FATTY ACID MODIFICATION AND TAG ASSEMBLY GENES

FIELD OF THE INVENTION

The present invention relates to cells and methods for producing hydroxylated fatty acids. Also provided are novel polypeptides, and polynucleotides encoding therefor, which can be used to produce the hydroxylated fatty acids, particularly in transgenic plants.

BACKGROUND OF THE INVENTION

Hydroxylated fatty acids

Fatty acids are carboxylic acids with long-chain hydrocarbon side groups that play a fundamental role in many biological processes. Fatty acids are often unhydroxylated but may be converted to hydroxyl fatty acids by the introduction of at least one hydroxyl group, a process catalyzed by an hydroxylase enzyme.

Hydroxyl fatty acids and hydroxyl oils are particularly important for a variety of industrial applications. For example, hydroxyl fatty acids, such as ricinoleic acid (RA, 12-hydroxyoctadec-9-enoic acid, 12 hydroxy oleic acid), are important industrial feedstock in the manufacture of biolubricants, functional fluids, ink, paints, coatings, nylons, resins, foams and other biopolymers.

The biosynthesis of fatty acids is a major activity of plants and microorganisms.

Biotechnology has long been considered an efficient way to manipulate the process of producing fatty acids in plants and microorganisms. It is cost-effective and renewable with little side effects. Thus, industrial effort directed to the production of various compounds including speciality fatty acids and pharmaceutical polypeptides through the manipulation of plant, animal, and yeast cells has ensued.

At present, castor bean (Ricinus communis) is a major source for hydroxyl fatty acids. Due to poor agronomic performance and the presence of highly potent toxins and allergens in the seed, castor bean is not an ideal source for the fatty acids. Thus, a growing demand exists for alternatives to replace castor bean as a source of the hydroxyl fatty acids. Genes involved in the biosynthesis of hydroxyl fatty acids such as ricinoleic and lesqueroleic acids have been isolated from plant castor bean (Ricinus communis) and Lesquerella fendleri (van de Loo et al., 1995; Broun et al., 1998). Both genes encode oleate 12-hydroxylase, which introduces a hydroxyl group at position 12 of oleic acid. However, the introduction of the castor bean oleate hydroxylase into tobacco, Arabidopsis thaliana resulted in low to intermediate levels of ricinoleic acid accumulation in seeds (van de Loo et al., 1995; Broun and Somerville, 1997; Smith et al., 2003).

There is a need for the identification of further hydroxylases that can be used to produce hydroxylated fatty acids.

Triacylglycerol biosynthesis

Triaclyglycerol (TAG) constitutes the major form of lipid in seeds and consists of three acyl chains esterified to a glycerol backbone. Fatty acids are synthesized in the plastid as acyl-acyl carrier protein (ACP) intermediates where they can undergo a first desaturation catalyzed by the stearoyl-ACP desaturase to yield oleic acid (C18: 1 ^A9 ). Subsequently, the acyl chains are transported to the cytosol and endoplasmic reticulum (ER) as acyl-Coenzyme (acyl-CoA) esters. Prior to entering the major TAG biosynthesis pathway, also known as the Kennedy or glycerol- 3 -phosphate (G-3-P) pathway, the acyl chains are typically integrated into phospholipids of the ER membrane where they can undergo further desaturation. Two key enzymes in the production of polyunsaturated fatty acids are the membrane-bound FAD2 and FAD3 desaturases which produce linoleic (C18:2 ^A9 ' ¹² ) and a-linolenic acid (C18:3 ^A9 ' ¹² ' ¹⁵ ), respectively.

TAG biosynthesis via the Kennedy pathway consists of a series of subsequent acylations, each using acyl-CoA esters as the acyl-donor. The first acylation step typically occurs at the snl -position of the G-3-P backbone and is catalyzed by the G-3- P acyltransferase (swi-GPAT). The product, sTii-lysophosphatidic acid {snl -LP A) serves as a substrate for the lysophosphatidic acid acyltransferase (LPAAT) which couples a second acyl chain at the snl -position to form phosphatidic acid (PA). Phosphatidic acid is further dephosphorylated to diacylglycerol (DAG) by the PA phosphatase (PAP), thereby providing the substrate for the final acylation step. Finally, a third acyl chain is esterified to the s¾3-position of DAG in a reaction catalyzed by the diacylglycerol acyltransferase (DGAT) to form TAG which accumulates in oil bodies. A second enzymatic reaction, catalyzed by phosphatidyl glycerol acyltransferase (PDAT), also results in the conversion of DAG to TAG. This reaction is unrelated to DGAT and uses phospholipids as the acyl-donors.

Plant lipids such as seedoil TAG have many uses, for example, culinary uses (shortening, texture, flavor), industrial uses (in soaps, candles, perfumes, cosmetics, suitable as drying agents, insulators, lubricants) and provide nutritional value. There is also growing interest in using plant lipids for the production of biofuel. To maximise yields for the commercial production of lipids, there is a need for further means to increase the levels of lipids, particularly non-polar lipids such as DAGs and TAGs, in transgenic organisms or parts thereof such as plants, seeds, leaves, algae and fungi.

SUMMARY OF THE INVENTION

The present inventors have produced plant cells with an enhanced ability to hydroxylate fatty acids.

In a first aspect, the present invention provides a plant cell comprising an exogenous polynucleotide encoding a polypeptide with fatty acid Δ12 hydroxylase activity which has one or more or all of the following features:

i) the hydroxylase has an efficiency of conversion of oleic acid to 12- hydroxyoleic acid of at least about 20%,

ii) the hydroxylation efficiency of the hydroxylase is at least about 20%, or iii) the ratio of ricinoleic acid (RA) to linoelic acid (LA) in the cell is at least about 4.2.

In another aspect, the present invention provides a plant cell comprising an exogenous polynucleotide encoding a polypeptide with fatty acid Δ12 hydroxylase activity, wherein the plant cell has at least about a 1.1 fold higher amount of 12- hydroxyoleic acid when compared to an isogenic plant cell comprising a different exogenous polynucleotide which encodes a fatty acid Δ12 hydroxylase from Ricinus communis (SEQ ID NO: 107), Lesquerella fendleri (SEQ ID NO: 108) or Claviceps purpurea (SEQ ID NO: 111).

In an embodiment, the plant cell of the above aspects, where relevant, has one or more or all of the following features:

i) the hydroxylase has an efficiency of conversion of oleic acid to 12- hydroxyoleic acid of at least about 20%, or at least about 22%, or about 20% to about 25%,

ii) the hydroxylation efficiency of the hydroxylase is at least about 20%, or at least about 22%, or at least about 25%,

iii) the ratio of ricinoleic acid (RA) to linoelic acid (LA) in the cell is at least about 4.2, or at least about 5, or at least about 6,

iv) the plant cell has at least about a 1.1 fold, or at least about a 1.2 fold, or at least about 1.3 fold, higher amount of 12-hydroxyoleic acid when compared to an isogenic plant cell comprising a different exogenous polynucleotide which encodes a fatty acid Δ12 hydroxylase from Ricinus communis, Lesquerella fendleri or Claviceps purpurea,

v) the level of ricinoleic acid (RA) in the total fatty acid of the cell is at least 20%, preferably at least 25% or at least 30%,

vi) less than about 3%, or less than about 2.75%, or less than about 2.5%, or about 3%, or about 2.75%, or about 2.5%, by weight of the total fatty acid content of the cell is palmitic acid,

vii) about 0.1% to about 3%, or about 2% to about 3%, or about 3%, or about 2%, by weight of the total fatty acid content of the cell is polyunsaturated fatty acids (PUFA),

viii) less than about 3%, or less than about 2.5%, or less than about 2.25%, or about 3%, or about 2.5%, or about 2.25%, by weight of the total fatty acid content of the cell is linoleic acid (LA), and

ix) less than about 1%, or less than about 0.5%, by weight of the total fatty acid content of the cell is a-linolenic acid (ALA).

In an embodiment, the PUFA is linoleic acid (LA).

In another embodiment, a-linolenic acid (ALA) is undetectable in the fatty acid content of the lipid.

In a preferred embodiment, the polypeptide with fatty acid Δ12 hydroxylase activity comprises amino acids having a sequence as provided in SEQ ID NO: 9 or SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or both of SEQ ID NO: 9 or SEQ ID NO: 10.

In an embodiment, the cell further comprises an exogenous polynucleotide encoding a diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol-3-phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A ₂ (PLA ₂ ), phospholipase C (PLC), phospholipase D (PLD), CDP- choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine: diacylglycerol choline phosphotransferase (PDCT), acyl-CoA binding protein (ACBP), acyl-CoA synthase (ACS), a fatty acid desaturase, a fatty acid elongase, or a combination of two or more thereof. More preferably, the cell further comprises an exogenous polynucleotide encoding a diacylglycerol acyltransferase (DGAT) and/or a polypeptide with DGAT activity.

In a further embodiment, the cell further comprises an introduced mutation or an exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme of the cell selected from DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA ₂ , PLC, PLD, CPT, PDAT, a desaturase, or an elongase, or a combination of two or more thereof.

Examples of exogenous polynucleotide which down regulates the production and/or activity of an endogenous enzyme include, but are not limited to, an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, and a double stranded RNA.

Preferably, the exogenous polynucleotide that down regulates the production and/or activity of an endogenous enzyme does not significantly effect the production and/or activity of an enzyme encoded by a transgene in the cell.

In an embodiment, the cell is a cell of an oilseed plant or part thereof. Examples of oilseed plants include, but are not limited to, is Brassica sp., Gossypium hirsutum, Linum usitatissimum, Helianthus sp., Carthamus tinctorius, Glycine max, Zea mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum vulgare, Avena sativa, Trifolium sp., Elaesis guineenis, Nicotiana benthamiana, Hordeum vulgare, Lupinus angustifolius, Oryza sativa, Oryza glaberrima, Camelina sativa, Miscanthus x giganteus, or Miscanthus sinensis.

In another aspect, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs: 7 to 12, 33, 34, 41 to 46, 48, 50, 53, 54, 56, 58, 62 to 64, 74 to 77, 82 to 85, 92 to 97, 100 and 101, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or more of SEQ ID NOs: 7 to 12, 33, 34, 41 to 46, 48, 50, 53, 54, 56, 58, 62 to 64, 74 to 77, 82 to 85, 92 to 97, 100 and 101.

In an embodiment, the polypeptide is involved in the synthesis of triacylglycerol

(TAG), in the production of fatty acid-CoA, or fatty acid modification. Examples of such polypeptides include, but are not necessarily limited to, a fatty acid Δ12 hydroxylase, fatty acid Δ12 desaturase, diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol- 3 -phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl- CoA:lysophosphatidylcholine acyltransferase (LPCAT), CDP-choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine: diacylglycerol choline phosphotransferase (PDCT), and/or acyl-CoA binding protein (ACBP).

In a preferred embodiment, the polypeptide has fatty acid Δ12 hydroxylase activity and comprises amino acids having a sequence as provided in SEQ ID NO: 9 or SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or both of SEQ ID NO: 9 or SEQ ID NO: 10.

In yet a further embodiment, the polypeptide with fatty acid Δ12 hydroxylase activity has one or more or all of the following features when recombinantly expressed in a plant cell:

i) the hydroxylase has an efficiency of conversion of oleic acid to 12- hydroxyoleic acid of at least about 20%,

ii) the hydroxylation efficiency of the hydroxylase is at least about 20%, iii) the ratio of ricinoleic acid (RA) to linoelic acid (LA) in the cell is at least about 4.2,

iv) the plant cell has at least about a 1.1 fold higher amount of 12-hydroxyoleic acid when compared to an isogenic plant cell which recombinantly expresses a fatty acid Δ12 hydroxylase from Ricinus communis (SEQ ID NO: 107), Lesquerella fendleri (SEQ ID NO: 108) or Claviceps purpurea (SEQ ID NO: 111).

In another aspect, the present invention provides an isolated and/or exogenous polynucleotide comprising:

i) a sequence of nucleotides selected from any one of SEQ ID NOs: 1 to 6, 15 to 26, 31, 32, 35 to 40, 47, 49, 51, 52, 55, 57, 59 to 61, 70 to 73, 78 to 81, 86 to 91, 98 and 99,

ii) a sequence of nucleotides encoding a polypeptide of the invention, iii) a sequence of nucleotides which is at least 60% identical to any one or more of i) or ii), and

iv) a sequence of nucleotides which hybridizes to any one or more of i) to iii) under stringent conditions.

In a preferred embodiment, the polynucleotide encodes a polypeptide having fatty acid Δ12 hydroxylase activity and which comprises nucleotides having a sequence as provided in SEQ ID NO: 3 or SEQ ID NO: 4, or a nucleotide sequence which is at least 60% identical to any one or both of SEQ ID NO: 3 or SEQ ID NO: 4.

In a further aspect, the present invention provides a process for determining whether a polynucleotide encodes a fatty acid Δ12 hydroxylase, and/or for identifying a polynucleotide encoding a fatty acid Δ12 hydroxylase, comprising:

a) obtaining a polynucleotide operably linked to a promoter, the polynucleotide encoding a polypeptide comprising one or more of the following:

i) a sequence of nucleotides selected from SEQ ID NO: 3 and SEQ ID NO: 4, ii) a sequence of nucleotides encoding a polypeptide of the invention with fatty acid Δ12 hydroxylase activity,

iii) a sequence of nucleotides which is at least 60% identical to any one or more of i) or ii), and

iv) a sequence of nucleotides which hybridizes to any one or more of i) to iii) under stringent conditions,

b) introducing the polynucleotide into a cell or cell-free expression system in which the promoter is active,

c) determining whether the level of fatty acid Δ12 hydroxylation is modified relative to the cell or cell-free expression system before introduction of the polynucleotide, and

d) optionally, selecting a polynucleotide which when expressed increased levels of fatty acid Δ12 hydroxylation.

In an embodiment, step c) comprises determining whether:

i) the hydroxylase has an efficiency of conversion of oleic acid to 12- hydroxyoleic acid of at least about 20%,

ii) the hydroxylation efficiency of the hydroxylase is at least about 20%, iii) when recombinantly expressed in a plant cell, the ratio of ricinoleic acid (RA) to linoelic acid (LA) in the cell is at least about 4.2,

iv) when recombinantly expressed in a plant cell, the plant cell has at least about a 1.1 fold higher amount of 12-hydroxyoleic acid when compared to an isogenic plant cell which recombinantly expresses a fatty acid Δ12 hydroxylase from Ricinus communis (SEQ ID NO: 107), Lesquerella fendleri (SEQ ID NO: 108) or Claviceps purpurea (SEQ ID NO: 111).

In another aspect, the present invention provides a process for identifying a polynucleotide involved in the synthesis of triacylglycerol (TAG), in the production of fatty acid-CoA, or fatty acid modification, comprising:

a) obtaining a polynucleotide operably linked to a promoter, the polynucleotide encoding a polypeptide comprising one or more of the following:

i) a sequence of nucleotides selected from any one of SEQ ID NOs: 1 to 6,

15 to 26, 31, 32, 35 to 40, 47, 49, 51, 52, 55, 57, 59 to 61, 70 to 73, 78 to 81, 86 to 91, 98 and 99,

ii) a sequence of nucleotides encoding a polypeptide of the invention, iii) a sequence of nucleotides which is at least 60% identical to any one or more of i) or ii), and iv) a sequence of nucleotides which hybridizes to any one or more of i) to iii) under stringent conditions.

b) introducing the polynucleotide into a cell or cell-free expression system in which the promoter is active,

c) determining whether the production of triacylglycerol (TAG) and/or fatty acid-CoA, or modification of fatty acids is modified relative to the cell or cell-free expression system before introduction of the polynucleotide, and

d) optionally, selecting a polynucleotide which modified the production of triacylglycerol (TAG), fatty acid-CoA or fatty acid.

In an embodiment, the triacylglycerol (TAG) or fatty acid-Co A comprises an hydroxyl group.

In a further embodiment, the polynucleotide encodes a fatty acid Δ12 hydroxylase, fatty acid Δ12 desaturase, diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol- 3 -phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl- CoA:lysophosphatidylcholine acyltransferase (LPCAT), CDP-choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine:diacylglycerol choline phosphotransferase (PDCT), acyl- CoA binding protein (ACBP), or a combination of two or more thereof.

Also provided is a chimeric vector comprising the polynucleotide of the invention, wherein the polynucleotide is operably linked to a promoter.

Preferably, the promoter is functional in an oilseed, and/or is a seed specific promoter.

In a further aspect, the present invention provides a cell comprising one or more of the recombinant polypeptides of the invention, the exogenous polynucleotide of the invention, or the vector of the invention.

In an embodiment, the cell is suitable for fermentation.

In a further embodiment, the cell is a plant cell, preferably a plant seed cell. More preferably, the plant cell is an oilseed plant cell. Examples of oilseed plants include, but are not limited to, is Brassica sp., Gossypium hirsutum, Linum usitatissimum, Helianthus sp., Carthamus tinctorius, Glycine max, Zea mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum vulgare, Avena sativa, Trifolium sp., Elaesis guineenis, Nicotiana benthamiana, Hordeum vulgare, Lupinus angustifolius, Oryza sativa, Oryza glaberrima, Camelina sativa, Miscanthus x giganteus, or Miscanthus sinensis. In a further embodiment, the cell is further characterized by one or more of the above features.

In an embodiment, the exogenous polynucleotide encodes a polypeptide having fatty acid Δ12 hydroxylase activity and which comprises amino acids having a sequence as provided in SEQ ID NO: 9 or SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or both of SEQ ID NO: 9 or SEQ ID NO: 10.

In another embodiment, the cell comprises a first exogenous polynucleotide encoding a polypeptide involved in the synthesis of triacylglycerol (TAG) and/or in the production of fatty acid-Co A and which comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 33, 34, 41 to 46, 48, 50, 53, 54, 56, 58, 62 to 64, 74 to 77, 82 to 85, 92 to 97, 100 and 101, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or more of SEQ ID NOs: 33, 34, 41 to 46, 48, 50, 53, 54, 56, 58, 62 to 64, 74 to 77, 82 to 85, 92 to 97, 100 and 101, and a second exogenous polynucleotide encoding a fatty acid Δ12 hydroxylase.

In an embodiment, the first exogenous polynucleotide encodes a polypeptide with DGAT activity. In a further embodiment, the polypeptide with DGAT activity comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 48, 50, 53, 54, 56 and 58, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or more of SEQ ID NOs: 48, 50, 53, 54, 56 and 58.

In a further embodiment, the fatty acid Δ12 hydroxylase comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 9, 10 or 107 to 111, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or more of SEQ ID NOs: 9, 10 or 107 to 111. More preferably, the fatty acid Δ12 hydroxylase comprises amino acids having a sequence as provided in SEQ ID NO: 9 or SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or both of SEQ ID NO: 9 or SEQ ID NO: 10.

In a further embodiment, the cell comprises a first exogenous polynucleotide encoding a polypeptide having fatty acid Δ12 hydroxylase activity and which comprises amino acids having a sequence as provided in SEQ ID NO: 9 or SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one or both of SEQ ID NO: 9 or SEQ ID NO: 10, and a second exogenous polynucleotide encoding a polypeptide involved in the synthesis of triacylglycerol (TAG), in the production of fatty acid-CoA, or fatty acid modification.

Examples of polypeptides involved in the synthesis of triacylglycerol (TAG), in the production of fatty acid-CoA, or fatty acid modification include, but are not limited to, a diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol-3-phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A ₂ (PLA ₂ ), phospholipase C (PLC), phospholipase D (PLD), CDP- choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine: diacylglycerol choline phosphotransferase (PDCT), acyl-CoA binding protein (ACBP), acyl-CoA synthase (ACS), a fatty acid desaturase, or a fatty acid elongase.

In an embodiment, the second exogenous polynucleotide encodes a diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol- 3 -phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), phospholipase C (PLC), phospholipase D (PLD), CDP- choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT) or phosphatidylcholine: diacylglycerol choline phosphotransferase (PDCT), acyl-CoA binding protein (ACBP), acyl-CoA synthase (ACS), a fatty acid desaturase, or a fatty acid elongase, or a combination of two or more thereof.

In a preferred embodiment, the first exogenous polynucleotide encodes a diacylglycerol acyltransferase (DGAT).

As skilled person will appreciate, a cell of the invention may comprise multiple different exogenous polynucleotides, for examples two, three, four, five, six, seven or more, encoding polypeptides with different (or overlapping) activity in the synthesis of triacylglycerol (TAG), in the production of fatty acid-CoA, or fatty acid modification. The exogenous polynucleotides, or at least some thereof, may form part of the same continuous stretch of nucleic acid (for example in the same transfer nucleic acid molecule), or be in separate nucleic acid molecules (such as different transfer nucleic acids molecules).

In a further aspect, the present invention provides a method of producing the polypeptide of the invention, the method comprising expressing in a cell or cell free expression system the polynucleotide of the invention, and/or of the vector of the invention. Also provided is a transgenic non-human organism comprising a cell of the invention. Preferably, the organsim is a transgenic plant, more preferably a transgenic oilseed plant.

In another aspect, the present invention provides a method of producing the cell of the invention, the method comprising the step of introducing the polynucleotide of the invention, and/or the vector of the invention, into a cell.

Also provided is the use of the polynucleotide of the invention, and/or the vector of the invention to produce a recombinant cell.

In another aspect, the present invention provides a method of producing a transgenic plant comprising a cell of the invention, or seed thereof, the method comprising

i) introducing at least one polynucleotide of the invention, and/or at least one vector of the invention, into a cell of an oilseed plant,

ii) regenerating a transgenic plant from the cell, and

iii) optionally producing one or more progeny plants or seed thereof from the transgenic plant,

thereby producing the transgenic plant or seed thereof.

In a further aspect, the present invention provides a seed comprising the cell of the invention, or produced by the method of the invention.

In another aspect, the present invention provides a method of producing seed, the method comprising,

a) growing a plant of the invention, preferably in a field as part of a population of at least 1000 such plants, and

b) harvesting the seed.

In a further aspect, the present invention provides oil or fatty acid, produced by, or obtained from, the cell of the invention, the transgenic non-human organism or plant of the invention, or the seed of the invention.

In an embodiment, the oil or fatty acid comprises 12-hydroxyoleic acid, and/or wherein the oil is obtained by extraction of oil from an oilseed.

In a further aspect, the present invention provides a method of producing oil comprising one or more Δ12 hydroxylated fatty acids, the method comprising extracting oil from the cell of the invention, the transgenic non-human organism or plant of the invention, or the seed of the invention.

In another aspect, the present invention provides a method of producing a modified fatty acid or fatty acid-CoA, or performing, a fatty acid Δ12 hydroxylase reaction, a desaturase reaction, an acyltransferase reaction, a phosphotransferase reaction, or a synthase reaction, the method comprising contacting a fatty acid which may be esterified to phosphatidyl choline, glycerol or CoA with the polypeptide of the invention.

In an embodiment, the polypeptide is a fatty acid Δ12 hydroxylase, fatty acid Δ12 desaturase, diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol-3-phosphate acyltransferase (GPAT), 1-acyl- glycerol- 3 -phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), CDP-choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine: diacylglycerol choline phosphotransferase (PDCT), and/or acyl- CoA binding protein (ACBP).

Also provided is a composition comprising one or more of the cell of the invention, the polypeptide of the invention, the polynucleotide of the invention, the vector of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention or the oil or fatty acid of the invention, and one or more acceptable carriers.

Also provided is the use of one or more of the cell of the invention, the polypeptide of the invention, the polynucleotide of the invention, the vector of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention, for the manufacture of an industrial product.

In another aspect, the present invention provides a process for producing an industrial product, the process comprising the steps of:

i) obtaining one or more of the cell of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention,

ii) optionally physically processing one or more of the cell of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention, of step i)

iii) converting at least some of the cell of the invention, the transgenic non- human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention, or the physically processed product of step ii), to the industrial product by applying heat, chemical, or enzymatic means, or any combination thereof, to the lipid, and

iv) recovering the industrial product,

thereby producing the industrial product. It would be understood by a person skilled in the art that the converting step could be done simultaneously with or after the physical processing step.

In a further aspect, the present invention provides a method of producing fuel, the method comprising

i) reacting one or more of the cell of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention, with an alcohol, optionally in the presence of a catalyst, to produce alkyl esters, and

ii) optionally, blending the alkyl esters with petroleum based fuel.

In an embodiment, the alkyl esters are methyl esters.

In another aspect, the present invention provides a method of producing a feedstuff, the method comprising admixing one or more of the cell of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention, with at least one other food ingredient.

Also provided are feedstuffs, cosmetics or chemicals comprising one or more of the cell of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention.

In another aspect, the present invention provides a product produced from or using one or more of cell of the invention, the polypeptide of the invention, the polynucleotide of the invention, the vector of the invention, the transgenic non-human organism or plant of the invention, the seed of the invention, the oil or fatty acid of the invention, or the composition of the invention.

Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter. The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

Figure 1. Sequences alignment of HbFAD2-l to HbFAD2-6 (SEQ ID NO:7 to 12) with RcFAD2 (SEQ ID NO: 107), LfFAH12 (SEQ ID NO: 108), P1FAH12 (SEQ ID NO: 109) and AtFAD2 (SEQ ID NO: 110). The accession numbers used for the comparison are, RcFAH12, Ricinus communis A12-hydroxylase, U22378; LfFAH12, Lesquerella fendleri A12-hydroxylase, AAC32755; P1FAH12, Physaria lindheimeri A12-hydroxylase, ABQ01458; and AtFAD2, Arabidopsis thaliana A12-desaturase, P46313.

Figure 2. Phylogenetic comparison of HbFAD2- 1 to HbFAD2-6 with FAD2-like sequences from closely related species and Arabidopsis . Sequences and their accession numbers used for the comparison are, AtFAD2, Arabidopsis thaliana A12-desaturase, P46313; LfFAH12, Lesquerella fendleri A12-hydroxylase, AAC32755; LuFDA2-l and LuFAD2-2, Linum usitatissimum A12-desaturases, ACF49508 and ACF49507;

P1FAH12, Physaria lindheimeri A12-hydroxylase, ABQ01458; RcFAD2, Ricinus communis A12-desaturase, ABK59093; RcFAH12, Ricinus communis Δ12- hydroxylase, U22378.

Figure 3. Sequence alignment of HbLPAAT- 1 a (SEQ ID NO:41 ) and HbLPAAT-2a (SEQ ID NO:43). Figure 4. Sequence alignment of HbLPAAT- la (SEQ ID NO:41) and HbLPAAT- lb (SEQ ID NO:42).

Figure 5. Sequence alignment of HbLPAAT-2a (SEQ ID NO:43) and HbLPAAT-2b (SEQ ID NO:44).

Figure 6. Sequence alignment of HbDGAT2a (SEQ ID NO:53) and HbDGAT2b (SEQ ID NO:54).

Figure 7. Sequence alignment of HbLPCATla (SEQ ID NO:62) and HbLPCAT2a (SEQ ID NO:64). Figure 8. Forward LPCAT activity of HbLPCATl and LPCAT2 with different acyl- CoAs as acyl donors.

Figure 9. Relative reverse activity of HbLPCATl and HbLPCAT2 compared to AtLPCAT2, provided with C 18 : 1 -Co A or Ricinoleoyl-Co A (Ric-Co A) .

Figure 10. Sequence alignment of HbCPT-la (SEQ ID NO:74), HbCPT-lb (SEQ ID NO:75), HbCPT-2a (SEQ ID NO:76) and HbCPT-2b (SEQ ID NO:77). Figure 11. Sequence alignment of HbPDAT3a (SEQ ID NO:87) and HbPDAT3b (SEQ ID NO:88).

Figure 12. Sequence alignment of HbPDAT3a (SEQ ID NO:93) and HbPDAT3b (SEQ ID NO:94).

KEY TO THE SEQUENCE LISTING

SEQ ID NO:l - HbFAD2-l cDNA nucleotide sequence

SEQ ID NO:2 - HbFAD2-2 cDNA nucleotide sequence

SEQ ID NO:3 - HbFAD2-3 cDNA nucleotide sequence

SEQ ID NO:4 - HbFAD2-4 cDNA nucleotide sequence

SEQ ID NO:5 - HbFAD2-5 cDNA nucleotide sequence

SEQ ID NO:6 - HbFAD2-6 partial cDNA nucleotide sequence

SEQ ID NO:7 - HbFAD2- 1 amino acid sequence

SEQ ID NO:8 - HbFAD2-2 amino acid sequence

SEQ ID NO:9 - HbFAD2-3 amino acid sequence

SEQ ID NO:10 - HbFAD2-4 amino acid sequence

SEQ ID NO:ll - HbFAD2-5 amino acid sequence

SEQ ID NO:12 - HbFAD2-6 amino acid sequence

SEQ ID NO:13 - Primer (RcD12hyd-SalF)

SEQ ID NO:14 - Primer (RcD12hyd-SalR)

SEQ ID NO:15 - HbGPAT contig 1

SEQ ID NO:16 - HbGPAP contig 2

SEQ ID NO:17 - HbGPAP contig 3

SEQ ID NO:18 - HbGPAT contig 6

SEQ ID NO:19 - HbGPAT contig 7

SEQ ID NO:20 - HbGPAT contig 8 SEQ ID NO:21 - HbGPAT contig 9

SEQ ID NO:22 - HbGPAT contig 21

SEQ ID NO:23 - HbGPAT contig 22

SEQ ID NO:24 - HbGPAT contig 77

SEQ ID NO:25 - HbGPATa (Hb416673) EST nucleotide sequence SEQ ID NO:26 - HbGPATb (Hb416438) EST nucleotide sequence SEQ ID NO:27 - Primer (HbGPAT c9 forward)

SEQ ID NO:28 - Primer (HbGPAT c9 reverse)

SEQ ID NO:29 - Primer (HbGPAT gene forward)

SEQ ID NO:30 - Primer (HbGPAT gene reverse)

SEQ ID NO:31 - HbGPAT9a cDNA nucleotide sequence

SEQ ID NO:32 - HbGPAT9b cDNA nucleotide sequence

SEQ ID NO:33 - HbGPAT9a amino acid sequence

SEQ ID NO:34 - HbGPAT9b amino acid sequence

SEQ ID NO:35 - HbLPAAT-la cDNA nucleotide sequence

SEQ ID NO:36 - HbLPAAT-lb cDNA nucleotide sequence

SEQ ID NO:37 - HbLPAAT-2a cDNA nucleotide sequence

SEQ ID NO:38 - HbLPAAT-2b partial cDNA nucleotide sequence SEQ ID NO:39 - HbLPAAT-3 partial cDNA nucleotide sequence SEQ ID NO:40 - HbLPAAT-4 partial cDNA nucleotide sequence SEQ ID NO:41 - HbLPAAT-la amino acid sequence

SEQ ID NO:42 - HbLPAAT-lb amino acid sequence

SEQ ID NO:43 - HbLPAAT-2a amino acid sequence

SEQ ID NO:44 - HbLPAAT-2b partial amino acid sequence

SEQ ID NO:45 - HbLPAAT-3 partial amino acid sequence

SEQ ID NO:46 - HbLPAAT-4 partial amino acid sequence

SEQ ID NO:47 - HbDGATl contig 1

SEQ ID NO:48 - Polypeptide encoded by SEQ ID NO:47

SEQ ID NO:49 - HbDGATl contig 2

SEQ ID NO:50 - Polypeptide encoded by SEQ ID NO:49

SEQ ID NO:51 - HbOGATla cDNA nucleotide sequence

SEQ ID NO:52 - HbDGATlb cDNA nucleotide sequence

SEQ ID NO:53 - HbDGAT2a amino acid sequence

SEQ ID NO:54 - HbDGAT2b amino acid sequence

SEQ ID NO:55 - HbDGAT3 contig 1

SEQ ID NO:56 - Polypeptide encoded by SEQ ID NO:55 SEQ ID NO:57 HbDGAT3 contig 2

SEQ ID NO:58 Polypeptide encoded by SEQ ID NO:57

SEQ ID NO:59 HbLPCATla (Hb301421) cDNA nucleotide sequence

SEQ ID NO:60 HbLPCATlb cDNA nucleotide sequence

SEQ ID NO:61 HbLPCAT2 (Hb301480) cDNA nucleotide sequence

SEQ ID NO:62 HbLPCATla amino acid sequence

SEQ ID NO:63 HbLPCATlb amino acid sequence

SEQ ID NO:64 HbLPCAT2a amino acid sequence

SEQ ID NO:65 Primer (A1-63050-OF)

SEQ ID NO:66 Primer (A 1-63050-OR)

SEQ ID NO:67 Primer (HbLPCAT-OF)

SEQ ID NO:68 Primer (HbLPCAT- 1 a-OR)

SEQ ID NO:69 Primer (HbLPCAT-2a-OR)

SEQ ID NO:70 HbCPT-la cDNA nucleotide sequence

SEQ ID NO:71 HbCPT-lb cDNA nucleotide sequence

SEQ ID NO:72 HbCPT-2a cDNA nucleotide sequence

SEQ ID NO:73 ■ HbCPT-2b cDNA nucleotide sequence

SEQ ID NO:74 HbCPT-la amino acid sequence

SEQ ID NO:75 HbCPT-lb partial amino acid sequence

SEQ ID NO:76 HbCPT-2a amino acid sequence

SEQ ID NO:77 HbCPT-2b amino acid sequence

SEQ ID NO:78 ■ HbPDCT-la cDNA nucleotide sequence

SEQ ID NO:79 ■ HbPDCT-lb cDNA nucleotide sequence

SEQ ID NO:80 ■ HbPDCT-2a partial cDNA nucleotide sequence

SEQ ID NO:81 ■ HbPDCT-2b partial cDNA nucleotide sequence

SEQ ID NO:82 ■ HbPDCT-la amino acid sequence

SEQ ID NO:83 ■ HbPDCT-lb amino acid sequence

SEQ ID NO:84 ■ HbPDCT-2a partial amino acid sequence

SEQ ID NO:85 ■ HbPDCT-2b partial amino acid sequence

SEQ ID NO:86 ■ HbPDATl partial cDNA nucleotide sequence

SEQ ID NO:87 ■ HbPDAT3a cDNA nucleotide sequence

SEQ ID NO:88 ■ HbPDAT3b partial cDNA nucleotide sequence

SEQ ID NO:89 ■ HbPDAT4 partial cDNA nucleotide sequence

SEQ ID NO:90 ■ HbPDAT5 partial cDNA nucleotide sequence

SEQ ID NO:91 ■ HbPDAT6 partial cDNA nucleotide sequence

SEQ ID NO:92 ■ HbPDATl partial amino acid sequence SEQ ID NO:93 - HbPDAT3a amino acid sequence

SEQ ID NO:94 - HbPDAT3b partial amino acid sequence

SEQ ID NO:95 - HbPDAT4 partial amino acid sequence

SEQ ID NO:96 - HbPDAT5 partial amino acid sequence

SEQ ID NO:97 - HbPDAT6 partial amino acid sequence

SEQ ID NO:98 - HbACBPa cDNA nucleotide sequence

SEQ ID NO:99 - HbACBPb cDNA nucleotide sequence

SEQ ID NO:100 - HbACBPa amino acid sequence

SEQ ID NO:101 - HbACBPb amino acid sequence

SEQ ID NO:102 - Ricinus communis (castor) A12-hydroxylase nucleotide sequence

(RcFAH12, Accession No. U22378)

SEQ ID NO: 103 - Lesquerella fendleri A12-hydroxylase nucleotide sequence

(LfFAH12, Accession No. AF016103)

SEQ ID NO:104 - Physaria lindheimeri A12-hydroxylase nucleotide sequence

(PIFAH12, Accession No. EF432246)

SEQ ID NO:105 - Arabidopsis thaliana A12-desaturase nucleotide sequence (AtFAD2, Accession No. AAA32782)

SEQ ID NO:106 - Claviceps purpurea A12-hydroxylase nucleotide sequence

(CpFAH12, Accession No. EU661785)

SEQ ID NO: 107 - Ricinus communis (castor) A12-hydroxylase polypeptide sequence (RcFAH12; Accession No.AAC49010)

SEQ ID NO: 108 - Lesquerella fendleri A12-hydroxylase polypeptide sequence (LfFAH12, Accession No. AAC32755)

SEQ ID NO:109 - Physaria lindheimeri A12-hydroxylase polypeptide sequence (P1FAH12, Accession No. ABQ01458)

SEQ ID NO:110 - Arabidopsis thaliana A12-desaturase polypeptide sequence

(AtFAD2, Accession No. P46313)

SEQ ID NO:lll - Claviceps purpurea A12-hydroxylase polypeptide sequence

(CpFAH12, Accession No. ACF37070)

SEQ ID NO:112 - Ricinus communis DGAT2 polynucelotide sequence (RcDGAT2; Accession No: EU391592.1)

SEQ ID NO:113 - Ricinus communis DGAT2 polypeptide sequence (RcDGAT2; Accession No. ACB30544.1)

SEQ ID NO: 114 - Ricinus communis PDAT polynucelotide sequence (RcPDAT;

Accession No: XM_002514026 or castor database 29912.m005286) SEQ ID NO: 115 - Ricinus communis PDAT polynucelotide sequence (RcPDAT;

Accession No: XM_002521304 or castor database 29706.m001305)

SEQ ID NO: 116 - Ricinus communis PDAT polynucelotide sequence (RcPDAT;

Accession No: XM_002527387 or castor database 29991.m000626)

SEQ ID NO: 117 - Ricinus communis PDAT polypeptide sequence (RcPDAT;

Accession No. XP_002514072)

SEQ ID NO: 118 - Ricinus communis PDAT polypeptide sequence (RcPDAT;

Accession No. XP_002521350)

SEQ ID NO:119 - Ricinus communis PDAT polypeptide sequence (RcPDAT;

Accession No. XP_002527433)

DETAILED DESCRIPTION OF THE INVENTION

General Techniques and Definitions

Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, fatty acid chemistry and biochemistry).

Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors), Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

The term "and/or", e.g., "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.

As used herein, the term about, unless stated to the contrary, refers to +/- 10%, more preferably +/- 5%, of the designated value. Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Selected Definitions

The term "exogenous" in the context of a polynucleotide or polypeptide refers to the polynucleotide or polypeptide when present in a cell in an altered amount compared to its native state. In one embodiment, the cell is a cell that does not naturally comprise the polynucleotide or polypeptide. In another embodiment, the exogenous polynucleotide or polypeptide is from a different genus to the cell comprising the exogenous polynucleotide or polypeptide. In another embodiment, the exogenous polynucleotide or polypeptide is from a different species. In one embodiment the exogenous polynucleotide or polypeptide is expressed in a host plant or plant cell and the exogenous polynucleotide or polypeptide is from a different species or genus. The exogenous polynucleotide or polypeptide may be non-naturally occurring, such as for example, a synthetic DNA molecule which has been produced by recombinant DNA methods. The DNA molecule may, often preferably, include a protein coding region which has been codon-optimised for expression in the cell, thereby producing a polypeptide which has the same amino acid sequence as a naturally occurring polypeptide, even though the nucleotide sequence of the protein coding region is non- naturally occurring. In one embodiment, the exogenous polynucleotide may encode, or the exogenous polypeptide is a Δ 12 hydroxylase.

As used herein, the term "oil" refers to a composition which comprises at least 60% (w/w) lipid. Oil is typically a liquid at room temperature. Preferably, the lipid predominantly comprises fatty acids that are at least 16 carbons in length. The fatty acids may be free fatty acids and/or in an esterified form. The fatty acids are typically in an esterified form, such as, for example, triacylglycerol (TAG), diacylglycerol (DAG), acyl-Coenzyme A (acyl-CoA) or phospholipid. Oil may be present in or obtained from recombinant cells or from non-human organisms such as plants or yeast, or from plant parts such as seed, leaves or fruit. Oil of the invention may form part of "seedoil" if it is present in or obtained from seed.

As used herein, the term "seedoil" refers to a composition obtained from the seed/grain of a plant which comprises at least 60% (w/w) lipid, or obtainable from the seed/grain if the seedoil is still present in the seed/grain. That is, seedoil of the invention includes seedoil which is present in the seed/grain or portion thereof, as well as seedoil which has been extracted from the seed/grain. The seedoil is preferably extracted seedoil. Seedoil is typically a liquid at room temperature. Preferably, the total fatty acid (TFA) content in the seedoil predominantly (>50%) comprises fatty acids that are at least 16 carbons in length. More preferably, at least 50% of the total fatty acids in the seedoil are CI 8 fatty acids, for example, oleic acid. The fatty acids may be free fatty acids and/or in an esterified form. The fatty acids are typically in an esterified form, such as, for example, triacylglycerol (TAG), diacylglycerol (DAG), acyl-Coenzyme A (acyl-CoA) or phospholipid. In an embodiment, at least 50%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99% of the fatty acids in seedoil of the invention can be found as TAG. In an embodiment, seedoil of the invention is "substantially purified" or "purified" oil that has been separated from one or more other lipids, nucleic acids, polypeptides, or other contaminating molecules with which it is associated in the seed or in a crude extract. It is preferred that the substantially purified seedoil is at least 60% free, more preferably at least 75% free, and more preferably, at least 90% free from other components with which it is associated in the seed or extract. Seedoil of the invention may further comprise non-fatty acid molecules such as, but not limited to, sterols. In an embodiment, the seedoil is canola oil (Brassica napus, Brassica rapa ssp.), mustard oil (Brassica juncea), other Brassica oil (e.g., Brassica napobrassica, Brassica camelina), sunflower oil (Helianthus annus), linseed oil (Linum usitatissimum), soybean oil (Glycine max), safflower oil (Carthamus tinctorius), corn oil (Zea mays), tobacco oil (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm oil (Elaeis guineensis), cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), avocado oil (Persea americana), olive oil (Olea europaea), cashew oil (Anacardium occidentale), macadamia oil (Macadamia inter grifolia), almond oil (Prunus amygdalus), oat seed oil (Avena sativa), rice oil (Oryza sativa or Oryza glaberrima), or Arabidopsis seed oil (Arabidopsis thaliana). Seedoil may be extracted from seed/grain by any method known in the art. This typically involves extraction with nonpolar solvents such as diethyl ether, petroleum ether, chloroform/methanol or butanol mixtures, generally associated with first crushing of the seeds. Lipids associated with the starch in the grain may be extracted with water- saturated butanol. The seedoil may be "de- gummed" by methods known in the art to remove polysaccharides or treated in other ways to remove contaminants or improve purity, stability, or colour. The TAGs and other esters in the seedoil may be hydrolysed to release free fatty acids, or the seedoil hydrogenated, treated chemically, or enzymatically as known in the art.

As used herein, the term "fatty acid" refers to a carboxylic acid with a long aliphatic tail of at least 8 carbon atoms in length, either saturated or unsaturated. Typically, fatty acids have a carbon-carbon bonded chain of at least 12 carbons in length. Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate which has two carbon atoms. The fatty acids may be in a free state (non-esterified) or in an esterified form such as part of a triacylglycerol (TAG), diacylglycerol (DAG), acyl-Coenzyme A (acyl-CoA) (thio- ester) bound, or other covalently bound form. When covalently bound in an esterified form, the fatty acid is referred to herein as an "acyl" group. The fatty acid may be esterified as a phospholipid such as a phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, or diphosphatidylglycerol.

"Saturated fatty acids" do not contain any double bonds or other functional groups along the chain. The term "saturated" refers to hydrogen, in that all carbons (apart from the carboxylic acid [-COOH] group) contain as many hydrogens as possible. In other words, the omega (ω) end contains 3 hydrogens (CH3-) and each carbon within the chain contains 2 hydrogens (-CH2-).

"Unsaturated fatty acids" are of similar form to saturated fatty acids, except that one or more alkene functional groups exist along the chain, with each alkene substituting a singly-bonded "-CH2-CH2-" part of the chain with a doubly-bonded "- CH=CH-" portion (that is, a carbon double bonded to another carbon). The two next carbon atoms in the chain that are bound to either side of the double bond can occur in a cis or trans configuration.

As used herein, the term "monounsaturated fatty acid" refers to a fatty acid which comprises at least 12 carbon atoms in its carbon chain and only one alkene group in the chain.

As used herein, the term "polyunsaturated fatty acid" (PUFA) refers to a fatty acid which comprises at least 12 carbon atoms in its carbon chain and at least two alkene groups (carbon-carbon double bonds). Ordinarily, the number of carbon atoms in the carbon chain of the fatty acids refers to an unbranched carbon chain. If the carbon chain is branched, the number of carbon atoms excludes those in sidegroups. The polyunsaturated fatty acid may be an co3 fatty acid, that is, having a desaturation (carbon-carbon double bond) in the third carbon-carbon bond from the methyl end of the fatty acid. Alternatively, the polyunsaturated fatty acid may be an co6 fatty acid, that is, having a desaturation (carbon-carbon double bond) in the sixth carbon-carbon bond from the methyl end of the fatty acid.

As used herein, the term "long-chain polyunsaturated fatty acid" (LC-PUFA") refers to a fatty acid which comprises at least 20 carbon atoms in its carbon chain and at least two carbon-carbon double bonds.

"Monoacylglyceride" (MAG) is glyceride in which the glycerol is esterified with one fatty acid. As used herein, MAG comprises a hydroxyl group at an sn-l/3 (also referred to herein as sn-l MAG or 1-MAG or 1/3-MAG) or sn-2 position (also referred to herein as 2-MAG), and therefore MAG does not include phosphorylated molecules such as phosphatidic acid phosphatidic acid (PA) or phosphatidylcholine (PC). MAG is thus a component of neutral lipids in a cell.

"Diacylglyceride" or "DAG" is glyceride in which the glycerol is esterified with two fatty acids. As used herein, DAG comprises a hydroxyl group at a sn-l,3 or sn- 1,2/2,3 position, and therefore DAG does not include phosphorylated molecules such as PA or PC. DAG is thus a component of neutral lipids in a cell. In the Kennedy pathway of DAG synthesis, the precursor sTi-glycerol-3-phosphate (G-3-P) is esterified to two acyl groups, each coming from a fatty acid coenzyme A ester, in a first reaction catalysed by a glycerol- 3 -phosphate acyltransferase (GPAT) at position sn-l to form LysoPA, followed by a second acylation at position sn-2 catalysed by a lysophosphatidic acid acyltransferase (LPAAT) to form phosphatidic acid (PA). This intermediate is then de-phosphorylated to form DAG. In an alternative anabolic pathway, DAG may be formed by the acylation of either sn- 1 MAG or preferably sn-2 MAG, catalysed by monoacylglycerol acyltransferase (MGAT). DAG may also be formed from TAG by removal of an acyl group by a lipase, or from phosphatidylcholine (PC) essentially by removal of a choline headgroup by any of the enzymes CDP-choline diacylglycerol choline phosphotransferase (CPT), phosphatidylcholine :diacylglycerol choline phosphotransferase (PDCT) or phospholipase C (PLC).

"Triacylglyceride" (TAG) is glyceride in which the glycerol is esterified with three fatty acids. In the Kennedy pathway of TAG synthesis, the precursor s¾-glycerol- 3-phosphate is esterified by a fatty acid Coenzyme A (CoA) ester in a reaction catalysed by a glycerol- 3 -phosphate acyltransferase (GPAT) at position sn-l to form lysophosphatidic acid (sn-l LP A), and this is in turn acylated by an acylglycerophosphate acyltransferase in position sn-2 to form phosphatidic acid (PA). The phosphate group is removed by the enzyme phosphatidic phosphohydrolase (PAP), and the resultant l,2-diacyl-s¾-glycerol (DAG) is acylated by a diacylglycerol acyltransferase to form the triacyl-sw-glycerol (TAG).

"Δ12 hydroxylase" or "fatty acid Δ12 hydroxylase" as used herein, refers to an enzyme that introduces a hydroxyl group into the 12 ^th carbon of a fatty acid Hydroxylases may also have enzyme activity as a fatty acid desaturase. Examples of A12-hydroxylases include SEQ ID NO: 9 and 10 of the present invention, those from Ricinus communis (U22378, van de Loo 1995, SEQ ID NO: 107); Physaria lindheimeri, (ABQ01458, Dauk et al., 2007, SEQ ID NO: 109); Lesquerella fendleri, (AAC32755, Broun et al., 1998, SEQ ID NO: 108); and Daucus carota, (AAK30206), as well as variants and/or mutants thereof. The term "fatty acid Δ12 hydroxylase" does not include fatty acid hydroxylases which hydroxylate the terminus of fatty acids such as, for example, A, thaliana CYP86A1 (P48422, fatty acid ω-hydroxylase); Vicia sativa CYP94A1 (P98188, fatty acid ω-hydroxylase); mouse CYP2E1 (X62595, lauric acid co- l hydroxylase); rat CYP4A1 (M57718, fatty acid ω-hydroxylase), as well as variants and/or mutants thereof.

The level of production of a hydroxylated fatty acid(s) (for example, 12 hydroxyoleic acid, also referred to herein as ricinoleic acid (RA)) in a recombinant cell may also be expressed as a conversion ratio, that is, the amount of the hydroxylated fatty acid(s) formed as a percentage of one or more substrate fatty acids. For a Δ12- hydroxylase, the formula for the conversion ratio is: (%RA and any fatty acid products derived from RA) x 100 / (% oleic acid + RA and any fatty acid products derived from RA). This is referred to herein as the "efficiency of conversion". In a preferred embodiment, the "efficiency of conversion" is determined by analysing a recombinant cell as described in Example 4.

As used herein, the term "acyltransferase" refers to a protein which is capable of transferring an acyl group from acyl-Coenzyme A (acyl-CoA) onto a substrate and includes monoacylglycerol acyltransferases (MGATs), glycerol-3-phosphate acyltransferases (GPATs) and diacylglycerol acyltransferases (DGATs).

As used herein, the term "diacylglycerol acyltransferase" (DGAT) refers to a protein which transfers a fatty acyl group from acyl-Coenzyme A (acyl-CoA) to a diacylglycerol (DAG) substrate to produce triacylglycerol (TAG). Thus, the term "diacylglycerol acyltransferase activity" refers to the transfer of an acyl group from acyl-CoA to DAG to produce TAG. Preferably, a DGAT has little or no detectable MGAT activity, for example, less than 300 pmol/min/mg protein, preferably less than 200 pmol/min/mg protein, more preferably 100 pmol/min/mg protein. There are three known types of DGAT, referred to as DGAT1, DGAT2 and DGAT3, respectively. DGAT1 polypeptides typically have 10 transmembrane domains, DGAT2 polypeptides typically have 2 transmembrane domains, whilst DGAT3 polypeptides typically have none and are thought to be soluble in the cytoplasm, not integrated into membranes. Examples of DGAT1 polypeptides include those from Aspergillus fumigatus (Accession No. XP_755172), Arabidopsis thaliana (CAB44774), Ricinus communis (AAR11479), Vernicia fordii (ABC94472), Vernonia galamensis (ABV21945, ABV21946), Euonymus alatus (AAV31083), Caenorhabditis elegans (AAF82410), Rattus norvegicus (NP_445889), Homo sapiens (NP_036211), as well as variants and/or mutants thereof. Examples of DGAT2 polypeptides include those from A. thaliana (NP_566952.1), R. communis (AAY16324.1), V. fordii (ABC94474.1), Mortierella ramanniana (AAK84179.1), Homo sapiens (Q96PD7.2 and Q58HT5.1), Bos taurus (Q70VZ8.1), Mus musculus (AAK84175.1), as well as variants and/or mutants thereof. Examples of DGAT3 polypeptides include those from peanut (Arachis hypogaea, Saha, et al., 2006), as well as variants and/or mutants thereof.

As used herein, the term "monoacylglycerol acyltransferase" (MGAT) refers to a protein which transfers a fatty acyl group from acyl-Coenzyme A (acyl-CoA) to a monoacylglycerol (MAG) substrate to produce diacylglycerol (DAG). Thus, the term "monoacylglycerol acyltransferase activity" at least refers to the transfer of an acyl group from acyl-CoA to MAG to produce DAG. MGAT is best known for its role in fat absorption in the intestine of mammals, where the fatty acids and sn-2 MAG generated from the digestion of dietary fat are resynthesized into TAG in enterocytes for chylomicron synthesis and secretion. MGAT catalyzes the first step of this process, in which the acyl group from fatty acyl-CoA, formed from fatty acids and CoA, and sn- 2 MAG are covalently joined. The term "MGAT" as used herein includes enzymes that act on sn-l/3 MAG and/or sn-2 MAG substrates to form sn- 1,3 DAG and/or sn- 1,2/2,3- DAG, respectively. In a preferred embodiment, the MGAT has a preference for sn-2 MAG substrate relative to sn-1 MAG, or substantially uses only sn-2 MAG as substrate (examples include MGATs described in Cao et al., 2003; Yen and Farese, 2003; and Cheng et al., 2003).

As used herein, "MGAT" does not include enzymes which transfer an acyl group preferentially to LysoPA relative to MAG, such enzymes are known as LPAATs. That is, a MGAT preferentially uses non-phosphorylated monoacyl substrates, even though they may have low catalytic activity on LysoPA. A preferred MGAT does not have detectable activity in acylating LysoPA. A MGAT (e.g., M. musculus MGAT2) may also have DGAT function but predominantly functions as a MGAT, that is, it has greater catalytic activity as a MGAT than as a DGAT when the enzyme activity is expressed in units of nmoles product/min/mg protein (see Yen et al., 2002).

There are three known classes of MGAT, referred to as, MGATl, MGAT2 and MGAT3, respectively. Homologs of the human MGATl gene (AF384163) are present (i.e. sequences are known) at least in chimpanzee, dog, cow, mouse, rat, zebrafish, Caenorhabditis elegans, Schizosaccharomyces pombe, Saccharomyces cerevisiae, Kluyveromyces lactis, Eremothecium gossypii, Magnaporthe grisea, and Neurospora crassa. Homologs of the human MGAT2 gene (AY157608) are present at least in chimpanzee, dog, cow, mouse, rat, chicken, zebrafish, fruit fly, and mosquito. Homologs of the human MGAT3 gene (AY229854) are present at least in chimpanzee, dog, cow, and zebrafish. However, homologs from other organisms can be readily identified by methods known in the art for identifying homologous sequences.

Examples of MGATl polypeptides include proteins encoded by MGATl genes from Homo sapiens (AF384163), Mus musculus (AF384162), Pan troglodytes (XM_001166055, XM_0526044.2), Canis familiaris (XM_545667.2), Bos taurus (NM_001001153.2), Rattus norvegicus (NM_001108803.1), Danio rerio MGATl (NM_001122623.1), Caenorhabditis elegans (NM_073012.4, NM_182380.5, NM_065258.3, NM_075068.3, NM_072248.3), Kluyveromyces lactis (XM_455588.1), Ashbya gossypii (NM_208895.1), Magnaporthe oryzae (XM_368741.1), Ciona intestinalis predicted (XM_002120843.1). Examples of MGAT2 polypeptides include proteins encoded by MGAT2 genes from Homo sapiens (AY157608), Mus musculus (AY157609), Pan troglodytes (XM_522112.2), Canis familiaris (XM_542304.1), Bos taurus (NM_001099136.1), Rattus norvegicus, Gallus gallus (XM_424082.2), Danio rerio (NM_001006083.1), Drosophila melanogaster (NM_136474.2, NM_136473.2, NM_136475.2), Anopheles gambiae (XM_001688709.1, XM_315985), Tribolium castaneum (XM_970053.1). Examples of MGAT3 polypeptides include proteins encoded by MGAT3 genes from Homo sapiens (AY229854), Pan troglodytes (XM .001154107.1, XM_001154171.1, XM_527842.2), Canis familiaris (XM_845212.1), Bos taurus (XM_870406.4), Danio rerio (XM_688413.4).

As used herein, the term "glycerol-3-phosphate acyltransferase" (GPAT) refers to a protein which acylates sTi-glycerol-3-phosphate (G-3-P) to form l-acyl-sn-glycerol- 3-phosphate (sn-l G-3-P). Thus, the term "glycerol- 3 -phosphate acyltransferase activity" refers to the acylation of G-3-P to form sn-l G-3-P.

As used herein, the term "phosphatidylcholine diacylglycerol acyltransferase"

(PDAT) refers to a protein which transfers an acyl group from phosphatidylcholine (PC) to diacylglycerol (DAG). Thus, the term "phosphatidylcholine diacylglycerol acyltransferase activity" refers to the transfer of PC onto DAG to produce triacylglycerol.

As used herein, the term "CDP-choline diacylglycerol choline phosphotransferase" (CPT), refers to a protein which reversibly transfers phosphatidylcholine groups onto diacylglycerol (DAG). Thus, the term "CDP-choline diacylglycerol choline phosphotransferase activity" refers to the reversible transfer of phosphatidylcholine groups onto DAG.

As used herein, the term "acyl-Coenzyme A (acyl- CoA):lysophosphatidylcholine acyltransferase" (LPCAT) refers to a protein which reversibly catalyzes the acyl-CoA-dependent acylation of lysophophatidylcholine (LPC) to produce phosphatidylcholine (PC) and Coenzyme A (Co A). Thus, the term "acyl-CoA:lysophosphatidylcholine acyltransferase activity" refers to the reversible acylation of lysophophatidylcholine to produce PC and CoA.

As used herein, the term " l-acyl-glycerol-3-phosphate acyltransferase"

(LPAAT) refers to a protein which acylates sTi-l-acyl-glycerol-3-phosphate (sn-l G-3- P) at the sn-2 position to form phosphatidic acid (PA). Thus, the term " 1-acyl-glycerol- 3-phosphate acyltransferase activity" refers to the acylation of (sn-l G-3-P) at the sn-2 position to produce PA.

As used herein, the term "phosphatidylcholine:diacylglycerol choline phosphotransferase" (PDCT) refers to a protein that catalyzes transfer of the phosphocholine headgroup from phosphatidylcholine (PC) to diacylglycerol (DAG).

As used herein, the term "acyl-Coenzyme A (acyl-CoA) binding protein" (ACBP) refers to a protein that binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters.

As used herein, the term "desaturase" or "fatty acid desaturase" and variations thereof refer to an enzyme which removes two hydrogen atoms from the carbon chain of the fatty acid creating a carbon-carbon double bond. Desaturases are classified as; i) delta - indicating that the double bond is created at a fixed position from the carboxyl group of a fatty acid (for example, Δ12 desaturase creates a double bond at the 12th position from the carboxyl end), or ii) omega (e.g., ω3 desaturase) - indicating the double bond is created at a specific position from the methyl end of the fatty acid.

Biochemical evidence suggests that the fatty acid elongation consists of 4 steps: condensation, reduction, dehydration and a second reduction. In the context of this invention, an "elongase" refers to the polypeptide that catalyses the condensing step in the presence of the other members of the elongation complex, under suitable physiological conditions. It has been shown that heterologous or homologous expression in a cell of only the condensing component ("elongase") of the elongation protein complex is required for the elongation of the respective acyl chain. Thus the introduced elongase is able to successfully recruit the reduction and dehydration activities from the transgenic host to carry out successful acyl elongations. The specificity of the elongation reaction with respect to chain length and the degree of desaturation of fatty acid substrates is thought to reside in the condensing component. This component is also thought to be rate limiting in the elongation reaction. Two groups of condensing enzymes have been identified so far. The first are involved in the extension of saturated and monounsaturated fatty acids (CI 8-22) such as, for example, the FAE1 gene of Arabidopsis. An example of a product formed is erucic acid (22: 1) in Brassicas. This group are designated the FAE-like enzymes and do not appear to have a role in long-chain polyunsaturated fatty acids (LC-PUFA) biosynthesis. The other identified class of fatty acid elongases, designated the ELO family of elongases, are named after the ELO genes whose activities are required for the synthesis of the very long-chain fatty acids of sphingolipids in yeast. Apparent paralogs of the ELO-type elongases isolated from LC-PUFA synthesizing organisms like algae, mosses, fungi and nematodes have been shown to be involved in the elongation and synthesis of LC- PUFA. Examples of elongases include those described in WO 2005/103253.

The term "transgenic non-human organism" refers to, for example, a whole plant, alga, non-human animal, or an organism suitable for fermentation such as a yeast or fungus, comprising an exogenous polynucleotide (transgene) or an exogenous polypeptide. In an embodiment, the transgenic non-human organism is not an animal or part thereof. In one embodiment, the transgenic non-human organism is a phototrophic organism (for example, a plant or alga) capable of obtaining energy from sunlight to synthesize organic compounds for nutrition. In another embodiment, the transgenic non-human organism is a photosyntheic bacterium.

As used herein, the phrase "does not significantly effect the production and/or activity of an enzyme encoded by a transgene" means that the level of activity of the enzyme is at least 75%, more preferably at least 90%, of the level of an isogenic transgenic cell lacking the exogenous polynucleotide that down regulates the production and/or activity of an endogenous enzyme.

As used herein, the term "wild-type" or variations thereof refers to a cell, or transgenic non-human organism or part thereof that has not been modified according to the invention. "Isogenic" refers to a cell, or transgenic non-human organism or part thereof which differs from a reference cell, or transgenic non-human organism or part thereof, generally not more than a few such as two, three or four, genetic loci, resulting in an alteration of one or more traits. The genetic locus (loci) may have a single gene or genetic construct, or multiple genes or genetic constructs (generally not more than a few such as two, three or four), typically a transgene(s). A "corresponding" cell, or transgenic non-human organism or part thereof as used herein refers to a second cell, or transgenic non-human organism or part thereof which lacks the gene(s) or construct(s), which differs from the first cell, or transgenic non-human organism or part thereof essentially by only that gene(s) or construct(s), and which typically has been treated in the same manner, for example, temperature, culture conditions, etc., as the first. An isogenic wildtype cell, or transgenic non-human organism or a part thereof may be used as a control to compare levels of expression of an exogenous polynucleotide or the extent and nature of trait modification with cells, or transgenic non-human organism or part thereof modified as described herein. Polynucleotides

The terms "polynucleotide", and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide of the invention may be of genomic, cDNA, semisynthetic, or synthetic origin, double- stranded or single- stranded and by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature, (2) is linked to a polynucleotide other than that to which it is linked in nature, or (3) does not occur in nature. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, locus (loci) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, chimeric DNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization such as by conjugation with a labeling component.

By "isolated polynucleotide" it is meant a polynucleotide which has generally been separated from the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from the polynucleotide sequences with which it is naturally associated or linked.

As used herein, the term "gene" is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of at least about 2 kb on either end and which are involved in expression of the gene. In this regard, the gene includes control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals, in which case, the gene is referred to as a "chimeric gene". The sequences which are located 5' of the protein coding region and which are present on the mRNA are referred to as 5' non-translated sequences. The sequences which are located 3' or downstream of the protein coding region and which are present on the mRNA are referred to as 3' non-translated sequences.

The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region which may be interrupted with non-coding sequences termed "introns", "intervening regions", or "intervening sequences." Introns are segments of a gene which are transcribed into nuclear RNA (nRNA). Introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the mRNA transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.

As used herein, "chimeric DNA" refers to any DNA molecule that is not naturally found in nature; also referred to herein as a "DNA construct". Typically, chimeric DNA comprises regulatory and transcribed or protein coding sequences that are not naturally found together in nature. Accordingly, chimeric DNA may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. The open reading frame may or may not be linked to its natural upstream and downstream regulatory elements. The open reading frame may be incorporated into, for example, the plant genome, in a non- natural location, or in a replicon or vector where it is not naturally found such as a bacterial plasmid or a viral vector. The term "chimeric DNA" is not limited to DNA molecules which are replicable in a host, but includes DNA capable of being ligated into a replicon by, for example, specific adaptor sequences.

A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The terms "genetically modified", "transgenic" and variations thereof include introducing a gene into a cell by transformation or transduction, mutating a gene in a cell and genetically altering or modulating the regulation of a gene in a cell, or the progeny of any cell modified as described above.

A "genomic region" as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a cluster), have been inserted into a cell, or predecessor thereof. Such regions only comprise nucleotides that have been incorporated by the intervention of man such as by methods described herein.

A "recombinant polynucleotide" of the invention refers to a nucleic acid molecule which has been constructed or modified by artificial recombinant methods. The recombinant polynucleotide may be present in a cell in an altered amount or expressed at an altered rate (e.g., in the case of mRNA) compared to its native state. In one embodiment, the polynucleotide is introduced into a cell that does not naturally comprise the polynucleotide. Typically an exogenous DNA is used as a template for transcription of mRNA which is then translated into a continuous sequence of amino acid residues coding for a polypeptide of the invention within the transformed cell. In another embodiment, the polynucleotide is endogenous to the cell and its expression is altered by recombinant means, for example, an exogenous control sequence is introduced upstream of an endogenous gene of interest to enable the transformed cell to express the polypeptide encoded by the gene.

A recombinant polynucleotide of the invention includes a polynucleotides which has not been separated from other components of the cell-based or cell-free expression system, in which it is present, and a polynucleotide produced in said cell-based or cell- free system which is subsequently purified away from at least some other components. The polynucleotide can be a contiguous stretch of nucleotides existing in nature, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide. Typically, such chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.

With regard to the defined polynucleotides, it will be appreciated that % identity figures higher than those provided herein will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence which is at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.

In one embodiment, the exogenous polynucleotide encodes a glycerol-3- phosphate acyltransferase (GPAT) comprising one or more of:

i) a sequence of nucleotides selected from any one of SEQ ID NOs: 15 to 26, 31 and 32,

ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in SEQ ID NOs:33 or 34, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a glycerol-3- phosphate acyltransferase 9 (GPAT9) comprising one or more of:

i) a sequence of nucleotides selected from SEQ ID NOs:31 or 32, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in SEQ ID NOs:33 or 34, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a 1-acyl- glycerol- 3 -phosphate acyltransferase (LPAAT) comprising one or more of:

i) a sequence of nucleotides selected from any one of SEQ ID NOs:35 to 40, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:41 to 46, or a biologically active fragment thereof, iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a diacylglycerol acyltransferase (DGAT) comprising one or more of:

i) a sequence of nucleotides selected from any one of SEQ ID NOs:47, 49, 51, 52, 55 and 57,

ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:48, 50, 53, 54, 56 and 58, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a diacylglycerol acyltransferase 1 (DGAT1) comprising one or more of:

i) a sequence of nucleotides selected from SEQ ID NOs:47 or 49, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in SEQ ID NOs:48 or 50, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a diacylglycerol acyltransferase 2 (DGAT2) comprising one or more of:

i) a sequence of nucleotides selected from SEQ ID NOs:51 or 52, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in SEQ ID NOs:53 or 54, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a diacylglycerol acyltransferase 3 (DGAT3) comprising one or more of:

i) a sequence of nucleotides selected from SEQ ID NOs:55 or 57, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in SEQ ID NOs:56 or 58, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a acyl- CoA:lysophosphatidylcholine acyltransferase (LPCAT) comprising one or more of: i) a sequence of nucleotides selected from any one of SEQ ID NOs:59 to 61, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:62 to 64, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a CDP-choline diacylglycerol choline phosphotransferase (CPT) comprising one or more of:

i) a sequence of nucleotides selected from any one of SEQ ID NOs:70 to 73, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:74 to 77, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a phosphatidylcholine: diacylglycerol choline phosphotransferase (PDCT) comprising one or more of:

i) a sequence of nucleotides selected from any one of SEQ ID NOs:78 to 81, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:82 to 85, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes a phoshatidylcholine diacylglycerol acyltransferase (PDAT) comprising one or more of: i) a sequence of nucleotides selected from any one of SEQ ID NOs:86 to 91, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:92 to 97, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

In another embodiment, the exogenous polynucleotide encodes an Acyl-CoA binding protein (ACBP) comprising one or more of:

i) a sequence of nucleotides selected from SEQ ID NOs:99 or 99, ii) a sequence of nucleotides encoding a polypeptide comprising amino acids having a sequence as provided in SEQ ID NOs: 100 or 101, or a biologically active fragment thereof,

iii) a sequence of nucleotides which is at least 60% identical to i) or ii), and iv) a sequence of nucleotides which hybridizes to any one of i) to iii) under stringent conditions.

A polynucleotide of, or useful for, the present invention may selectively hybridise, under stringent conditions, to a polynucleotide defined herein. As used herein, stringent conditions are those that: (1) employ during hybridisation a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% (w/v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (2) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS, and/or (3) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at 50°C.

Polynucleotides of the invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Polynucleotides which have mutations relative to a reference sequence can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid). Polynucleotide for Reducing Expression Levels of Endogenous Proteins

RNA Interference

RNA interference (RNAi) is particularly useful for specifically inhibiting the production of a particular protein. Although not wishing to be limited by theory, Waterhouse et al. (1998) have provided a model for the mechanism by which double stranded RNA (dsRNA; duplex RNA) can be used to reduce protein production. This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest or part thereof. Conveniently, the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti- sense sequences to hybridize to form the dsRNA molecule with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules is well within the capacity of a person skilled in the art, particularly considering Waterhouse et al. (1998), Smith et al. (2000), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.

In one example, a DNA is introduced that directs the synthesis of an at least partly double stranded RNA product(s) with homology to the target gene to be inactivated. The DNA therefore comprises both sense and antisense sequences that, when transcribed into RNA, can hybridize to form the double stranded RNA region. In one example, the sense and antisense sequences are separated by a spacer region that comprises an intron which, when transcribed into RNA, is spliced out. This arrangement has been shown to result in a higher efficiency of gene silencing. The double stranded region may comprise one or two RNA molecules, transcribed from either one DNA region or two. The presence of the double stranded molecule is thought to trigger a response from an endogenous system that destroys both the double stranded RNA and also the homologous RNA transcript from the target gene, efficiently reducing or eliminating the activity of the target gene.

The length of the sense and antisense sequences that hybridize should each be at least 19 contiguous nucleotides. The full-length sequence corresponding to the entire gene transcript may be used. The degree of identity of the sense and antisense sequences to the targeted transcript should be at least 85%, at least 90%, or at least 95- 100%. The RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule. The RNA molecule may be expressed under the control of a RNA polymerase II or RNA polymerase III promoter. Examples of the latter include transfer RNA (tRNA) or small nuclear (snRNA) promoters. Preferred small interfering RNA ("siRNA") molecules comprise a nucleotide sequence that is identical to about 19-21 contiguous nucleotides of the target mRNA. Preferably, the siRNA sequence commences with the dinucleotide AA, comprises a GC-content of about 30-70% (preferably, 30-60%, more preferably 40-60% and more preferably about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the organism in which it is to be introduced, for example, as determined by standard BLAST search. microRNA

MicroRNA (miRNA) molecules are generally 19-25 nucleotides (commonly about 20-24 nucleotides in plants) non-coding RNA molecules that are derived from larger precursors that form imperfect stem-loop structures.

miRNA molecules bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing.

In plant cells, miRNA precursor molecules are believed to be largely processed in the nucleus. The pri-miRNA (containing one or more local double- stranded or "hairpin" regions as well as the usual 5' "cap" and polyadenylated tail of an mRNA) is processed to a shorter miRNA precursor molecule that also includes a stem-loop or fold-back structure and is termed the "pre-miRNA". In plants, the pre-miRNAs are cleaved by distinct DICER-like (DCL) enzymes, yielding miRNA:miRNA duplexes. Prior to transport out of the nucleus, these duplexes are methylated.

In the cytoplasm, the miRNA strand from the miRNA:miRNA duplex is selectively incorporated into an active RNA-induced silencing complex (RISC) for target recognition. The RISC- complexes contain a particular subset of Argonaute proteins that exert sequence- specific gene repression (see, for example, Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005).

Cosuppression

Genes can suppress the expression of related endogenous genes and/or transgenes already present in the genome, a phenomenon termed homology-dependent gene silencing. Most of the instances of homology dependent gene silencing fall into two classes - those that function at the level of transcription of the transgene, and those that operate post-transcriptionally.

Post-transcriptional homology-dependent gene silencing (i.e., cosuppression) describes the loss of expression of a transgene and related endogenous or viral genes in transgenic plants. Cosuppression often, but not always, occurs when transgene transcripts are abundant, and it is generally thought to be triggered at the level of mRNA processing, localization, and/or degradation. Several models exist to explain how cosuppression works (see in Taylor, 1997).

One model, the "quantitative" or "RNA threshold" model, proposes that cells can cope with the accumulation of large amounts of transgene transcripts, but only up to a point. Once that critical threshold has been crossed, the sequence-dependent degradation of both transgene and related endogenous gene transcripts is initiated. It has been proposed that this mode of cosuppression may be triggered following the synthesis of copy RNA (cRNA) molecules by reverse transcription of the excess transgene mRNA, presumably by endogenous RNA-dependent RNA polymerases. These cRNAs may hybridize with transgene and endogenous mRNAs, the unusual hybrids targeting homologous transcripts for degradation. However, this model does not account for reports suggesting that cosuppression can apparently occur in the absence of transgene transcription and/or without the detectable accumulation of transgene transcripts.

To account for these data, a second model, the "qualitative" or "aberrant RNA" model, proposes that interactions between transgene RNA and DNA and/or between endogenous and introduced DNAs lead to the methylation of transcribed regions of the genes. The methylated genes are proposed to produce RNAs that are in some way aberrant, their anomalous features triggering the specific degradation of all related transcripts. Such aberrant RNAs may be produced by complex transgene loci, particularly those that contain inverted repeats.

A third model proposes that intermolecular base pairing between transcripts, rather than cRNA-mRNA hybrids generated through the action of an RNA-dependent RNA polymerase, may trigger cosuppression. Such base pairing may become more common as transcript levels rise, the putative double- stranded regions triggering the targeted degradation of homologous transcripts. A similar model proposes intramolecular base pairing instead of intermolecular base pairing between transcripts.

Cosuppression involves introducing an extra copy of a gene or a fragment thereof into a plant in the sense orientation with respect to a promoter for its expression. A skilled person would appreciate that the size of the sense fragment, its correspondence to target gene regions, and its degree of sequence identity to the target gene can vary. In some instances, the additional copy of the gene sequence interferes with the expression of the target plant gene. Reference is made to WO 97/20936 and EP 0465572 for methods of implementing co- suppression approaches. Antisense Polynucleotides

The term "antisense polynucletoide" shall be taken to mean a DNA or RNA, or chimeric DNA/RNA molecule that is complementary to at least a portion of a specific mRNA molecule encoding an endogenous polypeptide and capable of interfering with a post-transcriptional event such as mRNA translation. The use of antisense methods is well known in the art (see for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)). The use of antisense techniques in plants has been reviewed by Bourque (1995) and Senior (1998). Bourque (1995) lists a large number of examples of how antisense sequences have been utilized in plant systems as a method of gene inactivation. Bourque also states that attaining 100% inhibition of any enzyme activity may not be necessary as partial inhibition will more than likely result in measurable change in the system. Senior (1998) states that antisense methods are now a very well established technique for manipulating gene expression.

In one example, the antisense polynucleotide hybridises under physiological conditions, that is, the antisense polynucleotide (which is fully or partially single stranded) is at least capable of forming a double stranded polynucleotide with mRNA encoding a protein such as an endogenous enzyme, for example, diacylglycerol acyltransferase (DGAT), glycerol-3-phosphate acyltransferase (GPAT), 1-acyl- glycerol- 3 -phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A2 (PLA2), phospholipase D (PLD), CDP- choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), a desaturase, or an elongase, or a combination of two or more thereof, under normal conditions in a cell.

Antisense molecules may include sequences that correspond to the structural genes or for sequences that effect control over the gene expression or splicing event. For example, the antisense sequence may correspond to the targeted coding region of endogenous gene, or the 5'-untranslated region (UTR) or the 3'-UTR or combination of these. It may be complementary in part to intron sequences, which may be spliced out during or after transcription, preferably only to exon sequences of the target gene. In view of the generally greater divergence of the UTRs, targeting these regions provides greater specificity of gene inhibition.

The length of the antisense sequence should be at least 19 contiguous nucleotides, preferably at least 50 nucleotides, and more preferably at least 100, 200, 500 or 1000 nucleotides. The full-length sequence complementary to the entire gene transcript may be used. The length is most preferably 100-2000 nucleotides. The degree of identity of the antisense sequence to the targeted transcript should be at least 90% and more preferably 95-100%. The antisense RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule.

Catalytic Polynucleotides

The term "catalytic polynucleotide" refers to a DNA molecule or DNA- containing molecule (also known in the art as a "deoxyribozyme") or an RNA or RNA- containing molecule (also known as a "ribozyme") which specifically recognizes a distinct substrate and catalyses the chemical modification of this substrate. The nucleic acid bases in the catalytic nucleic acid can be bases A, C, G, T (and U for RNA).

Typically, the catalytic polynucleotide contains an antisense sequence for specific recognition of a target polynucleotide, and a nucleic acid cleaving enzymatic activity (also referred to herein as the "catalytic domain"). The types of ribozymes that are particularly useful in this invention are hammerhead ribozymes (Haseloff and Gerlach, 1988; Perriman et al., 1992) and hairpin ribozymes (Zolotukiin et al., 1996; Klein et al., 1998; Shippy et al., 1999).

Ribozymes useful in the invention and DNA encoding the ribozymes can be chemically synthesized using methods well known in the art. The ribozymes can also be prepared from a DNA molecule (that upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, for example, the promoter for T7 RNA polymerase or SP6 RNA polymerase. In a separate embodiment, the DNA can be inserted into an expression cassette or transcription cassette. After synthesis, the RNA molecule can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase.

As with antisense oligonucleotides, small interfering RNA (siRNA) and microRNA (miRNA) described herein, catalytic polynucleotides useful in the invention should be capable of "hybridizing" the target nucleic acid molecule under "physiological conditions", namely those conditions within a plant, algal or fungal cell.

Recombinant Vectors

One embodiment of the present invention includes a recombinant vector, which comprises at least one polynucleotide defined herein and is capable of delivering the polynucleotide into a host cell. Recombinant vectors include expression vectors. Recombinant vectors contain heterologous polynucleotide sequences, that is, polynucleotide sequences that are not naturally found adjacent to a polynucleotide defined herein, that preferably, are derived from a different species. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a viral vector, derived from a virus, or a plasmid. Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic cells, for example, pUC-derived vectors, pSK- derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions. Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.

"Operably linked" as used herein, refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element (promoter) to a transcribed sequence. For example, a promoter is operably linked to a coding sequence of a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell. Generally, promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, that is, they are ds-acting. However, some transcriptional regulatory elements such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.

When there are multiple promoters present, each promoter may independently be the same or different.

Recombinant vectors may also contain: (a) one or more secretory signals which encode signal peptide sequences, to enable an expressed polypeptide defined herein to be secreted from the cell that produces the polypeptide, or which provide for localisation of the expressed polypeptide, for example, for retention of the polypeptide in the endoplasmic reticulum (ER) in the cell, or transfer into a plastid, and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion or localisation of a polypeptide defined herein. Preferred signal segments include, but are not limited to, Nicotiana nectarin signal peptide (US 5,939,288), tobacco extensin signal, or the soy oleosin oil body binding protein signal. Recombinant vectors may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequence of a polynucleotide defined herein. To facilitate identification of transformants, the recombinant vector desirably comprises a selectable or screenable marker gene as, or in addition to, the nucleic acid sequence of a polynucleotide defined herein. By "marker gene" is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus, allows such transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene confers a trait for which one can "select" based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells). A screenable marker gene (or reporter gene) confers a trait that one can identify through observation or testing, that is, by "screening" (e.g., β-glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells). The marker gene and the nucleotide sequence of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in US 4,399,216, is also an efficient process in for example, plant transformation. The actual choice of a marker is not crucial as long as it is functional (i.e., selective or screenable) in combination with the cells of choice such as plant cells.

Examples of bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol, or tetracycline resistance, preferably kanamycin resistance. Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptlT) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as for example, described in WO 87/05327; an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin as for example, described in EP 275957; a gene encoding a 5- enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N- phosphonomethylglycine as, for example, described by Hinchee et al. (1988); a bar gene conferring resistance against bialaphos as, for example, described in WO 91/02071; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS) which confers resistance to imidazolinone, sulfonylurea, or other ALS -inhibiting chemicals (EP 154204); a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.

Preferred screenable markers include, but are not limited to, a uidA gene encoding a β-glucuronidase (GUS) enzyme for which various chromogenic substrates are known; a β-galactosidase gene encoding an enzyme for which chromogenic substrates are known; an aequorin gene (Prasher et al., 1985) which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; or a luciferase (luc) gene (Ow et al., 1986) which allows for bioluminescence detection. By "reporter molecule" it is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.

Preferably, the recombinant vector is stably incorporated into the genome of the cell such as the plant cell. Accordingly, the recombinant vector may comprise appropriate elements which allow the vector to be incorporated into the genome, or into a chromosome of the cell.

Expression Vector

As used herein, an "expression vector" is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of one or more specified polynucleotides. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in host cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, animal, algal, and plant cells. Particularly preferred expression vectors of the present invention can direct gene expression in yeast, algae and/or plant cells.

Expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the host cell and that control the expression of polynucleotides of the present invention. In particular, expression vectors of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. The choice of the regulatory sequences used depends on the target cell of interest. Such regulatory sequences may be obtained from any eukaryotic organism such as plants or plant viruses, or may be chemically synthesized. A variety of such transcription control sequences are known to those skilled in the art. Particularly preferred transcription control sequences are promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use of the plant or part(s) thereof.

A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, for example, Pouwels et al, Cloning Vectors: A Laboratory Manual, 1985, supp. 1987, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, a RNA processing signal, a transcription termination site, and/or a polyadenylation signal.

A number of constitutive promoters that are active in plant cells have been described. Suitable promoters for constitutive expression in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the Figwort mosaic virus (FMV) 35S, the sugarcane bacilliform virus promoter, the commelina yellow mottle virus promoter, the light-inducible promoter from the small subunit of the ribulose-l,5-bis-phosphate carboxylase, the rice cytosolic triosephosphate isomerase promoter, the adenine phosphoribosyltransferase promoter of Arabidopsis, the rice actin 1 gene promoter, the mannopine synthase and octopine synthase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll α/β binding protein gene promoter. These promoters have been used to create DNA vectors that have been expressed in plants (see, for example, WO 84/02913). All of these promoters have been used to create various types of plant- expressible recombinant DNA vectors.

For the purpose of expression in source tissues of the plant such as the leaf, seed, root or stem, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues. For this purpose, one may choose from a number of promoters for genes with tissue- or cell- specific, or -enhanced expression. Examples of such promoters reported in the literature include, the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose- 1,6- biphosphatase promoter from wheat, the nuclear photo synthetic ST-LSl promoter from potato, the serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana. Also reported to be active in photo synthetically active tissues are the ribulose-l,5-bisphosphate carboxylase promoter from eastern larch (Larix laricina), the promoter for the Cab gene, Cab6, from pine, the promoter for the Cab-1 gene from wheat, the promoter for the Cab-1 gene from spinach, the promoter for the Cab 1R gene from rice, the pyruvate, orthophosphate dikinase (PPDK) promoter from Zea mays, the promoter for the tobacco Lhcbl*2 gene, the Arabidopsis thaliana

Suc2 sucrose-H 30 symporter promoter, and the promoter for the thylakoid membrane protein genes from spinach (PsaD, PsaF, PsaE, PC, FNR, AtpC, AtpD, Cab, RbcS). Other promoters for the chlorophyll α/β -binding proteins may also be utilized in the present invention such as the promoters for LhcB gene and PsbP gene from white mustard (Sinapis alba).

A variety of plant gene promoters that are regulated in response to environmental, hormonal, chemical, and/or developmental signals, also can be used for expression of RNA-binding protein genes in plant cells, including promoters regulated by (1) heat, (2) light (e.g., pea RbcS-3A promoter, maize RbcS promoter), (3) hormones such as abscisic acid, (4) wounding (e.g., Wunl), or (5) chemicals such as methyl jasmonate, salicylic acid, steroid hormones, alcohol, Safeners (WO 97/06269), or it may also be advantageous to employ (6) organ- specific promoters.

As used herein, the term "plant storage organ specific promoter" refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a storage organ of a plant. Preferably, the promoter only directs expression of a gene of interest in the storage organ, and/or expression of the gene of interest in other parts of the plant such as leaves is not detectable by Northern blot analysis and/or RT-PCR. Typically, the promoter drives expression of genes during growth and development of the storage organ, in particular during the phase of synthesis and accumulation of storage compounds in the storage organ. Such promoters may drive gene expression in the entire plant storage organ or only part thereof such as the seedcoat, embryo or cotyledon(s) in seeds of dicotyledonous plants, or the endosperm or aleurone layer of seeds of monocotyledonous plants.

For the purpose of expression in sink tissues of the plant such as the tuber of the potato plant, the fruit of tomato, or the seed of soybean, canola, cotton, Zea mays, wheat, rice, and barley, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues. A number of promoters for genes with tuber- specific or -enhanced expression are known, including the class I patatin promoter, the promoter for the potato tuber ADPGPP genes, both the large and small subunits, the sucrose synthase promoter, the promoter for the major tuber proteins, including the 22 kD protein complexes and proteinase inhibitors, the promoter for the granule bound starch synthase gene (GBSS), and other class I and II patatins promoters. Other promoters can also be used to express a protein in specific tissues such as seeds or fruits. The promoter for β-conglycinin or other seed-specific promoters such as the napin, zein, linin and phaseolin promoters, can be used. Root specific promoters may also be used. An example of such a promoter is the promoter for the acid chitinase gene. Expression in root tissue could also be accomplished by utilizing the root specific subdomains of the CaMV 35S promoter that have been identified.

In a particularly preferred embodiment, the promoter directs expression in tissues and organs in which lipid biosynthesis take place. Such promoters act in seed development at a suitable time for modifying lipid composition in seeds.

In a further particularly preferred embodiment, the promoter is a plant storage organ specific promoter. In one embodiment, the plant storage organ specific promoter is a seed specific promoter. In a more preferred embodiment, the promoter preferentially directs expression in the cotyledons of a dicotyledonous plant or in the endosperm of a monocotyledonous plant, relative to expression in the embryo of the seed or relative to other organs in the plant such as leaves. Preferred promoters for seed-specific expression include: 1) promoters from genes encoding enzymes involved in lipid biosynthesis and accumulation in seeds such as desaturases and elongases, 2) promoters from genes encoding seed storage proteins, and 3) promoters from genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds. Seed specific promoters which are suitable are, the oilseed rape napin gene promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Phaseolus vulgaris phaseolin promoter (US 5,504,200), the Brassica Bce4 promoter (WO 91/13980), or the legumin B4 promoter (Baumlein et al., 1992), and promoters which lead to the seed-specific expression in monocots such as maize, barley, wheat, rye, rice and the like. Notable promoters which are suitable are the barley lpt2 or Iptl gene promoter (WO 95/15389 and WO 95/23230), or the promoters described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene). Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173. In an embodiment, the seed specific promoter is preferentially expressed in defined parts of the seed such as the cotyledon(s) or the endosperm. Examples of cotyledon specific promoters include, but are not limited to, the FP1 promoter (Ellerstrom et al., 1996), the pea legumin promoter (Perrin et al., 2000), and the bean phytohemagglutnin promoter (Perrin et al., 2000). Examples of endosperm specific promoters include, but are not limited to, the maize zein-1 promoter (Chikwamba et al., 2003), the rice glutelin-1 promoter (Yang et al., 2003), the barley D-hordein promoter (Horvath et al., 2000) and wheat HMW glutenin promoters (Alvarez et al., 2000). In a further embodiment, the seed specific promoter is not expressed, or is only expressed at a low level, in the embryo and/or after the seed germinates.

In another embodiment, the plant storage organ specific promoter is a tuber specific promoter. Examples include, but are not limited to, the potato patatin B33, PAT21 and GBSS promoters, as well as the sweet potato sporamin promoter (for review, see Potenza et al., 2004). In a preferred embodiment, the promoter directs expression preferentially in the pith of the tuber, relative to the outer layers (skin, bark) or the embryo of the tuber.

In another embodiment, the plant storage organ specific promoter is a fruit specific promoter. Examples include, but are not limited to, the tomato polygalacturonase, E8 and Pds promoters, as well as the apple ACC oxidase promoter (for review, see Potenza et al., 2004). In a preferred embodiment, the promoter preferentially directs expression in the edible parts of the fruit, for example the pith of the fruit, relative to the skin of the fruit or the seeds within the fruit.

The 5' non-translated leader sequence can be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide of the present invention, or may be heterologous with respect to the coding region of the enzyme to be produced, and can be specifically modified if desired so as to increase translation of mRNA. For a review of optimizing expression of transgenes, see Koziel et al. (1996). The 5' non-translated regions can also be obtained from plant viral RNAs (Tobacco mosaic virus, Tobacco etch virus, Maize dwarf mosaic virus, Alfalfa mosaic virus, among others) from suitable eukaryotic genes, plant genes (wheat and maize chlorophyll a/b binding protein gene leader), or from a synthetic gene sequence. The present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence. The leader sequence could also be derived from an unrelated promoter or coding sequence. Leader sequences useful in context of the present invention comprise the maize Hsp70 leader (US 5,362,865 and US 5,859,347), and the TMV omega element.

The termination of transcription is accomplished by a 3' non-translated DNA sequence operably linked in the expression vector to the polynucleotide of interest. The 3' non-translated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA. The 3' non-translated region can be obtained from various genes that are expressed in plant cells. The nopaline synthase 3' untranslated region, the 3' untranslated region from pea small subunit Rubisco gene, the 3' untranslated region from soybean 7S seed storage protein gene are commonly used in this capacity. The 3' transcribed, non-translated regions containing the polyadenylate signal of Agwbacterium tumor-inducing (Ti) plasmid genes are also suitable.

Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide by manipulating, for example, the number of copies of the polynucleotide within a host cell, the efficiency with which those polynucleotide are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotides defined herein include, but are not limited to, operatively linking the polynucleotide to a high-copy number plasmid, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to the plasmid, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of the polynucleotide to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.

Transfer Nucleic Acids

Transfer nucleic acids can be used to deliver an exogenous polynucleotide to a cell and comprise one, preferably two, border sequences and a polynucleotide of interest. The transfer nucleic acid may or may not encode a selectable marker. Preferably, the transfer nucleic acid forms part of a binary vector in a bacterium, where the binary vector further comprises elements which allow replication of the vector in the bacterium, selection, or maintenance of bacterial cells containing the binary vector. Upon transfer to a eukaryotic cell, the transfer nucleic acid component of the binary vector is capable of integration into the genome of the eukaryotic cell. As used herein, the term "extrachromosomal transfer nucleic acid" refers to a nucleic acid molecule that is capable of being transferred from a bacterium such as Agwbacterium sp., to a eukaryotic cell such as a plant leaf cell. An extrachromosomal transfer nucleic acid is a genetic element that is well-known as an element capable of being transferred, with the subsequent integration of a nucleotide sequence contained within its borders into the genome of the recipient cell. In this respect, a transfer nucleic acid is flanked, typically, by two "border" sequences, although in some instances a single border at one end can be used and the second end of the transferred nucleic acid is generated randomly in the transfer process. A polynucleotide of interest is typically positioned between the left border-like sequence and the right border-like sequence of a transfer nucleic acid. The polynucleotide contained within the transfer nucleic acid may be operably linked to a variety of different promoter and terminator regulatory elements that facilitate its expression, that is, transcription and/or translation of the polynucleotide. Transfer DNAs (T-DNAs) from Agwbacterium sp. such as Agwbacterium tumefaciens or Agwbacterium rhizogenes, and man made variants/mutants thereof are probably the best characterized examples of transfer nucleic acids. Another example is P-DNA ("plant-DNA") which comprises T-DNA border-like sequences from plants.

As used herein, "T-DNA" refers to, for example, T-DNA of an Agwbacterium tumefaciens Ti plasmid or from an Agwbacterium rhizogenes Ri plasmid, or man made variants/mutants thereof which function as T-DNA. The T-DNA may comprise an entire T-DNA including both right and left border sequences, but need only comprise the minimal sequences required in cis for transfer, that is, the right and T-DNA border sequence. The T-DNAs of the invention have inserted into them, anywhere between the right and left border sequences (if present), the polynucleotide of interest flanked by target sites for a site-specific recombinase. The sequences encoding factors required in trans for transfer of the T-DNA into a plant cell such as vir genes, may be inserted into the T-DNA, or may be present on the same replicon as the T-DNA, or preferably are in trans on a compatible replicon in the Agwbacterium host. Such "binary vector systems" are well known in the art.

As used herein, "P-DNA" refers to a transfer nucleic acid isolated from a plant genome, or man made variants/mutants thereof, which comprise at each end, or at only one end, a T-DNA border-like sequence. The border-like sequence preferably shares at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or at least 95%, but less than 100% sequence identity, with a T-DNA border sequence from an Agwbacterium sp. such as Agwbacterium tumefaciens or Agwbacterium rhizogenes. Thus, P-DNAs can be used instead of T-DNAs to transfer a nucleotide sequence contained within the P-DNA from, for example Agwbacterium, to another cell. The P- DNA, before insertion of the exogenous polynucleotide which is to be transferred, may be modified to facilitate cloning and should preferably not encode any proteins. The P- DNA is characterized in that it contains, at least a right border sequence and preferably also a left border sequence.

As used herein, a "border" sequence of a transfer nucleic acid can be isolated from a selected organism such as a plant or bacterium, or a man made variant/mutant thereof. The border sequence promotes and facilitates the transfer of the polynucleotide to which it is linked and may facilitate its integration in the recipient cell genome. In an embodiment, a border- sequence is between 5-100 base pairs (bp) in length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length, 15-40 bp in length, 15-30 bp in length, 16-30 bp in length, 20-30 bp in length, 21-30 bp in length, 22-30 bp in length, 23-30 bp in length, 24-30 bp in length, 25-30 bp in length, or 26-30 bp in length. Border sequences from T-DNA from Agwbacterium sp. are well known in the art and include those described in Lacroix et al. (2008), Tzfira and Citovsky (2006) and Glevin (2003).

Whilst traditionally only Agwbacterium sp. have been used to transfer genes to plants cells, there are now a large number of systems which have been identified/developed which act in a similar manner to Agwbacterium sp. Several non- Agrobacterium species have recently been genetically modified to be competent for gene transfer (Chung et al., 2006; Broothaerts et al., 2005). These include Rhizobium sp. NGR234, Sinorhizobium meliloti and Mezorhizobium loti. The bacteria are made competent for gene transfer by providing the bacteria with the machinery needed for the transformation process, that is, a set of virulence genes encoded by an Agwbacterium Ti-plasmid and the T-DNA segment residing on a separate, small binary plasmid. Bacteria engineered in this way are capable of transforming different plant tissues (leaf disks, calli and oval tissue), monocots or dicots, and various different plant species (e.g., tobacco, rice).

Direct transfer of eukaryotic expression plasmids from bacteria to eukaryotic hosts was first achieved several decades ago by the fusion of mammalian cells and protoplasts of plasmid-carrying Escherichia coli (Schaffner, 1980). Since then, the number of bacteria capable of delivering genes into mammalian cells has steadily increased (Weiss, 2003), being discovered by four groups independently (Sizemore et al. 1995; Courvalin et al., 1995; Powell et al., 1996; Darji et al., 1997). Attenuated Shigella flexneri, Salmonella typhimurium or E. coli that had been rendered invasive by the virulence plasmid (pWRlOO) of S. flexneri have been shown to be able to transfer expression plasmids after invasion of host cells and intracellular death due to metabolic attenuation. Mucosal application, either nasally or orally, of such recombinant Shigella or Salmonella induced immune responses against the antigen that was encoded by the expression plasmids. In the meantime, the list of bacteria that was shown to be able to transfer expression plasmids to mammalian host cells in vitro and in vivo has been more then doubled and has been documented for S. typhi, S. choleraesuis, Listeria monocytogenes, Yersinia pseudotuberculosis, and Y. enterocolitica (Fennelly et al., 1999; Shiau et al., 2001; Dietrich et al., 1998; Hense et al., 2001; Al-Mariri et al., 2002).

In general, it could be assumed that all bacteria that are able to enter the cytosol of the host cell (like S. flexneri or L. monocytogenes) and lyse within this cellular compartment, should be able to transfer DNA. This is known as 'abortive' or 'suicidal' invasion as the bacteria have to lyse for the DNA transfer to occur (Grillot-Courvalin et al., 1999). In addition, even many of the bacteria that remain in the phagocytic vacuole (like S. typhimurium) may also be able to do so. Thus, recombinant laboratory strains of E. coli that have been engineered to be invasive but are unable of phagosomal escape, could nontheless deliver their plasmid load to the nucleus of the infected mammalian cell (Grillot-Courvalin et al., 1998). Furthermore, Agrobacterium tumefaciens has recently also been shown to introduce transgenes into mammalian cells (Kunik et al., 2001).

As used herein, the terms "transfection", "transformation" and variations thereof are generally used interchangeably. "Transfected" or "transformed" cells may have been manipulated to introduce the polynucleotide(s) of interest, or may be progeny cells derived therefrom.

Recombinant Cells

The invention also provides a recombinant cell, for example, a recombinant plant cell, which is a host cell transformed with one or more polynucleotides or vectors defined herein, or combination thereof. The term "recombinant cell" is used interchangeably with the term "transgenic cell" herein. Suitable cells of the invention include any cell that can be transformed with a polynucleotide or recombinant vector of the invention, encoding, for example, a polypeptide or enzyme described herein. The cell is preferably a cell which is thereby capable of being used for producing lipid. The recombinant cell may be a cell in culture, a cell in vitro, or in an organism such as for example, a plant, or in an organ such as, for example, a seed or a leaf. Preferably, the cell is in a plant, more preferably in the seed of a plant.

Host cells into which the polynucleotide(s) are introduced can be either untransformed cells or cells that are already transformed with at least one nucleic acid. Such nucleic acids may be related to lipid synthesis, or unrelated. Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing polypeptide(s) defined herein, in which case the recombinant cell derived therefrom has an enhanced capability of producing the polypeptide(s), or can be capable of producing said polypeptide(s) only after being transformed with at least one polynucleotide of the invention. In an embodiment, a recombinant cell of the invention has an enhanced capacity to produce non-polar lipid.

Host cells of the present invention can be any cell capable of producing at least one polypeptide or protein described herein, and include bacterial, fungal (including yeast), parasite, arthropod, animal, algal, and plant cells. The cells may be prokaryotic or eukaryotic. Preferred host cells are yeast, algal and plant cells. In a preferred embodiment, the plant cell is a seed cell, in particular, a cell in a cotyledon or endosperm of a seed. In one embodiment, the cell is an animal cell. The animal cell may be of any type of animal such as, for example, a non-human animal cell, a non- human vertebrate cell, a non-human mammalian cell, or cells of aquatic animals such as fish or Crustacea, invertebrates, insects, etc. Non limiting examples of arthropod cells include insect cells such as Spodoptera frugiperda (Sf) cells, for example, Sf9, Sf21, Trichoplusia ni cells, and Drosophila S2 cells. An example of a bacterial cell useful as a host cell of the present invention is Synechococcus spp. (also known as Synechocystis spp.), for example Synechococcus elongatus. Examples of algal cells useful as host cells of the present invention include, for example, Chlamydomonas sp. (for example, Chlamydomonas reinhardtii), Dunaliella sp., Haematococcus sp., Chlorella sp., Thraustochytrium sp., Schizochytrium sp., and Volvox sp.

Host cells for expression of the polynucleotides described herein may include microbial hosts that grow on a variety of feedstocks, including simple or complex carbohydrates, organic acids and alcohols and/or hydrocarbons over a wide range of temperature and pH values. Preferred microbial hosts are oleaginous organisms that are naturally capable of non-polar lipid synthesis.

The host cells may be of an organism suitable for a fermentation process, such as, for example, Yarrowia lipolytica or other yeasts. Transgenic Plants

The invention also provides a plant comprising an exogenous polynucleotide or polypeptide of the invention, a cell of the invention, a vector of the invention, or a combination thereof. The term "plant" refers to whole plants, whilst the term "part thereof" refers to plant organs (e.g., leaves, stems, roots, flowers, fruit), single cells (e.g., pollen), seed, seed parts such as an embryo, endosperm, scutellum or seed coat, plant tissue such as vascular tissue, plant cells and progeny of the same. As used herein, plant parts comprises plant cells.

As used herein, the term "plant" is used in it broadest sense. It includes, but is not limited to, any species of grass, ornamental or decorative plant, crop or cereal (e.g., oilseed, maize, soybean), fodder or forage, fruit or vegetable plant, herb plant, woody plant, flower plant, or tree. It is not meant to limit a plant to any particular structure. It also refers to a unicellular plant (e.g., microalga). The term "part thereof" in reference to a plant refers to a plant cell and progeny of same, a plurality of plant cells that are largely differentiated into a colony (e.g., volvox), a structure that is present at any stage of a plant's development, or a plant tissue. Such structures include, but are not limited to, leaves, stems, flowers, fruits, nuts, roots, seed, seed coat, embryos. The term "plant tissue" includes differentiated and undifferentiated tissues of plants including those present in leaves, stems, flowers, fruits, nuts, roots, seed, for example, embryonic tissue, endosperm, dermal tissue (e.g., epidermis, periderm), vascular tissue (e.g., xylem, phloem), or ground tissue (comprising parenchyma, collenchyma, and/or sclerenchyma cells), as well as cells in culture (e.g., single cells, protoplasts, callus, embryos, etc.). Plant tissue may be in planta, in organ culture, tissue culture, or cell culture.

As used herin, the term "transgenic plant" or "genetically modified plant" and variations thereof refers to a plant that contains a transgene not found in a wild-type plant of the same species, variety or cultivar. Transgenic plants as defined in the context of the present invention include plants and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide defined herein in the desired plant or part thereof. Transgenic plant parts has a corresponding meaning.

The terms "seed" and "grain" are used interchangeably herein. "Grain" refers to mature grain such as harvested grain or grain which is still on a plant but ready for harvesting, but can also refer to grain after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%. "Developing seed" as used herein refers to a seed prior to maturity, typically found in the reproductive structures of the plant after fertilisation or anthesis, but can also refer to such seeds prior to maturity which are isolated from a plant.

As used herein, the term "plant storage organ" refers to a part of a plant specialized to store energy in the form of, for example, proteins, carbohydrates, lipid. Examples of plant storage organs are seed, fruit, tuberous roots, and tubers. A preferred plant storage organ of the invention is seed.

As used herein, the term "phenotypically normal" refers to a genetically modified plant or part thereof, particularly a storage organ such as a seed, tuber or fruit of the invention not having a significantly reduced ability to grow and reproduce when compared to an unmodified plant or plant thereof. In an embodiment, the genetically modified plant or part thereof which is phenotypically normal comprises a recombinant polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter and has an ability to grow or reproduce which is essentially the same as a corresponding plant or part thereof not comprising said polynucleotide. Preferably, the biomass, growth rate, germination rate, storage organ size, seed size and/or the number of viable seeds produced is not less than 90% of that of a plant lacking said recombinant polynucleotide when grown under identical conditions. This term does not encompass features of the plant which may be different to the wild-type plant but which do not effect the usefulness of the plant for commercial purposes such as, for example, a ballerina phenotype of seedling leaves.

Plants provided by or contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. In preferred embodiments, the plants of the present invention are crop plants (e.g., cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes. The plants may be grown for production of edible roots, tubers, leaves, stems, flowers or fruit. The plants may be vegetable or ornamental plants. The plants of the invention may be: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), other Brassicas such as, for example, rutabaga (Brassica napobrassica) or Brassica camelina, sugarbeet (Beta vulgaris) clover (Trifolium sp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.), cocoa (Theobwma cacao), tea (Camellia senensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia inter grif olid), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, or barley.

In a preferred embodiment, the plant is an angiosperm.

In an embodiment, the plant is an oilseed plant, preferably an oilseed crop plant.

As used herein, an "oilseed plant" is a plant species used for the commercial production of lipid from the seeds of the plant. The oilseed plant may be oil-seed rape (such as canola), maize, sunflower, safflower, soybean, sorghum, flax (linseed) or sugar beet. Furthermore, the oilseed plant may be other Brassicas, cotton, peanut, poppy, rutabaga, mustard, castor bean, sesame, safflower, or nut producing plants. The plant may produce high levels of lipid in its fruit such as olive, oil palm or coconut. Horticultural plants to which the present invention may be applied are lettuce, endive, or vegetable Brassicas including cabbage, broccoli, or cauliflower. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, tomato, or pepper. In an embodiment, the oilseed is a non-photosynthetic oilseed. Examples of non-photo synthetic oilseed plants include, but are not necessarily limited to, safflower, sunflower, cotton or castor.

In a further embodiment, the cell, plant or part thereof (such as seed) of the invention has one or more the features described in co-pending US provisional application number 61/638,447.

In a preferred embodiment, the transgenic plant is homozygous for each and every gene that has been introduced (transgene) so that its progeny do not segregate for the desired phenotype. The transgenic plant may also be heterozygous for the introduced transgene(s), preferably uniformly heterozygous for the transgene such as for example, in Fl progeny which have been grown from hybrid seed. Such plants may provide advantages such as hybrid vigour, well known in the art.

Where relevant, the transgenic plants may also comprise additional transgenes encoding enzymes involved in the production of non-polar lipid such as, but not limited to diacylglycerol acyltransferase (DGAT), glycerol- 3 -phosphate acyltransferase (GPAT), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl- CoA:lysophosphatidylcholine acyltransferase (LPCAT), CDP-choline diacylglycerol choline phosphotransferase (CPT), phoshatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine:diacylglycerol choline phosphotransferase (PDCT), or acyl-CoA binding protein (ACBP), or a combination of two or more thereof. The transgenic plants of the invention may also express oleosin from an exogenous polynucleotide. Transformation of plants

Transgenic plants can be produced using techniques known in the art, such as those generally described in Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), and Christou and Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).

As used herein, the term "stably transforming" or "stably transformed" and variations thereof refer to the integration of the polynucleotide into the genome of the cell such that the polynucleotide is transferred to progeny cells during cell division without the need for positively selecting for their presence. Stable transformants, or progeny thereof, can be selected by any means known in the art such as Southern blots on chromosomal DNA, or in situ hybridization of genomic DNA.

Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues, plant organs, or explants in tissue culture, for either transient expression, or for stable integration of the DNA in the plant cell genome. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see for example, US 5177010, US 5104310, US 5004863, or US 5159135). The region of DNA to be transferred is defined by the border sequences, and the intervening DNA (T- DNA) is usually inserted into the plant genome. Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements. In those plant varieties where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer. Preferred Agwbacterium transformation vectors are capable of replication in E. coli as well as Agwbacterium, allowing for convenient manipulations as described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer- Verlag, New York, pp. 179-203 (1985)).

Acceleration methods that may be used include, for example, microprojectile bombardment and the like. One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) that may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. A particular advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly transforming monocots, is that neither the isolation of protoplasts, nor the susceptibility of Agwbacterium infection are required. An illustrative embodiment of a method for delivering DNA into Zea mays cells by acceleration is a biolistics a-particle delivery system, that can be used to propel particles coated with DNA through a screen such as a stainless steel or Nytex screen, onto a filter surface covered with corn cells cultured in suspension. A particle delivery system suitable for use with the present invention is the helium acceleration PDS- 1000/He gun available from Bio-Rad Laboratories.

For the bombardment, cells in suspension may be concentrated on filters. Filters containing the cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the gun and the cells to be bombarded.

Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Through the use of techniques set forth herein, one may obtain up to 1000 or more foci of cells transiently expressing a marker gene. The number of cells in a focus that express the gene product 48 hours post-bombardment often range from one to ten and average one to three.

In bombardment transformation, one may optimize the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA such as linearized DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature embryos.

In another alternative embodiment, plastids can be stably transformed. Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (US 5,451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99/05265).

Accordingly, it is contemplated that one may wish to adjust various aspects of the bombardment parameters in small scale studies to fully optimize the conditions. One may particularly wish to adjust physical parameters such as gap distance, flight distance, tissue distance, and helium pressure. One may also minimize the trauma reduction factors by modifying conditions that influence the physiological state of the recipient cells and that may therefore influence transformation and integration efficiencies. For example, the osmotic state, tissue hydration and the subculture stage, or cell cycle of the recipient cells, may be adjusted for optimum transformation. The execution of other routine adjustments will be known to those of skill in the art.

Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).

Other methods of cell transformation can also be used and include, but are not limited to, the introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.

The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach et al., In: Methods for Plant Molecular Biology, Academic Press, San Diego, Calif., (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.

The development or regeneration of plants containing the foreign, exogenous gene is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polynucleotide is cultivated using methods well known to one skilled in the art.

Methods for transforming dicots, primarily by use of Agwbacterium tumefaciens, and obtaining transgenic plants have been published for cotton (US 5,004,863, US 5,159,135, US 5,518,908), soybean (US 5,569,834, US 5,416,011), Brassica (US 5,463,174), peanut (Cheng et al., 1996), and pea (Grant et al., 1995).

Methods for transformation of cereal plants such as wheat and barley for introducing genetic variation into the plant by introduction of an exogenous polynucleotide and for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see for example, CA 2,092,588, AU 61781/94, AU 667939, US 6,100,447, PCT/US97/10621, US 5,589,617, US 6,541,257, and other methods set out in WO 99/14314. Preferably, transgenic wheat or barley plants are produced by Agwbacterium tumefaciens mediated transformation procedures. Vectors carrying the desired polynucleotide may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts.

The regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.

To confirm the presence of the transgenes in transgenic cells and plants, a polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art. Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay. One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene such as GUS. Once transgenic plants have been obtained, they may be grown to produce plant parts, for example, seeds having the desired phenotype. The plant parts may be harvested and/or the seed collected. The seed may serve as a source for growing additional plants with tissues or parts having the desired characteristics.

A transgenic plant formed using Agwbacterium or other transformation methods typically contains a single genetic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene(s). More preferred is a transgenic plant that is homozygous for the added gene(s), that is, a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by self-fertilising a hemizygous transgenic plant, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.

It is also to be understood that two different transgenic plants that contain two independently segregating exogenous genes or loci can also be crossed (mated) to produce offspring that contain both sets of genes or loci. Selfing of appropriate Fl progeny can produce plants that are homozygous for both exogenous genes or loci. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987).

TILLING

In one embodiment, TILLING (Targeting Induced Local Lesions IN Genomes) can be used to produce plants in which endogenous genes are knocked out, for example genes encoding a DGAT, sn-l glycerol-3-phosphate acyltransferase (GPAT), 1-acyl- glycerol- 3 -phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phosphatidic acid phosphatase (PAP), or a combination of two or more thereof.

In a first step, introduced mutations such as novel single base pair changes are induced in a population of plants by treating seeds (or pollen) with a chemical mutagen, and then advancing plants to a generation where mutations will be stably inherited. DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.

For a TILLING assay, PCR primers are designed to specifically amplify a single gene target of interest. Specificity is especially important if a target is a member of a gene family or part of a polyploid genome. Next, dye-labeled primers can be used to amplify PCR products from pooled DNA of multiple individual plants. These PCR products are denatured and reannealed to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from the population are likely to carry the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to display the mutation). After heteroduplex formation, the use of an endonuclease, such as Cell, that recognizes and cleaves mismatched DNA, is the key to discovering novel SNPs within a TILLING population.

Using this approach, many thousands of plants can be screened to identify any individual with a single base change as well as small insertions or deletions (1-30 bp) in any gene or specific region of the genome. Genomic fragments being assayed can range in size anywhere from 0.3 to 1.6 kb. At 8-fold pooling, 1.4 kb fragments (discounting the ends of fragments where SNP detection is problematic due to noise) and 96 lanes per assay, this combination allows up to a million base pairs of genomic DNA to be screened per single assay, making TILLING a high-throughput technique. TILLING is further described in Slade and Knauf (2005), and Henikoff et al. (2004). In addition to allowing efficient detection of mutations, high-throughput TILLING technology is ideal for the detection of natural polymorphisms. Therefore, interrogating an unknown homologous DNA by heteroduplexing to a known sequence reveals the number and position of polymorphic sites. Both nucleotide changes and small insertions and deletions are identified, including at least some repeat number polymorphisms. This has been called ECOTILLING (Comai et al., 2004).

Each SNP is recorded by its approximate position within a few nucleotides. Thus, each haplotype can be archived based on its mobility. Sequence data can be obtained with a relatively small incremental effort using aliquots of the same amplified DNA that is used for the mismatch-cleavage assay. The left or right sequencing primer for a single reaction is chosen by its proximity to the polymorphism. Sequencher software performs a multiple alignment and discovers the base change.

ECOTILLING can be performed more cheaply than full sequencing, the method currently used for most SNP discovery. Plates containing arrayed ecotypic DNA can be screened rather than pools of DNA from mutagenized plants. Because detection is on gels with nearly base pair resolution and background patterns are uniform across lanes, bands that are of identical size can be matched, thus discovering and genotyping SNPs in a single step. In this way, ultimate sequencing of the SNP is simple and efficient, made more so, by the fact that the aliquots of the same PCR products used for screening can be subjected to DNA sequencing.

Enhancing Exogenous RNA Levels and Stabilized Expression

Post-transcriptional gene silencing (PTGS) is a nucleotide sequence-specific defense mechanism that can target both cellular and viral mRNAs for degradation. PTGS occurs in plants or fungi stably or transiently transformed with a recombinant polynucleotide(s) and results in the reduced accumulation of RNA molecules with sequence similarity to the introduced polynucleotide. "Post-transcriptional" refers to a mechanism operating at least partly, but not necessarily exclusively, after production of an initial RNA transcript, for example, during processing of the initial RNA transcript, or concomitant with splicing or export of the RNA to the cytoplasm, or within the cytoplasm by complexes associated with Argonaute proteins.

RNA molecule levels can be increased, and/or RNA molecule levels stabilized over numerous generations or under different environmental conditions, by limiting the expression of a silencing suppressor in a storage organ of a plant or part thereof. As used herein, a "silencing suppressor" is any polynucleotide or polypeptide that can be expressed in a plant cell that enhances the level of expression product from a different transgene in the plant cell, particularly, over repeated generations from the initially transformed plant. In an embodiment, the silencing suppressor is a viral silencing suppressor or mutant thereof. A large number of viral silencing suppressors are known in the art and include, but are not limited to P19, V2, P38, Pe-Po and RPV-PO. Examples of suitable viral silencing suppressors include those described in WO 2010/057246. A silencing suppressor may be stably expressed in a plant or part thereof of the present invention.

As used herein, the term "stably expressed" or variations thereof refers to the level of the RNA molecule being essentially the same or higher in progeny plants over repeated generations, for example, at least three, at least five, or at least ten generations, when compared to corresponding plants lacking the exogenous polynucleotide encoding the silencing suppressor. However, this term(s) does not exclude the possibility that over repeated generations there is some loss of levels of the RNA molecule when compared to a previous generation, for example, not less than a 10% loss per generation.

The suppressor can be selected from any source, for example, plant, viral, mammal, etc. The suppressor may be, for example:

flock house virus B2,

pothos latent virus P14,

pothos latent virus AC2,

African cassava mosaic virus AC4,

bhendi yellow vein mosaic disease C2,

bhendi yellow vein mosaic disease C4,

bhendi yellow vein mosaic disease βθ,

tomato chlorosis virus p22,

tomato chlorosis virus CP,

tomato chlorosis virus CPm,

tomato golden mosaic virus AL2,

tomato leaf curl Java virus βθ,

tomato yellow leaf curl virus V2,

tomato yellow leaf curl virus-China C2,

tomato yellow leaf curl China virus Y10 isolate βθ,

tomato yellow leaf curl Israeli isolate V2,

mungbean yellow mosaic virus-Vigna AC2,

hibiscus chlorotic ringspot virus CP,

turnip crinkle virus P38, turnip crinkle virus CP,

cauliflower mosaic virus P6,

beet yellows virus p21,

citrus tristeza virus p20,

citrus tristeza virus p23,

citrus tristeza virus CP,

cowpea mosaic virus SCP,

sweet potato chlorotic stunt virus p22, cucumber mosaic virus 2b,

tomato aspermy virus HC-Pro,

beet curly top virus L2,

soil borne wheat mosaic virus 19K, barley stripe mosaic virus Gammab, poa semilatent virus Gammab,

peanut clump pecluvirus P 15 ,

rice dwarf virus PnslO,

curubit aphid borne yellows virus P0, beet western yellows virus P0,

potato virus X P25,

cucumber vein yellowing virus Plb, plum pox virus HC-Pro,

sugarcane mosaic virus HC-Pro,

potato virus Y strain HC-Pro,

tobacco etch virus Pl/HC-Pro,

turnip mosaic virus Pl/HC-Pro,

cocksfoot mottle virus PI,

cocksfoot mottle virus-Norwegian isolate PI, rice yellow mottle virus PI,

rice yellow mottle virus-Nigerian isolate PI, rice hoja blanca virus NS3,

rice stripe virus NS3,

crucifer infecting tobacco mosaic virus 126K, crucifer infecting tobacco mosaic virus pl22, tobacco mosaic virus pl22,

tobacco mosaic virus 126,

tobacco mosaic virus 130K, tobacco rattle virus 16K,

tomato bushy stunt virus PI 9,

tomato spotted wilt virus NSs,

apple chlorotic leaf spot virus P50,

grapevine virus A p 10,

grapevine leafroll associated virus-2 homolog of BYV p21,

as well as variants/mutants thereof. The list above provides the virus from which the suppressor can be obtained and the protein (e.g., B2, P14, etc.), or coding region designation for the suppressor from each particular virus. Other candidate silencing suppressors may be obtained by examining viral genome sequences for polypeptides encoded at the same position within the viral genome, relative to the structure of a related viral genome comprising a known silencing suppressor, would be appreciated by a person of skill in the art.

Silencing suppressors can be categorized based on their mode of action. Suppressors such as V2 which preferentially bind to a double- stranded RNA molecule which has overhanging 5' ends relative to a corresponding double-stranded RNA molecule having blunt ends are particularly useful for enhancing transgene expression when used in combination with gene silencing (exogenous polynucleotide encoding a double stranded (dsRNA)). Other suppressors such as pl9 which preferentially bind a dsRNA molecule which is 21 base pairs in length relative to a dsRNA molecule of a different length can also allow transgene expression in the presence of an exogenous polynucleotide encoding a dsRNA, but generally to a lesser degree than, for example, V2. This allows the selection of an optimal combination of dsRNA, silencing suppressor and over-expressed transgene for a particular purpose. Such optimal combinations can be routinely identified as would be appreciated by a person of skill in the art.

In an embodiment, the silencing suppressor preferentially binds to a double- stranded RNA molecule which has overhanging 5' ends relative to a corresponding double- stranded RNA molecule having blunt ends. In this context, the corresponding double- stranded RNA molecule preferably has the same nucleotide sequence as the molecule with the 5' overhanging ends, but without the overhanging 5' ends. Binding assays are routinely performed, for example in in vitro assays, by any method as known to a person of skill in the art.

Multiple copies of a suppressor may be used. Different suppressors may be used together (e. g., in tandem). Essentially any RNA molecule which is desirable to be expressed in a plant storage organ can be co-expressed with the silencing suppressor. The RNA molecule may influence an agronomic trait, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and the like. The encoded polypeptides may be involved in metabolism of lipid, starch, carbohydrates, nutrients, etc., or may be responsible for the synthesis of proteins, peptides, lipids, waxes, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids. hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc.

Polypeptides

The terms "polypeptide" and "protein" are generally used interchangeably.

A polypeptide or class of polypeptides may be defined by the extent of identity (% identity) of its amino acid sequence to a reference amino acid sequence, or by having a greater % identity to one reference amino acid sequence than to another. The % identity of a polypeptide to a reference amino acid sequence is typically determined by GAP analysis (Needleman and Wunsch, 1970; GCG program) with parameters of a gap creation penalty = 5, and a gap extension penalty = 0.3. The query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the GAP analysis aligns two sequences over their entire length. The polypeptide or class of polypeptides may have the same enzymatic activity as, or a different activity than, or lack the activity of, the reference polypeptide. Preferably, the polypeptide has an enzymatic activity of at least 10% of the activity of the reference polypeptide.

As used herein a "biologically active fragment" is a portion of a polypeptide of the invention which maintains a defined activity of a full-length reference polypeptide for example, delta 12 hydroxylase activity. Biologically active fragments as used herein exclude the full-length polypeptide. Biologically active fragments can be any size portion as long as they maintain the defined activity. Preferably, the biologically active fragment maintains at least 10% of the activity of the full length polypeptide.

With regard to a defined polypeptide or enzyme, it will be appreciated that % identity figures higher than those provided herein will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polypeptide/enzyme comprises an amino acid sequence which is at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.

Amino acid sequence mutants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes into a polynucleotide defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include for example, deletions, insertions, or substitutions of residues within the amino acid sequence. A combination of deletions, insertions and substitutions can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics.

Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution or rational design strategies (see below). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they possess hydroxylase (for example, delta 12 hydroxylase), acyltransferase (for example, DGAT, GPAT, LPAAT, LPCAT, and/or PDAT), phosphotransferase (for example, CPT), or desaturase activity, or a combination of two or more thereof.

In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, for example, by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.

Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.

Substitution mutants have at least one amino acid residue in the polypeptide removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s). Other sites of interest are those in which particular residues obtained from various strains or species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "Exemplary substitutions".

In a preferred embodiment, a mutant/variant polypeptide has only, or not more than, one or two or three or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of conservative amino acid changes are provided in Table 1. As the skilled person would be aware, such minor changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in a recombinant cell.

Table 1. Exemplary substitutions.

Val (V) ile; leu; met; phe, ala

In a preferred embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in SEQ ID NO:9 or 10, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to SEQ ID NO:9 or 10, wherein the polypeptide has Δ12 hydroxylase activity. Other Δ12 hydroxylases can be identified by homology to, for example, SEQ ID NO:9 or 10. Conserved motifs and/or residues can be used as a sequence-based diagnostic for the identification of "Δ12 hydroxylase. For example, identification of one or more conserved His boxes (see Figure 1) at for example, about residue 105 to about 114, about residue 141 to about 149, or about residue 315 to about 323. Preferablly, the His box comprises between about 5 to about 10 His residues, more preferably about 5 or about 6 His residues. Enzymatic activity can readily be tested in recombinant cells such as yeast cells as described herein.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in SEQ ID NO:33 or 34, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to SEQ ID NO:33 or 34, wherein the polypeptide has glycerol- 3 -phosphate acyltransferase (GPAT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:41 to 46, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one of SEQ ID NOs:41 to 46, wherein the polypeptide has l-acyl-glycerol-3-phosphate acyltransferase (LPAAT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:48, 50, 53, 54, 56 and 58, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one of SEQ ID NOs:48, 50, 53, 54, 56 and 58, wherein the polypeptide has diacylglycerol acyltransferase (DGAT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in SEQ ID NO:48 or 50, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to SEQ ID NO:48 or 50, wherein the polypeptide has diacylglycerol acyltransferase 1 (DGAT1) activity. In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in SEQ ID NO:53 or 54, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to SEQ ID NO:53 or 54, wherein the polypeptide has diacylglycerol acyltransferase 2 (DGAT2) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in SEQ ID NO:56 or 58, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to SEQ ID NO:56 or 58, wherein the polypeptide has diacylglycerol acyltransferase 3 (DGAT3) activity

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NO:62 to 64, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one of SEQ ID NO:62 to 64, wherein the polypeptide has acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:74 to 77, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one of SEQ ID NOs:74 to 77, wherein the polypeptide has CDP-choline diacylglycerol choline phosphotransferase (CPT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:82 to 85, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one of SEQ ID NOs:82 to 85, wherein the polypeptide has phosphatidylcholine:diacylglycerol choline phosphotransferase (PDCT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in any one of SEQ ID NOs:92 to 97, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to any one of SEQ ID NOs:92 to 97, wherein the polypeptide has phoshatidylcholine diacylglycerol acyltransferase (PDAT) activity.

In another embodiment, the present invention provides a substantially purified and/or recombinant polypeptide comprising amino acids having a sequence as provided in SEQ ID NO: 100 or 101, a biologically active fragment thereof, or an amino acid sequence which is at least 60% identical to SEQ ID NO: 100 or 101, wherein the polypeptide has acyl-CoA binding protein (ACBP) activity. Directed Evolution

In directed evolution, random mutagenesis is applied to a protein, and a selection regime is used to pick out variants that have the desired qualities, for example, increased Δ12 hydroxylase activity. Further rounds of mutation and selection are then applied. A typical directed evolution strategy involves three steps:

1) Diversification: The gene encoding the protein of interest is mutated and/or recombined at random to create a large library of gene variants. Variant gene libraries can be constructed through error prone PCR (see, for example, Leung, 1989; Cadwell and Joyce, 1992), from pools of DNasel digested fragments prepared from parental templates (Stemmer, 1994a; Stemmer, 1994b; Crameri et al., 1998; Coco et al., 2001) from degenerate oligonucleotides (Ness et al., 2002, Coco, 2002) or from mixtures of both, or even from undigested parental templates (Zhao et al., 1998; Eggert et al., 2005; Jezequek et al., 2008) and are usually assembled through PCR. Libraries can also be made from parental sequences recombined in vivo or in vitro by either homologous or non-homologous recombination (Ostermeier et al., 1999; Volkov et al., 1999; Sieber et al., 2001). Variant gene libraries can also be constructed by sub- cloning a gene of interest into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-1 red (Stratagene) and propagating the transformed bacteria for a suitable number of generations. Variant gene libraries can also be constructed by subjecting the gene of interest to DNA shuffling (i.e., in vitro homologous recombination of pools of selected mutant genes by random fragmentation and reassembly) as broadly described by Harayama (1998).

2) Selection: The library is tested for the presence of mutants (variants) possessing the desired property using a screen or selection. Screens enable the identification and isolation of high-performing mutants by hand, while selections automatically eliminate all nonfunctional mutants. A screen may involve screening for the presence of known conserved amino acid motifs. Alternatively, or in addition, a screen may involve expressing the mutated polynucleotide in a host organsim or part thereof and assaying the level of Δ12 hydroxylase activity by, for example, quantifying the level of resultant product in lipid extracted from the organism or part thereof, and determining the level of product in the extracted lipid from the organsim or part thereof relative to a corresponding organism or part thereof lacking the mutated polynucleotide and optionally, expressing the parent (unmutated) polynucleotide. Alternatively, the screen may involve feeding the organism or part thereof labelled substrate and determining the level of substrate or product in the organsim or part thereof relative to a corresponding organism or part thereof lacking the mutated polynucleotide and optionally, expressing the parent (unmutated) polynucleotide.

3) Amplification: The variants identified in the selection or screen are replicated many fold, enabling researchers to sequence their DNA in order to understand what mutations have occurred.

Together, these three steps are termed a "round" of directed evolution. Most experiments will entail more than one round. In these experiments, the "winners" of the previous round are diversified in the next round to create a new library. At the end of the experiment, all evolved protein or polynucleotide mutants are characterized using biochemical methods. Rational Design

A protein can be designed rationally, on the basis of known information about protein structure and folding. This can be accomplished by design from scratch (de novo design) or by re-design based on native scaffolds (see, for example, Hellinga, 1997; and Lu and Berry, Protein Structure Design and Engineering, Handbook of Proteins 2, 1153-1157 (2007)). Protein design typically involves identifying sequences that fold into a given or target structure and can be accomplished using computer models. Computational protein design algorithms search the sequence-conformation space for sequences that are low in energy when folded to the target structure. Computational protein design algorithms use models of protein energetics to evaluate how mutations would affect a protein's structure and function. These energy functions typically include a combination of molecular mechanics, statistical (i.e. knowledge- based), and other empirical terms. Suitable available software includes IPRO (Interative Protein Redesign and Optimization), EGAD (A Genetic Algorithm for Protein Design), Rosetta Design, Sharpen, and Abalone.

Polypeptides as described herein may be expressed as a fusion to at least one other polypeptide. In a preferred embodiment, the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the fusion protein, and a polypeptide that assists in the purification of the fusion protein.

Also included within the scope of the invention are polypeptides defined herein which are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.

Production of Lipids

Techniques that are routinely practiced in the art can be used to extract, process, purify and analyze the non-polar lipids produced by cells, or transgenic non-human organisms or parts thereof of the instant invention. Such techniques are described and explained throughout the literature in sources such as, Fereidoon Shahidi, Current Protocols in Food Analytical Chemistry, John Wiley & Sons, Inc. (2001) D 1.1.1 - Dl.1.11, and Perez- Vich et al. (1998).

Production of seedoil

Typically, plant seeds are cooked, pressed, and/or extracted to produce crude seedoil, which is then degummed, refined, bleached, and deodorized. Generally, techniques for crushing seed are known in the art. For example, oilseeds can be tempered by spraying them with water to raise the moisture content to, for example, 8.5%, and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm. Depending on the type of seed, water may not be added prior to crushing. Application of heat deactivates enzymes, facilitates further cell rupturing, coalesces the lipid droplets, and agglomerates protein particles, all of which facilitate the extraction process.

In an embodiment, the majority of the seedoil is released by passage through a screw press. Cakes expelled from the screw press are then solvent extracted, for example, with hexane, using a heat traced column. Alternatively, crude seedoil produced by the pressing operation can be passed through a settling tank with a slotted wire drainage top to remove the solids that are expressed with the seedoil during the pressing operation. The clarified seedoil can be passed through a plate and frame filter to remove any remaining fine solid particles. If desired, the seedoil recovered from the extraction process can be combined with the clarified seedoil to produce a blended crude seedoil.

Once the solvent is stripped from the crude seedoil, the pressed and extracted portions are combined and subjected to normal lipid processing procedures (i.e., degumming, caustic refining, bleaching, and deodorization). In an embodiment, the oil and/or protein content of the seed is analysed by near- infrared reflectance spectroscopy as described in Horn et al. (2007).

Degumming

Degumming is an early step in the refining of oils and its primary purpose is the removal of most of the phospholipids from the oil, which may be present as approximately 1-2% of the total extracted lipid. Addition of -2% of water, typically containing phosphoric acid, at 70-80°C to the crude oil results in the separation of most of the phospholipids accompanied by trace metals and pigments. The insoluble material that is removed is mainly a mixture of phospholipids and triacylglycerols and is also known as lecithin. Degumming can be performed by addition of concentrated phosphoric acid to the crude seedoil to convert non-hydratable phosphatides to a hydratable form and to chelate minor metals that are present. Gum is separated from the seedoil by centrifugation. The seedoil can be refined by addition of a sufficient amount of a sodium hydroxide solution to titrate all of the fatty acids and removing the soaps thus formed.

Alkali refining

Alkali refining is one of the refining processes for treating crude oil, sometimes also referred to as neutralization. It usually follows degumming and precedes bleaching. Following degumming, the seedoil can treated by the addition of a sufficient amount of an alkali solution to titrate all of the fatty acids and phosphoric acids, and removing the soaps thus formed. Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate and ammonium hydroxide. This process is typically carried out at room temperature and removes the free fatty acid fraction. Soap is removed by centrifugation or by extraction into a solvent for the soap, and the neutralised oil is washed with water. If required, any excess alkali in the oil may be neutralized with a suitable acid such as hydrochloric acid or sulphuric acid.

Bleaching

Bleaching is a refining process in which oils are heated at 90-120°C for 10-30 minutes in the presence of a bleaching earth (0.2-2.0%) and in the absence of oxygen by operating with nitrogen or steam or in a vacuum. This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol etc), and the process also removes oxidation products, trace metals, sulphur compounds and traces of soap.

Deodorization

Deodorization is a treatment of oils and fats at a high temperature (200-260°C) and low pressure (0.1-1 mm Hg). This is typically achieved by introducing steam into the seedoil at a rate of about 0.1 ml/minute/100 ml of seedoil. Deodorization can be performed by heating the seedoil to 260°C under vacuum, and slowly introducing steam into the seedoil at a rate of about 0.1 ml/minute/100 ml of seedoil. After about 30 minutes of sparging, the seedoil is allowed to cool under vacuum. The seedoil is typically transferred to a glass container and flushed with argon before being stored under refrigeration. If the amount of seedoil is limited, the seedoil can be placed under vacuum, for example, in a Parr reactor and heated to 260°C for the same length of time that it would have been deodorized. This treatment improves the colour of the seedoil and removes a majority of the volatile substances or odorous compounds including any remaining free fatty acids, monoacylglycerols and oxidation products.

Winterisation

Winterization is a process sometimes used in commercial production of oils for the separation of oils and fats into solid (stearin) and liquid (olein) fractions by crystallization at sub-ambient temperatures. It was applied originally to cottonseed oil to produce a solid-free product. It is typically used to decrease the saturated fatty acid content of oils. Plant biomass for the production of lipid

Parts of plants involved in photosynthesis (e.g., and stems and leaves of higher plants and aquatic plants such as algae) can also be used to produce lipid. Independent of the type of plant, there are several methods for extracting lipids from green biomass. One way is physical extraction, which often does not use solvent extraction. It is a "traditional" way using several different types of mechanical extraction. Expeller pressed extraction is a common type, as are the screw press and ram press extraction methods. The amount of lipid extracted using these methods varies widely, depending upon the plant material and the mechanical process employed. Mechanical extraction is typically less efficient than solvent extraction described below.

In solvent extraction, an organic solvent (e.g., hexane) is mixed with at least the genetically modified plant green biomass, preferably after the green biomass is dried and ground. Of course, other parts of the plant besides the green biomass (e.g., lipid- containing seeds) can be ground and mixed in as well. The solvent dissolves the lipid in the biomass and the like, which solution is then separated from the biomass by mechanical action (e.g., with the pressing processes above). This separation step can also be performed by filtration (e.g., with a filter press or similar device) or centrifugation, etc. The organic solvent can then be separated from the non-polar lipid (e.g., by distillation). This second separation step yields non-polar lipid from the plant and can yield a re-usable solvent if one employs conventional vapor recovery.

If, for instance, the plant part is not to be used immediately to extract, and/or process the lipid, it is preferably handled post-harvest to ensure the lipid content does not decrease, or such that any decrease in lipid content is minimized as much as possible (see, for example, Christie, 1993). In one embodiment, the plant part is frozen as soon as possible after harvesting using, for example, dry ice or liquid nitrogen. In another embodiment, the plant part is stored at a cold temperature, for example -20°C or -60°C in an atmosphere of nitrogen.

Algae for the production of lipids

Algae can produce 10 to 100 times as much mass as terrestrial plants in a year. In addition to being a prolific organism, algae are also capable of producing oils and starches.

The specific algae most useful for lipid production are known as microalgae, consisting of small, often unicellular, types. These algae can grow almost anywhere. With more than 100,000 known species of diatoms (a type of alga), 40,000 known species of green plant-like algae, and smaller numbers of other algae species, algae will grow rapidly in nearly any environment, with almost any kind of water. Specifically, useful algae can be grown in marginal areas with limited or poor quality water, such as in the arid and mostly empty regions of the American Southwest. These areas also have abundant sunshine for photosynthesis. In short, algae can be an ideal organism for production of biofuels - efficient growth, needing no premium land or water, not competing with food crops, needing much smaller amounts of land than food crops, and storing energy in a desirable form.

Algae can store energy in its cell structure in the form of either oil or starch. Stored oil can be as much as 60% of the weight of the algae. Certain species which are highly prolific in oil or starch production have been identified, and growing conditions have been tested. Processes for extracting and converting these materials to fuels have also been developed. The most common oil-producing algae can generally include, or consist essentially of, the diatoms (bacillariophytes), green algae (chlorophytes), blue-green algae (cyanophytes), and golden -brown algae (chrysophytes). In addition a fifth group known as haptophytes may be used. Groups include brown algae and heterokonts. Specific non-limiting examples algae include the Classes: Chlorophyceae, Eustigmatophyceae, Prymnesiophyceae, Bacillariophyceae. Bacillariophytes capable of oil production include the genera Amphipleura, Amphora, Chaetoceros, Cyclotella, Cymbella, Fragilaria, Hantzschia, Navicula, Nitzschia, Phaeodactylum, and Thalassiosira. Specific non-limiting examples of chlorophytes capable of oil production include Ankistrodesmus, Botryococcus, Chlorella, Chlorococcum, Dunaliella, Monoraphidium, Oocystis, Scenedesmus, and Tetraselmis. In one aspect, the chlorophytes can be Chlorella or Dunaliella. Specific non-limiting examples of cyanophytes capable of oil production include Oscillatoria and Synechococcus. A specific example of chrysophytes capable of oil production includes Boekelovia. Specific non-limiting examples of haptophytes include Isochysis and Pleurochysis.

Specific algae useful in the present invention include, for example, Chlamydomonas sp. such as Chlamydomonas reinhardtii, Dunaliella sp. such as Dunaliella salina, Dunaliella tertiolecta, D. acidophila, D. bardawil, D. bioculata, D. lateralis, D. maritima, D. minuta, D. parva, D. peircei, D. polymorpha, D. primolecta, D. pseudosalina, D. quartolecta. D. viridis, Haematococcus sp., Chlorella sp. such as Chlorella vulgaris, Chlorella sorokiniana or Chlorella protothecoides, Thraustochytrium sp., Schizochytrium sp., Volvox sp, Nannochloropsis sp., Botryococcus braunii which can contain over 60 wt lipid, Phaeodactylum tricornutum, Thalassiosira pseudonana, Isochrysis sp., Pavlova sp., Chlorococcum sp, Ellipsoidion sp., Neochloris sp., Scenedesmus sp.

Lipid may be separated from the algae by mechanical crushing. When algae is dried it retains its lipid content, which can then be "pressed" out with an oil press. Since different strains of algae vary widely in their physical attributes, various press configurations (screw, expeller, piston, etc.) work better for specific algae types.

Osmotic shock is sometimes used to release cellular components such as lipid from algae. Osmotic shock is a sudden reduction in osmotic pressure and can cause cells in a solution to rupture.

Ultrasonic extraction can accelerate extraction processes, in particular enzymatic extraction processes employed to extract lipid from algae. Ultrasonic waves are used to create cavitation bubbles in a solvent material. When these bubbles collapse near the cell walls, the resulting shock waves and liquid jets cause those cells walls to break and release their contents into a solvent.

Chemical solvents (for example, hexane, benzene, petroleum ether) are often used in the extraction of lipids from algae. Soxhlet extraction can be use to extract lipids from algae through repeated washing, or percolation, with an organic solvent under reflux in a special glassware.

Fermentation processes for lipid production

As used herein, the term the "fermentation process" refers to any fermentation process or any process comprising a fermentation step. A fermentation process includes, without limitation, fermentation processes used to produce alcohols (e.g., ethanol, methanol, butanol), organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid), ketones (e.g., acetone), amino acids (e.g., glutamic acid), gases (e.g., H ₂ and C0 ₂ ), antibiotics (e.g., penicillin and tetracycline), enzymes, vitamins (e.g., riboflavin, beta-carotene), and hormones. Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred fermentation processes include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art. Suitable fermenting cells, typically microorganisms that are able to ferment, that is, convert, sugars such as glucose or maltose, directly or indirectly into the desired fermentation product.

Examples of fermenting microorganisms include fungal organisms such as yeast, preferably an oleaginous organism. As used herein, an "oleaginous organism" is one which accumulates at least 25% of its dry weight as triglycerides. As used herein, "yeast" includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces starkey, and Yarrowia lipolytica. Preferred yeast include Yarrowia lipolytica or other oleaginous yeasts and strains of the Saccharomyces spp., and in particular, Saccharomyces cerevisiae.

In one embodiment, the fermenting microorganism is a transgenic non-human organism that comprises one or more exogenous polynucleotides, wherein the transgenic non-human organism has an increased level of one or more hydroxyl fatty acids when compared to a corresponding organism lacking the one or more exogenous polynucleotides. The transgenic microorganism is preferably grown under conditions that optimize activity of fatty acid biosynthetic genes and acyltransferase genes. This leads to production of the greatest and the most economical yield of lipid. In general, media conditions that may be optimized include the type and amount of carbon source, the type and amount of nitrogen source, the carbon-to-nitrogen ratio, the oxygen level, growth temperature, pH, length of the biomass production phase, length of the lipid accumulation phase and the time of cell harvest.

It is contemplated that a variety of fermentation process designs may be applied, where commercial production of lipids using the instant nucleic acids is desired. For example, commercial production of lipid from a recombinant microbial host may be produced by a batch, fed-batch or continuous fermentation process.

Fatty acids, including polyunsaturated fatty acids (PUFAs), may be found in the host microorganism as free fatty acids or in esterified forms such as acylglycerols, phospholipids, sulfolipids or glycolipids, and may be extracted from the host cell through a variety of means well-known in the art.

In general, means for the purification of fatty acids, including PUFAs, may include extraction with organic solvents, sonication, supercritical fluid extraction (e.g., using carbon dioxide), saponification and physical means such as presses, or combinations thereof. Of particular interest is extraction with methanol and chloroform in the presence of water (Bligh and Dyer, 1959). Where desirable, the aqueous layer can be acidified to protonate negatively-charged moieties and thereby increase partitioning of desired products into the organic layer. After extraction, the organic solvents can be removed by evaporation under a stream of nitrogen. When isolated in conjugated forms, the products may be enzymatically or chemically cleaved to release the free fatty acid or a less complex conjugate of interest, and can then be subject to further manipulations to produce a desired end product. Desirably, conjugated forms of fatty acids are cleaved with potassium hydroxide.

If further purification is necessary, standard methods can be employed. Such methods may include extraction, treatment with urea, fractional crystallization, HPLC, fractional distillation, silica gel chromatography, high-speed centrifugation or distillation, or combinations of these techniques. Protection of reactive groups such as the acid or alkenyl groups, may be done at any step through known techniques (e.g., alkylation, iodination). Methods used include methylation of the fatty acids to produce methyl esters. Similarly, protecting groups may be removed at any step. Desirably, purification of fractions containing gamma-linolenic acid (GLA), stearidonic acid (STA), arachidonic acid (ARA), docosahexaenoic acid (DHA), docosapentaenoic acid (DPA), and/or eicosapentaenoic acid (EPA) may be accomplished by treatment with urea and/or fractional distillation. An example of the use of plant biomass for the production of a biomass slurry using yeast is described in WO 2011/100272.

Uses of Oils and Fatty Acids

The oils and/or fatty acids produced by the methods described have a variety of uses. In some embodiments, the oils and/or fatty acids are used as food oils. In other embodiments, the oils and/or fatty acids are refined and used as lubricants or for other industrial uses such as the synthesis of plastics. It may be used in the manufacture of cosmetics, soaps, fabric softeners, electrical insulation or detergents. It may be used to produce agricultural chemicals such as surfactants or emulsifiers. In some embodiments, the oils and/or fatty acids are refined to produce biodiesel. The oil of the invention may advantageously be used in paints or varnishes since the absence of linolenic acid means it does not discolour easily.

An industrial product produced using a method of the invention may be a hydrocarbon product such as fatty acid esters, preferably fatty acid methyl esters and/or a fatty acid ethyl esters, an alkane such as methane, ethane or a longer-chain alkane, a mixture of longer chain alkanes, an alkene, a biofuel, carbon monoxide and/or hydrogen gas, a bioalcohol such as ethanol, propanol, or butanol, biochar, or a combination of carbon monoxide, hydrogen and biochar. The industrial product may be a mixture of any of these components, such as a mixture of alkanes, or alkanes and alkenes, preferably a mixture which is predominantly (>50%) C4-C8 alkanes, or predominantly C6 to CIO alkanes, or predominantly C6 to C8 alkanes. The industrial product is not carbon dioxide and not water, although these molecules may be produced in combination with the industrial product. The industrial product may be a gas at atmospheric pressure/room temperature, or preferably, a liquid, or a solid such as biochar, or the process may produce a combination of a gas component, a liquid component and a solid component such as carbon monoxide, hydrogen gas, alkanes and biochar, which may subsequently be separated. In an embodiment, the hydrocarbon product is predominantly fatty acid methyl esters. In an alternative embodiment, the hydrocarbon product is a product other than fatty acid methyl esters.

Heat may be applied in the process, such as by pyrolysis, combustion, gasification, or together with enzymatic digestion (including anaerobic digestion, composting, fermentation). Lower temperature gasification takes place at, for example, between about 700°C to about 1000°C. Higher temperature gasification takes place at, for example, between about 1200°C to about 1600°C. Lower temperature pyrolysis (slower pyrolysis), takes place at about 400°C, whereas higher temperature pyrolysis takes place at about 500°C. Mesophilic digestion takes place between about 20°C and about 40°C. Thermophilic digestion takes place from about 50°C to about 65°C.

Chemical means include, but are not limited to, catalytic cracking, anaerobic digestion, fermentation, composting and transesterification. In an embodiment, a chemical means uses a catalyst or mixture of catalysts, which may be applied together with heat. The process may use a homogeneous catalyst, a heterogeneous catalyst and/or an enzymatic catalyst. In an embodiment, the catalyst is a transition metal catalyst, a molecular sieve type catalyst, an activated alumina catalyst or sodium carbonate as a catalyst. Catalysts include acid catalysts such as sulphuric acid, or alkali catalysts such as potassium or sodium hydroxide or other hydroxides. The chemical means may comprise transesterification of fatty acids in the lipid, which process may use a homogeneous catalyst, a heterogeneous catalyst and/or an enzymatic catalyst. The conversion may comprise pyrolysis, which applies heat and may apply chemical means, and may use a transition metal catalyst, a molecular sieve type catalyst, an activated alumina catalyst and/or sodium carbonate as a catalyst.

Enzymatic means include, but are not limited to, digestion by microorganisms in, for example, anaerobic digestion, fermentation or composting, or by recombinant enzymatic proteins. Biofuel

As used herein the term "biofuel" includes biodiesel and bioalcohol. Biodiesel can be made from oils derived from plants, algae and fungi. Bioalcohol is produced from the fermentation of sugar. This sugar can be extracted directly from plants (e.g., sugarcane), derived from plant starch (e.g., maize or wheat) or made from cellulose (e.g., wood, leaves or stems).

Biofuels currently cost more to produce than petroleum fuels. In addition to processing costs, biofuel crops require planting, fertilising, pesticide and herbicide applications, harvesting and transportation. Plants, algae and fungi of the present invention may reduce production costs of biofuel.

General methods for the production of biofuel can be found in, for example,

Maher and Bressler (2006), Maher and Bressler (2007), Greenwell et al. (2011), Karmakar et al. (2010), Alonso et al. (2010), Lee and Mohamed (2010), Liu et al. (2010), Gong and Jiang (2011), Endalew et al. (2011) and Semwal et al. (2011). Biodiesel

The production of biodiesel, or alkyl esters, is well known. There are three basic routes to ester production from lipids: 1) Base catalysed transesterification of the lipid with alcohol; 2) Direct acid catalysed esterification of the lipid with methanol; and 3) Conversion of the lipid to fatty acids, and then to alkyl esters with acid catalysis.

Any method for preparing fatty acid alkyl esters and glyceryl ethers (in which one, two or three of the hydroxy groups on glycerol are etherified) can be used. For example, fatty acids can be prepared, for example, by hydrolyzing or saponifying triglycerides with acid or base catalysts, respectively, or using an enzyme such as a lipase or an esterase. Fatty acid alkyl esters can be prepared by reacting a fatty acid with an alcohol in the presence of an acid catalyst. Fatty acid alkyl esters can also be prepared by reacting a triglyceride with an alcohol in the presence of an acid or base catalyst. Glycerol ethers can be prepared, for example, by reacting glycerol with an alkyl halide in the presence of base, or with an olefin or alcohol in the presence of an acid catalyst.

In some preferred embodiments, the lipids are transesterified to produce methyl esters and glycerol. In some preferred embodiments, the lipids are reacted with an alcohol (such as methanol or ethanol) in the presence of a catalyst (for example, potassium or sodium hydroxide) to produce alkyl esters. The alkyl esters can be used for biodiesel or blended with petroleum based fuels.

The alkyl esters can be directly blended with diesel fuel, or washed with water or other aqueous solutions to remove various impurities, including the catalysts, before blending. It is possible to neutralize acid catalysts with base. However, this process produces salt. To avoid engine corrosion, it is preferable to minimize the salt concentration in the fuel additive composition. Salts can be substantially removed from the composition, for example, by washing the composition with water.

In another embodiment, the composition is dried after it is washed, for example, by passing the composition through a drying agent such as calcium sulfate.

In yet another embodiment, a neutral fuel additive is obtained without producing salts or using a washing step, by using a polymeric acid, such as Dowex 50™, which is a resin that contains sulfonic acid groups. The catalyst is easily removed by filtration after the esterification and etherification reactions are complete. Compositions

The present invention also encompasses compositions, particularly pharmaceutical compositions, comprising one or more lipids or oils produced using the methods of the invention.

A pharmaceutical composition may comprise one or more of the lipids, in combination with a standard, well-known, non-toxic pharmaceutically-acceptable carrier, adjuvant or vehicle such as phosphate-buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent, or an emulsion such as a water/oil emulsion. The composition may be in either a liquid or solid form. For example, the composition may be in the form of a tablet, capsule, ingestible liquid, powder, topical ointment or cream. Proper fluidity can be maintained for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. It may also be desirable to include isotonic agents for example, sugars, sodium chloride, and the like. Besides such inert diluents, the composition can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents.

Suspensions, in addition to the active compounds, may comprise suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, or mixtures of these substances.

Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art. For example, lipid produced in accordance with the present invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipients into a gelatin capsule along with antioxidants and the relevant lipid(s).

For intravenous administration, the lipids produced in accordance with the present invention or derivatives thereof may be incorporated into commercial formulations.

A typical dosage of a particular fatty acid is from 0.1 mg to 20 g, taken from one to five times per day (up to 100 g daily) and is preferably in the range of from about 10 mg to about 1, 2, 5, or 10 g daily (taken in one or multiple doses). As known in the art, a minimum of about 300 mg/day of fatty acid, especially polyunsaturated fatty acid, is desirable. However, it will be appreciated that any amount of fatty acid will be beneficial to the subject. Possible routes of administration of the pharmaceutical compositions of the present invention include for example, enteral and parenteral. For example, a liquid preparation may be administered orally. Additionally, a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhalant.

The dosage of the composition to be administered to the subject may be determined by one of ordinary skill in the art and depends upon various factors such as weight, age, overall health, past history, immune status, etc., of the subject.

Additionally, the compositions of the present invention may be utilized for cosmetic purposes. The compositions may be added to pre-existing cosmetic compositions, such that a mixture is formed, or a fatty acid produced according to the invention may be used as the sole "active" ingredient in a cosmetic composition.

EXAMPLES

Example 1. Materials and Methods

H. benghalensis cDNA library screening by hybridisation

XLl-Blue MRF' cells were grown in LB broth with 10 mM MgS0 ₄ and 0.2% maltose at 30°C overnight, collected by centrifuging 1000 x g, and resuspended in 10 mM MgS0 ₄ at OD ₆ oo of 0.5. An aliquot of the H. benghalensis cDNA library (5 x 10 ⁵ pfu) was added to the XLl-Blue MRF' cells at 37°C for 15 minutes, and mixed with NZY top agar for plating out. The resultant phage plaques were then transferred to Hybond N ⁺ membranes, which were then denatured with 1.5 M NaCl/0.5 M NaOH, then neutralized with 1.5 M NaCl/0.5 M Tris-HCl (pH 8.0), and finally rinsed with 2 x SSC buffer. After air drying, the membranes were hybridized with radioactively- labelled probes at 60°C overnight under standard conditions and then washed with 2x SSC/0.1% SDS for 30 minutes at 65°C, followed by washing with 0.2x SSC/0.1% SDS for 30 minutes at 65°C (high stringency) or hybridised at 55°C overnight and washed at 60°C with 2x SSC/0.1% SDS three times each for 10 minutes (moderate stringency). The plasmids were excised from positive plaques and the nucleotide sequences of the inserts were determined.

Construction of expression plasmids

H. benghalensis protein coding regions or gene fragments in selected cDNA clones were cut out of the vectors with restriction enzymes and ligated to similarly digested pENTRl l entry vector (Invitrogen), and transformed into E. coli DH5a. Kanamycin resistant/ampicillin sensitive colonies were selected and inserts in the plasmids sequenced to confirm their identity, and then recombined using LR Clonase (Invitrogen) into the yeast vector pYES-DEST52 (Invitrogen) for yeast expression or into pXZP391 or pXZP393 binary vector modified from pHellsgate8 (Helliwell et al., 2002) for plant expression under control of the Fp 1 seed specific promoter (Stalberg et al, 1993) or CaMV 35S promoter. The resultant yeast expression plasmids were transformed into yeast strain YPH499 (Stratagene). The resultant plant expression plasmids were transformed into Agwbacterium tumefaciens strain AGLl and used for plant transformation by standard methods.

Yeast culturing

Yeast culturing was essentially as previously described (Zhou et al, 2006a; Zhou et al., 2007). Plasmids were introduced into yeast by a standard heat shock method and transformants selected on yeast synthetic drop out (SD) medium plates containing 2% glucose. Cultures were inoculated in liquid SD with 2% glucose to an initial OD ₆ oo of about 0.3. Cultures were grown at 30°C with shaking until the OD ₆ oo was approximately 1.0. The cells were harvested by centrifugation and washed with sterile water, then resuspended into the same volume of synthetic media with 2% galactose (SG) instead of glucose. Selected precursor fatty acids were added as specified to a final concentration of 0.5 mM at the presence of 1% NP-40, while controls had no fatty acids added or the yeast contained vector with no insert. Cultures were incubated at 30°C with shaking for a further 48 hours prior to harvesting by centrifugation. Cell pellets were washed with 1% NP-40, 0.5% NP-40 and water to remove any unincorporated fatty acids from the surface of the cells.

Plant transformation

Arabidopsis thaliana plants which were of the fadl/fael double mutant genotype (Smith et al., 2003) were used in transformation experiments with different plant expression vectors as specified. Arabidopsis transformations were done by spraying flower buds with suspensions of A. tumefaciens (AGLl strain) containing the binary vector having the T-DNA of choice. Seeds (T seeds) were collected from the treated plants (To generation) at maturity (Zhou et al., 2006b). Transformed plants (T generation) were selected by plating the T _\ seeds on medium containing either kanamycin or hygromycin according to the selectable marker gene of the T-DNA used, where resistance to the antibiotic indicated the presence of the selectable marker gene and therefore of transformation with the desired T-DNA. All transgenic Arabidopsis plants were grown in a greenhouse under natural day-length at controlled temperatures of 24°C in the daylight hours and 18°C during the night. Seeds from selfed T _\ plants (T ₂ seed) were harvested and the seed fatty acid composition was analysed by gas chromatography (GC) by standard methods. For segregation studies for the transgene(s), individual T ₂ seeds were planted, the T ₂ plants grown to maturity after self-fertilisation, and the T ₃ seeds were harvested and analysed for antibiotic resistance and fatty acid composition of seed oil by GC or GC mass spectra (GC-MS).

Fatty acid methyl esters (FAME) preparation

Fatty acid methyl esters (FAME) were formed by transesterification of the total fatty acids in yeast cells, obtained as cell pellets after centrifugation of cultures, or Arabidopsis seeds, essentially as described previously (Zhou et al, 2006a; Zhou et al. 2007; Zhou et al, 2011), modified from Smith et al. (2003), by adding 750 of 1 M MeOH-HCl and incubating the samples at 80°C for at least 2 hours, then adding 500 of 0.9% NaCl. FAMEs were extracted into 300 μΐ _^ of hexane. For hydroxyl fatty acids, the FAME mixtures were further modified by adding 25 μΐ _^ of 1% trimethylchlorosilane (TMCS) in N,0-bis(trimethylsilyl)trifluoroacetamide (BSTFA, Supelco) at 80°C for at least 30 minutes. The FAME were then analysed by GC and GC-MS. Capillary gas chromatography (GC)

FAME were analysed with an Agilent 6890 gas chromatograph fitted with 6980 series automatic injector with temperature at 240°C and a flame-ionization detector (FID) with temperature at 280°C. FAME samples were injected at 150°C onto a BPX70 polar capillary column (SGE; 60 m x 0.25 mm i.d.; 0.25 μιη film thickness). After 1 minute, the oven temperature was raised to 200°C at 5°C min ¹ , then to a final temperature of 240°C at 10°C min ^"1 where it was kept for 5 minutes. Helium was the carrier gas. Identification of peaks was based on comparison of relative retention time data with standard FAMEs. For quantification, Chemstation (Agilent) was used to integrate peaks. Gas chromatography-mass spectrometry (GC-MS)

Mass spectrometry (GC-MS) analysis was carried out on a Shimadzu GC-MS QP2010 Plus ion-trap fitted with on-column injection. Samples were injected using an AS3000 auto sampler onto a retention gap attached to a BPX70 polar capillary column (SGE; 30 m x 0.25 mm i.d.; 0.25 μιη film thickness). The initial temperature of 150°C was held for 1 minute, followed by temperature programming at 5 ⁰ C.min ^_1 to 200°C then at 10°C.min ^{" 1} to 240°C where it was held for 5 minutes. Helium was used as the carrier gas. Mass spectra were acquired and processed with GC-MS solution software (Version 2.61).

Yeast microsome preparation

Yeast cells from colonies grown on plates were inoculated into 10 mL YNB-

URA media and grown aerobically with 2% glucose overnight. Cells were harvested by centrifugation at 4400 rpm for 5 minutes, resuspended in 1 ml YNB-URA with 2% galactose, and diluted into 100 mL media to an OD ₆ oo of about 0.2. These were allowed to grow for at least 24 hours to an OD ₆ oo of between 3 and 4. The cells were harvested by centrifugation at 4400 rpm for 5-10 minutes, washed with 2x 20 mL 25 mM Tris-HCl pH7.6, and resuspended in 2x 1 mL Tris-HCl pH 7.6 in 2 mL screw-cap tubes. The cells were then spun down again at 10,000 rpm for 10 minutes to remove all the liquid. 1.5 mL glass beads (0.5mm Zirconia/Silica Beads, BioSpec Products) were added to the yeast cells, the tube filled with lysis buffer (20 mM Tris-HCl, pH 7.9, 10 mM MgCl ₂ , 1 mM EDTA, 5% Glycerol, 0.3 M (NH ₄ ) ₂ S0 ₄ ) supplemented with protease inhibitors (1 tablet/50 mL buffer). The cells were then broken with a Mini Bead Beater in the cold room, and the samples transferred into 50 mL plastic tubes. After adding more lysis buffer, without protease inhibitors, to 20 mL, the samples were spun at 4400 rpm at 4°C for 10 minutes. The supernatants were transferred to ultra centrifuge tubes, spun at 42,000 rpm for 2 hours at 4°C in a Beckmann 70Ti rotor, and microsomes harvested. The microsome pellet was briefly washed with 0.1 M K-P0 ₄ buffer (pH 7.2), resuspended in 1 mL 0.1 M K-P0 ₄ buffer (pH 7.2) with a glass homogenizer, and stored in aliquots at -80°C. The protein concentration was determined with a BAC protein assay kit. LPCAT forward reaction assay

For each reaction, 10 nmole of [ ¹⁴ C]-LPC was dissolved in 0.1 M K-P0 ₄ buffer (pH 7.2), and 5 nmole of acyl-CoA and about 0.1-0.5 μg microsomal proteins were added, made up to a final volume of 50 μΐ _^ with 0.1 M K-PO ₄ buffer (pH 7.2). The reaction was started by adding the microsomes and the mixtures incubated for 4 minutes at 30°C, with slow shaking. The reactions were stopped and the mixtures extracted with 170 μΐ. 5% HAc and 500 μΐ. CHCl ₃ :MeOH (1: 1). After vortexing, the CHC1 ₃ phase was separated by centrifugation for 2 minutes, and transferred into a glass tube. Lipids in the CHC1 ₃ phase were dried down to 40 μΐ _^ by heating under nitrogen, loaded onto a TLC plate, and developed with CHCl ₃ :MeOH:HAc:H ₂ 0 (90: 15: 10:3 v/v/v/v). The TLC plate was scanned with an Instant Image or a Phosphor Imager and quantified.

LPCAT reverse reaction assay

For each reaction, freeze-dried microsomes equivalent to 43 μg of protein, 9 nmol of ¹⁴ C-PC ( ¹⁴ C 18: 1-PC and ¹⁴ C-ric-PC, 4.5 nmole each) dissolved in 19 μΐ of benzene were used. The benzene was immediately evaporated under a stream of N ₂ , followed by adding 100 μΐ of 100 mM K-PO ₄ buffer (pH 7.2) containing 0.2 μηιοΐ (= 2 mM) CoASH (CoA lithium salt), 10 nmol cold 18: l-CoA and 1 mg BSA (freshly mixed), and vortexing. The reaction mixture was incubated with shaking at 30°C for 0 minutes (only empty vector control) or for 60 minutes. Three pooled reactions were transferred to a glass tube with 100 μΐ BSA in H ₂ 0 (100 mg/ml). The lipids were extracted by the Bligh and Dyer method, and collected in the CHC1 ₃ phase. An aliquot of the CHC1 ₃ phase was loaded onto a TLC plate and the lipids in each sample separated using a polar solvent (CHCl _s :MeOH:HAc:H ₂ 0; 90: 15: 10:3 v/v/v/v). An aliquot (1/10 ^Λ ) of the fraction was counted in a scintillation counter and the amount of PC from the combined results of TLC and scintillation counter was calculated. The upper phase containing acyl-CoA was washed with 3x 2.5mL CHCl _3i and hydrolyzed with 0.5 ml 4 M KOH for 15 minutes at 90°C. The mixture was transferred to large tubes (15 ml), and neutralized with 0.5 ml 6 M HC1. The lipids were extracted into CHC1 ₃ phase using the Bligh and Dyer method. An aliquot was counted in a scintillation counter, and the remainder was loaded onto a TLC plate and developed with a neutral solvent (hexane:DEE:HAc; 50:50: 1 v/v/v). The free fatty acids that were hydrolyzed from ¹⁴ C acyl-CoA were quantified by an Instant Image or Phosphor Imager. The amounts of ¹⁴ C fatty acid in the PC and acyl-CoA fractions were then calculated.

Example 2. Construction and use of Hiptage benghalensis cDNA library

In recent years, various genes responsible for the production of unusual fatty acids such as hydroxylated fatty acids have been cloned and introducing into model plants or oil crop species (Carlsson et al., 2011; Zhou et al., 2006c; Dyer et al., 2008; Singh et al., 2005). However, these attempts have yielded only relatively low amounts of the unusual fatty acids in the transgenic plants compared to the levels in the oil of the source plants (Carlsson et al., 2011). For example, oleate hydroxylase genes responsible for the formation of ricinoleic acid were cloned from castor bean (van de Loo, et al., 1995), Lesquerella fendleri (Broun et al., 1998), Physaria lindheimeri (Dauk et al., 2007) and the fungus Claviceps purpurea (Meesapyodsuk and Qiu, 2008). However, expressing the hydroxylase gene alone in the seeds of transgenic plants only achieved moderate levels of ricinoleic acid (Broun et al., 1997; Smith et al., 2003). Efforts have been made to identify efficient triacylglycerol (TAG) assembly pathways for the unusual fatty acids (Cagliari et al., 2010; Chan et al., 2010) and additional genes introduced into the hydroxylase expressing transgenic plants (Burgal et al., 2008; van Erp et al., 2011; Li et al., 2010; Mavraganis et al., 2010). These efforts led to increased levels of hydroxyl fatty acid accumulation in transgenic seed oil (Burgal, et al. 2008).

Hiptage benghalensis [L.] Kurz, a member of the Malpighiaceae family, is a vine-like plant native to temperate and tropical Asia, growing as a high-climbing (50- 60 m), twining liana when adjacent to trees or forms a large shrub to 4 m when trees are absent. The hiptage seed oil is rich in ricinoleic acid (RA), having about 70% RA in its seedoil (Badami and Kudari, 1970). Thus, the present inventors chose H. benghalensis as a source plant for cloning additional sources of oleate A12-hydroxylase and associated genes.

In order to isolate genes involved in the biosynthesis of hydroxylated fatty acids and their incorporation into TAG, a cDNA library was made from RNA isolated from Hiptage benghalensis embryos as follows. Developing embryos at middle and later developing stages were collected from plants growing in Douglas Shire, Mossman, Parks & Garden Department, Queensland. Total RNA was isolated from developing seeds ranging from middle to late developing stages using Trizol reagent (Promega) according to the supplier's instructions. mRNA was purified from total RNA using an Oligotex mRNA kit (Qiagen). First strand cDNA was synthesised from 4.7 μg mRNA using an oligo-dT primer supplied with the ZAP-cDNA synthesis kit (Stratagene) and reverse transcriptase Superscript III (Invitrogen). Double stranded cDNA (200 ng) was ligated to EcoRVXhoI adaptors and from this a library was constructed using the ZAP- cDNA synthesis kit according to the supplier's instructions. The titer of the primary library was 1 x 10 ⁶ plaque forming units (pfu)/ml and that of the amplified library was 4.6 x 10 ⁹ pfu/ ml. The average insert size of cDNA inserts in the library was 0.7 kb and the percentage of recombinants in the library was 93%.

Bulk excision and EST sequencing of H. benghalensis cDNA library

A portion of the unamplified cDNA library containing 9 x 10 ⁴ pfu was excised from the viral vectors into plasmids in colonies by infecting 100 of 10 mM MgS0 ₄ pretreated XL-1 Blue MRF cells (Stratagene) at OD ₆₀ o =1.0, and 10 μΐ. of ExAssist helper phage (1 x 10 ⁸ pfu, Stratagene). After infection at 37°C for 15 minutes, 1.5 mL of 37°C pre-warmed LB medium was added, and the mixture incubated at 37°C for 2 hours. The mixture was heated to 65°C for 20 minutes, and phagemid supernatant recovered after centrifuging at 14,000 rpm for 5 minutes. The phagemid was used to infect 10 mM MgS0 ₄ pretreated SOLR cells (Stratagene) at OD ₆₀₀ =1.0 (100 of cells for each 50 phagemid) for 15 minutes, then incubated at 37°C for 45 minutes after added 300 of 37°C pre-warmed LB media. The cells were then collected by centrifugation and plated out on LB/ampicillin/IPTG/X-gal plates until enough colonies were obtained for EST sequencing. White colonies were selected for plasmid DNA extraction and sequenced with standard Reverse primer (Beijing Genomic Institute, Beijing, China). The resultant sequences were translated to obtain predicted amino acid sequences which were used to search for homologous sequences in GenBank database by BlastX. Sequences of 13,007 clones were obtained from this EST sequencing. 454 deep sequencing

Mass sequencing (454 deep sequencing) of mRNA obtained from the H. benghalensis embryos was carried out at ACRF Biomolecular Resource Facility, John Curtin School of Medical Research, Australian National University, using 500 ng mRNA obtained from H. benghalensis developing embryos. A total of 431763 reads were obtained having a median sequence length of 470 nucleotides. The sequences were entered into a searchable database and searched by BLAST as described in the following Examples. The resultant sequences were analysed with VectorNTI (Invitrogen).

Example 3. Isolation and characterisation of cDNAs encoding Δ12 desaturase-like polypeptides from Hiptage

Genes isolated so far that encode fatty acid A12-modification enzymes, such as A12-hydroxylase, epoxygenase, conjugase and acetylenase either belong to the Δ12- desaturase (FAD2) like gene family, or in some cases to a cytochrome P450 family, such as Euphorbia lagascae P450 A12-epoxygenase (Cahoon, 2002). However, the cloned fatty acid A12-hydroxylase genes all belong to FAD2-like family. Therefore, the present inventors first screened the H. benghalensis cDNA library (EST library) for FAD2-like sequences. Screening of the H. benghalensis EST sequence database with Arabidopsis FAD2 and castor FAH12 sequences and further screening of the cDNA library with identified H. benghalensis i¾D2-like sequence as probe identified 6 clones (SEQ ID NO: 1-6) which encoded FAD2-like polypeptides from the cDNA library.(SEQ ID NO:7-12). These clones were designated HbFAD2-l to HbFAD2-6 (SEQ ID NO: 1-6). The clone HbFAD2-6 was predicted to encode a partial-length polypeptide, (SEQ ID NO:6), the encoded polypeptide missing about 72 amino acid residues from the N-terminus compared to the other HbFAD2-like sequences, but the others were predicted to encode full length polypeptides.

There was no mRNA sequence in the 454 deep sequencing database corresponding to the HbFAD2-6 sequence. Moreover, several attempts to clone the 5'- end of this gene by 5'-RACE were unsuccessful. From these observations, the present inventors concluded that this gene was expressed at a much lower level than the other HbFAD2-like genes, if at all.

In order to see whether any of the HbFAD2-like clones were more likely than the others to encode a A12-hydroxylase polypeptide rather than a FAD2 or other FAD2-like sequence which was not a hydroxylase, the amino acid sequences of the HbFAD2-like polypeptides were compared to several known A12-hydroxylases identified from plants or fungi which accumulate ricinoleic acid and to Arabidopsis FAD2. The extent of amino acid sequence identity between the 6 FAD2-like sequences ranged from 68%-98% (see Table 2). Their amino acid sequences showed 66%-75%, 65%-70%, 63%-70%, 67%-78% identity to Ricinus communis (castor) Δ12- hydroxylase (RcFAH12, Accession No. U22378, SEQ ID NO: 107), Lesquerella fendleri A12-hydroxylase (LfFAH12, Accession No. AAC32755, SEQ ID NO: 108), Physaria lindheimeri A12-hydroxylase (P1FAH12, Accession No. ABQ01458, SEQ ID NO: 109), and Arabidopsis thaliana A12-desaturase (AtFAD2, Accession No. P46313, SEQ ID NO: 110), respectively. That is, they were as closely related to the Arabidopsis FAD2 as to known hydroxylases- therefore the sequence comparison alone could not reliably predict which of the Hiptage sequences was likely to correspond to a hydroxylase. Also, they were relatively divergent to fungus Claviceps purpurea Δ12- hydroxylase (CpFAH12, Accession No. ACF37070, SEQ ID NO: 111) having an amino acid identity of 32%-37%. This data is tabulated as follows.

Table 2. Amino acid sequence identity of the 6 HbFAD2-like sequences (HbFAD2- 1 to HbFAD2-6) to RcFAH12, LfFAH12, P1FAH12, AtFAD2 and CpFAH12.

RcFAH12 LfFAH12 P1FAH12 AtFAD2 CpFAH12

LfFAH12 64.4%

P1FAH12 62.4% 91.1%

HbFAD2- 1 75.3% 65.1% 63.0% 69.9% 32.3%

HbFAD2-2 69.1% 69.4% 67.0% 76.3% 31.7%

HbFAD2-3 65.5% 66.8% 65.7% 67.4% 32.1%

HbFAD2-4 67.3% 66.8% 65.7% 68.2% 32.3%

HbFAD2-5 75.2% 65.9% 69.5% 77.6% 36.7% HbFAD2-6 73.5% 70.4% 63.0% 70.0% 37.1%

AtFAD12 66.7% 84.9% 82.2% 32.5%

The nucleotide sequences of the protein coding regions of the 6 cDNA clones were also compared to the nucleotide sequences of the cDNAs from the other species. The 6 HbFAD2-like sequences showed 66%-77% identity to AtFAD2 and to the fatty acid hydroxylase genes (see Table 3).

Table 3. Nucleotide sequence identity of the 6 HbFAD2-like sequences (HbFAD2- 1 to HBFAD2-6) to RcFAH12, LfFAH12, PIFAH12 and AtFAD2.

Therefore, these comparisons did not allow any conclusion, even tentative, as to which of the HbFAD2-like sequences might be a A12-desaturase or a A12-hydroxylase, a bifunctional enzyme, or indeed from a pseudogene encoding a polypeptide without activity.

Alignment of the 6 HbFAD2-like sequences (see Figure 1) revealed conserved

His boxes (boxed in Figure 1). Sequence alignment of the HbFAD2s including other two species, R. communis Euphorbiaceae and Linum usitatissimum, from the same large branch of Malpighiales and Arabidopsis also suggested that H. benghalensis might have 3 pairs of related i¾D2-like genes, each pair perhaps having arisen by gene duplication events (Figure 2). These pairs were: HbFAD2-l/HbFAD2-6, HbFAD2- 5/HbFAD2-2 and HbFAD2 -3/HbFAD2 -4. The extent of identity was closer within a pair than to the other sequences.

Example 4. Functional analysis of HbFAD2-like genes

In order to carry out functional studies of the 5 full length HbFAD2-like sequences in yeast and plant cells, the HbFAD2-l to HbFAD2-5 full-length cDNA sequences (SEQ ID NO: 1-5), including the 5'- and 3'-UTR sequences, were cloned into the pENTRl 1 entry vector. The inserts were then recombined into the yeast vector pYES-DEST52, generating the yeast expression plasmids pXZP524, pXZP526, pXZP534, pXZP536 and pXZP565. As a positive control, the cDNA fragment in the clone pESC-LFAH, corresponding to the A12-hydroxylase gene from L. fendleri (LfFAH12) in pESC-LFAH (provided by Dr Ljerka Kunst, Columbia University) was inserted as a Hindlll-Sphl fragment directly into pYES2, resulting in pYES-LfFAH12. The RcFAH12 coding region from R. communis was amplified from the clone pMS191.1 (provided by Prof Chris Somerville, Stanford University) using the primers RcD12hyd-SalF (5 '-GTCG ACGG ATCCC AT AGT AACGGCGG- 3 ' ; SEQ ID NO: 13) and RcD12hyd-SalR (5'-GTCGACCCGCCAGTGTGCTCTAAAGTT-3'; SEQ ID NO: 14) and inserted into the plasmid vector pGEM-T Easy (Promega). After confirming the correct clone by nucleotide sequencing, the coding region was cloned into pENTRl 1, resulting in pXZP551, and then recombined into pYES-DEST52 to generate the yeast expression plasmid pXZP552. The protein coding region encoding CpFAH12 from C. purpurea based on sequence Accession No. EU661785 (Meesapyodsuk and Qui, 2008) was synthesized and cloned as an Ncol-Xhol fragment into pENTRl 1, resulting in pXZP566, and then recombined into pYES-DEST52 to generate the yeast expression plasmid pXZP567.

These yeast expression plasmids were introduced into yeast strain YPH499 (Stratagene) by a standard heat shock method and transformants selected on yeast synthetic drop out (SD) medium plates containing 2% glucose.

The same coding regions in the entry vectors, except for LfFAH12, were also inserted into the Gateway binary vector pXZP391, which was modified from pHellsgate8 (Helliwell et al., 2002). The coding region for LfFAH12 was directly cloned as an EcoRI fragment from pESC-LFAH into Smal digested pWVec8-Fpl (Singh et al., 2001) for plant expression under control of the Fpl seed specific promoter (Stalberg, 1993). The resultant plant expression plasmids were designated pXZP624 (for HbFAD2-l), pXZP626 (for HbFAD2-2), pXZP634 (for HbFAD2-3), pXZP636 (for HbFAD2-4), pXZP652 (for RcFAH12), pXZP301 (for LfFAH12) and pXZP653 (for CpFAH12). Each construct had its coding region under the control of the seed- specific Fpl promoter. These constructs were all individually transformed into Agwbacterium tumefaciens strain AGLl and used for plant transformation as described in Example 1.

Fatty acids from the yeast cultures and the transformed Arabidopsis seeds were examined for the presence of ricinoleic acid and other A12-hydroxylated fatty acids and for an altered level of linoleic acid which would indicate FAD2 activity (Δ12- desaturase), by FAME analysis as described in Example 1. The GC analysis was done on FAME from triplicate seed samples from the lines with the maximal level hydroxylated fatty acids (HFA) for each construct (see Table 5). The present inventors concluded from the yeast expression data that HbFAD2-l (SEQ ID NO:7), HbFAD2-2 (SEQ ID NO:8) and HbFAD2-5 (SEQ ID NO: 11) were all A12-desaturases (i.e. FAD2 enzymes), producing dienoic acids C16:2 ^A9 ' ¹² and C18:2 ^A9 ' ¹² from the corresponding monounsaturated fatty acid substrates. HbFAD2-3 (SEQ ID NO: 9) and HbFAD2-4 (SEQ ID NO: 10) were A12-hydroxylases, producing hydroxyl fatty acids 120H- C16: 1 ^A9 and 120H-C18: 1 ^A9 (see Table 4, listed as C16: 10H and C18: 10H). Both of these A12-hydroxylases also had a low level of A12-desaturation activity, but were classified as A12-hydroxylases because that activity was much greater than their Δ12- desaturation activity. The chemical structures of the hydroxyl fatty acids were confirmed by GC-MS analysis of the fatty acid methyl ester (FAME)-trimethylsilyl (TMS) derivatives. The HbFAD2-3 and HbFAD2-4 are thus renamed as HbFAH12a (SEQ ID NO: 9) and HbFAH12b (SEQ ID NO: 10). Fatty acid composition of yeast cells expressing Hiptage cDNAs encoding FAD2-like polypeptides

Fatty acid Enzyme

Vector HbFAD2-1 HbFAD2-2 HbFAD2-5 HbFAH12a HbFAH12b RcFAH12 CpFAH12 LfFAH12

:C14:0 0.98 ±0.02 ; 1.00 ±:0.07 1.01 ±:0.05 i 0.74 ±10.21 0.82 ± 0.01 0.75 ±j0.02 j 0.78 ±0.02 ; 0.60 ± iO.OO 0.83 ± 0.02 :

iC14:1 0.42 ±0.01 i 0.34 ±:0.04 0.37 ±:0.03 i 0.25 ±;0.09 0.29 ±:0.00 0.25 ±10.01 j 0.26 ±0.01 i 0.20 ±0.01 0.30 + 0.01 i

:C16:0 17.21 ±:0.03 M7.42 ±0.18 18.19 ±:0.39 117.07 ±;2.86 16.61 ± jO.17 16.84 ±:0.22 117.44 ±0.21 6.68 ±0.13 18.22 + 0.18 i iC16:1 44.98 ±0.14 40.40 ±1.14 41.57 ±:0.99 :36.98 ±;3.75 38.11 ± 10.13 36.06 ±:0.49 36.26 ±0.10 35.53 ± i0.29 39.50 t 0.17 i

:C18:0 6.30 ±0.06 i 7.17 ±:0.28 7.00 ±:0.32 i 8.02 ±;0.34 9.43 ± 10.13 9.06 ±:0.09 \ 9.14 ± 0.13 110.30 ± 0.13 8.38 t 0.12 i iC18:1 27.28 ±:0.09 129.61 ±1.10 27.46 ±0.41 133.31 ±16.91 25.92 ±:0.46 25.72 ±:0.10 25.40 ±0.29 10.02 ± 0.04 27.71 ί 0.45 i C18:d11 2.15 ±0.01 i 2.04 ±:0.02 2.08 ±:0.06 i 2.02 ±:0.16 1.85 ±:0.03 1.99 ±j0.03 j 1.98 ±0.02 i 1.97 ± D.OO 2.18 ± 0.03 i

:C16:2 0 ±0 i 0.13 ±:0.02 0.14 ±0.01 i 0.16 ±;o.03 0.26 ±:0.03 0.15 ±j0.00 j 0.16 ±0.00 i 0.16 ± D.03 0.20 ± 0.02 i

:C18:2 0 ±0 i 1.38 ±:0.04 1.68 ±0.11 i 0.70 ± jo.10 1.08 ± Ϊ0.26 1.67 ±10.14 j 1.61 ±0.03 i 5.76 it 0.06 1.25 + 0.02 j jC16:1-OH 0 ±0 0 ±0 0 ±0 0 ±io 1.72 ± 10.10 2.95 ±:0.20 j 2.86 ±0.03 i 5.69 ±0.11 0.16 t 0.02 i

;C18:1-OH 0 ±0 0 ±0 0 ±0 ±io 3.87 ± Ϊ0.29 4.52 ±:0.50 \ 4.10 ±0.34 12.12 ± 0.15 1.10 t 0.02 i

3'82-OH 0 ±0 0 ±0 0 ±0 o ±io 0 ±:0 0 ±:0 o ±0 i 0.90 ± 0.06 0 t

ilbtal HFA 0 ±0 0 ±0 0 ±0 o ±io 5.59 ± C 28 7.47 ±:0.66 6.96 ±0.33 18.71 ±0.10 1.25 ί 0.04 i

:Hydroxylation(%) 0 ±0 0 ±0 0 ±0 o ±jo 7.88 ±:0.40 10.51 ± j0.90 j 9.89 ±0.45 28.33 ± 2.92 1.79 ± 0.06 i

M6:10H/16:2 6.66 ± C 32 19.07 ±11.20 18.28 ±0.53 44.06 ±13.94 0.80 + 0.06 j

M8:10H/18:2 3.67 ±C59 2.70 ±10.21 j 2.55 ±0.17 i 2.06 ± 0.09 0.87 + 0.01 i

Hydroxylation efficiency (%) was calculated as total hydroxyl fatty acids (HFA, sum of C16: 1-OH, C18:l-OH, C18:2-OH) divided by the sum of total HFA, total 5 desaturated fatty acids from C16:l and CIS: 1, and the remaining C16:l, C18:l. Hydroxylation/Desaturation ratio on C16:l and C18:l are also shown as 16:OH/16:2,orl8:10H/18:2.

Table 5. Seedoil fatty acid composition of transgenic Arabidopsis seeds

Transgene fad2/fae1 HbFAH12a HbFAH12b ! LfFAH12 RcFAH12 ! CpFAH12

Total lines 7 8 15 28 9

Fatty acid (%)

C16:0 6.37 ±0.14! 7.55 ± 0.03 7.08 ±0.30! 7.67 ± 0.08 ! 7.54 ±0.17! 9.93 ± 0.53 !

C16:1 0.51 ± 0.05! 0.43 ± 0.01 0.43 ± 0.03 ! 0.48 ±0.01 ! 0.53 ± 0.05 ! 0.60 ±0.01 !

C16:2 0.03 ± 0.05! 0.14 ±0.02 0.16 ±0.05: 0.13 ± 0.13 ! 0.04 ± 0.07 ! 0.11 ±0.09 !

C18:0 2.31 ± 0.08! 3.33 ± 0.05 3.20 ±0.12! 3.66 ± 0.14 ! 3.14 ±0.15 ! 4.13 ±0.39 !

C18:1 81.65 ± 0.47! 57.66 ±1.11 55.02 ± 3.46 ! 56.44 ± 1.15 ! 60.50 ±4.04 ! 51.74 ±1.29 !

C18:1d11 3.89 ± 0.18! 3.97 ± 0.04 4.27 ± 0.08 ! 4.32 ±0.11 ! 4.95 ±0.16 ! 5.26 ±0.17 !

C18:2 0.78 ± 0.19! 2.49 ±0.13 2.70 ±0.01 ! 5.97 ± 0.23 ! 2.18 ±0.18 ! 7.49 ±0.12 !

C18:3 3.21 ± 0.17! 2.05 ± 0.07 1.95 ±0.10! 2.67 ± 0.08 ! 2.47 ± 0.08 ! 3.60 ± 0.20 !

C20:0 0.71 ± 0.04! 0.66 ± 0.02 0.63 ± 0.02 ! 0.69 ± 0.06 ! 0.68 ± 0.09 ! 0.74 ±0.11 !

C20:1 0.55 ± 0.02! 0.40 ±0.01 0.40 ± 0.02 ! 0.38 ± 0.06 ! 0.36 ± 0.04 ! 0.40 ± 0.07 !

C18:1-OH 0! 14.60 ±0.62 16.06 ±2.72 ! 12.00 ± 0.75 ! 10.29 ±2.57 ! 12.11 ±0.75 !

C18:2-OH °! 6.71 ± 0.40 8.10 ± 1.27 ! 5.58 ± 0.56 ! 7.31 ± 1.48 ! 3.89 ± 0.27 !

Total HFA 0! 21.31 ± 1.02 24.15 ±3.99 ! 17.58 ±1.31 ! 17.60 ±4.05 ! 16.00 ±1.02 !

Hydroxylation (%) 0! 25.5 ± 1.2 28.8 ±4.6 ! 21.3 ± 1.5 ! 21.3 ±4.9 ! 20.3 ± 1.2 !

18:1-OH/18:2 °! 5.9 ±0.1 5.9 ± 1.0 ! 2.0 ±0.1 ! 4.7 ±0.8 ! 1.6 ±0.1 !

Hydroxylation efficiency (%) was calculated as total hydroxyl fatty acids (HFA, sum of CI 8:1 -OH, C18:2-OH) divided by the sum of total HFA, total desaturated fatty acids from CI 8:1, and the remaining CI 8:1. Hydroxylation/desaturation ratio on CI 8:1 is shown as 18:10H/18:2.

The tested hydroxylases showed differences in the amount of Δ12- hydroxylation product produced from C16:1 ^A9 relative to that produced from C18:1 ^A9 , as well as the amount of A12-desaturation product C16:2 ^A9 ' ¹² relative to C18:2 ^A9 ' ¹² , produced from CI 6:1 and CI 8:1 respectively, and so exhibited different desaturation and hydroxylation ratios (see Table 4). The production of 120H-C16:1 ^A9 by the CpFAH12 enzyme was also reported by Meesapyodsuk and Qui (2008), as well as densipolic acid (120H-C18:2 ^A9 ' ¹⁵ , see Table 4, listed as C18:20H) a hydroxyl fatty acid product that was also produced by plant hydroxylases (Broun and Somerville, 1997, Broun et al, 1998).

The yeast expression data indicated that HbFAH12b had similar hydroxylation activity and preference on C18:l substrate compared to castor enzyme RcFAH12, while HbFAH12a had slightly lower hydroxylation activity than RcFAH12, but with a higher preference for the CI 8: 1 substrate in yeast.

Expression of the hydroxylases in the Arabidopsis fadl/fael double mutant further confirmed the activity of HbFAH12a and HbFAH12b. Table 5 shows the seed fatty acid composition of the line with highest level hydroxyl fatty acid observed for each transgene, with three repeats. Production of 120H-C18: 1 ^A9 and 120H-C18:2 ^{A9 15} (listed as C18: l-OH and C18:2-OH in Table 5) was confirmed by GC-MS. As there was no detectable level of CI 6: 1 -OH, the total HFA was calculated as the sum of C18: l-OH and C18:2-OH. The hydroxylation efficiency (%) was calculated as the total HFA percentage divided by the sum of the percentages for the total HFA, total desaturation products from C18: l (C18:2 and C18:3) and the remaining C18: l. HbFAhl2a and HbFAhl2b showed higher hydroxylation efficiency in the plant seeds than the other tested hydroxylases, also indicated by the higher C18: l-OH/C18:2 ratio.

The raw data for individual lines is tabulated below (see Tables 6 and 7). Lines LfFAH12: HP10, RcFAH12: JN1, HbFAH12a: JF3, HbFAH12b: JK2 and CpFAH12: JX7 were used for triplicate repeat studies, the results of which are shown in Table 5.

Table 6. Seed fatty acid composition (wt%) of transgenic Arabidopsis lines expressing hdroxylase from R. communis

: Line : C16:0 ;C16:1 C16:2 C18:0 O18:1 ;C18:1d11 ;C18:2 ;C18:3 C20:0 C20:1 i CI 8: 1 H C18:2-OH ; Total HFA: Hydroxylation (%);C18:10H C18:2 !

: Control

\fad2/fae1 6.3: 0.5 : 0.1 2.6! 81.2! 3.9! 0.6! 3.0 0.8 0.6! 0 ! 0! 0! 0! 0 !

Ifad2/fae1 6.2: 0.5; 0.1 2.5! 81.5! 3.8! 0.6! 2.9 0.7 0.6! 0 ; 0; 0! 0! 0 !

^■ Iad2/'fae1 6.3! 0.5: 0.1 2.4! 81.4! 3.9! 0.7: 2.9 0.7 0.6: 0 ! 0! 0! 0: 0 :

: RcFAH12

;JN1 7.8; 0.6: 0.1 3.5: 62.6! 5.1 : 2.0! 2.3 0.9 0.5! 8.2 : 5.9: 14.1 ! 17.4! 4.1 !

;JN2 6.7: 0.5; 0.1 2.6! 75.2! 3.8! 1.2! 2.6 0.7 0.5! 2.4! 3.3! 5.7! 6.7! 2.1 !

:JN3 6.5! 0.5: 0.1 2.6! 77.1 ! 3.8! 1.0: 2.6 0.7 0.5: 1.6! 2.5! 4.1 ! 4.8: 1.6:

:JN4 6.4! 0.5: 0.1 2.3: 79.9! 3.7! 0.8! 2.7 0.7 0.6! 0.6! 1.2! 1.8! 21 ! 0.7!

:JN5 6.6! 0.5! 0.1 2.9: 69.2! 3.8: 1.7! 2.5 0.7 0.4! 5.1 : 6.0: 11.1 ! 13.1 ! 2.9 !

!JN6 7.2! 0.4: 0.1 3.4! 65.6! 4.1 ! 1.9: 2.1 0.7 0.4! 7.0 ! 6.5! 13.5! 16.3! 3.7!

:JN7 6.3! 0.4: 0.1 2.6! 77.6! 3.6! 1.0: 2.8 0.8 0.6: 1.4! 2.3! 3.7! 4.3: 1.4:

:JN8 6.7! 0.5: 0.1 2.6: 78.4! 3.8! 0.8! 2.3 0.7 0.5! 1.4! 1.7! 3.1 ! 3.7! 1 -7;

:JN9 6.7! 0.5! 0.1 2.7: 74.1 ! 4.2: 1.3! 2.6 0.7 0.5! 2.4: 3.9: 6.2! 7.4! 1.8!

! JN10 6.2! 0.5: 0.1 2.3! 79.4! 4.0! 1.0! 2.8 0.7 0.6! 0.7! 1.3! 2.0! 2.3! 0.7!

;JN11 6.7! 0.4: 0.1 2.8! 69.3! 3.8! 1.8: 2.4 0.7 0.5: 5.3 ! 5.9! 11.2! 13.2: 3.0 :

:JN12 6.5! 0.5: 0.1 3.0: 70.0! 4.0! 1.5! 2.5 0.7 0.4! 4.1 ! 6.2! 10.3! 12.2! 2.7!

:JN13 6.3! 0.5; 0.1 2.5: 77.6! 3.8: 1.0! 2.6 0.8 0.6! 1.3 : 2.5: 3.8! 4.4! 1.3 !

;JN14 6.4! 0.4: 0.1 3.0! 73.2! 3.6! 1.3! 2.7 0.8 0.5! 2.6! 4.9! 7.5! 8.9! 2.0 !

:JN15 7.3! 0.4: 0.1 3.2! 66.7! 3.8! 1.9! 2.4 0.8 0.4! 6.6! 5.9! 12.5! 15.0! 3.4!

:JN17 6.2! 0.5 : 0.1 2.6! 79.8! 3.7! 0.7! 2.9 0.8 0.6! 0.4! 1.0! 1.4! 1.7! 0.5:

!JN20 6.3! 0.5; 0.1 2.5! 79.7! 3.5! 1.1 ; 2.8 0.9 0.7! 0.6! 0.7! 1.4! 1.6! 0.6!

: JN21 6.7! 0.5: 0.1 2.8! 71.1 ! 3.9! 1.5: 2.3 0.7 0.5: 4.2 ! 5.3! 9.5! 11.3: 2.9 :

:JN22 6.6! 0.5: 0.1 2.5! 74.9! 4.2! 1.2! 2.6 0.8 0.5! 1.9 ! 3.7! 5.6! 6.7! 1.6!

!JN23 6.4! 0.4: 0.1 2.5: 73.5! 4.0: 1.4! 2.5 0.7 0.5! 2.8: 4.7: 7.5! 8.9! 2.1 !

;JN24 7.6! 0.4; 0.1 3.2! 64.6! 4.2! 1.9: 2.0 0.8 0.4! 7.5! 6.8! 14.3! 17.3! 4.0 !

:JN26 6.3! 0.5: 0.1 2.4! 78.4! 4.0! 0.9: 2.8 0.8 0.6: 1.1 ; 1.6! 2.6! 3.1 : 1.2 :

:JN27 6.5! 0.5: 0.1 2.5! 74.0! 4.0! 1 -2; 2.6 0.7 0.5! 2.6! 4.4! 7.0! 8.2! 2.1 !

:JN28 6.4! 0.5! 0.1 2.6: 72.8! 4.1 : 1.4! 2.4 0.7 0.5! 3.4: 4.7: 8.1 ! 9.6! 2.5!

IJN29 6.5! 0.5: 0.1 2-7! 72.6! 4.0! 1.4! 2.5 0.7 0.5! 3.4! 4.7! 8.0! 9.5! 2.4!

:JN30 6.5! 0.4: 0.1 2.5! 77.4! 3.8! 1.0: 2.5 0.8 0.6: 1.3 ! 2.7! 4.0! 4.7: 1.3 :

:JN31 6.3! 0.4: 0.1 2.6! 76.0! 3.8! 1 -2; 2.4 0.9 0.6! 2.0 ! 3.3! 5.3! 6.2! 1 -7;

!JN32 6.7! 0.5! 0.1 2.7: 71.8! 3.9: 1.5! 2.7 0.8 0.5! 3.7: 4.6: 8.3! 9.8! 2.4!

Hydroxylation efficiency (%) was calculated as total hydroxyl fatty acids (HFA, sum of C18: 1 Η, C18:2-OH) divided by the sum of total HFA, total desaturated fatty acids from C18:l, and the remaining CI 8:1. Hydroxylation/desaturation ratio on C18:l is shown as 18:10H/18:2.

Seed fatty acid composition (wt%) of transgenic Ambidopsis lines expressing hdroxylase from H. bengkilensis and C.

; Line iC16:0!C16:1 C16:2 C18:0 :C18:1 C18:1d11 : C18:2 ;C18:3r:C20:0 : C20:1 ! C18 : 1 -OH C18:2-OH i Total HFAiHydroxylation (%) C18:1-OH/C18:2

^Control

fad2/fae1 i 6.0: 0.6! 0.0! 1.9! 82.6 3.7! 0.8! 2.9! 0.7! 0.6! o; 0! 0| 0 0|

\fad2/fae1 i 5.7: 0.8! 0.1 ! 1.9! 82.3 3.7! 1.0! 2.8! 0.7! 0.7! 0! 0| 0! 0 0!

\fad2/fae1 i 5.7: 0.8! 0.0! 2.2! 82.2 3.4! 1.2! 2.9! 0.7! 0.6! o; 0! 0| 0 0|

;HbFAH12a i

IJF1 i 7.2: 0.7! 0.1 ! 3.1 ! 64.3 4.1 2.5! 2.3! 0.7! 0.5! 8.9! 5.4! 14.4 17.2 3.6!

;JF3 i 7.5: 0.4! 0.1 ! 3.2! 57.7 3.9! 2.5! 2.1 ! 0.7! 0.4! 15.1 ! 6.2! 21.3 25.5 6.1

:JF4 i 8.9: 0.9! 0.1 ! 3.3! 55.6 4.4! 2.8! 2.6! 0.8! 0.5! 15.9! 4.1 20.0! 24.7 5.8!

;JF7 i 8.3: 0.8! 0.1 ! 3.1 ! 62.3 4.0! 2.5! 2.6! 0.8! 0.5! 10.9! 3.9! 14.8 18.0 4.3!

;JF8 i 5.8: 0.5! 0.1 ! 2.3! 74.5 4.0! 1.5! 3.8! 0.8! 0.6! 2.5! 3.5! 6.0! 7.0 1.7!

;HbFAH12b i

;JK2 i 7.5: 0.7! 0.1 ! 3.4! 59.5 4.4! 2.9! 2.0! 0.7! 0.4! 12.7! 5.7! 18.4! 22.2 4.4!

;jK4 i 6.2: 0.7! 0.0! 2.4! 80.2 3.5! 1.0! 2.4! 0.8! 0.6! 1.0! 0.9! 1.9! 2.2 1.0!

:CpFAH12 i

;JX5 i 7.8: 0.5! 0.1 ! 3.4! 60.5 4.6! 5.3! 3.2! 0.5! 0.4! 9.3! 4.5! 13.7 16.6 1.8!

:JX6 i 7.0: 0.7! 0.1 ! 3.2! 69.3 3.8! 3.2! 4.4! 0.7! 0.5! 3.9! 3.2! 7.0! 8.4 1.2!

;JX i 10.5: 0.9! 0.3! 4.6! 52.0 5.4! 7.4! 3.1 ! 0.9! 0.5! 10.9! 3.3! 14.2 18.5 1.5!

;JX8 i 8.0: 0.7! 0.1 ! 3.2! 61.6 4.2! 5.9! 3.7! 0.6! 0.4! 8.3! 3.1 11.4! 13.8 1.4!

;JX9 i 7.5: 0.7! 0.0! 3.6! 59.9 4.3! 5.4! 4.2! 0.6! 0.4! 10.0! 3.3! 13.2 16.0 1.8!

;jxio i 7.1 : 0.5! 0.2! 3.1 ! 63.0 4.1 4.9! 3.7! 0.5! 0.3! 8.2! 4.2! 12.5! 14.8 1.7!

JX11 i 7.3: 0.7! 0.1 ! 2.9! 64.9 4.0! 4.8! 4.3! 0.6! 0.6! 6.2! 3.5! 9.6! 11.5 1.3!

:JX12 i 8.3: 0.5! 0.2! 3.4! 56.3 5.1 5.7! 3.1 ! 0.7! 0.5! 12.1 ! 4.1 16.2! 19.9 2.1

Hydroxylation efficiency (%) was calculated as total hydroxyl fatty acids (HFA, sum of C18: 1ΌΗ, C18:2-OH) divided by the sum of total HFA, total desaturated fatty acids from C18:l, and the remaining C18:l. Hydroxylation/desaturation ratio on C18:l is shown as 18:10H/18:2.

Example 5. Isolation and characterisation of cDNAs which encode glycerol-3- phosphate acyltransferase (GPAT)

Glycerol-3-phosphate acyltransferase (GPAT) is an enzyme that transfers an acyl group from acyl-Coenzyme A (acyl-CoA) to the sn-l position of sTi-glycerol-3- phosphate (G-3-P) to form l-acyl-sTi-glycerol-3-phosphate (sn-l G-3-P), also known as lysophosphatidic acid (LPA). This enzymatic step is considered the first step of triacylglycerol (TAG) assembly by the Kennedy pathway. A cDNA encoding a GPAT was cloned from developing embryos of Bernardia pulchella, a plant that produces 92% of epoxy fatty acid in its seed oil (see PCT/AU2009/000517). The Hiptage benghalensis EST sequence database was queried with the B. pulchella GPAT (BpGPAT) amino acid sequence, the cDNA library was screened with a hybridisation probe corresponding to a B. pulchella GPAT (BpGPAT; clone Bp203239) under low stringency, and the 454 deep sequence database was searched for homologous sequences. These searches resulted in many GPAT-like sequences being identified from H. benghalensis. These sequences were assembled into different contigs, which are presented as SEQ ID NOs: 15-24. Two EST sequences were also identified, designated HbGPATa (SEQ ID NO:25) and HbGPATb (SEQ ID NO:26).

Of the identified sequences, HbGPAT contig 9 (SEQ ID NO:21) and contig 77 (SEQ ID NO:24) had the highest extent of sequence identity to Arabidopsis thaliana GPAT9 (AtGPAT9; At5g60620 gene) at the 5'- and 3'-ends. The HbGPAT contig 9 specific primers 5 '- AGGTCTTTGGTTG A ATTA ATTTGC- 3 ' (forward) (SEQ ID NO:27) and HbGPAT contig 77 5 '- AGTCG AG AC ACCTCTCTCTA- 3 ' (reverse) (SEQ ID NO:28) were used for 5'- and 3'-RACE. The gene specific primers 5'- AAAGGATCCAAAGAAATGGGGAGTCCGGGT (forward) (SEQ ID NO:29) and 5'- AACCTCGAGTCACTTCTCCTCCAGACG (reverse) (SEQ ID NO:30) based on the sequences of the RACE products were used to amplify the full-length HbGPAT9 cDNA with a proof reading polymerase. Two highly homologous sequences were isolated. These appeared to be full-length and were designated HbGPAT9a (SEQ ID NO:31) and HbGPAT9b (SEQ ID NO:32). The present inventors speculated that the existence of two highly similar GPAT9 sequences in Hiptage might have resulted from an ancient gene or genome duplication event, similar to the possible gene duplication of FAD2-like sequences (Example 3).

The cDNAs in pGEM-T Easy were designated plasmids pXZP592 and pXZP593. After determining the nucleotide sequence of each, the genes were inserted into the Gateway entry vector pENTRl l, generating entry clones pXZP594E and pXZP595E. The genes were then inserted into Gateway destination vectors pYES- DEST52 and pXZP391 by recombinational cloning, resulted in the yeast expression vectors designated pXZP596 and pXZP597, and the plant expression binary vectors pXZP696 and pXZP697 for seed expression.

The GPAT activity of full-length HbGPAT clones are confirmed by introducing pXZP596 and pXZP597 into the yeast GPAT knockout strain gat lis., and observing complementation. The effect of pXZP596 and pXZP597 on hydroxyl fatty acid accumulation in seed is tested in transgenic seeds which also express a FAH12 gene. Example 6. Isolation and characterisation of cDNAs which encode 1-acyl-glycerol- 3-phosphate acyltransferase (LPAAT)

The enzyme l-acyl-glycerol-3-phosphate acyltransferase (LPAAT) transfers an acyl group from acyl-Coenzyme A (acyl-CoA) to the sn-2 position of sTi-l-acyl- glycerol- 3 -phosphate (LPA) to form phosphatidic acid (PA). At least 8 LPAAT sequences have been identified in the Arabidopsis genome. To identify LPAAT candidates, the Hiptage benghalensis EST sequence database was queried with the known Arabidopsis LPAAT amino acid sequences, the cDNA library was further screened with an identified putative LPAAT as a hybridisation probe under low stringency conditions, and the 454 deep sequence database was searched for more homologous sequences to the LPAATs from Arabidopsis or castor. The searching resulted in 41 LPAAT-like sequences from H. benghalensis. These sequences were assembled into different contigs.

The contig designated HbLPAAT-la (SEQ ID NO:35) was full-length and encoded a polypeptide (SEQ ID NO:41) having 73.9% amino acid sequence identity and 82.6% similarity with Arabidopsis thaliana LPAAT2 (AtLPAAT2; clone At3g57650, Accession No. NP_567052). A clone encoding a highly homologous polypeptide, designated as HbLPAAT-lb (SEQ ID NO:42), was also identified. This sequence might correspond to another allele of the same LPAAT-1 gene. The contig designated HbLPAAT-2a (SEQ ID NO:37) was also full-length and encoded a polypeptide (SEQ ID NO:43) which had 77.9% amino acid sequence identity and 85.6% similarity with AtLPAAT2. Again, a highly homologous sequence, which might correspond to a second allele of HbLPAAT-2a, was identified, and designated as HbLPAAT-2b (SEQ ID NO:44). HbLPAAT-3 (SEQ ID NO:45) and HbLPAAT-4 (SEQ ID NO:46) were partial-length sequences. Example 7. Isolation and characterisation of cDNAs for Diacylglycerol

acyltransferase 1 (DGATl)

The enzyme acyl-Coenzyme A (acyl-Coa):diacylglycerol acyltransferase (DGAT; EC 2.3.1.20) catalyzes the final step in triacylglycerol (TAG) assembly via the Kennedy pathway by transferring a fatty acyl group from acyl-CoA to a diacylglycerol (DAG) substrate, forming TAG. Three different, structurally unrelated DGAT enzymes have been identified so far in plants. The first two to be identified were DGATl and DGAT2, both of which were endoplasmic reticulum (ER)-localized and contained predicted membrane spanning domains (Hobbs et al., 1999; Zou et al., 1999; Lardizabal et al., 2001). The third enzyme was represented by a single member of a soluble DGAT3, which was identified in peanut (Saha et al., 2006) but has not been characterized in other species.

The Hiptage benghalensis EST sequence database was queried with the Arabidopsis thaliana DGATl amino acid sequence (AtDGATl; Accession No. NP_179535) and the 454 deep sequence database was searched for homologous sequences to A. thaliana, Bernardia pulchella (see PCT/AU2009/000517) and castor DGATl (Accession No. AAR11479). Searching of the EST sequencing and 454 deep sequence database resulted in 6 DGATl -like sequences, all partial in length in that they were missing N-terminal ATG codons. They assembled into 2 contigs. The contig designated number 1 (SEQ ID NO:47) was assembled from EST sequence Hb402460 and 454 sequences EBZJB, EM4F0 and BY6EZ, and encoded only 58 amino acid residues from the C-terminus of the polypeptide (SEQ ID NO:48). Contig number 2 (SEQ ID NO:49) was from 454 sequences D81FJ and BDQ79, and encoded 260 amino acid residues at the C-terminal end ((SEQ ID NO:50).

Example 8. Isolation and characterisation of cDNAs for Diacylglycerol

acyltransferase 2 (DGAT2)

The Hiptage benghalensis EST sequence database was queried with the DGAT2 amino acid sequences from Arabidopsis (AtDGAT2; Accession No. AEE78802), castor (RcDAGT2; Accession No. AAY16324), Bernardia pulchella (BpDGAT2; see PCT/AU2009/000517) and Vernicia fordi (VfDGAT2; Accession No. ABC94473). The cDNA library was screened with the cDNA insert of an identified DGAT2-like sequence, Hb401323, as a hybridisation probe under low stringency conditions and the 454 deep sequence database was searched for homologous sequences to the above-mentioned DGAT2 sequences. Two highly similar HbDAGT2 sequences were identified, designated HbDGTA2a (SEQ ID NO:53) and HbDGAT2b (SEQ ID NO:54). Both appeared to be full-length. They shared 98.6% sequence identity The enzymatic activity of HbDGAT2a and HbDGAT2b aree assayed in the yeast DGAT knockout mutant, and the effect on the ricinoleic acid accumulation is tested by coexpression of the coding regions for the polypeptides with FAH12 in transgenic Arabidopsis seed.

Table 8. Amino acid sequence identity of the HbDGAT2-like sequence (HbDGAT2) to BpDGAT2, AtDGAT2, BnDGAT2, RcDGAT2 and VfDGAT2.

BpDGAT2 AtDGAT2 BnDAGT2 RcDAGT2 VfDGAT2

HbDGAT2 62.4% 57.3% 56.7% 59.2% 59.4%

BpDGAT2 58.1% 54.75% 68.1% 65.7%

AtDGAT2 76.1% 55.7% 58.1%

BnDAGT2 54.7% 57.8%

RcDAGT2 65.3% Example 9. Isolation and characterisation of cDNAs for putative soluble

Diacylglycerol acyltransferase 3 (DGAT3)

DGAT3 is a diacylglycerol acyltransferase identified from peanut (Arachis hypogaea, Saha et al., 2006) and a gene encoding it has been cloned. In contrast to DGAT1 and DGAT2 which are ER membrane-associated proteins, DGAT3 was found to be a soluble enzyme without membrane spanning domains or signal sequences for translocation across membranes. Furthermore, DGAT1 mRNA was expressed in Arabidopsis at high levels in many different tissues including in germinating seeds, young seedlings, roots and leaves. In contrast, the soluble DGAT3 protein in peanut was detected only in immature, developing seeds.

The Hiptage benghalensis EST sequence database was queried with the DGAT3 amino acid sequences from Arachis hypogaea (AhDGAT3; Accession No. AAX62735), Bernardia pulchella (BpDGAT; see PCT/AU2009/000517), and the 454 deep sequence database was searched for homologous sequences to AhDGAT3 and BpDGAT3. The EST and 454 searches resulted in 6 soluble DGAT3-like sequences, all partial in length. They were assembled into 2 contigs. The contig designated number 1 (SEQ ID NO:55) was assembled from 454 sequences AW2LJ, CDHFU, B8IP1 and D05FC, and encoded a polypeptide of 116 amino acid residues (SEQ ID NO:56) at the C-terminal end of the protein. The contig designated number 2 (SEQ ID NO:57) was assembled from 454 sequences B5SD8 and AV7JO, and encoded 50 amino acid residues at the C-terminal end of the protein (SEQ ID NO:58). The activity of HbDGAT3 is confirmed in yeast after cloning the full-length sequence.

Example 9. Isolation and characterisation of cDNAs for Acyl- CoA:lysophosphatidylcholine acyltransferase (LPCAT)

Acyl-Coenzyme A (acyl-CoA):lysophosphatidylcholine acyltransferase (LPCAT; EC 2.3.1.23), in its forward reaction, catalyzes the acyl-CoA-dependent acylation of lysophosphatidylcholine (LPC) to produce phosphatidylcholine (PC) and CoA. LPCAT activity may affect the incorporation of fatty acids at the sn-2 position of PC where desaturation and/or hydroxylation, epoxygenation, acetylenation or most other modifications of the acyl chains occur. LPCAT belongs to the membrane-bound o-acyltransferase (MBOAT) family of proteins. LPCAT genes have been cloned from mouse (Accession Nos. BAE94687, BAF47695), human (Accession No. BAE94688), rat (Accession No. BAE94689), yeast (Accession No. Q06510) and others.

The Hiptage benghalensis cDNA library was screened with a probe from a Bernardia pulchella LPCAT gene (BpLPCATl ; clone Bp208211) by hybridisation at 55°C. The hybridisation membrane was washed with 2x and lx of 0.5x SSC/0.1% SDS, each for 10 minutes. Six clones which hybridised and which had LPCAT-like sequences were isolated. The clone number Hb301421 was full-length, and was designated as HbLPCATla (SEQ ID NO:59), while clone number Hb301429 was partial and had 5 nucleotides different in sequence to Hb301421 in the overlapping region, resulting in differences in 3 amino acid residues. It was designated HbLPCATlb (SEQ ID NO:60). Another clone, Hb301425, was a partial sequence, but from a different gene to Hb301421. An EcoRl-Xhol fragment of the Hb301425 cDNA clone was used as a probe to screen the cDNA library at 65°C. After washing the membrane twice using 0.5x SSC/0.1% SDS, each for 10 minutes, 9 clones were isolated which hybridised to the probe. This led to the isolation of a clone which was a full-length cDNA, Hb301480, designated as HbLPCAT2 (SEQ ID NO:56), and 4 partial length clones with sequences identical to Hb301480 in the overlapping region, except for different polyA regions.

HbLPCATla (SEQ ID NO:62) and HbLPCAT2 (SEQ ID NO:64) shared 88.6% homology at the nucleotide level, and 92.0% identity or 94.4% similarity at the amino acid level.

Functional analysis of acyl-CoA:lvsophosphatidylcholine acyltransferase (HbLPCAT) The protein coding sequence of the Arabidopsis thaliana gene (AtLPCAT2; clone Atlg63050) was amplified by PCR using the primers A1-63050-OF (5'- TTGGAATTC ACGC AAGATACAACCATG-3 ', SEQ ID NO:65) and A1-63050-OR (5 - ATCCTCGAGACAACATTATTCTTCTTTTCTGG-3', SEQ ID NO:66). The protein coding sequences of HbLPCATla and HbLPCAT2a were PCR amplified with proofreading polymerase and the primers HbLPCAT-OF (5'- AAGGATCCAAAAAAATGGARCTAGACWTGGACG-3', forward, SEQ ID NO:67) and HbLPC AT- 1 a- OR (5 '-TGG AGCTC A ACTC ATTGTTCCTTTTG AGCTT- 3 ' , reverse, SEQ ID NO:68) or HbLPCAT-2a-OR (5'- TGG AGCTC A ACTC ATTGCATCTTTCG AGCTT-3 ' , reverse, SEQ ID NO:69). The amplified sequences were cloned into pGEM-T Easy, generating plasmids pXZP098TA, pXZP579 and pXZP580, respectively. After confirming the correct nucleotide sequences, the coding regions were inserted as EcoRI-XhoI or BamHI- EcoRI fragments into pENTRl I-Ncol, which is an entry vector pENTRl 1 with its Ncol site removed, resulting in entry clones pXZP098E, pXZP801 and pXZP802, respectively. The genes then further cloned into yeast destination vector pYES- DEST52 by using recombinase, to construct the yeast expression plasmids pXZP252, pXZP803 and pXZP804, respectively. The plasmids were transformed into the yeast Ipcat knockout mutant Yorl75. The empty yeast expression vector pYES2 was used as negative control, and a corresponding vector encoding AtLPCAT2 was used as a positive control. Yeast microsomal preparations were prepared as described in Example 1. A series of 19 different acyl-CoAs were added to the microsomal preparations, as potential donors of the acyl groups to [ ¹⁴ C]-LPC, which is the forward LPCAT reaction. Assays were carried out in duplicate with 0.8 ig and 0.15 ig aliquots of microsomal preparations from HbLPCATl and HbLPCAT2 expressing yeast cells. The resultant PC fraction of the lipid from the mixtures was calculated and compared (Figure 8). The data showed that both HbLPCATl and HbLPC AT2 could synthesize PC with C18: l-, C18:2-, n3C18:3-CoA as well as n3C22:5-CoA, n3C22:6-CoA and acyl-CoAs containing unusual fatty acids such as vernolyl-CoA or ricinolyl-CoA. Therefore, it was concluded that both HbLPCATl and HbLPC AT2 had LPCAT activity with a wide range of acyl-CoA substrates as acyl donors.

The same set of LPCAT microsomal protein preparations from yeast cells expressing the polypeptides were used to test the reverse LPCAT reaction assay. An equal number of moles (4.5 nmole each) of ¹⁴ C oleoyl-PC and ¹⁴ C-ricinoleoyl-PC (i.e. ricinoleic acid as the acyl group) were used as competitive substrates in the reverse reaction assays, to test whether the enzymes could transfer either or both the oleic acid and ricinoleic acid acyl groups to CoA. The acyl-CoA products were calculated after subtracting the background level obtained in control reactions with microsomes from yeast transformed with the empty vector. The activity of the enzymes on the substrates and their preference were compared. HbLPCAT2 (SEQ ID NO:64) had a similar level of activity to AtLPCAT2 but had higher activity than HbLPCATl (SEQ ID NO:62). Both of the Hiptage enzymes preferred ricinoleoyl-PC to oleoyl-PC (Figure 9).

Example 10. Isolation and characterisation of cDNAs for CDP-choline

diacylglycerol choline phosphotransferase (CPT)

The enzyme CDP-choline diacylglycerol choline phosphotransferase (CPT) catalyzes the reversible synthesis of phosphatidylcholine (PC) from diacylglycerol (DAG), which is one route by which acyl groups are made available for incorporation into triacylgylcerol (TAG) via a Coenzyme A (CoA)-independent pathway. CPT genes have been isolated from Arabidopsis thaliana (clone At3g25585), Saccharomyces cerevisiae (Accession No. AAA63571), Rattus norvegicus (Accession No. NP_001007700) and Homo sapiens (Accession No. NP_001007795) and others.

A fragment from the Arabidopsis gene encoding CPT (clone At3g25585) was used as probe to screen the developing embryo cDNA library under low stringency conditions. A partial sequence cDNA (clone Hb301252) encoding a polypeptide with homology to CPT was isolated. The insert from the cDNA, clone Hb301252, was then used as probe to screen the library at high stringency, resulting in the isolation of 7 cDNA clones which hybridised. Sequences of 6 of these clones were determined and assembled into 4 putative HbCPT cDNA sequences, namely HbCPT-la (full-length; SEQ ID NO:70), HbCPT-lb (partial; SEQ ID NO:71), HbCPT-2a (full-length; SEQ ID NO:72) and HbCPT-2b (full-length; SEQ ID NO:73). HbCPT-la (SEQ ID NO:74) shared 78.5% amino acid sequence identity and 88.2% similarity to A. thaliana CPT (AtCPT; clone At3g25585). HbCPT-2a (SEQ ID NO:75) shared 81.3% amino acid sequence identity and 88.2% similarity to AtCPT. The amino acid sequence identity between HbCPT-la and HbCPT-2a was 83.3%, while the amino acid sequence identity between HbCTP-2a (SEQ ID NO:76) and HbCPT-2b (SEQ I NO:77) was 97.9% - there were only 7 amino acid residue differences between them.

The protein coding regions of the full-length cDNAs encoding HbCPT-la,

HbCPT-2a and HbCPT-2b were amplified and inserted as EcoRI-XhoI fragments into the Gateway entry vector pENTRl 1, generated the entry clones pXZP558E, pXZP559E and pXZP560E, respectively. The coding regions were then inserted into the destination vectors pYES-DEST52 for yeast expression and pXZP391 for plant seed expression, resulting in the plasmid constructs designated pXZP598, pXZP599, pXZP600 for yeast expression, and pXZP688, pXZP689, pXZP690 for plant expression. The function of these polypeptides as CPT enzymes is demonstrated in the yeast and plant seed assays.

Example 11. Isolation and characterisation of cDNAs for

Phosphatidylcholine:diacylglycerol cholinephosphotransferase (PDCT)

The enzyme phosphatidylcholine :diacylglycerol cholinephosphotransferase (PDCT) catalyzes transfer of the phosphocholine headgroup from phosphatidylcholine (PC) to diacylglycerol (DAG). A gene encoding PDCT was cloned from Arabidopsis (Lu et al., 2009). In Arabidopsis, it transfers 18: 1 into PC for desaturation and also for the reverse transfer of 18:2 and 18:3 into triacylglycerol (TAG).

The Hiptage benghalensis EST sequence database was queried with the Arabidopsis thaliana PDCT amino acid sequence (AtPDCT; Accession No. AEE75730), and the 454 deep sequence database was searched for homologous sequences to AtPDCT. The searching of the EST library and 454 deep sequence database resulted in 7 PDCT-like sequences, which were assembled into 4 HbPDCT cDNA sequences. These were: HbPDCT-la (full-length; SEQ ID NO:78), HbPDCT- lb (full-length; SEQ ID NO:79), HbPDCT-2a (partial; SEQ ID NO:80) and HbPDCT- 2b (partial; SEQ ID NO:81). HbPDCT- la (SEQ ID NO:82) shared 58.9% amino acid identity and 69.2% similarity to AtPDCT encoded by the At3gl5820 gene. HbPDCT- lb (SEQ ID NO:83) shared 58.4% amino acid identity and 69.0% similarity to the AtPDCT. HbPDCT- la and HbPDCT- lb had a 5 base pair polymorphism in their coding regions, leading to 3 amino acid residues that were different, and 5 base pair difference in their 3'-UTR sequences. HbPDCT-2a (SEQ ID NO:84) and HbPDCT- 2b (SEQ ID NO: 85) had a 2 base pair difference in the overlapping region, resulting in 2 amino acid changes. HbPDCT-la and HbPDCT-2a shared 79.9% amino acid sequence identity and 86.0% similarity in the overlapping region. The protein coding sequences of HbPDCT-la and HbPDCT-lb were amplified by PCR and inserted into the pGEM-T Easy vector, generating the plasmids designated pXZP581 and pXZP582. The coding regions were then inserted into a plant binary vector, under the control of the seed specific Fpl promoter, with PPT as selection marker, resulting in the plant expression plasmids pXZP681 and pXZP682 for transformation into Arabidopsis. The enzymatic function is demonstrated in the transgenic seed.

Example 12. Isolation and characterisation of cDNAs for Phoshatidylcholine diacylglycerol acyltransferase (PDAT)

The enzyme phosphatidylcholine diacylglycerol acyltransferase (PDAT) catalyses the transfer of acyl groups from the sn-2 position of PC to the sn-3 position of diacylglycerol (DAG) to form triacylglycerol (TAG) in an acyl Coenzyme A (acyl- CoA)-independent manner. Genes encoding at least two Arabidopsis thaliana PDAT (AtPDAT) enzymes were cloned (At5gl3640 and At3g44830). The Hiptage benghalensis cDNA library was screened by hybridisation with probes from the AtPDAT coding region in pXZP161, corresponding to the At5g 13640 gene, and with a Bernardia pulchella PDAT (BpPDAT) cDNA (see PCT/AU2009/000517) and a Eurphorbia lagascae PDAT (EIPDAT) cDNA. Low stringency hybridisation conditions were used. Only one PDAT-like cDNA clone (Hb301417) was isolated with the EIPDAT probe. This clone contained a partial length cDNA sequence since the encoded polypeptide was missing about 119 amino acid residues at its N-terminus compared to the other PDAT polypeptides. The cloned sequence showed 54.8% amino acid identity and 65.4% similarity to the AtPDAT polypeptide encoded by the At3g444830 gene. The cDNA was used as probe to re-screen the cDNA library to isolate full-length clones at 65°C. After washing the membrane twice with 0.5x SSC/0.1% SDS, each for 10 minutes, 12 clones were isolated which encoded Hb301417-like polypeptides. Among them, one clone (Hb301520) contained a full- length cDNA, while the other 6 clones were partial cDNAs with sequences identical to Hb301520 in their overlapping regions except with different polyA sites. Another 5 clones contained partial-length cDNA sequences that showed high homology to Hb301520, but were not identical. The longest one, Hb301510, had 15 nucleotide differences compared to Hb301520, which resulted in 4 amino acid residue differences. Hb301510 was missing about 51 residues from its N-terminus compared to Hb301520.

The polypeptide encoded by Hb301520 showed a high degree of amino acid identity to the castor PDAT3 (RcPDAT3) enzyme (Castor genome sequence 29912.m005286) and to AtPDAT2 encoded by the At3g44830 gene, with 70% and 66% amino acid identity, or 81% and 80% similarity, respectively. Clone Hb301520 was designated as encoding HbPDAT3a (SEQ ID NO:93), while Hb301510 as HbPDAT3b (SEQ ID NO:94).

When the 454 deep sequence database was searched, other partial cDNA sequences which encoded polypeptides which shared homology to RcPDATl, RcPDAT4, RcPDAT5 and RcPDAT6 were also identified.

Example 13. Isolation and characterisation of cDNAs for Acyl-CoA binding protein (ACBP)

Acyl-Coenzyme A (acyl-CoA) binding protein (ACBP) non-covalently binds acyl-CoA. These proteins are believed to fulfil housekeeping functions in acyl-CoA pool maintenance and protection, as well as participating in the intracellular transport of acyl-CoAs. In Arabidopsis thaliana, six ACBP family members (At4g27780, Atlg31812, At3g05420, At4g24230, At5g53470, At5g27630) have been identified that differ in structure, cellular location and acyl-CoA binding properties (Engeseth et al., 1996; Chye et al., 1999).

The H. benghalensis EST sequence database was queried with the above- mentioned Arabidopsis ACBP amino acid sequences. Three EST sequences were isolated, Hb405528, Hb406933 and Hb417145. Sequence analysis suggested that the three sequences were encoded by two gene members. Hb406933 contained a full- length cDNA and the encoded protein was designated as HbACBPa (SEQ ID NO:98). Hb405528, which was partial length and was missing a translation start ATG, and Hb417145 which was missing the ATGG, from HbACBPb, were also different in their polyA sites. The polypeptides HbACBPa (SEQ ID NO: 100) and HbACBPb (SEQ ID NO: 101) shared 95.6% amino acid identity and 98.9% similarity. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

The present application claims priority from US61/640,472 filed 30 April 2012, the entire contents of which is incorporated herein by reference.

All publications discussed and/or referenced herein are incorporated herein in their entirety.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

REFERENCES

Abdullah et al. (1986) Biotech. 4: 1087.

Al-Mariri et al. (2002) Infect. Immun. 70: 1915-1923.

Alonso et al. (2010) Green Chem. 12: 1493-1513.

Alvarez et al. (2000) Theor Appl Genet 100:319-327.

Badami and Kudari (1970) Journal of the Science of Food and Agriculture 21:248-249.

Baumlein et al. (1991) Mol. Gen. Genet. 225:459-467.

Baumlein et al. (1992) Plant J. 2:233-239.

Bligh and Dyer (1959) Canadian Journal of Biochemistry and Physiology 37:911-7.

Bourque (1995) Plant Sci. 105: 125-149.

Broothaerts et al. (2005) Nature 433:629-633.

Broun et al. (1998) Plant J. 13:201-210.

Broun and Somerville (1997) Plant Physiol. 113:933-942.

Burgal et al. (2008) Plant Biotechnology Journal 6:819-831.

Cadwell and Joyce (1992) PCR Methods Appl. 2:28-33.

Cagliari et al. (2010) Plant Science 179: 499-509.

Cahoon (2002) Plant Physiol. 128:615-624.

Cao et al. (2003) J. Biol. Chem. 278: 13860-13866.

Carlsson et al. (2011) European Journal of Lipid Science and Technology 113:812-831. Chan et al. (2010) Nat. Biotech. 28:951-956.

Cheng et al. (1996) Plant Cell Rep. 15:653-657.

Chenthurpandy et al. (2009) Pharmacognosy Journal 1: 103-105.

Chikwamba et al. (2003) Proc. Natl. Acad. Sci. U.S.A. 100: 11127-11132.

Christie (1993) Advances in Lipid Methodology - Two, Oily Press, Dundee, pages 195-213.

Chung et al. (2006) BMC Genomics 7: 120.

Chye et al. (1999) Plant J. 18: 205-214.

Coco et al. (2001) Nature Biotechnology 19:354-359.

Coco et al. (2002) Nature Biotechnology 20: 1246-1250.

Comai et al. (2004) Plant J 37: 778-786.

Courvalin et al. (1995) Life Sci. 318: 1207- 1212.

Crameri et al. (1998) Nature 391:288-291.

Darji et al. (1997) Cell 91:765-775.

Dauk et al. (2007) Plant Science 173:43-49.

Dietrich et al. (1998) Nature Biotech. 18: 181-185.

Dyer et al. (2008) Plant Journal 54:640-655.

Eggert et al. (2005) Chembiochem 6: 1062-1067.

Ellerstrom et al. (1996) Plant Mol. Biol. 32: 1019-1027.

Endalew et al. (2011) Biomass and Bioenergy 35:3787-3809.

Engeseth et al. (1996) Arch Biochem Biophys 331 :55-62.

Fennelly et al. (1999) J. Immunol. 162: 1603-1610.

Fujimura et al. (1985) Plant Tissue Culture Lett. 2:74.

Glevin et al. (2003) Microbiol. Mol. Biol. Rev. 67: 16-37.

Gong and Jiang (2011) Biotechnol. Lett. 33: 1269-1284.

Grant et al. (1995) Plant Cell Rep. 15:254-258.

Greenwell et al. J. R. Soc. Interface (2011) 7:703-726.

Grillot-Courvalin et al (1998) Nature Biotech. 16:862-866.

Grillot-Courvalin (1999) Curr. Opin. Biotech. 10-477-481.

Haseloff and Gerlach (1988) Nature 334:585-591.

Henikoff et al (2004) Plant Physiol 135: 630-636.

Hellinga (1997) Proc. Natl. Acad. Sci. 94: 10015-10017.

Helliwell et al. (2002) Functional Plant Biology 29: 1217-1225.

Hense et al. (2001) Cell Microbiol. 3:599-609.

Hinchee et al. (1988) Biotechnology 6:915-922.

Hobbs et al. (1999) FEBS LETT 452: 145-149. Horn et al. (2007) Euphytica, 153:27-34.

Horvath et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97: 1914-1919.

Jezequel et al. (2008) Biotechniques 45:523-532.

Karmakar et al. (2010) Bioresource Technology 101:7201-7210.

Klein et al. (1998) Exp. Neurol. 150: 183-194.

Koziel et al. (1996) Plant Mol. Biol. 32:393-405.

Kunik et al. (2001) Proc. Natl. Acad. Sci. U.S.A. 98: 1871-1876.

Lacroix et al. (2008) Proc. Natl. Acad. Sci.U.S.A. 105: 15429-15434.

Lardizabal et al. (2001) J. Biol. Chem. 276:38862-38869.

Lee and Mohamed (2010).

Leung et al. (1989) Technique 1: 11-15.

Li et al. (2010) Lipids 45: 145-157.

Liu et al. (2010) Fuel 89:2735-2740.

Lu et al. (2009) Proceedings of the National Academy of Sciences 106: 18837-18842. Maher and Bressler (2006).

Maher and Bressler (2007) Bioresource Technology 98:2351-2368.

Mavraganis et al. (2010) Applied and Environmental Microbiology 76: 1135-1142.

Meesapyodsuk and Qiu (2008) Plant Physiol. 147: 1325-1333.

Ness et al. (2002) Nature Biotechnology 20: 1251-1255.

Niedz et al. (1995) Plant Cell Reports 14:403.

Ostermeier et al. (1999) Nature Biotechnology 17: 1205-1209.

Ow et al. (1986) Science 234:856-859.

Perez- Vich et al. (1998) JAOCS 75:547-555.

Perriman et al. (1992) Gene 113: 157-163.

Perrin et al. (2000) Mol Breed 6:345-352.

Potenza et al. (2004) In Vitro Cell Dev. Biol. Plant 40: 1-22.

Powell et al. (1996) Vaccines 183. Abstract.

Prasher et al. (1985) Biochem. Biophys. Res. Commun. 127:31-36.

Ryan et al. (1984) J. Am. Oil Chem. Soc. 61: 1610-1619.

Saha et al. (2006) Plant Physiology 141: 1533-1543.

Schaffner et al. (1980) Proc. Natl. Acad. Sci. U.S.A. 77:2163-2167.

Shiau et al. (2001) Vaccine 19:3947-3956.

Semwal et al. (2011) Bioresource Technology 102:2151-2161.

Senior (1998) Biotech. Genet. Engin. Revs. 15:79-119.

Shippy et al. (1999) Mol. Biotech. 12: 117-129.

Sieber et al. (2001) Nature Biotechnology 19:456-460. Singh et al. (2001) Planta 212:872-879.

Singh et al. (2005) Curr. Opin. Plant Biol. 8: 197-203.

Sizemore et al. (1995) Science 270:299-302.

Slade and Knauf (2005) Transgenic Res. 14: 109- 115.

Smith et al. (2000) Nature 407:319-320.

Smith et al. (2003) Planta 217:507-516.

Stalberg et al. (1993) Plant Mol. Biol. 23:671-683.

Stalker et al. 1988 Science 242: 419-423.

Stemmer (1994a) Proc. Natl. Acad. Sci. USA 91 : 10747-10751.

Stemmer (1994b) Nature 370(6488):389-391.

Taylor (1997) The Plant Cell 9: 1245-1249.

Thillet et al. (1988) J. Biol. Chem 263: 12500-12508.

Toriyama et al. (1986) Theor. Appl. Genet. 205:34.

Tzfira and Citovsky (2006) Curr. Opin. Biotech. 17: 147-154.

Waterhouse et al. (1998). Proc. Natl. Acad. Sci. USA 95: 13959-13964.

Weiss (2003) Int. J. Med. Microbiol. 293:95-106.

van de Loo et al. (1995) Proc. Natl. Acad. Sci. USA 92:6743-6747. van Erp et al. (2011) Plant Physiology 155:683-693.

Yang et al. (2003) Planta 216:597-603.

Yen and Farese (2003) J. Biol. Chem. 278: 18532-18537.

Yen et al. (2002) Proc. Natl. Acad. Sci. U.S.A. 99:8512-8517.

Volkov et al. (1999) Nucleic Acids Research 27(18):el8.

Zhao et al. (1998) Nature Biotechnology 16:258-261.

Zhou et al. (2006a) Plant Science 170:665-673.

Zhou et al. (2006b) Functional Plant Biology 33:585-592.

Zhou et al. (2006c) Lipid Technology 18: 199-203.

Zhou et al. (2007) Phytochemistry 68:785-796.

Zhou et al. (2011) J. Biol. Chem. 286: 43644-43650.

Zolotukiin et al. (1996) J. Virol. 70(7):4646-4654.

Zou et al. (1999) Plant J. 19:645-653.