protein from HeLa cells with high affinity for nuclear matrix/scaffold attachment DNA elements. Embo J 11,3431-40.

[36] Parker, M. G. (1995) Structure and function of estrogen receptors. Vitam Horm 51,267-87.

[37] Chen, H., Arbelle, J. E. , Gacad, M. A., Allegretto, E. A. and Adams, J. S.

(1997) Vitamin D and gonadal steroid-resistant New World primate cells express an intracellular protein which competes with the estrogen receptor for binding to the estrogen response element. J Clin Invest 99, 669-75.