Field of the invention

The invention refers to genetic engineering and can be used in biotechnology, medicine, and agriculture for the manufacture of gene therapy products.

Background of the Invention

Gene therapy is an innovative approach in medicine aimed at treating inherited and acquired diseases by means of delivery of new genetic material into a patient’s cells to compensate for or suppress the function of a mutant gene and/or treat a genetic disorder. The final product of gene expression may be an RNA molecule or a protein molecule. However, most physiological processes in the body are associated with the functional activity of protein molecules, while RNA molecules are either an intermediate product in the synthesis of proteins or perform regulatory functions. Thus, the objective of gene therapy in most cases is to inject the organism with genes that provide transcription and further translation of protein molecules encoded by these genes. Within the description of the invention, gene expression refers to the production of a protein molecule with amino acid sequence encoded by this gene.

BMP-2, BMP-7, NELL-1, and LMP-1 genes included in the group of genes play a key role in several processes in human and animal organisms. The correlations between low/insufficient concentrations of these proteins and different adverse states in some cases confirmed by disturbances in normal gene expression encoding these proteins was demonstrated. Thus, the gene therapy upregulation of expression of a gene selected from the group of BMP-2, BMP-7, NELL-1, and LMP-1 genes has the potential to correct various conditions in humans and animals.

BMP-2 and BMP-7 genes encode bone morphogenetic proteins 2 and 7, respectively. BMPs are cytokines belonging to the TGF family that are found mainly in bone tissue. The name“BMP” describes only one specific function, but in fact, these proteins have a number of other effects on the body, namely: cartilaginification, development of internal organs, i.e. morphogenesis, proliferation, apoptosis, and cell differentiation. Besides, BMPs block myogenesis and adipogenesis. Some BMPs, including BMP-2, BMP-4, and BMP-7, participate in specialisation of hematopoietic tissue from the embryonic mesoblast. They regulate proliferation and differentiation of human hematopoietic cells in both adults and newborns. So far, 20 types of BMP proteins have been identified. The most thoroughly studied in relation to the repair of bone and cartilage are BMP-2 and BMP-7. It is known that they are able to induce bone growth, namely affect proliferation and differentiation of four types of cells, i.e. osteoblasts, osteoclasts, chondroblasts, and chondrocytes. In vitro, BMP-2, -3, -4, and -7 contribute to growth of osteoblasts and bone cell derivatives. The BMP localisation site is an extracellular matrix of connective tissue containing osteoprogenitor and mesenchymal cells. It is demonstrated that BMPs are distributed along the collagen fibres of bone tissue in the osteogenic layer cells of periosteum; they are present in lamellar bone cells in moderate quantities and in tooth tissues in excess. BMPs are synthesised by osteoblasts, chondrocytes, and precursors thereof. The increased activity of BMPs in the growth sites of shin bone (epiphysis, metaphysis, cartilage) was observed. Besides the skeleton, BMPs are expressed in the extraskeletal organism tissues. High BMP content is found in prostate and placenta (Paralkar V et al. //J. Biol. Chem. - 1998. - Vol. 273, N 22. - P. 13760-13767).

Many researchers indicate extremely unstable or low osteoinductive indices of allogeneic bone grafts produced in different tissue banks. Biological optimisation or activation of osteoinductiveness of allogeneic or xenogeneic bone grafts can be achieved by demineralization with the addition of osteoinductive proteins or other growth factors. BMP-2 showed an increased osteoid formation compared to the same when autologous bone is used in experiments on rats in combination with demineralised bone matrix (Schwartz Z et al. //J. Periodontol. - 1998. - Vol. 69, N 12. - P. 1337— 1345). A higher percentage of bony unions was obtained in experiments on dogs by adding BMP-7 to the allogeneic bone graft than if autologous bone was used (Lewandrowski K. //Spine J. - 2007. - Vol. 7J5.-P. 609-614). An influence comparison was made on the osteogenic differentiation of mesenchymal stem cells and alkaline phosphatase activity of such materials as: demineralised bone matrix (DBM), demineralised bone matrix with the addition of BMP-7 (DBM + BMP-7), ossein + BMP-7, ossein, frozen bone graft, frozen bone graft with BMP-7. It was found that DBM + BMP-7 to a greater extent had stimulated the osteogenic differentiation of mesenchymal stem cells and the activation of alkaline phosphatase (Tsiridis E. et al. //J. Orthop. Res. - 2007. - Vol. 25, N 11. - P. 1425-1437).

The efficiency of BMP-7 use for the achievement of bony union in vertebral pathology was comparable to or slightly exceeded the efficiency of autologous bone material (Johnsson R et al. //Spin. - 2002. - Vol. 27. - P. 2654-2661). The study that included 9 patients aged 21 to 24 years with risk factors for bone nonunion (adrenal insufficiency, hypertension, long-term smoking, obesity, hyperthyroidism, rheumatoid arthritis) revealed that BMP-7 is safe and effective for spinal fusion (Govender S et al. //J. Bone Jt Surg. -2002. - Vol. 84A. - P. 2123-2134). Vaccaro et al. have examined 36 patients who underwent surgical treatment for degenerative lumbar spondylolysis with spinal stenosis. Ossigraft paste with rhBMP-7 was applied to one part of patients together with an autograft from the iliac crest (main group), to the other part only an autograft from the iliac crest (control group). After 1 year of observation, bony union was found in the main group in 86% of cases, in the control group - in 73% of cases, after 4 years - in 69% and 50%, respectively (Vaccaro A.R. et al. //Eur. Spine J. - 2005. - Vol. 14. - P. 623-629). Govender et al. reported on the clinical use of rhBMP-7 on collagen carrier at a dose of 0.75mg/ml (total dose 6mg) and 1.50mg/ml (total dose: 12mg). The study included 450 patients from 11 countries with open tibial fractures. Intramedullary osteosynthesis with titanium nail was performed for all patients. Fracture union without repeated interventions was achieved in 74% of patients. The data of this study contributed to the approval by the European Agency for the Evaluation of Medicinal Products (EMEA) in 2002 and the US Food and Drug Administration (FDA) in 2004 of rhBMP-7/ACS use in the treatment of open tibial fractures by intramedullary osteosynthesis (Govender S et al. //J. Bone Jt Surg. -2002. - Vol. 84A. - P. 2123— 2134).

An identical or greater frequency of bony union of the vertebral bodies was observed when using rhBMP-7 on the collagen sponge compared to the same when using an autologous graft from the iliac crest. In fact, bony union is reported in 100% of patients when rhBMP-7 is used (SchwenderJ.D. et al. //J. Spin. Disord. Tech. - 2005. - Vol. 18. - P. S1-S6). There were no complications characteristic of the surgical sampling of autologous bone.

The use of rhBMP-7 in the form of collagen paste in the treatment of patients with open tibial fractures contributed to the fracture healing in a larger percentage of cases and reduced the frequency of repeated surgical interventions (Fricdlaender G. et al. //J. Bone Jt Surg. -2001. - Vol. 83A. - P. SI 51— S 158). When used in combination with autologous bone or allogeneic demineralised bone matrix, the reduction of fracture healing time was shown compared to the same procedure when using only autologous bone (Bilic R et al. //Int. Orthop. -2006. - Vol. 30. - P. 128-134).

Advances in the use of recombinant BMPs provided an opportunity for a number of studies using gene therapy approaches. Thus, viral, plasmid and cell vectors have been successfully used to express BMPs genes in various studies for the regeneration of bone defects (Schwabe P et al. // ScientificWorldJoumal. 2012;2012:560142; Wegman F et al. // Eur Cell Mater. 2011 Mar 15;21 :230— 42; discussion 242; Wang CJ et al. // Arthroscopy. 2010 Jul;26(7):968-76; Heggeness MH. // Spine J. 2015 Nov 1;15(11):2410-1; Wu G et al. // J Craniofac Surg. 2015 Mar 15;26(2):378-81; Loozen LD et al. // Tissue Eng Part A. 2015 May;21(9-10):1672-9). One of the studies showed that a gene therapy approach using a combination of BMP-2 and BMP-7 genes had a more pronounced therapeutic effect than using each of these genes separately (Koh JT et al. // J Dent Res. 2008 Sep;87(9):845-9).

In addition to the use of BMPs proteins for the regeneration of bone and cartilage damage, it was shown that upregulation of the BMP-7 gene expression promotes healing of wounds and preventing the formation of tissue fibrosis (Tandon A et al. // PLoS One. 2013 Jun 14;8(6):e66434; 19; Zhong et al. // Int J Med Sci. 2013;10(4):441- 50.). Also, the adenoviral vector expressing the BMP-7 gene has a modulating effect on epithelial cells during regeneration of eye damage (Saika S et al. // Am J Physiol Cell Physiol. 2006 Jan;290(l):C282-9). In fact, it was shown that an adenoviral vector expressing BMP-7 can have a beneficial effect on the course of experimental ulcerative colitis in rats (Hao Z et al. // J Gene Med. 2012 Jul;14(7):482-90).

The LMP-1 gene encodes the LMP-1 protein (Lim mineralisation protein- 1) that increases the ability of cells to be involved in the BMP signalling cascade, induces the secretion of BMP-2 and BMP-7 proteins, and also increases the production of proteoglycans. It was shown in a study on rabbits that the adenoviral vector expressing the LMP-1 gene leads to a significant increase in the expression of aggrecan, collagen, BMP-2, and BMP-7 and can be considered as one of the directions for the development of treatments for degenerative disc changes and other bone and cartilage tissue damages (Yoon ST et al. // Spine (Phila Pa 1976). 2004;29(23):2603-2611).

It has been demonstrated in relation to oncological diseases that increased expression of LMP-1 gene, including that achieved due to the gene therapy approach using an adenoviral vector, can suppress the proliferation of osteosarcoma cells and facilitate their apoptosis (Liu H et al. // Int J Mol Sci. 2014 Apr 23;15(4):7037-48).

The NELL-1 gene encodes the NELL-1 protein. NELL-1 is a signalling protein that triggers the growth and maturation of tissues, including the skeleton, cardiac muscle, and blood vessels. Although it is most active during fetal development, it was shown that when purified recombinant protein NELL-1 is injected directly into heavily damaged adult tissues, the NELL-1 mediates and stimulates the innate regenerative pathways (regulated inflammation, stimulation of cell growth and differentiation, generation of blood vessels, etc.) in order to generate a new tissue of the correct architecture and function. It was shown that NELL-1 plays an important role in the production of fetal extracellular matrix (ECM), especially tenastins, collagens, and proteoglycans. ECM provides both the structural and signalling medium required for key tissue regeneration events, such as cell survival, proliferation, and differentiation. The recombinant NELL-1 protein also has a high therapeutic potential for the treatment of osteoporosis and bone regeneration (Kwak JH et al. // Biomaterials. 2015 Jul;57:73- 83; Tanjaya J et al. // Biores Open Access. 2016 Jim 1;5(1): 159-70).

Thus, background of the Invention suggests that BMP-2, BMP-7, LMP-1, and NELL-1 genes have the potential to correct a range of deviations including, but not limited to, bone and cartilage damage (spinal fusion, fractures), autoimmune diseases, cancer, hereditary and acquired pathological conditions, such as connective tissue damage, and other processes. This is why BMP-2, BMP-7, LMP-1, and NELL-1 genes are grouped within this patent. Genetic constructs that provide expression of proteins encoded by genes from BMP-2, BMP-7, LMP-1, and NELL-1 group can be used to develop drugs for the prevention and treatment of different diseases and pathological conditions.

Moreover, these data suggest that insufficient expression of proteins encoded by BMP-2, BMP-7, LMP-1, and NELL-1 genes included in the group of genes is associated not only with pathological conditions, but also with a predisposition to their development. Also, these data indicate that insufficient expression of these proteins may not appear explicitly in the form of a pathology that can be unambiguously described within the framework of existing clinical practice standards (for example, using the ICD code), but at the same time cause conditions that are unfavourable for humans and animals and associated with deterioration in the quality of life.

Analysis of approaches to increase the expression of therapeutic genes implies the practicability of use of different gene therapy vectors.

Gene therapy vectors are divided into viral, cell, and DNA vectors (Guideline on the quality, non-clinical, and clinical aspects of gene therapy medicinal Products EMA/CAT/80183/2014). Recently, gene therapy has paid increasingly more attention to the development of non-viral gene delivery systems with plasmid vectors topping the list. Plasmid vectors are free of limitations inherent in cell and viral vectors. In the target cell, they exist as an episome without being integrated into the genome, while producing them is quite cheap, and there is no immune response or side effects caused by the administration of plasmid vectors, which makes them a convenient tool for gene therapy and prevention of the genetic diseases (DNA vaccination) (Li L, Petrovsky N. // Expert Rev Vaccines. 2016;15(3):313—29).

However, limitations of plasmid vectors use in gene therapy are: 1) presence of antibiotic resistance genes for the production of constructs in bacterial strains; 2) the presence of various regulatory elements represented by sequences of viral genomes; 3) length of therapeutic plasmid vector that determines the efficiency of vector delivery to the target cell. It is known that the European Medicines Agency deems it necessary to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies). This recommendation is primarily related to the potential danger of the DNA vector penetration or horizontal antibiotic resistance gene transfer into the cells of bacteria found in the body as part of normal or opportunistic microflora. Furthermore, the presence of antibiotic resistance genes significantly increases the length of DNA vector, which reduces the efficiency of its penetration into eukaryotic cells.

It is important to note that antibiotic resistance genes also make a fundamental contribution to the method of production of DNA vectors. If antibiotic resistance genes are present, strains for the production of DNA vectors are usually cultured in medium containing a selective antibiotic, which poses risk of antibiotic traces in insufficiently purified DNA vector preparations. Thus, production of DNA vectors for gene therapy without antibiotic resistance genes is associated with the production of strains with such distinctive feature as the ability for stable amplification of therapeutic DNA vectors in the antibiotic-free medium.

In addition, the European Medicines Agency recommends avoiding the presence of regulatory elements in therapeutic plasmid vectors to increase the expression of therapeutic genes (promoters, enhancers, post-translational regulatory elements) that constitute nucleotide sequences of genomes of various viruses (Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en_GB/document_library/Scienti fic _guideline /2015/05/WC500187020.pdf). Although these sequences can increase the expression level of the therapeutic transgene, however, they pose risk of recombination with the genetic material of wild-type viruses and integration into the eukaryotic genome. Moreover, the relevance of overexpression of the particular gene for therapy remains an unresolved issue.

The size of the therapy vector is also essential. It is known that modem plasmid vectors often have unnecessary, non-functional sites that increase their length substantially (Mairhofer J, Grabherr R. // Mol Biotechnol. 2008.39(2) :97— 104). For example, ampicillin resistance gene in pBR322 series vectors, as a rule, consists of at least 1000 bp, which is more than 20% of the length of the vector itself. A reverse relationship between the vector length and its ability to penetrate into eukaryotic cells is observed; DNA vectors with a small length effectively penetrate into human and animal cells. For example, in a series of experiments on transfection of HELA cells with 383— 4548 bp DNA vectors it was shown that the difference in penetration efficiency can be up to two orders of magnitude (100 times different) (Homstein BD et al. // PLoS ONE. 2016;11(12): e0167537.).

Thus, when selecting a DNA vector, for reasons of safety and maximum effectiveness, preference should be given to those constructs that do not contain antibiotic resistance genes, the sequences of viral origin and length of which allows for the effective penetration into eukaryotic cells. A strain for production of such DNA vector in quantities sufficient for the purposes of gene therapy should ensure the possibility of stable DNA vector amplification using antibiotic-free nutrient media.

Example of usage of the recombinant DNA vectors for gene therapy is the method of producing a recombinant vector for genetic immunisation (Patent No. US 9550998 B2. The plasmid vector is a supercoiled plasmid DNA vector that is used for the expression of cloned genes in human and animal cells. The vector contains an origin of replication, regulatory elements comprising human cytomegalovirus promoter and enhancer, and regulatory sequences from the human T-cell lymphotropic virus.

The vector is accumulated in a dedicated E. coli strain free of antibiotics through antisense complementation of sacB gene inserted into the strain by means of bacteriophage. The disadvantage of this invention is the presence of regulatory elements in the composition of DNA vector that constitute sequences of viral genomes.

The following applications are prototypes of this invention with regard to the use of gene therapy approaches to increase the expression level of genes from the group of BMP-2, BMP-7, LMP- 1 , and NELL- 1 genes.

Patent No. US5942496A describes a method of bone tissue regeneration and treatment of diseases associated with bone tissue by introducing into cells or human and animal organism genes selected from the group of genes, including BMP-2 and BMP-7 genes. The disadvantage of this invention are vague requirements for the properties of vectors.

Patent No.US6300127Bl describes a method of use of vectors expressing the LMP-1 gene for bone tissue regeneration. The disadvantage of this invention is the lack of safety requirements applied to the used vector.

Patent No.US7807787B2 describes the use of recombinant NELL-1 protein for the regeneration of bone tissue. The disadvantage of this invention is the lack of a gene therapy approach to the embodiment of invention.

Disclosure of the Invention

The purpose of this invention is to construct the gene therapy DNA vectors in order to increase the expression level of a group of BMP-2, BMP-7, LMP-1, and NELL- 1 genes in human and animal organisms that combine the following properties:

I) Efficiency of gene therapy DNA vector in order to increase the expression level of therapeutic genes in eukaryotic cells.

II) Possibility of safe use in gene therapy of human beings and animals due to the absence of regulatory elements representing the nucleotide sequences of viral genomes in the gene therapy DNA vector.

III) Possibility of safe use in the gene therapy of human beings and animals due to the absence of antibiotic resistance genes in the gene therapy DNA vector.

IV) Producibility and constructability of gene therapy DNA vector on an industrial scale.

Item II and III are provided for herein in line with the recommendations of the state regulators for gene therapy medicines and, specifically, the requirement of the European Medicines Agency to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies) and refrain from adding viral genomes to newly engineered plasmid vectors for gene therapy (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products / 23 March 2015, EMA/CAT/80183/2014, Committee for Advanced Therapies). The purpose of the invention also includes the construction of strains carrying these gene therapy DNA vectors for the development and production of these gene therapy DNA vectors on an industrial scale.

The specified purpose is achieved by constructing a gene therapy DNA vector based on gene therapy DNA vector VTvafl7 for treatment of diseases associated with disorders of regeneration of bone and cartilage tissues, nonunion of bone fractures of various skeleton parts, as well as for induction of bone and cartilage tissue growth by regulating proliferation and differentiation of osteoblasts, osteoclasts, chondroblasts and chondrocytes, for improvement in osteoinduction of allogeneic and xenogeneic bone grafts, for achieving spinal fusion, increase of bone union percentage in bone fracture therapy and reduction of healing time, for therapy of degenerative changes of intervertebral discs, osteoporosis, and other bone and cartilage damage, while the gene therapy DNA vector VTvafl7-BMP-2 contains the coding region of BMP-2 therapeutic gene, cloned to the gene therapy DNA vector VTvafl7 with the nucleotide sequence SEQ ID No. 1, the gene therapy DNA vector VTvafl7-BMP-7 contains the coding region of BMP-7 therapeutic gene, cloned to the gene therapy DNA vector VTvafl7 with the nucleotide sequence SEQ ID No. 2, the gene therapy DNA vector VTvafl 7- LMP-1 contains the coding region of LMP-1 therapeutic gene, cloned to the gene therapy DNA vector VTvafl7 with the nucleotide sequence SEQ ID No. 3, the gene therapy DNA vector VTvafl7-NELL-l contains the coding region of NELL-1 therapeutic gene, cloned to the gene therapy DNA vector VTvafl7 with the nucleotide sequence SEQ ID No. 4.

Each of the constructed gene therapy DNA vectors, namely VTvafl7-BMP-2, or VTvafl 7-BMP-7, or VTvafl7-LMP-l, or VTvafl7-NELL-l due to the limited size of VTvafl7 vector part not exceeding 3200 bp has the ability to efficiently penetrate into human and animal cells and express the therapeutic gene BMP-2, BMP-7, LMP-1, or NELL-1 cloned to it.

Each of the constructed gene therapy DNA vectors, namely VTvafl 7-BMP-2, or VTvafl 7-BMP-7, or VTvafl 7-LMP-l, or VTvafl 7-NELL-l uses nucleotide sequences that are not antibiotic resistance genes, virus genes, or regulatory elements of viral genomes as the structure elements, which ensures its safe use for gene therapy in humans and animals. A method of gene therapy DNA vector production based on gene therapy DNA vector VTvafl7 carrying the BMP-2, BMP-7, LMP-1, NELL-1 therapeutic gene was also developed that involves obtaining each of gene therapy DNA vectors: VTvafl7- BMP-2, or VTvafl7-BMP-7, or VTvafl7-LMP-l, or VTvafl7-NELL-l as follows: the coding region of BMP-2, BMP-7, LMP-1, NELL-1 therapeutic gene is cloned to gene therapy DNA vector VTvafl7, and gene therapy DNA vector VTvafl7-BMP-2, SEQ ID No. 1, or VTvafl7-BMP-7, SEQ ID No. 2 or VTvafl7-LMP-l, SEQ ID No. 3, or VTvafl7-NELL-l, SEQ ID No. 4, respectively, is obtained, while the coding region of the BMP-2, or BMP-7, or LMP-1, or NELL-1 therapeutic gene is obtained by isolating total RNA from the human biological tissue sample followed by the reverse transcription reaction and PCR amplification using the obtained oligonucleotides and cleaving the amplification product by corresponding restriction endonucleases, while cloning to gene therapy DNA vector VTvafl7 is performed out by Nhel and Hindlll restriction sites, while the selection is performed without antibiotics;

at the same time, the following oligonucleotides produced for this purpose are used during gene therapy DNA vector VTvafl7-BMP-2, SEQ ID No. 1 production for the reverse transcription reaction and PCR amplification:

BMP-2 F AC AGCT AGCCTCCT A A AGGTCC ACC AT GGT,

BMP-2 R TATAAGCTTCTAGCGACACCCACAACCCT,

and the cleaving of amplification product and cloning of the coding region of BMP-2 gene to gene therapy DNA vector VTvafl7 is performed by Nhel and Hindlll restriction endonucleases.

and the following oligonucleotides produced for this purpose are used during gene therapy DNA vector VTvafl7-BMP-7, SEQ ID No. 2 production for the reverse transcription reaction and PCR amplification:

BMP-7 F TCAGCTAGCGTAGAGCCGGCGCGATGCA,

BMP-7 R TATAAGCTTCTAGTGGCAGCCACAGGC,

and the cleaving of amplification product and cloning of the coding region of BMP-7 gene in gene therapy DNA vector VTvafl7 is performed by Nhel and Hindlll restriction endonucleases,

and the following oligonucleotides produced for this purpose are used during gene therapy DNA vector VTvafl7-LMP-l, SEQ ID No. 3 production for the reverse transcription reaction and PCR amplification: LMP- 1 _F GGATCC ACC AT GG ATT CCTTC A A AGT AGT GC,

LMP-1 _R AT AG A ATT C AC AC AT G AG AG A AGGC AT GGCT,

and the cleaving of amplification product and cloning of the coding region of LMP-1 gene to DNA vector VTvafl7 is performed by BamHI and EcoRI restriction endonucleases,

and the following oligonucleotides produced for this purpose are used during gene therapy DNA vector VTvafl7-NELL-l, SEQ ID No. 4 production for the reverse transcription reaction and PCR amplification:

NELL- 1 _F GG AT CC AC CAT GC C GAT GG ATTT G ATTTT AGTTG,

NELL- 1_R TTCGGTACCTAATTATTTTGAAGACACTCAAAATCC, and the cleaving of amplification product and cloning of the coding region of NELL-1 gene to DNA vector VTvafl7 is performed by BamEQI and Kpnl restriction endonucleases.

A method of use of the gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the BMP-2, BMP-7, LMP-1, NELL-1 therapeutic gene for the treatment of diseases associated with disorders of regeneration of bone and cartilage tissues, nonunion of bone fractures of various skeleton parts, as well as for induction of bone and cartilage tissue growth by regulating proliferation and differentiation of osteoblasts, osteoclasts, chondroblasts and chondrocytes, for improvement in osteoinduction of allogeneic and xenogeneic bone grafts, for achieving spinal fusion, increase of bone union percentage in bone fracture therapy and reduction of healing time, for therapy of degenerative changes of intervertebral discs, osteoporosis, and other bone and cartilage damage was developed that involves transfection of the cells of patient or animal organs and tissues with the selected gene therapy DNA vector carrying the therapeutic gene based on gene therapy DNA vector VTvafl7, or several selected gene therapy DNA vectors carrying therapeutic genes based on gene therapy DNA vector VTvafl7, from the group of constructed gene therapy DNA vectors carrying therapeutic genes based on gene therapy DNA vector VTvafl7 and/or injection of autologous cells of said patient or animal transfected by the selected gene therapy DNA vector carrying therapeutic gene based on gene therapy DNA vector VTvafl7 or several selected gene therapy DNA vectors carrying the therapeutic genes based on gene therapy DNA vector VTvafl7 from the constructed gene therapy DNA vectors carrying therapeutic genes based on gene therapy DNA vector VTvafl7 into the organs and tissues of the same patient or animal and/or the injection of the selected gene therapy DNA vector carrying therapeutic gene based on gene therapy DNA vector VTvafl7 or several selected gene therapy DNA vectors carrying therapeutic genes based on gene therapy DNA vector VTvafl7 from the group of constructed gene therapy DNA vectors carrying therapeutic genes based on gene therapy DNA vector VTvafl7 into the organs and tissues of the same patient or animal, or the combination of the indicated methods.

A method of production of strain for construction of a gene therapy DNA vector for the treatment of diseases associated with disorders of regeneration of bone and cartilage tissues, nonunion of bone fractures of various skeleton parts, as well as for induction of bone and cartilage tissue growth by regulating proliferation and differentiation of osteoblasts, osteoclasts, chondroblasts and chondrocytes, for improvement in osteoinduction of allogeneic and xenogeneic bone grafts, for achieving spinal fusion, increase of bone union percentage in bone fracture therapy and reduction of healing time, for therapy of degenerative changes of intervertebral discs, osteoporosis, and other bone and cartilage damage was developed that involves making electrocompetent cells of Escherichia coli SCSI 10- AF strain and subjecting these cells to electroporation with gene therapy DNA vector VTvafl7-BMP-2, or DNA vector VTvafl7-BMP-7, or DNA vector VTvafl7-LMP-l, or DNA vector VTvafl7-NELL-l. After that, the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol, and as a result, Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-2, or Escherichia coli strain SCS 110-AF/VTvaf 17-BMP-7, or Escherichia coli strain SCSI 10-AF/VTvafl7-LMP-l, or Escherichia coli strain SCSI 10-AF/VTvafl7-NELL-l is obtained.

Escherichia coli strain SCS110-AF/VTvafl7-BMP-2 strain carrying the gene therapy DNA vector VTvafl7-BMP-2 for production thereof allowing for antibiotic- free selection during gene therapy DNA vector production, Escherichia coli strain

SCS110-AF/VTvafl7-BMP-7 carrying the gene therapy DNA vector VTvafl7-BMP-7 for production thereof allowing for antibiotic-free selection during gene therapy DNA vector production, or Escherichia coli strain SCS110-AF/VTvafl7-LMP-l carrying the gene therapy DNA vector VTvafl7-LMP-l for production thereof allowing for antibiotic-free selection during gene therapy DNA vector production, or Escherichia coli strain SCSI 10-AF/VTvafl7-NELL-l carrying the gene therapy DNA vector

VTvafl7-NELL-l for production thereof allowing for antibiotic-free selection during gene therapy DNA vector production for treatment of diseases associated with disorders of regeneration of bone and cartilage tissues, nonunion of bone fractures of various skeleton parts, as well as for induction of bone and cartilage tissue growth by regulating proliferation and differentiation of osteoblasts, osteoclasts, chondroblasts and chondrocytes, for improvement in osteoinduction of allogeneic and xenogeneic bone grafts, for achieving spinal fusion, increase of bone union percentage in bone fracture therapy and reduction of healing time, for therapy of degenerative changes of intervertebral discs, osteoporosis, and other bone and cartilage damage is claimed.

A method of production on an industrial scale of gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the BMP-2, BMP-7, LMP-1, NELL-1 therapeutic gene for treatment of diseases associated with disorders of regeneration of bone and cartilage tissues, nonunion of bone fractures of various skeleton parts, as well as for induction of bone and cartilage tissue growth by regulating proliferation and differentiation of osteoblasts, osteoclasts, chondroblasts and chondrocytes, for improvement in osteoinduction of allogeneic and xenogeneic bone grafts, for achieving spinal fusion, increase of bone union percentage in bone fracture therapy and reduction of healing time, for therapy of degenerative changes of intervertebral discs, osteoporosis, and other bone and cartilage damage was developed that involves production of gene therapy DNA vector VTvafl7-BMP-2, or gene therapy DNA vector VTvafl 7-BMP-7, or gene therapy DNA vector VTvafl7-LMP-l, or gene therapy DNA vector VTvafl 7-NELL-l by inoculating a culture flask containing the prepared medium with seed culture selected from Escherichia coli strain SCS 110-AF/VTvafl 7-BMP-2, or Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-7, or Escherichia coli strain SCS 110-AF/VTvaf 17-LMP- 1 , or Escherichia coli strain SCS 110-AF/VTvafl 7-NELL-l then the cell culture is incubated in an incubator shaker and transferred to an industrial fermenter, then grown to a stationary phase, then the fraction containing the target DNA product is extracted, multi-stage filtered, and purified by chromatographic methods.

Brief description of figures

Figure 1 shows the structure of gene therapy DNA vector VTvafl 7 carrying the therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 genes that constitutes a circular double-stranded DNA molecule capable of autonomous replication in Escherichia coli cells.

Figure 1 shows the structures corresponding to:

A - gene therapy DNA vector VTvafl7-BMP-2,

B - gene therapy DNA vector VTvafl7-BMP-7,

C - gene therapy DNA vector VTvafl7-LMP-l,

D - gene therapy DNA vector VTvafl 7-NELL- 1.

The following structural elements of the vector are indicated in the structures:

EFla - the promoter region of human elongation factor EF1 A with an intrinsic enhancer contained in the first intron of the gene. It ensures efficient transcription of the recombinant gene in most human tissues,

The reading frame of the therapeutic gene corresponding to the coding region of the BMP-2 gene (Fig. 1A), or BMP-7 gene (Fig. IB), or LMP-1 gene (Fig. 1C), or NELL-1 gene (Fig. ID), respectively, hGH-TA - the transcription terminator and the polyadenylation site of the human growth factor gene, ori - the origin of replication for autonomous replication with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains,

RNA-out - the regulatory element RNA-out of transposon Tn 10 allowing for antibiotic-free positive selection in case of the use of Escherichia coli strain SCS 110- AF.

Unique restriction sites are marked.

Figure 2 shows diagrams of cDNA amplicon accumulation of the therapeutic gene, namely BMP-2 gene, in HOb human osteoblast culture (Cell Applications, Inc Cat. 406-05a) before their transfection and 48 hours after transfection of these cells with gene therapy DNA vector VTvafl7-BMP-2 in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level. Curves of accumulation of amplicons during the reaction are shown in Fig. 2 corresponding to:

1 - cDNA of BMP-2 gene in HOb human osteoblast culture before transfection with DNA vector VTvafl7-BMP-2, 2 - cDNA of BMP-2 gene in HOb human osteoblast culture after transfection with DNA vector VTvafl7-BMP-2,

3 - cDNA of B2M gene in HOb human osteoblast culture before transfection with DNA vector VTvafl7-BMP-2,

4 - cDNA of B2M gene in HOb human osteoblast culture after transfection with DNA vector VTvafl 7-BMP-2.

B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene.

Figure 3 shows diagrams of cDNA amplicon accumulation of the therapeutic gene, namely the BMP-7 gene, in MG-63 human osteosarcoma culture (ATCC® CRL-1427™) before its transfection and 48 hours after transfection of these cells with DNA vector VTvafl 7- BMP-7 in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level.

Curves of accumulation of amplicons during the reaction are shown in Fig. 3 corresponding to:

1 - cDNA of BMP-7 gene in MG-63 human osteosarcoma culture before transfection with DNA vector VTvafl 7-BMP-7,

2 - cDNA of BMP-7 gene in MG-63 human osteosarcoma culture after transfection with DNA vector VTvafl 7-BMP-7, 3 - cDNA of B2M gene in MG-63 human osteosarcoma culture before transfection with DNA vector VTvafl 7-BMP-7,

4 - cDNA of B2M gene in MG-63 human osteosarcoma culture after transfection with DNA vector VTvafl 7-BMP-7. B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene.

Figure 4 shows diagrams of cDNA amplicon accumulation of the therapeutic gene, namely the LMP-1 gene, in Hs 870.T human bone fibroblast cell line (ATCC® CRL-7606™) before their transfection and 48 hours after transfection of these cells with gene therapy DNA vector VTvafl7-LMP-l in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level.

Curves of accumulation of amplicons during the reaction are shown in Fig. 4 corresponding to:

1 - cDNA of LMP-1 gene in Hs 870.T human bone fibroblast cell line before transfection with DNA vector VTvafl7-LMP-l,

2 - cDNA of LMP-1 gene in Hs 870.T human bone fibroblast cell line after transfection with DNA vector VTvafl7-LMP-l, 3 - cDNA of B2M gene in Hs 870.T human bone fibroblast cell line before transfection with DNA vector VTvafl7-LMP-l,

4 - cDNA of B2M gene in Hs 870.T human bone fibroblast cell line after transfection with DNA vector VTvafl7-LMP-l .

B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene.

Figure 5 shows diagrams of cDNA amplicon accumulation of the therapeutic gene, namely NELL-1 gene, in human chondrocyte culture (HC) (Cell Applications, Inc Cat. 402K- 05a) before their transfection and 48 hours after transfection of these cells with the DNA vector VTvafl7-NELL-l in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level.

Curves of accumulation of amplicons during the reaction are shown in Fig. 5 corresponding to: 1 - cDNA of NELL-1 gene in human chondrocyte cell culture (HC) before transfection with DNA vector VTvafl7-NELL-l,

2 - cDNA of NELL-1 gene in human chondrocyte cell culture (HC) after transfection with DNA vector VTvafl7-NELL-l, 3 - cDNA of B2M gene in human chondrocyte cell culture (HC) before transfection with DNA vector VTvafl7-NELL-l,

4 - cDNA of B2M gene in human chondrocyte cell culture (HC) after transfection with DNA vector VTvafl 7-NELL-l .

B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene.

Figure 6 shows the plot of BMP-2 protein concentration in the cell lysate of HOb human osteoblast culture after transfection of these cells with DNA vector VTvafl 7-BMP-2 in order to assess the functional activity, i.e. expression at the protein level based on the BMP-2 protein concentration change in the cell lysate.

The following elements are indicated in Figure 6: culture A - HOb human osteoblast culture transfected with aqueous dendrimer solution without plasmid DNA (reference), culture B - HOb human osteoblast culture transfected with DNA vector VTvafl 7, culture C - HOb human osteoblast culture transfected with DNA vector VTvafl 7-

BMP-2.

Figure 7 shows the plot of BMP-7 protein concentration in the lysate of MG-63 human osteosarcoma culture (ATCC® CRL-1427™) after transfection of these cells with DNA vector VTvafl 7-BMP-7 in order to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the level of protein expression by gene therapy DNA vector based on gene therapy vector VTvafl 7 carrying the BMP-7 therapeutic gene. The following elements are indicated in Figure 7: culture A - MG-63 human osteosarcoma culture transfected with aqueous dendrimer solution without plasmid DNA (reference), culture B - MG-63 human osteosarcoma culture transfected with DNA vector VTvafl7, culture C - MG-63 human osteosarcoma culture transfected with DNA vector VTvafl 7-BMP-7.

Figure 8 shows the plot of LMP-1 protein concentration in the lysate of Hs 870.T human bone fibroblast cell line (ATCC® CRL-7606™) after transfection of these cells with DNA vector VTvafl 7-LMP-l in order to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the level of protein expression by gene therapy DNA vector based on gene therapy vector VTvafl 7 carrying the LMP-1 therapeutic gene.

The following elements are indicated in Figure 8: culture A - cell culture of Hs 870.T human bone fibroblast cell line transfected with aqueous dendrimer solution without plasmid DNA (reference), culture B - cell culture of Hs 870.T human bone fibroblast cell line transfected with DNA vector VTvafl 7, culture C - cell culture of Hs 870.T human bone fibroblast cell line transfected with DNA vector VTvafl 7-LMP-l.

Figure 9 shows the plot of NELL-1 protein concentration in the lysate of human chondrocytes (HC) (Cell Applications, Inc Cat. 402K-05a) after transfection of these cells with gene therapy DNA vector VTvafl 7-NELL-l in order to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the level of protein expression by gene therapy DNA vector based on gene therapy DNA vector VTvafl 7 carrying the NELL-1 therapeutic gene.

The following elements are indicated in Figure 9: culture A - cell culture of human chondrocytes (HC) transfected with aqueous dendrimer solution without plasmid DNA (reference), culture B - cell culture of human chondrocytes (HC) transfected with gene therapy DNA vector VTvafl7, culture C - cell culture of human chondrocytes (HC) transfected with gene therapy DNA vector VTvafl 7-NELL- 1.

Figure 10 shows the plot of NELL- 1 protein concentration in the skin biopsy specimens of three patients after injection of gene therapy DNA vector VTvafl 7-NELL- 1 into the skin of these patients in order to assess the functional activity, i.e. the expression of the therapeutic gene at the protein level, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on gene therapy vector VTvafl 7 carrying the NELL-1 therapeutic gene.

The following elements are indicated in Figure 10: PI I - patient PI skin biopsy in the region of injection of gene therapy DNA vector

VTvafl 7-NELL- 1,

PHI - patient PI skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

PI III - patient PI skin biopsy from intact site, P2I - patient P2 skin biopsy in the region of injection of gene therapy DNA vector

VTvafl 7-NELL-l,

P2II - patient P2 skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

P2III - patient P2 skin biopsy from intact site, P3I - patient P3 skin biopsy in the region of injection of gene therapy DNA vector

VTvafl 7-NELL-l,

P3II - patient P3 skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7 (placebo), P3III - patient P3 skin biopsy from intact site.

Figure 11 shows the plot of LMP-1 protein concentration in the gastrocnemius muscle biopsy specimens of three patients after injection of gene therapy DNA vector VTvafl7-LMP-l into the gastrocnemius muscle of these patients in order to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on gene therapy vector VTvafl7 carrying the LMP-1 therapeutic gene.

The following elements are indicated in Figure 11 : P1I - patient PI gastrocnemius muscle biopsy in the region of injection of gene therapy DNA vector VTvafl7-LMP-l,

PHI - patient PI gastrocnemius muscle biopsy in the region of injection of gene therapy DNA vector VTvafl7 (placebo),

PI III - patient PI gastrocnemius muscle biopsy from intact site, P2I - patient P2 gastrocnemius muscle biopsy in the region of injection of gene therapy DNA vector VTvafl7-LMP-l,

P2II - patient P2 gastrocnemius muscle biopsy in the region of injection of gene therapy DNA vector VTvafl7 (placebo),

P2III - patient P2 gastrocnemius muscle biopsy from intact site, P3I - patient P3 gastrocnemius muscle biopsy in the region of injection of gene therapy DNA vector VTvafl7-LMP-l,

P3II - patient P3 gastrocnemius muscle biopsy in the region of injection of gene therapy DNA vector VTvafl7 (placebo),

P3III - patient P3 gastrocnemius muscle biopsy from intact site. Figure 12 shows the plot of BMP-7 protein concentration in the skin biopsy specimens of three patients after injection of gene therapy DNA vector VTvafl7-BMP-7 into the skin of these patients in order to assess the functional activity, i.e. the expression of the therapeutic gene at the protein level, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on gene therapy vector VTvafl7 carrying the BMP-7 therapeutic-gene.

The following elements are indicated in Figure 12:

PI I - patient PI skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7-BMP-7,

Pill - patient PI skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

PI III - patient PI skin biopsy from intact site,

P2I - patient P2 skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7-BMP-7,

P2II - patient P2 skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

P2III - patient P2 skin biopsy from intact site,

P3I - patient P3 skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7-BMP-7,

P3II - patient P3 skin biopsy in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

P3III - patient P3 skin biopsy from intact site.

Figure 13 shows the plot of BMP-7 protein concentration in human skin biopsy samples after subcutaneous injection of autologous fibroblast cell culture transfected with the gene therapy DNA vector VTvafl 7-BMP-7 in order to demonstrate the method of use by injecting autologous cells transfected with the gene therapy DNA vector VTvafl 7- BMP-7.

The following elements are indicated in Figure 13:

PIC - patient PI skin biopsy in the region of injection of autologous fibroblast culture of the patient transfected with gene therapy DNA vector VTvafl 7-BMP-7, P1B - patient PI skin biopsy in the region of injection of autologous fibroblasts of the patient transfected with gene therapy DNA vector VTvafl7,

PI A - patient PI skin biopsy from intact site.

Figure 14 shows the plot of protein concentrations: human BMP-2 protein, human BMP-7 protein, human LMP-1 protein, human NELL-1 protein in bone fragments of the lower third of thigh of three Wistar rats after injection into the femoral epiphysis site of a mixture of gene therapy vectors: gene therapy DNA vector VTvafl7-BMP-2, gene therapy DNA vector VTvafl7-BMP-7, gene therapy DNA vector VTvafl7-LMP-l, gene therapy DNA vector VTvafl7-NELL-l in order to demonstrate the method of use of a mixture of gene therapy DNA vectors.

The following elements are indicated in Figure 14:

K1I - bone fragment of the lower third of K1 rat thigh in the region of injection of a mixture of gene therapy DNA vectors: VTvafl7-BMP-2, VTvafl7-BMP-7, VTvafl 7-LMP- 1 , and VTvafl 7 -NELL- 1 ,

Kill - bone fragment of the lower third of K1 rat thigh in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

K1III - bone fragment of K1 rat thigh from reference intact site,

K2I - bone fragment of the lower third of K2 rat thigh in the region of injection of a mixture of gene therapy DNA vectors: VTvafl 7-BMP-2, VTvafl 7-BMP-7, VTvafl 7-LMP- 1 , and VTvafl 7-NELL- 1 ,

K2II - bone fragment of the lower third of K2 rat thigh in the region of injection of gene therapy DNA vector VTvafl 7 (placebo),

K2III - bone fragment of K2 rat thigh from reference intact site, K3I - bone fragment of the lower third of K3 rat thigh in the region of injection of a mixture of gene therapy DNA vectors: VTvafl 7-BMP-2, VTvafl 7-BMP-7, VTvafl 7-LMP- 1 , and VTvafl 7-NELL- 1 ,

K3II - bone fragment of the lower third of K3 rat thigh in the region of injection of gene therapy DNA vector VTvafl 7 (placebo), K3III - bone fragment of K3 rat thigh from reference intact site.

Figure 15 shows diagrams of cDNA amplicon accumulation of the LMP-1 therapeutic gene in Canine Osteoblast cells (CnOb) (Cell Application Cat. Cn406K-05) before and 48 hours after transfection of these cells with DNA vector VTvafl7-LMP-l in order to demonstrate the method of use by injection of gene therapy DNA vector into animals.

Curves of accumulation of amplicons during the reaction are shown in Fig. 15 corresponding to:

1 - cDNA of LMP-1 gene in CnOb canine osteoblast cells before transfection with gene therapy DNA vector VTvafl 7-LMP- 1 ,

2 - cDNA of LMP-1 gene in CnOb canine osteoblast cells after transfection with gene therapy DNA vector VTvafl 7-LMP- 1,

3 - cDNA of GAPDH gene in CnOb canine osteoblast cells before transfection with gene therapy DNA vector VTvafl 7-LMP- 1, 4 - cDNA of GAPDH gene in CnOb canine osteoblast cells after transfection with gene therapy DNA vector VTvafl 7-LMP- 1.

Canine gene GAPDH listed in the GenBank database under number NC_006609.3, GENE ID 403755 was used as a reference gene.

Embodiment of the Invention Gene therapy DNA vectors carrying the human therapeutic genes designed to increase the expression level of these therapeutic genes in human and animal tissues were constructed based on 3165 bp DNA vector VTvafl 7. The method of production of each gene therapy DNA vector carrying the therapeutic genes is to clone the protein coding sequence of the therapeutic gene selected from the group of the following genes: BMP-2 gene (encodes BMP-2 protein), BMP-7 gene (encodes BMP-7 protein), LMP-1 gene (encodes LMP-1 protein), and NELL-1 gene (encodes NELL-1 protein) to the polylinker of gene therapy DNA vector VTvafl 7. It is known that the ability of DNA vectors to penetrate into eukaryotic cells is due mainly to the vector size. DNA vectors with the smallest size have higher penetration capability. Thus, the absence of elements in the vector that bear no functional load, but at the same time increase the vector DNA size is preferred. These features of DNA vectors were taken into account during the production of gene therapy DNA vectors based on gene therapy DNA vector VTvafl7 carrying the therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 genes with no large non-functional sequences and antibiotic resistance genes in the vector, which, in addition to technological advantages and safe use, allowed for the significant reduction of size of the produced gene therapy DNA vector VTvafl7 carrying the therapeutic gene selected from the group of BMP-2, BMP -7, LMP-1, and NELL-1 genes. Thus, the ability of the obtained gene therapy DNA vector to penetrate into eukaryotic cells is due to its small length.

Each of the following gene therapy DNA vectors: DNA vector VTvafl7-BMP-2, or VTvafl7-BMP-7, or VTvafl7-LMP-l, or VTvafl7-NELL-l was produced as follows: the coding region of the therapeutic gene from the group of BMP-2, or BMP-7, or LMP-1, or NELL-1 genes was cloned to gene therapy DNA vector VTvafl7 and gene therapy DNA vector VTvafl7-BMP-2, SEQ ID No. 1, or VTvafl7-BMP-7, SEQ ID No. 2 or VTvafl7-LMP-l, SEQ ID No. 3, or VTvafl7-NELL-l, SEQ ID No. 4, respectively, was obtained. The coding region of BMP-2 gene (1219 bp), or BMP-7 gene (1322 bp), or LMP-1 gene (1375 bp), or NELL-1 gene (2294 bp) was produced by extracting total RNA from the biological normal tissue sample. The reverse transcription reaction was used for the synthesis of the first chain cDNA of human BMP-2, BMP-7, LMP-1, and NELL-1 genes. Amplification was performed using oligonucleotides produced for this purpose by the chemical synthesis method. The amplification product was cleaved by specific restriction endonucleases taking into account the optimal procedure for further cloning, and cloning to the gene therapy DNA vector VTvafl7 was performed by BamHI, EcoRI, Hindlll, Nhel, and Kpnl restriction sites located in the VTvafl7 vector polylinker. The selection of restriction sites was carried out in such a way that the cloned fragment entered the reading frame of expression cassette of the vector VTvafl7, while the protein coding sequence did not contain restriction sites for the selected endonucleases. Experts in this field realise that the methodological implementation of gene therapy DNA vector VTvafl7-BMP-2, or VTvafl7-BMP-7, or VTvafl7-LMP-l, or VTvafl7-NELL-l production can vary within the framework of the selection of known methods of molecular gene cloning and these methods are included in the scope of this invention. For example, different oligonucleotide sequences can be used to amplify BMP-2, or BMP-7, or LMP-1, or NELL-1 gene, different restriction endonucleases, or laboratory techniques, such as ligation independent cloning of genes.

Gene therapy DNA vector VTvafl7-BMP-2, or VTvafl7-BMP-7, or VTvafl 7- LMP-1, or VTvafl7-NELL-l has the nucleotide sequence SEQ ID No. 1, or SEQ ID No. 2, or SEQ ID No. 3, or SEQ ID No. 4, respectively. At the same time, degeneracy of genetic code is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences differing by insertion, deletion, or replacement of nucleotides that do not result in a change in the polypeptide sequence encoded by the therapeutic gene, and/or do not result in a loss of functional activity of the regulatory elements of VTvafl7 vector. At the same time, genetic polymorphism is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences of genes from BMP-2, BMP-7, LMP-1, and NELL-1 genes that also encode different variants of the amino acid sequences of BMP- 2, BMP-7, LMP-1, and NELL-1 proteins that do not differ from those listed in their functional activity under physiological conditions.

The ability to penetrate into eukaryotic cells and express functional activity, i.e. the ability to express the therapeutic gene of the obtained gene therapy DNA vector

VTvafl 7-BMP-2, or VTvafl7-BMP-7, or VTvafl7-LMP-l, or VTvafl 7-NELL- 1 is confirmed by injecting the obtained vector into eukaryotic cells and performing subsequent analysis of the expression of specific mRNA and/or protein product of the therapeutic gene. The presence of specific mRNA in cells into which the gene therapy

DNA vector VTvafl 7-BMP-2, or VTvafl 7-BMP-7, or VTvafl 7-LMP-l, or VTvafl 7-

NELL-1 was introduced shows the ability of the obtained vector to both penetrate into eukaryotic cells and express mRNA of the therapeutic gene. Furthermore, it is known to the experts in this field that the presence of mRNA gene is a mandatory condition, but not an evidence of the translation of protein encoded by the therapeutic gene. Therefore, in order to confirm properties of the gene therapy DNA vector VTvafl 7-BMP-2, or

VTvafl 7-BMP-7, or VTvafl 7-LMP-l, or VTvafl 7-NELL- 1 to express the therapeutic gene at the protein level in eukaryotic cells into which the gene therapy DNA vector was introduced, analysis of the concentration of proteins encoded by the therapeutic genes was carried out using immunological methods. The presence of BMP-2, or BMP-

7, or LMP-1, or NELL-1 protein confirms the efficiency of expression of therapeutic genes in eukaryotic cells and the possibility of increasing the protein concentration using the gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 genes. Thus in order to confirm the efficiency of the produced gene therapy DNA vector VTvafl7-BMP-2 carrying the therapeutic gene, namely the BMP-2 gene, gene therapy DNA vector VTvafl7-BMP-7 carrying the therapeutic gene, namely the BMP-7 gene, gene therapy DNA vector VTvafl7-LMP-l carrying the therapeutic gene, namely the LMP-1 gene, gene therapy DNA vector VTvafl7-NELL-l carrying the therapeutic gene, namely the NELL-1 gene, the following methods were used:

A) real-time PCR, i.e. change in mRNA accumulation of therapeutic genes in human and animal cell lysate after transfection of different human and animal cell lines with gene therapy DNA vectors,

B) Enzyme-linked immunosorbent assay, i.e. change in the quantitative level of therapeutic proteins in the human cell lysate after transfection of different human cell lines with gene therapy DNA vectors,

C) Enzyme-linked immunosorbent assay, i.e. change in the quantitative level of therapeutic proteins in the supernatant of human and animals tissue biopsy specimens after the injection of gene therapy DNA vectors into these tissues,

D) Enzyme-linked immunosorbent assay, i.e. change in the quantitative level of therapeutic proteins in the supernatant of human tissue biopsies after the injection of these tissues with autologous cells of this human transfected with gene therapy DNA vectors.

In order to confirm the practicability of use of the constructed gene therapy DNA vector VTvafl7-BMP-2 carrying the therapeutic gene, namely the BMP-2 gene, gene therapy DNA vector VTvafl7-BMP-7 carrying the therapeutic gene, namely the BMP-7 gene, gene therapy DNA vector VTvafl7-LMP-l carrying the therapeutic gene, namely the LMP-1 gene, gene therapy DNA vector VTvafl7-NELL-l carrying the therapeutic gene, namely the NELL-1 gene, the following was performed:

A) transfection of different human and animal cell lines with gene therapy DNA vectors, B) injection of gene therapy DNA vectors into different human and animal tissues,

C) injection of a mixture of gene therapy DNA vectors into animal tissues,

D) injection of autologous cells transfected with gene therapy DNA vectors into human tissues.

These methods of use lack potential risks for gene therapy of humans and animals due to the absence of regulatory elements in the gene therapy DNA vector that constitute the nucleotide sequences of viral genomes and absence of antibiotic resistance genes in the gene therapy DNA vector as confirmed by the lack of regions homologous to the viral genomes and antibiotic resistance genes in the nucleotide sequences of gene therapy DNA vector VTvafl7-BMP-2, or gene therapy DNA vector VTvafl7-BMP-7, or gene therapy DNA vector VTvafl7-LMP-l, or gene therapy DNA vector VTvafl 7-NELL- 1 (SEQ ID No. 1, or SEQ ID No. 2, or SEQ ID No. 3, or SEQ ID No. 4, respectively).

It is known to the experts in this field that antibiotic resistance genes in the gene therapy DNA vectors are used to obtain these vectors in preparative quantities by increasing bacterial biomass in a nutrient medium containing a selective antibiotic. Within the framework of this invention, in order to ensure the safe use of gene therapy DNA vector VTvafl 7 carrying BMP-2, or BMP-7, or LMP-1, or NELL-1 therapeutic genes, the use of selective nutrient media containing an antibiotic is not possible. A method for obtaining strains for production of these gene therapy vectors based on Escherichia coli strain SCS110-AF is proposed as a technological solution for obtaining the gene therapy DNA vector VTvafl 7 carrying a therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 genes in order to scale up the production of gene therapy vectors to an industrial scale. The method of Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-2, or Escherichia coli strain SCSI 10- AF/VTvafI7-BMP-7, or Escherichia coli strain SCS 1 10-AF/VTvaf 17-LMP- 1 , or Escherichia coli strain SCSI 10-AF/VTvafl 7-NELL- 1 production involves production of competent cells of Escherichia coli strain SCS110-AF with the injection of gene therapy DNA vector VTvafl 7-BMP-2, or DNA vector VTvafl 7-BMP-7, or DNA vector VTvafl 7-LMP- 1, or DNA vector VTvafl 7-NELL- 1 into these cells, respectively, using transformation (electroporation) methods widely known to the experts in this field. The obtained Escherichia coli strain SCS110-AF/VTvafl7-BMP-2, or Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-7, or Escherichia coli strain SCSI 10- AF/VTvafl7-LMP-l, or Escherichia coli strain SCS 1 10-AF/VTvafl 7-NELL- 1 is used to produce the gene therapy DNA vector VTvafl7-BMP-2, or VTvafl7-BMP-7, or VTvafl 7-LMP-l, or VTvafl 7-NELL- 1, respectively, allowing for the use of antibiotic- free media.

In order to confirm the production of Escherichia coli strain SCSI 10- AF/VTvafl7-BMP-2, or Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-7, or Escherichia coli strain SCSI 10-AF/VTvafl7-LMP-l, or Escherichia coli strain SCS 1 10-AF/VTvafl 7-NELL- 1 , transformation, selection, and subsequent tailing with extraction of plasmid DNA were performed.

To confirm the producibility, constructability and scale up of the production of gene therapy DNA vector VTvafl 7-BMP-2 carrying the therapeutic gene, namely BMP-2 gene, gene therapy DNA vector VTvafl 7-BMP-7 carrying the therapeutic gene, namely BMP-7 gene, gene therapy DNA vector VTvafl 7-LMP-l carrying the therapeutic gene, namely LMP-1 gene, gene therapy DNA vector VTvafl 7-NELL- 1 carrying the therapeutic gene, namely NELL-1 gene, to an industrial scale, the fermentation on an industrial scale of Escherichia coli strain SCS 110-AF/VTvafl 7- BMP-2, or Escherichia coli strain SCS 110-AF/VTvafl 7-BMP-7, or Escherichia coli strain SCS 110-AF/VTvafl 7-LMP-l, or Escherichia coli strain SCSI 10-AF/VTvafl 7- NELL-1 each containing gene therapy DNA vector VTvafl 7 carrying the therapeutic gene, namely BMP-2, or BMP-7, or LMP-1, or NELL-1 gene, was performed.

The method of scaling the production of bacterial mass to an industrial scale for the isolation of gene therapy DNA vector VTvafl 7 carrying the therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 genes involves incubation of the seed culture of Escherichia coli strain SCS 110-AF/VTvafl 7-BMP-2, or Escherichia coli strain SCSI 10-AF/VTvafl 7-BMP-7 strain, or Escherichia coli strain SCS 110-AF/VTvafl 7-LMP-l strain, or Escherichia coli strain SCS 110-AF/VTvafl 7- NELL-1 in the antibiotic-free nutrient medium that provides suitable biomass accumulation dynamics. Upon reaching a sufficient amount of biomass in the logarithmic phase, the bacterial culture is transferred to an industrial fermenter and then grown to a stationary phase, then the fraction containing the therapeutic DNA product, i.e. gene therapy DNA vector VTvafl7-BMP-2, or gene therapy DNA vector VTvafl7- BMP-7, or gene therapy DNA vector VTvafl7-LMP-l, or gene therapy DNA vector VTvafl7-NELL-l, is extracted, multi-stage filtered, and purified by chromatographic methods. It is known to the experts in this field that culture conditions of strains, composition of nutrient media (except for antibiotic-free), equipment used, and DNA purification methods may vary within the framework of standard operating procedures depending on the particular production line, but known approaches to scaling, industrial production, and purification of DNA vectors using Escherichia coli strain SCSI 10- AF/VTvafl 7-BMP-2, or Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-7, or Escherichia coli strain SCSI 10-AF/VTvafl7-LMP-l, or Escherichia coli strain SCSI 10-AF/VTvafl7-NELL-l fall within the scope of this invention.

The described disclosure of the invention is illustrated by examples of the embodiment of this invention.

The essence of the invention is explained in the following examples.

Example 1.

Production of gene therapy DNA vector VTvafl7-BMP-2 carrying the therapeutic gene, namely the BMP-2 gene.

Gene therapy DNA vector VTvafl7-BMP-2 was constructed by cloning the coding region of BMP-2 gene (1219 bp) to a 3165 bp DNA vector VTvafl7 by Nhel and Hindlll restriction sites. The coding region of BMP-2 gene (1219 bp) was obtained by isolating total RNA from the biological human tissue sample followed by reverse transcription reaction using commercial kit Mint-2 (Evrogen, Russia) and PCR amplification using the following oligonucleotides:

BMP-2 F ACAGCTAGCCTCCTAAAGGTCCACCATGGT,

BMP-2 R T AT AAGCTT CT AGCG AC ACCC AC A ACCCT

and commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs, USA).

Gene therapy DNA vector VTvafl7 was constructed by consolidating six fragments of DNA derived from different sources: (a) the origin of replication was produced by PCR amplification of a region of commercially available plasmid pBR322 with a point mutation,

(b) EFla promoter region was produced by PCR amplification of a site of human genomic DNA, (c) hGH-TA transcription terminator was produced by PCR amplification of a site of human genomic DNA,

(d) the RNA-OUT regulatory site of transposon TnlO was synthesised from oligonucleotides,

(e) kanamycin resistance gene was produced by PCR amplification of a site of commercially available plasmid pET-28,

(f) the polylinker was produced by annealing two synthetic oligonucleotides.

PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs, USA) as per the manufacturer’s instructions. The fragments have overlapping regions allowing for their consolidation with subsequent PCR amplification. Fragments (a) and (b) were consolidated using oligonucleotides Ori-F and EF1-R, and fragments (c), (d), and (e) were consolidated using oligonucleotides hGH-F and Kan-R. Afterwards, the produced fragments were consolidated by restriction with subsequent ligation by sites BamHI and Ncol. This resulted in a plasmid still devoid of the polylinker. To add it, the plasmid was cleaved by BamHI and EcoRI sites followed by ligation with fragment (f). Therefore, a 3165 bp vector was constructed carrying the kanamycin resistance gene flanked by Spel restriction sites. Then this gene was cleaved by Spel restriction sites and the remaining fragment was ligated to itself. This resulted in a 3165 bp gene therapy DNA vector VTvafl7 that is recombinant and allows for antibiotic-free selection. The amplification product of the coding region of BMP-2 gene and DNA vector

VTvafl7 was cleaved by Nhel and Hindlll restriction endonucleases (New England Biolabs, USA).

This resulted in a 4360 bp DNA vector VTvafl7-BMP-2 with the nucleotide sequence SEQ ID No. 1 and general structure shown in Fig. 1 A. Example 2. Production of gene therapy DNA vector VTvafl7-BMP-7 carrying the therapeutic gene, namely the BMP-7 gene.

Gene therapy DNA vector VTvafl7-BMP-7 was constructed by cloning the coding region of BMP-7 gene (1322 bp) to a 3165 bp DNA vector VTvafl7 by Nhel and Hindlll restriction sites. The coding region of BMP-7 gene (1322 bp) was obtained by isolating total RNA from the biological human tissue sample followed by reverse transcription reaction using commercial kit Mint-2 (Evrogen, Russia) and PCR amplification using= the following oligonucleotides:

BMP-7 F TCAGCTAGCGTAGAGCCGGCGCGATGCA,

BMP-7 R TAT AAGCTT CT AGT GGC AGCC AC AGGC

and commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs, USA); amplification product and DNA vector VTvafl7 were cleaved by restriction endonucleases Nhel and Hindlll (New England Biolabs, USA).

This resulted in a 4463 bp DNA vector VTvafl7-BMP-7 with the nucleotide sequence SEQ ID No. 2 and general structure shown in Fig. IB.

Gene therapy DNA vector VTvafl 7 was constructed as described in Example 1.

Example 3.

Production of gene therapy DNA vector VTvafl 7-LMP-l carrying the therapeutic gene, namely the human LMP-1 gene.

Gene therapy DNA vector VTvafl 7-LMP-l was constructed by cloning the coding region of LMP-1 gene (1375 bp) to a 3165 bp DNA vector VTvafl7 by BamHI and EcoRI restriction sites. The coding region of LMP-1 gene (1375 bp) was obtained by isolating total RNA from the biological human tissue sample followed by reverse transcription reaction using commercial kit Mint-2 (Evrogen, Russia) and PCR amplification using the following oligonucleotides:

LMP-1 _F GG ATCC ACC AT GG ATTCCTT C AA AGT AGT GC ,

LMP- 1 _R AT AG A ATT C AC AC AT GAGAGA AGGC AT GGCT

and commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs, USA); amplification product and DNA vector VTvafl 7 were cleaved by restriction endonucleases BamHI and EcoRI (New England Biolabs, USA). This resulted in a 4516 bp DNA vector VTvafl7-LMP-l with the nucleotide sequence SEQ ID No. 3 and general structure shown in Fig. 1C.

Gene therapy DNA vector VTvafl7 was constructed as described in Example 1.

Example 4. Production of gene therapy DNA vector VTvafl7-NELL-l carrying the therapeutic gene, namely the NELL-1 gene.

Gene therapy DNA vector VTvafl7-NELL-l was constructed by cloning the coding region of NELL-1 gene (2294 bp) to a 3165 bp DNA vector VTvafl7 by BamHII and Kpnl restriction sites. The coding region of NELL- 1 gene (2294 bp) was obtained by isolating total RNA from the biological human tissue sample followed by reverse transcription reaction using commercial kit Mint-2 (Evrogen) and PCR amplification using the following oligonucleotides:

NELL- 1_F GG ATCC ACC AT GCCG ATGG ATTTG ATTTT AGTT G,

NELL- 1 _R TTCGGTACCTAATTATTTTGAAGAC ACTC A AAATCC and commercially available kit Phusion® High-Fidelity DNA Polymerase (New

England Biolabs, USA); amplification product and DNA vector VTvafl7 were cleaved by restriction endonucleases BamHII and Kpnl (New England Biolabs, USA).

This resulted in a 5441 bp DNA vector VTvafl7-NELL-l with the nucleotide sequence SEQ ID No. 4 and general structure shown in Fig. ID. Gene therapy DNA vector VTvafl 7 was constructed as described in Example 1.

Example 5.

Proof of the ability of gene therapy DNA vector VTvafl 7-BMP-2 carrying the therapeutic gene, namely BMP-2 gene, to penetrate eukaryotic cells and its functional activity at the level of therapeutic gene mRNA expression. This example also demonstrates practicability of use of gene therapy DNA vector carrying the therapeutic gene.

Changes in the mRNA accumulation of the BMP-2 therapeutic gene were assessed in HOb human osteoblast culture (Cell Applications, Inc Cat. 406-05a) 48 hours after their transfection with gene therapy DNA- vector VTvafl 7-BMP -2 carrying the human BMP -2 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PCR.

Primary HOb human osteoblasts culture was used in order to assess the change in the mRNA accumulation of the BMP-2 therapeutic gene. HOb cell culture was grown under standard conditions (37°C, 5% C02) using the Human Osteoblast Growth Medium: All-in-one ready-to-use (Cell Applications, Inc Cat. 417-500). The growth medium was replaced every 48 hours during the cultivation process.

To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24- well plate in the quantity of 5x 10 ⁴ cells per well. Transfection with gene therapy DNA vector VTvafl7-BMP-2 expressing the human BMP-2 gene was performed using Lipofectamine 3000 (ThermoFisher Scientific, USA) according to the manufacturer’s recommendations. In test tube 1, Imΐ of DNA vector VTvafl7-BMP- 2 solution (concentration 500ng/ l) and Imΐ of reagent P3000 was added to 25m1 of medium Opti-MEM (Gibco, USA). The preparation was mixed by gentle shaking. In test tube 2, Imΐ of Lipofectamine 3000 solution was added to 25 mΐ of medium Opti- MEM (Gibco, USA). The preparation was mixed by gentle shaking. The contents from test tube 1 were added to the contents of test tube 2, and the mixture was incubated at room temperature for 5 minutes. The resulting solution was added dropwise to the cells in the volume of 40m1.

HOb cells transfected with the gene therapy DNA vector VTvafl7 devoid of the inserted therapeutic gene (cDNA of BMP-2 gene before and after transfection with gene therapy DNA vector VTvafl7 devoid of the inserted therapeutic gene is not shown in the figures) were used as a reference. Reference vector VTvafl7 for transfection was prepared as described above.

Total RNA from HOb cells was extracted using Trizol Reagent (Invitrogen, USA) according to the manufacturer’s recommendations. 1ml of Trizol Reagent was added to the well with cells and homogenised and heated for 5 minutes at 65 °C. Then the sample was centrifuged at 14,000g for 10 minutes and heated again for 10 minutes at 65 °C. Then 200m1 of chloroform was added, and the mixture was gently stirred and centrifuged at 14,000g for 10 minutes. Then the water phase was isolated and mixed with 1/10 of the volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropyl alcohol. The sample was incubated at -20°C for 10 minutes and then centrifuged at 14,000g for 10 minutes. The precipitated RNA were rinsed in 1ml of 70% ethyl alcohol, air-dried and dissolved in 1 Omΐ of RNase-free water. The level of BMP-2 mRNA expression after transfection was determined by assessing the dynamics of the accumulation of cDNA amplicons by real-time PCR. For the production and amplification of cDNA specific for the human BMP-2 gene, the following BMP-2 SF and BMP-2 SR oligonucleotides were used

BMP-2 SF AT GC A AGC AGGT GGG A AAGT,

BMP-2 FR GGG AGCC AC A AT CC AGT CAT

The length of amplification product is 353 bp.

Reverse transcription reaction and PCR amplification was performed using SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) for real-time PCR. The reaction was carried out in a volume of 20m1, containing: 25m1 of QuantiTect SYBR Green RT-PCR Master Mix, 2.5mM of magnesium chloride, 0.5mM of each primer, and 5m1 of RNA. For the reaction, CFX96 amplifier (Bio-Rad, USA) was used under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation at 98°C for 15 minutes, followed by 40 cycles comprising denaturation at 94°C for 15 s, annealing of primers at 60°C for 30s and elongation at 72°C for 30s. B2M (beta-2- microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene. Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of BMP- 2 and B2M genes. Negative control included deionised water. Real-time quantification of the dynamics of accumulation of cDNA amplicons of BMP-2 and B2M genes was conducted using the Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 2.

Figure 2 shows that the level of specific mRNA of human BMP-2 gene has grown massively as a result of transfection of HOb human osteoblast cells with gene therapy DNA vector VTvafl7-BMP-2, which confirms the ability of the vector to penetrate eukaryotic cells and express the BMP-2 gene at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-BMP-2 in order to increase the expression level of BMP-2 gene in eukaryotic cells.

Example 6. Proof of the ability of gene therapy DNA vector VTvafl7-BMP-7 carrying the therapeutic gene, namely BMP-7 gene, to penetrate eukaryotic cells and its functional activity at the level of therapeutic gene mRNA expression. This example also demonstrates practicability of use of gene therapy DNA vector carrying the therapeutic gene.

Changes in the mRNA accumulation of the BMP-7 therapeutic gene were assessed in MG-63 human osteosarcoma culture (ATCC® CRL-1427™) 48 hours after their transfection with gene therapy DNA vector VTvafl7-BMP-7 carrying the human BMP-7 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PCR.

Primary MG-63 human osteosarcoma cells (ATCC® CRL-1427™) was grown in EMEM (ATCC® 30-2003™) with the addition of 10% of bovine serum (Paneko, Russia) under standard conditions (37°C, 5% C02). To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 5><10 ⁴ cells per well. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. The transfection with gene therapy DNA vector VTvafl7-BMP-7 expressing the human BMP-7 gene was performed according to the procedure described in Example 5. B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene. MG-63 human osteosarcoma cell culture transfected with the gene therapy DNA vector VTvafl7 devoid of the therapeutic gene (cDNA of BMP-7 gene before and after transfection with gene therapy DNA vector VTvafl7 devoid of the inserted therapeutic gene is not shown in the figures) was used as a reference. RNA isolation, reverse transcription reaction, and real-time PCR were performed as described in Example 5, except for oligonucleotides with sequences different from Example 5. For the amplification of cDNA specific for the human BMP-7 gene, the following BMP-7 SF and BMP-7_SR oligonucleotides were used:

BMP-7_SF GCTGGCTGGTGTTT G AC AT C ,

BMP-7 SR TGGT GGC GTTCATGTAGGAG

The length of amplification product is 459 bp. Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of BMP-7 and B2M genes. Negative control included deionised water. Real-time quantification of the PCR products, i.e. BMP-7 and B2M gene cDNAs obtained by amplification, was conducted using the Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 3.

Figure 3 shows that the level of specific mRNA of human BMP-7 gene has grown massively as a result of transfection of MG-63 human osteosarcoma cell culture with gene therapy DNA vector VTvafl 7-BMP-7, which confirms the ability of the vector to penetrate eukaryotic cells and express the BMP-7 gene at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl 7-BMP-7 in order to increase the expression level of BMP-7 gene in eukaryotic cells.

Example 7.

Proof of the ability of gene therapy DNA vector VTvafl7-LMP-l carrying the therapeutic gene, namely LMP-1 gene, to penetrate eukaryotic cells and its functional activity at the level of therapeutic gene mRNA expression. This example also demonstrates practicability of use of gene therapy DNA vector carrying the therapeutic gene.

Changes in the mRNA accumulation of the LMP-1 therapeutic gene were assessed in Hs 870.T human bone fibroblast cell line (ATCC® CRL-7606™) 48 hours after their transfection with gene therapy DNA vector VTvafl7-LMP-l carrying the human LMP-1 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PCR.

Hs 870.T human bone fibroblast cell line was grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC® 30-2002™) with the addition of 10% of bovine serum (ATCC® 30-2020™) under standard conditions (37°C, 5% C02). To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 5*10 ⁴ cells per well. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. The transfection with gene therapy DNA vector VTvafl7-LMP-l expressing the human LMP-1 gene was performed according to the procedure described in Example 5. B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene. Hs 870.T human bone fibroblast cell line transfected with the gene therapy DNA vector VTvafl7 devoid of the therapeutic gene (cDNA of LMP-1 gene before and after transfection with gene therapy DNA vector VTvafl7 devoid of the inserted therapeutic gene is not shown in the figures) was used as a reference. RNA isolation, reverse transcription reaction, and real-time PCR were performed as described in Example 5, except for oligonucleotides with sequences different from Example 5. For the amplification of cDNA specific for the human LMP-1 gene, the following LMP-1 SF and LMP-1 SR oligonucleotides were used:

LMP-1 _SF T CAT GC AAGACCCGGAT GAG,

LMP-1 _SR CACTGTGCTCGTTTTGTCCG

The length of amplification product is 194 bp.

Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of LMP-1 and B2M genes. Negative control included deionised water. Real-time quantification of the PCR products, i.e. LMP-1 and B2M gene cDNAs obtained by amplification, was conducted using the Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 4.

Figure 4 shows that the level of specific mRNA of human LMP-1 gene has grown massively as a result of transfection of Hs 870.T human bone fibroblast cell line with gene therapy DNA vector VTvafl7-LMP-l, which confirms the ability of the vector to penetrate eukaryotic cells and express the LMP-1 gene at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-LMP-l in order to increase the expression level of LMP-1 gene in eukaryotic cells.

Example 8.

Proof of the ability of gene therapy DNA vector VTvafl7-NELL-l carrying the therapeutic gene, namely NELL-1 gene, to penetrate eukaryotic cells and its functional activity at the level of therapeutic gene mRNA expression. This example also demonstrates practicability of use of gene therapy DNA vector carrying the therapeutic gene.

Changes in mRNA accumulation of the NELL-1 therapeutic gene were assessed in human chondrocyte culture (HC) (Cell Applications, Inc Cat. 402K-05a) were assessed 48 hours after their transfection with gene therapy DNA-vector VTvafl7- NELL-1 carrying the human NELL-1 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PCR.

Human chondrocyte cell line (HC) was grown in the Human Chondrocyte Growth Medium: All-in-one ready-to-use (Cell Applications, Inc Cat. 402K-05a) under standard conditions (37°C, 5% C02). To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 5x l0 ⁴ cells per well. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. The transfection with gene therapy DNA vector VTvafl7-NELL-l expressing the human NELL-1 gene was performed according to the procedure described in Example 5. Human chondrocyte cell line (HC) transfected with the gene therapy DNA vector VTvafl7 not carrying the therapeutic gene (cDNA of NELL-1 gene before and after transfection with gene therapy DNA vector VTvafl7, devoid of the inserted therapeutic gene is not shown in the figures) was used as a reference. RNA isolation, reverse transcription reaction, and real-time PCR were performed as described in Example 5, except for oligonucleotides with sequences different from Example 5. For the amplification of cDNA specific for the human NELL-1 gene, the following NELL- 1JSF and NELL-1 SR oligonucleotides were used:

NELL-1_SF CC ACT GT AC AGC AG A AGCC A,

NELL-1_SR CTGACAGTGCAACCTTGTGC

The length of amplification product is 195 bp.

Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of NELL-1 and B2M genes. B2M (beta-2 -microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene. Negative control included deionised water. Real-time quantification of the PCR products, i.e. NELL-1 and B2M gene cDNAs obtained by amplification, was conducted using the Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 5.

Figure 5 shows that the level of specific mRNA of human NELL-1 gene has grown massively as a result of transfection of human chondrocyte cell line HC with gene therapy DNA vector VTvafl7-NELL-l, which confirms the ability of the vector to penetrate eukaryotic cells and express the NELL-1 gene at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-NELL-l in order to increase the expression level of NELL-1 gene in eukaryotic cells.

Example 9.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-BMP-2 carrying the BMP-2 gene in order to increase the expression of BMP- 2 protein in mammalian cells.

The change in the BMP-2 protein concentration was assessed in the HOb human osteoblast lysate (Cell Applications, Inc Cat. 406-05a) after transfection of these cells with DNA vector VTvafl7-BMP-2 carrying the human BMP-2 gene.

HOb human osteoblast cell culture was grown as described in Example 5.

To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 5x 10 ⁴ cells per well. The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. The aqueous dendrimer solution without DNA vector (A) and DNA vector VTvafl7 devoid of cDNA of BMP-2 gene (B) were used as a reference, and DNA vector VTvafl7-BMP-2 carrying the human BMP-2 gene (C) was used as the transfected agent. The DNA-dendrimer complex was prepared according to the manufacturer’s procedure (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some modifications. For cell transfection in one well of a 24-well plate, the culture medium was added to 1 pg of DNA vector dissolved in TE buffer to a final volume of 60m1, then 5m1 of SuperFect Transfection Reagent was added and gently mixed by pipetting five times. The complex was incubated at room temperature for 10-15 minutes. Then the culture medium was taken from the wells, the wells were rinsed with lml of PBS buffer. 350m1 of medium containing 10pg/ml of gentamicin was added to the resulting complex, mixed gently, and added to the cells. The cells were incubated with the complexes for 2-3 hours at 37°C in the presence of 5% C02.

The medium was then removed carefully, and the live cell array was rinsed with lml of PBS buffer. Then, medium containing 10pg/ml of gentamicin was added and incubated for 24-48 hours at 37°C in the presence of 5% C02.

After transfection, 0.1ml of IN HC1 were added to 0.5ml of the culture broth, mixed thoroughly, and incubated for 10 minutes at room temperature. Then, the mixture was neutralised by adding 0.1ml of 1.2M NaOH/0.5M HEPES (pH 7-7.6) and stirred thoroughly. Supernatant was collected and used to assay the therapeutic protein. The BMP-2 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the Human BMP-2 DuoSet ELISA (R&D Systems Cat DY355-05, USA) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA).

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of BMP-2 protein was used. The sensitivity was 50pg/ml, measurement range - from 50pg/ml to 4000pg/ml. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 6.

Figure 6 shows that the transfection of HOb human osteoblast cells with gene therapy DNA vector VTvafl7-BMP-2 results in increased BMP-2 protein concentration compared to the reference samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the BMP-2 gene at the protein level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-BMP-2 in order to increase the expression level of BMP-2 gene in eukaryotic cells.

Example 10.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene in order to increase the expression of BMP- 7 protein in mammalian cells.

The change in the BMP-7 protein concentration in MG-63 human osteosarcoma cell lysate (ATCC® CRL-1427™) was assessed after transfection of these cells with the DNA vector VTvafl7-BMP-7 carrying the human BMP-7 gene. Cells were grown as described in Example 6.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. The aqueous dendrimer solution without DNA vector (A) and DNA vector VTvafl7 devoid of cDNA of BMP-7 gene (B) were used as a reference, and DNA vector VTvafl7-BMP-7 carrying the human BMP-7 gene (C) was used as the transfected agent. Preparation of the DNA dendrimer complex and transfection of MG- 63 cells were performed according to the procedure described in Example 9.

After transfection, 0.1ml of IN HC1 were added to 0.5ml of the culture broth, mixed thoroughly, and incubated for 10 minutes at room temperature. Then, the mixture was neutralised by adding 0.1ml of 1.2M NaOH/0.5M HEPES (pH 7-7.6) and stirred thoroughly. Supernatant was collected and used to assay the therapeutic protein. The BMP-7 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the Human BMP-7 ELISA (Raybiotech, Inc Cat. ELH-BMP7-1, USA) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA).

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of BMP-7 protein was used. The sensitivity was lOpg/ml, measurement range - from lOpg/ml to 6000pg/ml. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 7.

Figure 7 shows that the transfection of MG-63 human osteosarcoma cell culture with gene therapy DNA vector VTvafl7-BMP-7 results in increased BMP-7 protein concentration compared to the reference samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the BMP-7 gene at the protein level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-BMP-7 in order to increase the expression level of BMP-7 gene in eukaryotic cells.

Example 11. Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-LMP-l carrying the LMP-1 gene in order to increase the expression of LMP-1 protein in mammalian cells.

Changes in the LMP-1 protein concentration in the lysate of Hs 870.T human bone fibroblast cell line (ATCC® CRL-7606™) were assessed after transfection of these cells with gene therapy DNA vector VTvafl7-LMP-l carrying the human LMP-1 gene. Cells were cultured as described in Example 7.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. The aqueous dendrimer solution without DNA vector (A) and DNA vector VTvafl7 devoid of cDNA of LMP-1 gene (B) were used as a reference, and DNA vector VTvafl7-LMP-l carrying the human LMP-1 gene (C) was used as the transfected agent. Preparation of the DNA dendrimer complex and transfection of Hs 870.T human bone fibroblast cell line were performed according to the procedure described in Example 9.

After transfection, cells were rinsed three times with PBS, and then 1ml of PBS was added to the cells and the cells were subjected to freezing/thawing three times. Then the suspension was centrifuged for 15 minutes at 15,000rpm, and supernatant was collected and used for the quantification and assay of the therapeutic protein. The LMP-1 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the PDZ and LIM domain 7 (enigma) (PDLIM7), ELISA Kit (MyBioSource Cat MBS9327056, USA) according to the manufacturer’s method with optical density detection using ChemWell Automated El A and Chemistry Analyser (Awareness Technology Inc., USA).

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of LMP-1 protein was used. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 8.

Figure 8 shows that the transfection of Hs 870. T human bone fibroblast cell line with gene therapy DNA vector VTvafl7-LMP-l results in increased LMP-1 protein concentration compared to the reference samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the LMP-1 gene at the protein level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-LMP-l in order to increase the expression level of LMP-1 in eukaryotic cells.

Example 12.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-NELL-l carrying the NELL-1 gene in order to increase the expression of NELL-1 protein in mammalian cells.

The change in the NELL-1 protein concentration in the lysate of human chondrocyte cell culture (HC) (Cell Applications, Inc Cat. 402K-05a) was assessed after transfection of these cells with DNA vector VTvafl7-NELL-l carrying the human NELL-1 gene. Cells were cultured as described in Example 8.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. The aqueous dendrimer solution without DNA vector (A) and DNA vector VTvafl7 devoid of cDNA of NELL- 1 gene (B) were used as a reference, and DNA vector VTvafl7-NELL-l carrying the human NELL-1 gene (C) was used as the transfected agent. Preparation of the DNA dendrimer complex and transfection of HC cells were performed according to the procedure described in Example 9.

After transfection, 0.1ml of IN HC1 were added to 0.5ml of the culture broth, mixed thoroughly, and incubated for 10 minutes at room temperature. Then, the mixture was neutralised by adding 0.1ml of 1.2M NaOH/0.5M HEPES (pH 7-7.6) and stirred thoroughly. Supernatant was collected and used to assay the therapeutic protein.

The NELL-1 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the NELLI ELISA Kit (Human) (Aviva Systems Biology Cat. OKCA00780, USA) according to the manufacturer’s method with optical density detection using ChemWell Automated El A and Chemistry Analyser (Awareness Technology Inc., USA).

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of NELL-1 protein was used. The sensitivity was 31.25pg/ml, measurement range - from 31.25pg/ml to 2000pg/ml. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 9.

Figure 9 shows that the transfection of human chondrocytes cell culture (HC) with gene therapy DNA vector VTvafl7-NELL-l results in increased NELL-1 protein concentration compared to the reference samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the NELL-1 gene at the protein level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-NELL-l in order to increase the expression level of NELL-1 in eukaryotic cells.

Example 13.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-NELL-l carrying the NELL-1 gene in order to increase the expression of NELL-1 protein in human cells.

To confirm the efficiency of gene therapy DNA vector VTvafl7-NELL-l carrying the therapeutic gene, namely the NELL-1 gene, and practicability of its use, changes in NELL-1 protein concentration in human skin upon injection of gene therapy DNA vector VTvafl7-NELL-l carrying the human NELL-1 gene were assessed.

To analyse changes in the NELL-1 protein concentration, gene therapy DNA vector VTvafl7-NELL-l carrying the NELL-1 gene was injected into the forearm skin of three patients with concurrent injection of a placebo being gene therapy DNA vector VTvafl7 devoid of cDNA of NELL- 1 gene.

Patient 1, man, 59 y.o. (PI); Patient 2, woman, 49 y.o. (P2); Patient 3, man, 53 y.o. (P3). Polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. Gene therapy DNA vector VTvafl7-NELL-l containing cDNA of NELL- 1 gene and gene therapy DNA vector VTvafl7 used as a placebo not containing cDNA of NELL- 1 gene were dissolved in sterile nuclease-free water. To obtain a gene construct, DNA-cGMP grade in-vivo- jetPEI complexes were prepared according to the manufacturer recommendations.

Gene therapy DNA vector VTvafl7 (placebo) and gene therapy DNA vector VTvafl7-NELL-l carrying the NELL-1 gene were injected in the quantity of lmg for each genetic construct using the tunnel method with a 30G needle to the depth of 3mm. The injectate volume of gene therapy DNA vector VTvafl7 (placebo) and gene therapy DNA vector VTvafl7-NELL-l carrying the NELL-1 gene was 0.3ml for each genetic construct. The points of injection of each genetic construct were located at 8 to 10cm intervals at the forearm site.

The biopsy samples were taken on the 2nd day after the injection of the genetic constructs of gene therapy DNA vectors. The biopsy samples were taken from the patients’ skin in the site of injection of gene therapy DNA vector VTvafl7-NELL-l carrying the NELL-1 gene (I), gene therapy DNA vector VTvafl7 (placebo) (II), and from intact skin (III) using the skin biopsy device Epitheasy 3.5 (Medax SRL, Italy). The skin of patients in the biopsy site was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. The biopsy sample size was ca. 10mm3, and the weight was approximately 1 lmg. The sample was placed in a buffer solution containing 50mM of Tris-HCl, pH 7.6, lOOmM of NaCl, ImM of EDTA, and ImM of phenylmethylsulfonyl fluoride, and homogenised to obtain a homogenised suspension. The suspension was then centrifuged for 10 minutes at 14,000 g. Supernatant was collected and used in order to assay the therapeutic protein by enzyme-linked immunosorbent assay (ELISA). The NELL-1 protein was assayed by enzyme-linked immunosorbent assay (ELISA) as described in Example 12.

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of NELL-1 protein was used. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA). Diagrams resulting from the assay are shown in Figure 10.

Figure 10 shows the increased NELL-1 protein concentration in the skin of all three patients in the injection site of gene therapy DNA vector VTvafl7-NELL-l carrying the human NELL-1 gene compared to the NELL-1 protein concentration in the injection site of gene therapy DNA vector VTvafl7 (placebo) devoid of the human NELL-1 gene, which indicates the efficiency of gene therapy DNA vector VTvafl7- NELL-1 and confirms the practicability of its use, in particular upon intracutaneous injection of gene therapy DNA vector in human tissues. Example 14.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-LMP-l carrying the LMP-1 gene in order to increase the expression of LMP-1 protein in human cells.

To confirm the efficiency of gene therapy DNA vector VTvafl7-LMP-l carrying the LMP-1 therapeutic gene and practicability of its use, the change in the LMP-1 protein concentration in human muscle tissues upon injection of gene therapy DNA vector VTvafl7-LMP-l carrying the therapeutic gene, namely the human LMP-1 gene, was assessed.

To analyse changes in the concentration of LMP-1 protein, gene therapy DNA vector VTvafl7-LMP-l carrying the LMP-1 gene with transport molecule was injected into the skin of three patients with concurrent injection of a placebo being gene therapy DNA vector VTvafl7 devoid of cDNA of LMP-1 gene with transport molecule.

Patient 1, woman, 50 y.o. (PI); Patient 2, man, 42 y.o. (P2); Patient 3, man, 62 y.o. (P3). Polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system; sample preparation was carried out in accordance with the manufacturer’s recommendations.

Gene therapy DNA vector VTvafl7 (placebo) and gene therapy DNA vector VTvafl7-LMP-l carrying the LMP-1 gene were injected in the quantity of lmg for each genetic construct using the tunnel method with a 30G needle to the depth of around 10mm. The injectate volume of gene therapy DNA vector VTvafl7 (placebo) and gene therapy DNA vector VTvafl7-LMP-l carrying the LMP-1 gene was 0.3ml for each genetic construct. The points of injection of each genetic construct were located medially at 8 to 10cm intervals.

The biopsy samples were taken on the 2nd day after the injection of the genetic constructs of gene therapy DNA vectors. The biopsy samples were taken from the patients’ muscle tissues in the site of injection of gene therapy DNA vector VTvafl7- LMP-1 carrying the LMP-1 gene (I), gene therapy DNA vector VTvafl7 (placebo) (II), and intact site of gastrocnemius muscle (III) using the skin biopsy device MAGNUM (BARD, USA). The skin of patients in the biopsy site was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. The biopsy sample size was ca. 20mm3, and the weight was up to 22mg. The sample was placed in a buffer solution containing 50mM of Tris-HCl, pH 7.6, lOOmM of NaCl, ImM of EDTA, and ImM of phenylmethylsulfonyl fluoride, and homogenised to obtain a homogenised suspension. The suspension was then centrifuged for 10 minutes at 14,000 g. Supernatant was collected and used to assay the therapeutic protein.

The LMP-1 protein was assayed by enzyme-linked immunosorbent assay (ELISA) as described in Example 11.

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of LMP-1 protein was used. R-3.0.2 was used for the statistical treatment of the results and data visualisation fhttps://www.r-proiect.org/). Diagrams resulting from the assay are shown in Figure 11.

Figure 11 shows the increased LMP-1 protein concentration in the gastrocnemius muscle of all three patients in the injection site of gene therapy DNA vector VTvafl 7- LMP-1 carrying the therapeutic gene, namely LMP-1 gene, compared to the LMP-1 protein concentration in the injection site of gene therapy DNA vector VTvafl7 (placebo) devoid of the human LMP-1 gene, which indicates the efficiency of gene therapy DNA vector VTvafl7-LMP-l and confirms the practicability of its use, in particular upon intramuscular injection of gene therapy DNA vector in human tissues.

Example 15.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl 7-BMP-7 carrying the BMP-7 gene in order to increase the expression of BMP- 7 protein in human cells.

To confirm the efficiency of gene therapy DNA vector VTvafl 7-BMP-7 carrying the therapeutic gene, namely the BMP-7 gene, and practicability of its use, changes in BMP-7 protein concentration in human skin upon injection of gene therapy DNA vector VTvafl 7-BMP-7 carrying the human BMP-7 gene were assessed.

To analyse changes in the BMP-7 protein concentration, gene therapy DNA vector VTvafl 7-BMP-7 carrying the BMP-7 gene was injected into the forearm skin of three patients with concurrent injection of a placebo being gene therapy DNA vector VTvafl 7 devoid of cDNA of BMP-7 gene. Patient 1, woman, 57 y.o. (PI); Patient 2, man, 50 y.o. (P2); Patient 3, man, 59 y.o. (P3); Polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. Gene therapy DNA vector VTvafl7-BMP-7 containing cDNA of BMP-7 gene and gene therapy DNA vector VTvafl7 used as a placebo not containing cDNA of BMP-7 gene were dissolved in sterile nuclease-free water. To obtain a gene construct, DNA-cGMP grade in-vivo- jetPEI complexes were prepared according to the manufacturer recommendations.

Gene therapy DNA vector VTvafl7 (placebo) and gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene were injected in the quantity of lmg for each genetic construct using the tunnel method with a 30G needle to the depth of 3mm. The injectate volume of gene therapy DNA vector VTvafl7 (placebo) and gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene was 0.3ml for each genetic construct. The points of injection of each genetic construct were located at 8 to 10cm intervals at the forearm site.

The biopsy samples were taken on the 2nd day after the injection of the genetic constructs of gene therapy DNA vectors. The biopsy samples were taken from the patients’ skin in the site of injection of gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene (I), gene therapy DNA vector VTvafl7 (placebo) (II), and from intact skin (III) using the skin biopsy device Epitheasy 3.5 (Medax SRL, Italy). The skin of patients in the biopsy site was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. The biopsy sample size was ca. 10mm3, and the weight was approximately 1 lmg. The sample was placed in a buffer solution containing 50mM of Tris-HCl, pH 7.6, lOOmM of NaCl, ImM of EDTA, and ImM of phenylmethylsulfonyl fluoride, and homogenised to obtain a homogenised suspension. The suspension was then centrifuged for 10 minutes at 14,000 g. Supernatant was collected and used in order to assay the therapeutic protein by enzyme-linked immunosorbent assay (ELISA) as described in Example 10.

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of BMP-7 protein was used. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 12. Figure 12 shows the increased BMP-7 protein concentration in the skin of all three patients in the injection site of gene therapy DNA vector VTvafl7-BMP-7 carrying the human BMP-7 therapeutic gene compared to the BMP-7 protein concentration in the injection site of gene therapy DNA vector VTvafl7 (placebo) devoid of the human BMP-7 gene, which indicates the efficiency of gene therapy DNA vector VTvafl7-BMP-7 and confirms the practicability of its use, in particular upon intracutaneous injection of gene therapy DNA vector in human tissues.

Example 16.

Proof of the efficiency of gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene and practicability of its use in order to increase the expression level of the BMP-7 protein in human tissues by injecting autologous fibroblasts transfected with gene therapy DNA vector VTvafl 7-BMP-7.

To confirm the efficiency of gene therapy DNA vector VTvafl 7-BMP-7 carrying the BMP-7 gene and practicability of its use, changes in the BMP-7 protein concentration in patient’s skin upon injection of autologous fibroblast culture of the same patient transfected with gene therapy DNA vector VTvafl 7-BMP-7 were assessed.

The appropriate autologous fibroblast culture transfected with the gene therapy DNA vector VTvafl 7-BMP-7 carrying the BMP-7 gene was injected into the patient’s forearm skin with concurrent injection of a placebo in the form of autologous fibroblast culture transfected with gene therapy DNA vector VTvafl 7 not carrying the BMP-7 gene.

The human primary fibroblast culture was isolated from the patient skin biopsy specimens. Biopsy specimens of the skin from the area protected by ultraviolet, namely behind the ear or on the inner lateral side of the elbow, were taken using the skin biopsy device Epitheasy 3.5 (Medax SRL, Italy). The biopsy sample was ca. 10mm and ca. 11 mg. The patient’s skin was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. The primary cell culture was cultivated at 37°C in the presence of 5% C02, in the DMEM medium with 10% fetal bovine serum and lOOU/ml of ampicillin. The passage and change of culture medium was performed every 2 days. Total duration of culture growth did not exceed 25-30 days. Then an aliquot of 5><10 ⁴ cells was taken from the cell culture. The patient’s fibroblast culture was transfected with the gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene or placebo, i.e. VTvafl7 vector not carrying the BMP-7 therapeutic gene.

The transfection was carried out using a cationic polymer such as polyethyleneimine JETPEI (Polyplus transfection, France), according to the manufacturer’s instructions. The cells were cultured for 72 hours and then injected into the patient. Injection of autologous fibroblast culture of the patient transfected with gene therapy DNA vector VTvafl7-BMP-7 and autologous fibroblast culture of the patient transfected with gene therapy DNA vector VTvafl7 as a placebo was performed in the forearm using the tunnel method with a 13mm long 30G needle to the depth of approximately 3mm. The concentration of the modified autologous fibroblasts in the injected suspension was approximately 5 min cells per 1ml of the suspension, the dose of the injected cells did not exceed 15 min. The points of injection of the autologous fibroblast culture were located at 8 to 10cm intervals.

Biopsy samples were taken on the 4th day after the injection of autologous fibroblast culture transfected with the gene therapy DNA vector VTvafl7-BMP-7 carrying the therapeutic gene, namely BMP-7 gene, and placebo. Biopsy was taken from the patient’s skin in the site of injection of autologous fibroblast culture transfected with gene therapy DNA vector VTvafl 7-BMP- 7 carrying the therapeutic gene, namely BMP-7 gene (C), autologous fibroblast culture non-transfected with gene therapy DNA vector VTvafl 7 not carrying the BMP-7 therapeutic gene (placebo) (B), as well as from intact skin site (A) using the skin biopsy device Epitheasy 3.5 (Medax SRL, Italy). The skin of patients in the biopsy site was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. The biopsy sample size was ca. 10mm3, and the weight was approximately 11 mg. The sample was placed in a buffer solution containing 50mM of Tris-HCl, pH 7.6, lOOmM of NaCl, ImM of EDTA, and lmM of phenylmethylsulfonyl fluoride, and homogenised to obtain a homogenised suspension. The suspension was then centrifuged for 10 minutes at 14,000 g. Supernatant was collected and used to assay the therapeutic protein as described in Example 15.

Diagrams resulting from the assay are shown in Figure 13. Figure 13 shows the increased concentration of BMP-7 protein in the area of the patient’s skin in the injection site of autologous fibroblast culture transfected with the gene therapy DNA vector VTvafl7-BMP-7 carrying the BMP-7 gene compared to the BMP-7 protein concentration in the injection site of autologous fibroblast culture transfected with the gene therapy DNA vector VTvafl7 that does not carry the BMP-7 gene (placebo), which indicates the efficiency of gene therapy DNA vector VTvafl7- BMP-7 and practicability of its use in order to increase the expression level of BMP-7 in human organs, in particular upon injection of autologous fibroblasts transfected with the gene therapy DNA vector VTvafl7-BMP-7 into the skin.

Example 17.

Proof of the practicability of combined use of gene therapy DNA vector VTvafl7- BMP-2 carrying the therapeutic gene, namely the BMP-2 gene, gene therapy DNA vector VTvafl7-BMP-7 carrying the therapeutic gene, namely the BMP-7 gene, gene therapy DNA vector VTvafl7-LMP-l carrying the therapeutic gene, namely the LMP-1 gene, gene therapy DNA vector VTvafl7-NELL-l carrying the therapeutic gene, namely the NELL-1 gene, for the upregulation of expression level of BMP -2, BMP-7, LMP- 1 , and NELL- 1 proteins in mammalian tissues.

The changes in the BMP -2, BMP-7, LMP-1, and NELL-1 protein concentrations in the rat’s thigh were assessed upon injection of a mixture of gene therapy vectors into this site. The study was performed on 3 laboratory animals, i.e. male Wistar rats 8 months old weighing 240-290g. Under anaesthesia (Zoletil at a dose of 40mg/kg of body weight, IP), access to the femoral epiphysis was performed through muscles via puncture from an incision of skin up to 5mm through the outer surface of the lower third of thigh of animals. A 3.0mm deep channel was made using 1.7mm drill (Semenov // Journal of VolSU. Series 9. Is. 11. 2013).

Polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. Equimolar mixture of gene therapy DNA vectors was dissolved in sterile nuclease-free water. To obtain a gene construct, DNA-cGMP grade in-vivo-jetPEI complexes were prepared according to the manufacturer recommendations. The injectate volume was 0.3ml with a total quantity of DNA of lOOpg. The solution was pipetted using Gilson Pipetman P1000L (Gilson, USA) autosampler. After 48 hours, animals were sacrificed with an overdose of Zoletil (200mg/kg of body weight), and a bone fragment of thigh was taken for the study (Semenov // Journal of VolSU. Series 9. Is. 11. 2013)

The samples were taken on the 2nd day after the injection of the gene therapy DNA vectors. The material was taken from sites of the bone fragment of the lower third of right thigh in the region of injection of a mixture of four gene therapy DNA vectors carrying the BMP-2, BMP-7, LMP-1, NELL-1 genes (site I), the bone fragment of the lower third of left thigh in the region of injection of gene therapy DNA vector VTva£17 (placebo) (site II), as well as from sites of bone fragments of thigh (upper third) not subjected to any manipulations (site III). Each sample was placed in a buffer solution containing 50mM of Tris-HCl, pH 7.6, lOOmM of NaCl, ImM of EDTA, and ImM of phenylmethylsulfonyl fluoride, and homogenised to obtain a homogenised suspension. The suspension was then centrifuged for 10 minutes at 14,000 g. Supernatant was collected and used to assay the therapeutic proteins as described in Example 9 (quantification of BMP-2 protein), Example 10 (quantification of BMP-7 protein), Example 11 (quantification of LMP-1 protein), and Example 12 (quantification of NELL-1 protein). Diagrams resulting from the assay are shown in Figure 14.

Figure 14 shows an increase of BMP-2, BMP-7, LMP-1 and NELL-1 protein concentration in the bone fragment site of the lower third of right thigh (site I) where the mixture of gene therapy DNA vector VTvafl7-BMP-2 carrying the BMP-2 therapeutic gene, gene therapy DNA vector VTvafl 7-BMP-7 carrying the BMP-7 therapeutic gene, gene therapy DNA vector VTvafl 7-LMP-l carrying the LMP-1 therapeutic gene, and gene therapy DNA vector VTvafl 7-NELL-l carrying the NELL-1 therapeutic gene was injected compared to the site II (placebo site) and site III (intact site). The obtained results show the efficiency of combined use of gene therapy DNA vectors and practicability of use for the upregulation of the expression level of therapeutic proteins in mammalian tissues.

Example 18.

Proof of the efficiency of gene therapy DNA vector VTvafl 7-LMP-l carrying the LMP-1 gene and practicability of its use in order to increase the expression level of LMP-1 protein in mammalian cells. To confirm the efficiency of the therapy DNA vector VTvafl 7-LMP- 1 carrying the LMP-1 gene, changes in the LMP-1 therapeutic gene mRNA accumulation in Canine Osteoblast cells (CnOb) (Cell Application Cat. Cn406K-05) were assessed 48 hours after their transfection with gene therapy DNA- vector VTvafl 7-LMP- 1 carrying the human LMP-1 gene.

CnOb canine osteoblast cells were grown in Canine Osteoblast Growth Medium (Cell Application Cat. Cn406K-05) under standard conditions. Transfection with gene therapy DNA vector VTvafl 7-LMP- 1 carrying the human LMP-1 gene and DNA vector VTvafl 7 not carrying the human LMP-1 gene (reference), RNA extraction, reverse transcription reaction, PCR amplification, and data analysis were performed as described in Example 7. Canine gene GAPDH listed in the GenBank database under number NC 006609.3, GENE ID 403755 was used as a reference gene. Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of LMP-1 and GAPDH genes. Negative control included deionised water. Real-time quantification of the PCR products, i.e. LMP-1 and GAPDH gene cDNAs obtained by amplification, was conducted using the Bio-Rad CFX Manager 2.1 software (Bio- Rad, USA).

Diagrams resulting from the assay are shown in Figure 15.

Figure 15 shows that the level of specific mRNA of human LMP-1 gene has grown massively as a result of transfection of CnOb canine osteoblast cells CnOb with gene therapy DNA vector VTvafl 7-LMP- 1, which confirms the ability of the vector to penetrate eukaryotic cells and express the LMP-1 gene at the mRNA level. The presented results confirm the practicability of use of gene therapy DNA vector VTvafl 7-LMP- 1 in order to increase the expression level of LMP-1 gene in mammalian cells.

Example 19.

Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-2, or Escherichia coli strain SCS 11 O-AF/VTvafl 7-BMP-7, or Escherichia coli strain SCS 110-AF/VTvaf 17-LMP- 1 , or Escherichia coli strain SCS110-AF/VTvafl7-NELL-l carrying gene therapy DNA vector and method of production thereof. The construction of strain for the production of gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the therapeutic gene on an industrial scale selected from the group of the following genes: BMP-2, BMP-7, LMP-1, and NELL-1, namely Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-2, or Escherichia coli strain SCS110-AF/VTvafl7-BMP-7, or Escherichia coli strain SCSI 10- AF/VTvaf 17-LMP- 1 , or Escherichia coli strain SCSI 10-AF/VTvafl7-NELL-l carrying the gene therapy DNA vector VTvafl7-BMP-2, or VTvafl7-BMP-7, or VTvafl 7-LMP - 1, or VTvafl7-NELL-l, respectively, for its production allowing for antibiotic-free selection involves making electrocompetent cells of Escherichia coli strain SCS110-AF and subjecting these cells to electroporation with gene therapy DNA vector VTvafl 7- BMP-2, or DNA vector VTvafl7-BMP-7, or DNA vector VTvafl 7-LMP- 1, or DNA vector VTvafl 7-NELL-l . After that, the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol. At the same time, production of Escherichia coli strain SCS110-AF for the production of gene therapy DNA vector VTvafl 7 or gene therapy DNA vectors based on it allowing for antibiotic-free positive selection involves constructing a 64 bp linear DNA fragment that contains regulatory element RNA-IN of transposon TnlO allowing for antibiotic-free positive selection, a 1422 bp levansucrase gene sacB, the product of which ensures selection within a sucrose-containing medium, a 763 bp chloramphenicol resistance gene catR required for the selection of strain clones in which homologous recombination occurs, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination in the region of gene recA concurrent with gene inactivation, and then the Escherichia coli cells are transformed by electroporation, and clones surviving in a medium containing 10pg/ml of chloramphenicol are selected.

The obtained strains for production were included in the collection of the National Biological Resource Centre - Russian National Collection of Industrial Microorganisms (NBRC RNCIM), RF and NCIMB Patent Deposit Service, UK under the following registration numbers:

Escherichia coli strain SCS110-AF/VTvafl7-BMP-2 - registered at the Russian National Collection of Industrial Microorganisms under number B-13167, date of deposit: 11.05.2018, accession No. NCIMB: 43034, date of deposit: 20.04.2018; Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-7 - registered at the Russian National Collection of Industrial Microorganisms under number B-13166, date of deposit: 11.05.2018, accession No. NCIMB: 43036, date of deposit: 20.04.2018;

Escherichia coli strain SCSI 10-AF/VTvafl7-LMP-l - registered at the Russian National Collection of Industrial Microorganisms under number B-13325, date of deposit: 12.11.2018, accession No. NCIMB: 43247, date of deposit: 08.11.2018;

Escherichia coli strain SCS I 10-AF/VTvafl7-NELL-l - registered at the Russian National Collection of Industrial Microorganisms under number B-13324, date of deposit: 12.11.2018, accession No. NCIMB: 43249, date of deposit: 08.11.2018.

Example 20.

The method for scaling up of the gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 to an industrial scale.

To confirm the producibility and constructability of gene therapy DNA vector VTvafl7-BMP-2 (SEQ ID No. 1), or VTvafl7-BMP-7 (SEQ ID No. 2), or VTvafl 7- LMP-1 (SEQ ID No. 3), or VTvafl7-NELL-l (SEQ ID No. 4) on an industrial scale, large-scale fermentation of Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-2, or Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-7, or Escherichia coli strain SCSI 10-AF/VTvafl7-LMP-l, or Escherichia coli strain SCS 110-AF/VTvaf 17-NELL- 1 each containing gene therapy DNA vector VTvafl7 carrying the therapeutic gene, namely BMP-2, or BMP-7, or LMP-1, or NELL-1, was performed. Each Escherichia coli strain SCS 110-AF/VTvafl 7-BMP-2, or Escherichia coli strain SCS 110- AF/VTvafl7-BMP-7, or Escherichia coli strain SCS110-AF/VTvafl7-LMP-l, or Escherichia coli strain SCS 110-AF/VTvafl 7-NELL- 1 was produced based on Escherichia coli strain SCS110-AF (Cell and Gene Therapy LLC, United Kingdom) as described in Example 19 by electroporation of competent cells of this strain with the gene therapy DNA vector VTvafl7-BMP-2, or VTvafl 7-BMP-7, or VTvafl7-LMP-l, or VTvafl 7-NELL- 1 carrying the therapeutic gene, namely BMP -2, or BMP-7, or LMP-1, or NELL-1, with further inoculation of transformed cells into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, and 6% sucrose, and selection of individual clones. Fermentation of Escherichia coli SCSI 10-AF/VTvafl7-BMP-2 carrying gene therapy DNA vector VTvafl7-BMP-2 was performed in a 101 fermenter with subsequent extraction of gene therapy DNA vector VTvafl7-BMP-2.

For the fermentation of Escherichia coli strain SCS110-AF/VTvafl7-BMP-2, a medium was prepared containing (per 101 of volume): lOOg of tryptone and 50g of yeastrel (Becton Dickinson, USA); then the medium was diluted with water to 8800ml and autoclaved at 121 °C for 20 minutes, and then 1200ml of 50% (w/v) sucrose was added. After that, the seed culture of Escherichia coli strain SCS110-AF/VTvafl7- BMP-2 was inoculated into a culture flask in the volume of 100ml. The culture was incubated in an incubator shaker for 16 hours at 30°C. The seed culture was transferred to the Techfors S bioreactor (Infors HT, Switzerland) and grown to a stationary phase. The process was controlled by measuring optical density of the culture at 600nm. The cells were pelleted for 30 minutes at 5,000-10,000g. Supernatant was removed, and the cell pellet was re-suspended in 10% (by volume) phosphate buffered saline. The cells were centrifuged again for 30 minutes at 5,000-10,000g. Supernatant was removed, a solution of 20mM TrisCl, ImM EDTA, 200g/l sucrose, pH 8.0 was added to the cell pellet in the volume of 1000ml, and the mixture was stirred thoroughly to a homogenised suspension. Then egg lysozyme solution was added to the final concentration of 100pg/ml. The mixture was incubated for 20 minutes on ice while stirring gently. Then 2500ml of 0.2M NaOH, lOg/1 sodium dodecyl sulphate (SDS) was added, the mixture was incubated for 10 minutes on ice while stirring gently, then 3500ml of 3M sodium acetate, 2M acetic acid, pH 5-5.5 was added, and the mixture was incubated for 10 minutes on ice while stirring gently. The resulting sample was centrifuged for 20-30 minutes at 15,000g or a greater value. The solution was decanted delicately, and residual precipitate was removed by passing through a coarse filter (filter paper). Then, RNase A (Sigma, USA) was added to the final concentration of 20pg/ml, and the solution was incubated overnight for 16 hours at room temperature. The solution was then centrifuged for 20-30 minutes at 15,000g and passed through a 0.45pm membrane filter (Millipore, USA). Then, ultrafiltration was performed with a lOOkDa membrane (Millipore, USA) and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCl, pH 7.0. This manipulation was performed three to four times. The solution was applied to the column with 250ml of DEAE Sepharose HP (GE, USA), equilibrated with 25mM TrisCl, pH 7.0. After the application of the sample, the column was washed with three volumes of the same solution and then gene therapy DNA vector VTvafl7-BMP-2 was eluted using a linear gradient of 25mM TrisCl, pH 7.0, to obtain a solution of 25mM TrisCl, pH 7.0, 1M NaCl, five times the volume of the column. The elution process was controlled by measuring optical density of the run-off solution at 260nm. Chromatographic fractions containing gene therapy DNA vector VTvafl7-BMP-2 were joined together and subjected to gel filtration using Superdex 200 (GE, USA). The column was equilibrated with phosphate buffered saline. The elution process was controlled by measuring optical density of the run-off solution at 260nm, and the fractions were analysed by agarose gel electrophoresis. The fractions containing gene therapy DNA vector VTvafl7-BMP-2 were joined together and stored at -20°C. To assess the process reproducibility, the indicated processing operations were repeated five times. All processing operations for Escherichia coli strain SCSI 10- AF/VTvafl 7-BMP-7, or Escherichia coli strain SCS 110-AF/VTvafl 7-LMP- 1 , or Escherichia coli strain SCSI 10-AF/VTvafl7-NELL-l were performed in a similar way.

The process reproducibility and quantitative characteristics of final product yield confirm the producibility and constructability of gene therapy DNA vector VTvafl 7- BMP-2, or VTvafl 7-BMP-7, or VTvafl 7-LMP- 1, or VTvafl 7-NELL- 1 on an industrial scale.

Thus, the produced gene therapy DNA vector containing the therapeutic gene can be used to deliver it to the cells of human beings and animals that experience reduced or insufficient expression of protein encoded by this gene, thus ensuring the desired therapeutic effect.

The purpose set in this invention, namely the construction of the gene therapy DNA vectors in order to increase the expression level of BMP-2, BMP-7, LMP-1, and NELL-1 genes that combine the following properties:

I) The effectiveness of upregulation of therapeutic genes in eukaryotic cells due to the obtained gene therapy vectors with a minimum length,

II) Possibility of safe use in gene therapy of human beings and animals due to the absence of regulatory elements representing the nucleotide sequences of viral genomes and antibiotic resistance genes in the gene therapy DNA vector,

III) Producibility and constructability in the strains on an industrial scale, IV) as well as the purpose of the construction of strains carrying these gene therapy DNA vectors for the production of these gene therapy DNA vectors is achieved, which is supported by the following examples:

for Item I - Example 1, 2, 3, 4, 5; 6; 7; 8; 9; 10; 1 1; 12; 13; 14; 15; 16; 17; 18 for Item II - Example 1 , 2, 3, 4 for Item III and Item IV - Example 19, 20.

Industrial Applicability

All the examples listed above confirm the industrial applicability of the proposed gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the therapeutic gene selected from the group of BMP-2, BMP-7, LMP-1, and NELL-1 genes in order to increase the expression level of these therapeutic genes, method of its production and use, Escherichia coli strain SCSI 10-AF/VTvafl7-BMP-2, or Escherichia coli strain SCS110-AF/VTvafl7-BMP-7, or Escherichia coli strain SCSI 10-AF/VTvafl7-LMP-l, or Escherichia coli strain SCS 1 10-AF/VTvaf 17-NELL- 1 carrying gene therapy DNA vector, and method of its production on an industrial scale.

List of Abbreviations

VTvafl7 - Gene therapy vector devoid of sequences of viral genomes and antibiotic resistance markers (vector therapeutic virus-antibiotic-ffee)

DNA - Deoxyribonucleic acid cDNA - Complementary deoxyribonucleic acid

RNA - Ribonucleic acid mRNA - Messenger ribonucleic acid bp - base pair

PCR - Polymerase chain reaction ml - millilitre, mΐ - microlitre mm3 - cubic millimetre 1 - litre pg - microgram mg - milligram g - gram mM - micromol mM - millimol min - minute s - second rpm - rotations per minute nm - nanometre cm - centimetre mW - milliwatt

RFU - Relative fluorescence unit PBS - Phosphate buffered saline