The present invention relates to a method for preparing trophectoderm-like cells comprising culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells in a medium comprising a glycogen synthase kinase 3 (GSK-3) inhibitor.

In this specification, a number of documents including patent applications and manufacturer’s manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

The dividing zygote gives rise to a self-organizing entity of early embryonic and extraembryonic tissues that form the blastocyst. In mice, by embryonic day four and a half (E4.5), the blastocyst consists of an epithelial layer of trophectoderm (TE) cells and an inner cell mass (ICM) positioned on one side of a fluid-filled cavity. The ICM contains pluripotent epiblast cells, which later give rise to all tissues of the foetus, and a surface layer of primitive endoderm (PE) cells, which will form the yolk sac.

Although the first TE cells are specified during the transition from the 8-cell to the 16-cell stage, their fate is not restricted exclusively to the trophoblast lineage until the 32-cell to the 64-cell stage. These cells can divide asymmetrically and give rise to ICM cells, thus exhibiting developmental flexibility within a limited time frame before implantation ¹ · ² . Structurally, the TE defines the hollow-shaped architecture of the blastocyst and is subdivided into two compartments: the mural TE, which surrounds the blastocoel cavity, and the polar TE, in direct contact with the ICM. The mural TE mediates the process of implantation by differentiating into invasive trophoblast cells that penetrate the uterine wall. In contrast, the polar TE maintains its sternness and forms the extraembryonic ectoderm (ExE) of the nascent egg cylinder. The ExE is a pool of multipotent trophoblast stem cells that later gives rise to the placental tissues supporting the foetal development to term ³ . Several stem cell lines have been established from the embryonic and the extraembryonic lineages of blastocyst and egg cylinder stage embryos. For instance, embryonic stem cells (ESC) and epiblast stem cells (EpiSC) capture features of the pre-implantation (naive) and the post-implantation (primed) epiblast, respectively ⁴ . Similarly, stem cell lines have also been derived from the trophoblast lineage of pre-implantation (E3.5) and post-implantation (E6.5) embryos. However, in contrast to ESC and EpiSC, which represent distinct pluripotent states and require different signalling cues for their self-renewal, both E3.5 and E6.5 trophoblast stem cells (TSC) are established using an identical Fgf4/Heparin-supplemented medium ⁵ . As a result of the culture environment, the TSC express post-implantation markers such as Sox2 and Elf5 regardless of the embryonic stage of origin and, overall, resemble the multipotent stem cell pool of the ExE ⁶ . Thus, the conventional TSC capture and represent an ExE-like state but not a pre-implantation TE-like state.

The present invention aims at closing the gap of knowledge on the pre-implantation TE-like state by providing trophectoderm-like cells and methods for their production, noting that these cells embody key features of the pre-implantation trophoblast.

Accordingly, the present invention relates in a first aspect to a method for preparing trophectoderm-like cells comprising culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells in a medium comprising a glycogen synthase kinase 3 (GSK-3) inhibitor.

The “trophectoderm cells” are the first cell type that emerges during development and plays pivotal roles in the viviparous mode of reproduction in placental mammals. TE cells adopt typical epithelium morphology to surround a fluid-filled cavity, whose expansion is critical for hatching and efficient interaction with the uterine endometrium for implantation. TE cells, thus, in vivo self-organize into a polarized transporting single cell-layer that forms the outer wall of the blastocyst. The blastocyst is a structure formed in the early development of mammals. It possesses an inner cell mass (ICM) which consists of epiblast cells that later give rise to the foetus, and primitive endoderm (PE) cells, which will form the yolk sac . The outer layer of the blastocyst consists of the TE cells. The layer of TE cells surrounds the inner cell mass and a fluid-filled cavity known as the blastocoel. TE cells also differentiates into trophoblast cells to construct the placenta (Marikawa and Alarcon (2013), Results Probl Cell Differ.; 55: 165-184).

The term “trophectoderm-like cells” (also called herein TE-like cells or XTE-cells) as used herein refers to cells which functionally and structurally resemble trophectoderm cells but are not identical to trophectoderm cells. In particular, trophectoderm-like cells are characterized by the capability to self-organize into a vesicle resembling the outer cell-layer or cell wall of the blastocyst. They are also characterized by a unique gene expression profile that will be discussed herein below. In this regard it noted that a term “vesicle” as used herein is not a lipid bilayer fluid enclosing a fluid but a layer of the trophectoderm-like cells of the invention. Hence, the term “vesicle” as used herein designates an outer cell-layer or cell wall of the trophectoderm-like cells of the invention which encloses a fluid and may also enclose other material, such as cells. The vesicle of the invention may, thus, also be referred to as multicellular vesicle. As will be discussed in more detail herein below, the vesicles are capable of efficiently cavitating and incorporating pluripotent cells. In this case the vesciles then resemble hol!owed-shaped, blastocyst-like etnbryoids, noting that the pluripotent cells in this case resemble the inner cell mass of the blastocyst.

As is evident from the appended examples the trophectoderm-like cells of the invention can be obtained from a (i) blastocyst, (ii) extraembryonic endoderm stem (XEN) cells and/or (iii) XEN-like cells as starting material.

The blastocyst is preferably obtained by a method which does not require the destruction on a human embryo. As discussed, a blastocyst is formed in the early development of mammals and in composed of an inner cell mass (ICM) and an outer layer of TE cells.

The inner cell mass comprises two lineages: The epiblast (Epi) and the primitive endoderm (PrE). Representative stem cells derived from these two cell lineages can be expanded and maintained indefinitely in vitro as either embryonic stem (ES) or extraembryonic endoderm stem (XEN) cells. Protocols that can be used to establish XEN cell lines are established in the art (e.g. Niakan et al. (2018), Nature Protocols volume 8, pagesl 028-1041 and Lin eat al. (2016), Scientific Reports, Volume 6, Article number: 39457). Also methods for culturing and expanding XEN cells are known in the art. XEN cells are used in the art for the investigation of signaling pathways of cells of the extraembryonic endoderm lineages, and as an in vitro model to identify patterning activities of the extraembryonic endoderm.

The term “XEN-like cells” as used herein refers to cells that were differentiated from progenitor cells, such as embryonic-stem cells (ESCs), induced pluripotent stem cells (iPSCs), fibroblasts and pluripotent cells into cells which functionally and structurally resemble XEN cells but are not identical to XEN cells. Protocols for establishing XEN-like cells from ESCs are known in the art and will be further detailed herein below. Protocol for obtaining XEN-like cells from iPSCs (and for obtaing the iPSC from fibroblasts) are described, for example, in Parenti et al. (2016), Stem Cell Reports, 6(4):447-455 and Zhao et al. 2015, 163(7): 1678-91. A method for the chmical induction of XEN-like cells from fibroblasts is disclosed in Li et al. (2017), 21(2):264-273.e7. Means for establishing XEN-like cells from pluripotent cells are described in Linneberg-Agerholm et al. (2019), Development, 146(24):dev180620. The XEN-like cells as used in the appended examples were obtained from ESCs as will be discussed in more detail herein below.

Glycogen synthase kinase 3 (GSK-3) is a serine/threonine protein kinase that mediates the addition of phosphate molecules onto serine and threonine amino acid residues. GSK-3 is a kinase for over 100 different target proteins in a variety of different cellular pathways. In mammals GSK-3 is encoded by two paralogous genes, GSK-3 alpha (GSK-3a) and GSK-3 beta (GSK-3 ). GSK-3 has been implicated in a number of diseases, including but not limited to Type II diabetes, Alzheimer's disease, inflammation, cancer, and bipolar disorder.

A medium as used herein is a cell culture medium. Means and method for culturing cells as well as the basic ingredients of a cell culture medium for culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells are known in the art (i.e. a medium for culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN- like cells are known in the art with the exception of the XTE cells transformation factors as discussed herein). In general terms a “medium” as used herein is a liquid or gel designed to support the growth of the cells or cellular material cultured therein. Cell culture media generally comprise an appropriate source of energy and compounds which regulate the cell cycle.

An inhibitor of GSK-3 may be a compound that is capable to interfere with the serine/threonine protein kinase activity of GSK-3. Preferably, the the serine/threonine protein kinase activity of GSK-3 is reduced in the presence of the inhibitor by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98% and most preferred by about 100% (e.g., as compared to the same experimental set up in the absence of the compound). Various kinds of GSK-3 inhibitors are known from the prior art.

Non-limiting examples of GSK-3 inhibitors are:

(i) Metal cations, such as beryllium, copper, lithium (IC50=2mM), mercury and tungsten (Indirect).

(ii) Marine organism-derived inhibitors, such as 6-BIO (IC50=1.5pM), Dibromocantharelline (IC50=3pM), Hymenialdesine (IC50=10nM), Indirubin (IC50=5- 50nM), Meridianin, Manzamine A (IC50=1.5pM), Palinurine (IC50=4.5pM) and Tricantine (IC50=7.5pM).

(iii) Aminopyrimidines, such as CHIR99021 , CT98014, CT98023, CT99021 and TWS119.

(iv) Arylindolemaleimide, such as SB-216763 (IC50=34nM) and SB-41528 (IC50=77nM). (v) Thiazoles, such as AR-A014418 (IC50=104nM) and AZD-1080

(vi) Paullones (IC50=4-80nM), such as Alsterpaullone, Cazpaullone and Kenpaullone

(vii) Aloisines (IC50=0.5-1.5pM).

(viii) Thiazolidinediones, such as TDZD-8 (IC50=2pM), NP00111 (IC50=2pM), NP031115 (IC50=4pM) and Tideglusi. (ix) Halomethylketones, such as HMK-32 (IC50=1.5pM).

(x) Peptides, such as L803-mts (IC50=20pM) and L807-mts (IC50=1 mM).

The above GSK-3 inhibitors are commercially available from sources being summarized in the following table:

GSK3 Inhibitors commercial sources:

The GSK-3 inhibitor may also be an antibody or antibody mimetic or an aptamer against GSK-3. The antibody mimetic is preferably selected from affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides, Fynomers®, trispecific binding molecules and probodies. The term “antibody” as used in accordance with the present invention comprises, for example, polyclonal or monoclonal antibodies. Furthermore, also derivatives or fragments thereof, which still retain the binding specificity to the target, i.e. GSK-3, are comprised in the term "antibody". Antibody fragments or derivatives comprise, inter alia, Fab or Fab’ fragments, Fd, F(ab')2, Fv or scFv fragments, single domain VH or V-like domains, such as VhH or V-NAR-domains, as well as multimeric formats such as minibodies, diabodies, tribodies or triplebodies, tetrabodies or chemically conjugated Fab’-multimers (see, for example, Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane “Using Antibodies: A Laboratory Manual” Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol. 75(13), 1584; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23(9), 1126). The multimeric formats in particular comprise bispecific antibodies that can simultaneously bind to two different types of antigen. Non-limting examples of bispecific antibodies formats are Biclonics (bispecific, full length human IgG antibodies), DART (Dualaffinity Re-targeting Antibody) and BiTE (consisting of two single-chain variable fragments (scFvs) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7):838-847).

The term "antibody" also includes embodiments such as chimeric (human constant domain, non-human variable domain), single chain and humanised (human antibody with the exception of non-human CDRs) antibodies.

Various techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane (1988) and (1999) and Altshuler et al., 2010, loc. cit. Thus, polyclonal antibodies can be obtained from the blood of an animal following immunisation with an antigen in mixture with additives and adjuvants and monoclonal antibodies can be produced by any technique which provides antibodies produced by continuous cell line cultures. Examples for such techniques are described, e.g. in Harlow E and Lane D, Cold Spring Harbor Laboratory Press, 1988; Harlow E and Lane D, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999 and include the hybridoma technique originally described by Kdhler and Milstein, 1975, the trioma technique, the human B-cell hybridoma technique (see e.g. Kozbor D, 1983, Immunology Today, vol.4, 7; Li J, et al. 2006, PNAS, vol. 103(10), 3557) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, Alan R. Liss, Inc, 77-96). Furthermore, recombinant antibodies may be obtained from monoclonal antibodies or can be prepared de novo using various display methods such as phage, ribosomal, mRNA, or cell display. A suitable system for the expression of the recombinant (humanised) antibodies may be selected from, for example, bacteria, yeast, insects, mammalian cell lines or transgenic animals or plants (see, e.g., US patent 6,080,560; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23(9), 11265). Further, techniques described for the production of single chain antibodies (see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies specific for an epitope of GSK-3. Surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies.

As used herein, the term “antibody mimetics” refers to compounds which, like antibodies, can specifically bind antigens, such as GSK-3 in the present case, but which are not structurally related to antibodies. Antibody mimetics are usually artificial peptides or proteins with a molar mass of about 3 to 20 kDa. For example, an antibody mimetic may be selected from the group consisting of affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides, Fynomers®, trispecific binding molecules and prododies. These polypeptides are well known in the art and are described in further detail herein below.

The term “affibody”, as used herein, refers to a family of antibody mimetics which is derived from the Z-domain of staphylococcal protein A. Structurally, affibody molecules are based on a three-helix bundle domain which can also be incorporated into fusion proteins. In itself, an affibody has a molecular mass of around 6kDa and is stable at high temperatures and under acidic or alkaline conditions. Target specificity is obtained by randomisation of 13 amino acids located in two alpha-helices involved in the binding activity of the parent protein domain (Feldwisch J, Tolmachev V.; (2012) Methods Mol Biol. 899:103-26).

The term "adnectin" (also referred to as “monobody”), as used herein, relates to a molecule based on the 10th extracellular domain of human fibronectin III (10Fn3), which adopts an Ig- like b-sandwich fold of 94 residues with 2 to 3 exposed loops, but lacks the central disulphide bridge (Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255). Adnectins with the desired target specificity, i.e. against GSK-3, can be genetically engineered by introducing modifications in specific loops of the protein.

The term "anticalin", as used herein, refers to an engineered protein derived from a lipocalin (Beste G, Schmidt FS, Stibora T, Skerra A. (1999) Proc Natl Acad Sci U S A. 96(5):1898- 903; Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255). Anticalins possess an eight-stranded b-barrel which forms a highly conserved core unit among the lipocalins and naturally forms binding sites for ligands by means of four structurally variable loops at the open end. Anticalins, although not homologous to the IgG superfamily, show features that so far have been considered typical for the binding sites of antibodies: (i) high structural plasticity as a consequence of sequence variation and (ii) elevated conformational flexibility, allowing induced fit to targets with differing shape.

As used herein, the term "DARPin" refers to a designed ankyrin repeat domain (166 residues), which provides a rigid interface arising from typically three repeated b-turns. DARPins usually carry three repeats corresponding to an artificial consensus sequence, wherein six positions per repeat are randomised. Consequently, DARPins lack structural flexibility (Gebauer and Skerra, 2009).

The term “avimer”, as used herein, refers to a class of antibody mimetics which consist of two or more peptide sequences of 30 to 35 amino acids each, which are derived from A- domains of various membrane receptors and which are connected by linker peptides. Binding of target molecules occurs via the A-domain and domains with the desired binding specificity, i.e. for GSK-3, can be selected, for example, by phage display techniques. The binding specificity of the different A-domains contained in an avimer may, but does not have to be identical (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4): 155-68).

A “nanofitin” (also known as affitin) is an antibody mimetic protein that is derived from the DNA binding protein Sac7d of Sulfolobus acidocaldarius. Nanofitins usually have a molecular weight of around 7kDa and are designed to specifically bind a target molecule, in the present case GSK-3, by randomising the amino acids on the binding surface (Mouratou B, Behar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31).

The term “affilin”, as used herein, refers to antibody mimetics that are developed by using either gamma-B crystalline or ubiquitin as a scaffold and modifying amino-acids on the surface of these proteins by random mutagenesis. Selection of affilins with the desired target specificity, i.e. against GSK-3, is effected, for example, by phage display or ribosome display techniques. Depending on the scaffold, affilins have a molecular weight of approximately 10 or 20kDa. As used herein, the term affilin also refers to di- or multimerised forms of affilins (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4): 155-68).

A “Kunitz domain peptide” is derived from the Kunitz domain of a Kunitz-type protease inhibitor such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP) or tissue factor pathway inhibitor (TFPI). Kunitz domains have a molecular weight of approximately 6kDA and domains with the required target specificity, i.e. against GSK-3, can be selected by display techniques such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10(4): 155-68).

As used herein, the term "Fynomer®" refers to a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain. Fyn SH3-derived polypeptides are well-known in the art and have been described e.g. in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008/022759, Bertschinger et al (2007) Protein Eng Des Sel 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12).

The term “trispecific binding molecule” as used herein refers to a polypeptide molecule that possesses three binding domains and is thus capable of binding, preferably specifically binding to three different epitopes. At least one of these three epitopes is an epitope of the protein of the fourth aspect of the invention. The two other epitopes may also be epitopes of the protein of the fourth aspect of the invention or may be epitopes of one or two different antigens. The trispecific binding molecule is preferably a TriTac. A TriTac is a T-cell engager for solid tumors which comprised of three binding domains being designed to have an extended serum half-life and be about one-third the size of a monoclonal antibody.

As used herein, the term "probody" refers to a protease-activatable antibody prodrug. A probody consists of an authentic IgG heavy chain and a modified light chain. A masking peptide is fused to the light chain through a peptide linker that is cleavable by tumor-specific proteases. The masking peptide prevents the probody binding to healthy tissues, thereby minimizing toxic side effects.

Aptamers are nucleic acid molecules or peptide molecules that bind a specific target molecule. Aptamers are usually created by selecting them from a large random sequence pool, but natural aptamers also exist in riboswitches. Aptamers can be used for both basic research and clinical purposes as macromolecular drugs. Aptamers can be combined with ribozymes to self-cleave in the presence of their target molecule. These compound molecules have additional research, industrial and clinical applications (Osborne et. al. (1997), Current Opinion in Chemical Biology, 1 :5-9; Stull & Szoka (1995), Pharmaceutical Research, 12, 4:465-483).

Nucleic acid aptamers are nucleic acid species that normally consist of (usually short) strands of oligonucleotides. Typically, they have been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms.

Peptide aptamers are usually peptides or proteins that are designed to interfere with other protein interactions inside cells. They consist of a variable peptide loop attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range). The variable peptide loop typically comprises 10 to 20 amino acids, and the scaffold may be any protein having good solubility properties. Currently, the bacterial protein Thioredoxin-A is the most commonly used scaffold protein.

Aptamers offer the utility for biotechnological and therapeutic applications as they offer molecular recognition properties that rival those of the commonly used biomolecules, in particular antibodies. In addition to their discriminatory recognition, aptamers offer advantages over antibodies as they can be engineered completely in a test tube, are readily produced by chemical synthesis, possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications. Non-modified aptamers are cleared rapidly from the bloodstream, with a half-life of minutes to hours, mainly due to nuclease degradation and clearance from the body by the kidneys, a result of the aptamers' inherently low molecular weight. Unmodified aptamer applications currently focus on treating transient conditions such as blood clotting, or treating organs such as the eye where local delivery is possible. This rapid clearance can be an advantage in applications such as in vivo diagnostic imaging. Several modifications, such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) linkage, fusion to albumin or other half life extending proteins etc. are available to scientists such that the half-life of aptamers can be increased for several days or even weeks.

With the exception of aptamers the above examples of inhibitors solely act on the GSK-3 protein, i.e. the Ser/Thr kinase. It is also possible to inhibit the production of GSK-3 by interfering with the transcription and/or translation of GSK-3. Preferably, the transcription of the nucleic acid molecule and/or the protein of the invention or the translation of the protein of the invention is reduced by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98% and most preferred by about 100% (e.g., as compared to the same experimental set up in the absence of the compound).

The efficiency of inhibition of an inhibitor can be quantified by methods comparing the level of activity in the presence of the inhibitor to that in the absence of the inhibitor. For example, the change in the amount of the nucleic acid molecule and/or the protein of GSK-3 formed may be used in the measurement. The efficiency of several inhibitors may be determined simultaneously in high-throughput formats. High-throughput assays, independently of being biochemical, cellular or other assays, generally may be performed in wells of microtiter plates, wherein each plate may contain 96, 384 or 1536 wells. Handling of the plates, including incubation at temperatures other than ambient temperature, and bringing into contact of test compounds with the assay mixture is preferably effected by one or more computer-controlled robotic systems including pipetting devices. In case large libraries of test compounds are to be screened and/or screening is to be effected within a short time, mixtures of, for example 10, 20, 30, 40, 50 or 100 test compounds may be added to each well. In case a well exhibits the expected activity, said mixture of test compounds may be deconvolved to identify the one or more test compounds in said mixture giving rise to said activity.

Preferred examples of GSK-3 inhibitors interfering with the transcription and/or translation of GSK-3 are an aptamer (as described above), a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas-based construct (e.g. a CRISPR-Cas9- based construct or a CRISPR-Cpfl -based construct), a meganuclease, a zinc finger nuclease, and a transcription activator-like (TAL) effector (TALE) nuclease.

In accordance with the present invention, the term "small interfering RNA (siRNA)", also known as short interfering RNA or silencing RNA, refers to a class of 18 to 30, preferably 19 to 25, most preferred 21 to 23 or even more preferably 21 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome. siRNAs naturally found in nature have a well defined structure: a short double-strand of RNA (dsRNA) with 2-nt 3' overhangs on either end. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. siRNAs can also be exogenously (artificially) introduced into cells to bring about the specific knockdown of a gene of interest. Essentially any gene for which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA. The double- stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation. Exogenously introduced siRNAs may be devoid of overhangs at their 3' and 5' ends, however, it is preferred that at least one RNA strand has a 5'- and/or 3'-overhang Preferably, one end of the double-strand has a 3'-overhang from 1 to 5 nucleotides, more preferably from 1 to 3 nucleotides and most preferably 2 nucleotides. The other end may be blunt-ended or has up to 6 nucleotides 3'-overhang. In general, any RNA molecule suitable to act as siRNA is envisioned in the present invention. The most efficient silencing was so far obtained with siRNA duplexes composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3'- overhang. The sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair (Elbashir et al. 2001). 2'-deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant. Delivery of siRNA may be accomplished using any of the methods known in the art, for example by combining the siRNA with saline and administering the combination intravenously or intranasally or by formulating siRNA in glucose (such as for example 5% glucose) or cationic lipids and polymers can be used for siRNA delivery in vivo through systemic routes either intravenously (IV) or intraperitoneally (IP) (Fougerolles et al. (2008), Current Opinion in Pharmacology, 8:280-285; Lu et al. (2008), Methods in Molecular Biology, vol. 437: Drug Delivery Systems - Chapter 3: Delivering Small Interfering RNA for Novel Therapeutics).

A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it. si/shRNAs to be used in the present invention are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNAs or shRNAs are obtained from commercial RNA oligo synthesis suppliers, which sell RNA-synthesis products of different quality and costs. In general, the RNAs applicable in the present invention are conventionally synthesized and are readily provided in a quality suitable for RNAi.

Further molecules effecting RNAi include, for example, microRNAs (miRNA). Said RNA species are single-stranded RNA molecules. Endogenously present miRNA molecules regulate gene expression by binding to a complementary mRNA transcript and triggering of the degradation of said mRNA transcript through a process similar to RNA interference. Accordingly, exogenous miRNA may be employed as an inhibitor of GSK-3 after introduction into the respective cells.

A ribozyme (from ribonucleic acid enzyme, also called RNA enzyme or catalytic RNA) is an RNA molecule that catalyses a chemical reaction. Many natural ribozymes catalyse either their own cleavage or the cleavage of other RNAs, but they have also been found to catalyse the aminotransferase activity of the ribosome. Non-limiting examples of well-characterised small self-cleaving RNAs are the hammerhead, hairpin, hepatitis delta virus, and in vitro- selected lead-dependent ribozymes, whereas the group I intron is an example for larger ribozymes. The principle of catalytic self-cleavage has become well established. The hammerhead ribozymes are characterised best among the RNA molecules with ribozyme activity. Since it was shown that hammerhead structures can be integrated into heterologous RNA sequences and that ribozyme activity can thereby be transferred to these molecules, it appears that catalytic antisense sequences for almost any target sequence can be created, provided the target sequence contains a potential matching cleavage site. The basic principle of constructing hammerhead ribozymes is as follows: A region of interest of the RNA, which contains the GUC (or CUC) triplet, is selected. Two oligonucleotide strands, each usually with 6 to 8 nucleotides, are taken and the catalytic hammerhead sequence is inserted between them. The best results are usually obtained with short ribozymes and target sequences.

A more recent development, also useful in accordance with the present invention, is the combination of an aptamer, recognizing a small compound, with a hammerhead ribozyme. The conformational change induced in the aptamer upon binding the target molecule can regulate the catalytic function of the ribozyme.

The term “antisense nucleic acid molecule”, as used herein, refers to a nucleic acid which is complementary to a target nucleic acid. An antisense molecule in accordance with the invention is capable of interacting with the target nucleic acid, more specifically it is capable of hybridizing with the target nucleic acid. Due to the formation of the hybrid, transcription of the target gene(s) and/or translation of the target mRNA is reduced or blocked. Standard methods relating to antisense technology have been described (see, e.g., Melani et al., Cancer Res. (1991 ) 51 :2897-2901 ).

CRISPR/Cas technologies are applicable in nearly all cells/model organisms and can be used for knock out mutations, chromosomal deletions, editing of DNA sequences and regulation of gene expression. The regulation of the gene expression can be manipulated by the use of a catalytically dead Cas9 enzyme (dCas9) that is conjugated with a transcriptional repressor to repress transcription a specific gene, here the GSK-3 gene. Similarly, catalytically inactive, "dead" Cpf1 nuclease (CRISPR from Prevotella and Francisella-1 ) can be fused to synthetic transcriptional repressors or activators to downregulate endogenous promoters, e.g. the promoter which controls GSK-3 expression. Alternatively, the DNA- binding domain of zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can be designed to specifically recognize the GSK-3 gene or its promoter region or its 5 ^' -UTR thereby inhibiting the expression of the GSK-3 gene.

Inhibitors provided as inhibiting nucleic acid molecules that target the GSK-3 gene or a regulatory molecule involved in GSK-3 expression are also envisaged herein. Such molecules, which reduce or abolish the expression of GSK-3 or a regulatory molecule include, without being limiting, meganucleases, zinc finger nucleases and transcription activator-like (TAL) effector (TALE) nucleases. Such methods are described in Silva et al., Curr Gene Ther. 2011;11(1 ):11-27; Miller et al., Nature biotechnology. 2011;29(2): 143-148, and Klug, Annual review of biochemistry. 2010; 79:213-231.

As can be taken from the appended examples, it has been surprisingly found that a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells these starting cells can be transformed into a novel cell-type which is called herein “trophectoderm-like cells” (also called herein TE-like cells or XTE cells). Unexpectedly, it was found that these cells emerge from cells in extraembryonic endoderm-state (XEN-state) that acquire TE properties following the principles of the first lineage segregation in vivo. Mimicking the structure and function of the TE during morula to blastocyst transition, these cells efficiently cavitate and incorporate stem cells to assemble hollowed-shaped, blastocyst-like embryoids. As can be taken from Figure 1C (see “CH” which is the GSK-3 inhibitor CHIR 99021) the starting cells can be transformed into trophectoderm-like cells by already one exogenous factor, namely a GSK-3 inhibitor. As will be discussed in greater detail herein below further factors increase the transformation efficiency but it is emphasized that already only a GSK-3 inhibitor is sufficient in order obtain trophectoderm-like cells.

In the prior art, for example, in Harris et al. (2013), Reproduction, Fertility and Development, 25(1 ): 192 bovine blastocysts were contacted with inhibitors or mitogen-activated protein kinase kinase (MAPKK) and GSK3 which resulted in epiblast-specific expression of pluripotency markers. Hence, in case MAPKK and GSK3 are inhibited in blastocysts no “trophectoderm-like cells” in accordance with the present invention are obtained but instead pluripotency gene expression is promoted. It is also known from Czechanski et al (2014). Nature Protocols. 9(3):559-574, Nichols and Jones (2017), Cold Spring Harb Protoc. 379- 386 as well as Ying et al. (2008). Nature, 453:519-524 that the inhibition of the MAP kinase pathway and GSK3 in blastocysts promotes the pluripotent ground state and derivation of pluripotent embryonic stem cells, therefore the combination of these compounds does not result in the establishment of “trophectoderm-like cells” in accordance with the present invention.

In accordance with a preferred embodiment of the first aspect of the invention the GSK-3 inhibitor is a small molecule, preferably a heterocyclic small molecule, more preferably a small molecule comprising an pyrrole, imidazol, pyridine or pyrimidine ring and is most preferably selected from the group consisting of CHIR 99021, CHIR 99021 trihydrochloride, TWS 119, TCS 2002, BlO-acetoxime, Kenpaullone, lndirubin-3’-oxime, SB 216763, SB 415286, NSC 693868, NSC 693868, TC-G 24, 3F8, BIO, TDZD 8, CHIR 98014, MeBIO, lithium carbonate, TCS 21311 , A 1070722 and Alsterpaullone.

The "small molecule" as used herein is preferably an organic molecule. Organic molecules relate or belong to the class of chemical compounds having a carbon basis, the carbon atoms linked together by carbon-carbon bonds. The original definition of the term organic related to the source of chemical compounds, with organic compounds being those carbon- containing compounds obtained from plant or animal or microbial sources, whereas inorganic compounds were obtained from mineral sources. Organic compounds can be natural or synthetic.

The organic molecule is preferably an aromatic molecule and more preferably a heterocyclic small molecule, in particular a heteroaromatic molecule. In organic chemistry, the term aromaticity is used to describe a cyclic (ring-shaped), planar (flat) molecule with a ring of resonance bonds that exhibits more stability than other geometric or connective arrangements with the same set of atoms. Aromatic molecules are very stable, and do not break apart easily to react with other substances. In a heteroaromatic molecule at least one of the atoms in the aromatic ring is an atom other than carbon, e.g. N, S, or O. For all above- described organic molecules the molecular weight is preferably in the range of 200 Da to 2000 Da, more preferably in the range of 300 Da to 1000 Da.

As discussed the small molecule is preferably a small molecule comprising a pyrrole, imidazol, pyridine or pyrimidine ring. Pyrrole is a heterocyclic aromatic organic compound, a five-membered ring with the formula C4H4NH. Imidazol is an organic compound with the formula C3N2H4. Pyridine is a basic heterocyclic organic compound with the chemical formula C5H5N. Pyrimidine is an aromatic heterocyclic organic compound similar to pyridine. One of the three diazines (six-membered heterocyclics with two nitrogen atoms in the ring) has the nitrogen atoms at positions 1 and 3 in the ring. Among the options a small molecule comprising pyridine or pyrimidine ring is preferred and a small molecule comprising a pyrimidine ring is particularly preferred, noting that CHIR 99021 as used in the examples is a pyrimidine, in more detail an aminopyrimidine.

CHIR 99021 is 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl) pyrimidin-2- yl)amino)ethyl)amino)nicotinonitrile (CAS 252917-06-9). TWS 119 is 3-[[6-(3-Aminophenyl)- 7H-pyrrolo[2,3-d]pyrimidin-4-yl]oxyphenol ditrifluoroacetate. TCS 2002 is 2-Methyl-5-[3-[4- (methylsulfinyl)phenyl]-5-benzofuranyl]-1,3,4-oxadiazole. BlO-acetoxime is (2'Z,3’E)-6- Bromoindirubin-3'-acetoxime.Kenpaullone is 9-Bromo-7,12-dihydro-indolo[3,2- c(][1]benzazepin-6(5H)-one. lndirubin-3'-oxime is 3-[1,3-Dihydro-3-(hydroxyimino)-2/-/-indol-2- ylidene]-1,3-dihydro-2H-indol-2-one. SB 216763 is 3-(2,4-DichlorophenyI)-4-(1 -methyl-1 H- indol-3-yl)-1H-pyrrole-2,5-dione. SB 415286 is 3-[(3-Chloro-4-hydroxyphenyl)amino]-4-(2- nitrophenyl)-1H-pyrrole-2,5-dione. NSC 693868 is 1H-Pyrazolo[3,4-b]quinoxalin-3-amine. TC-G 24 is N-(3-Chloro-4-methylphenyl)-5-(4-nitrophenyl)-1,3,4-oxadiazo l-2-amine. 3F8 is 5- Ethyl-7,8-dimethoxy-1H-pyrrolo[3,4-c]isoquinoline-1,3(2H)-di one. BIO is 6-bromoindirubin-3- oxime.TDZD 8 2-Methyl-4-(phenylmethyl)-1,2,4-thiadiazolidine-3,5-dione. CHIR 98014 is N6-[2-[[4-(2,4-Dichlorophenyl)-5-(1H-imidazol-1-yl)-2-pyrimi dinyl]amino]ethyl]-3-nitro-2,6- pyridinediamine. MeBIO is (2'Z,3'E)-6-Bromo-1-methylindirubin-3'-oxime. TCS 21311 is 3-[5- [4-(2-Hydroxy-2-methyl-1-oxopropyl)-1-piperazinyl]-2-(triflu oromethyl)phenyl]-4-(1H-indol-3- yl)-1H-pyrrole-2,5-dione. A 1070722 is 1-(7-Methoxyquinolin-4-yl)-3-[6- (trifluoromethyl)pyridin-2-yl]urea. Alsterpaullone is 7,12-Dihydro-9-nitroindolo[3,2- d][1]benzazepin-6(5H)-one.

Alternatively, the "small molecule" in accordance with the present invention may be an inorganic compound, such as lithium carbonate. Inorganic compounds are derived from mineral sources and include all compounds without carbon atoms (except carbon dioxide, carbon monoxide and carbonates). Preferably, the small molecule has a molecular weight of less than about 2000 Da, or less than about 1000 Da such as less than about 500 Da, and even more preferably less than about Da amu. The size of a small molecule can be determined by methods well-known in the art, e.g., mass spectrometry. The small molecules may be designed, for example, based on the crystal structure of the target molecule, where sites presumably responsible for the biological activity can be identified and verified in in vivo assays such as in vivo high-throughput screening (HTS) assays. In accordance with a preferred embodiment of the first aspect of the invention the medium further comprises a bone morphogenetic protein (Bmp), preferably bone morphogenetic protein 4 (Bmp 4) or a nucleic acid molecule expressing a Bmp, preferably Bmp 4.

In accordance with a further preferred embodiment of the first aspect of the invention the medium further comprises a fibroblast growth factor (Fgf), preferably fibroblast growth factor 4 (Fgf 4) or a nucleic acid molecule expressing a Fgf, preferably Fgf 4.

In accordance with a yet further preferred embodiment of the first aspect of the invention the medium further comprises heparin and/or activin.

As discussed above, a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN- like cells can be transformed into trophectoderm-like cells by a GSK-3 inhibitor. As can be taken from Figure 1C, the efficiency of the transformation can be increased by using a GSK- 3 inhibitor and Bmp 4. This transformation efficiency can be further increased by using a GSK-3 inhibitor, Bmp 4, and Fgf 4 or Heparin. Finally, the best results were obtained by using a GSK-3 inhibitor, Bmp 4, Fgf 4/Heparin and Activin.

Bone morphogenetic proteins (BMP) are a group of growth factors also known as cytokines and as metabologens. Originally discovered by their ability to induce the formation of bone and cartilage, BMPs are now considered to constitute a group of pivotal morphogenetic signals, orchestrating tissue architecture throughout the body. Bone morphogenetic protein 4 (Bmp 4) is a protein that in humans is encoded by BMP4 gene. BMP4 is a member of the bone morphogenetic protein family which is part of the transforming growth factor-beta superfamily. The superfamily includes large families of growth and differentiation factors. BMP4 is highly conserved evolutionarily. BMP4 is found in early embryonic development in the ventral marginal zone and in the eye, heart blood and otic vesicle. The sequence of human Bmp4 can be retrieved from the gene bank entry ENSG00000125378.

The fibroblast growth factors (FGF) are a family of cell signalling proteins that are involved in a wide variety of processes, most notably as crucial elements for normal development. Any irregularities in their function lead to a range of developmental defects. Fibroblast growth factor 4 is a protein that in humans is encoded by the FGF4 gene. During embryonic development, the 21 -kD protein FGF4 functions as a signaling molecule that is involved in many important processes. Studies using Fgf4 gene knockout mice showed developmental defects in embryos both in vivo and in vitro, revealing that FGF4 facilitates the survival and growth of the inner cell mass during the postimplantation phase of development by acting as an autocrine or paracrine ligand. The sequence of human Fgf4 can be retrieved from the gene bank entry ENSG00000075388.

Heparin (also known as unfractionated heparin (UFH)) is a naturally occurring glycosaminoglycan. Heparin's normal role in the body is unclear. Heparin is usually stored within the secretory granules of mast cells and released only into the vasculature at sites of tissue injury. It has been proposed that, rather than anticoagulation, the main purpose of heparin is defense at such sites against invading bacteria and other foreign materials.

Activin is a protein complex enhancing follicle-stimulating hormone (FSH) biosynthesis and secretion, and participates in the regulation of the menstrual cycle. Many other functions have been found to be exerted by activin, including roles in cell proliferation, differentiation, apoptosis, metabolism, homeostasis, immune response, wound repair, and endocrine function.

The nucleic acid molecule expressing Bmp 4 and/or Fgf 4 is preferably an expression vector. An expression vector, otherwise known as an expression construct, is usually a plasmid or virus designed for gene expression in cells. The vector is used to introduce a specific gene into a target cell, and the cell's mechanism is used for protein synthesis to produce the protein encoded by the gene. The term “vector” in accordance with the invention means preferably a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering which carries the nucleic acid molecule of the invention. The nucleic acid molecule expressing Bmp 4 and/or Fgf 4 can be inserted into several commercially available vectors. Non-limiting examples include prokaryotic plasmid vectors, such as of the pUC-series, pBluescript (Stratagene), the pET-series of expression vectors (Novagen) or pCRTOPO (Invitrogen) and vectors compatible with an expression in mammalian cells like pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMCIneo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, plZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-Hygro (Novagen) and pCINeo (Promega). Examples for plasmid vectors suitable for Pichia pastoris comprise e.g. the plasmids pA0815, pPIC9K and pPIC3.5K (all Invitrogen). Also adenoviruses or adeno-associated viruses (AAV) can be used. Adenoviruses and adeno-associated viruses (AAV) are small viruses that infect humans and some other primate species. They belong to the genus Dependoparvovirus, which in turn belongs to the family Parvoviridae. AAV are small (20 nm) replication-defective, non-enveloped viruses. The nucleic acid molecules inserted into the vector can e.g. be synthesized by standard methods, or isolated from natural sources. Ligation of the coding sequences to transcriptional regulatory elements and/or to other amino acid encoding sequences can also be carried out using established methods. Transcriptional regulatory elements (parts of an expression cassette) ensuring expression in prokaryotes or eukaryotic cells are well known to those skilled in the art. These elements comprise regulatory sequences ensuring the initiation of transcription (e. g., translation initiation codon, promoters, such as naturally-associated or heterologous promoters and/or insulators; see above), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476) and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers. Preferably, the polynucleotide encoding the polypeptide/protein or fusion protein of the invention is operatively linked to such expression control sequences allowing expression in prokaryotes or eukaryotic cells. The vector may further comprise nucleic acid sequences encoding secretion signals as further regulatory elements. Such sequences are well known to the person skilled in the art. Furthermore, depending on the expression system used, leader sequences capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the polynucleotide of the invention. Such leader sequences are well known in the art.

Furthermore, it is preferred that the vector comprises a selectable marker. Examples of selectable markers include genes encoding resistance to neomycin, ampicillin, hygromycine, and kanamycin. Specifically-designed vectors allow the shuttling of DNA between different hosts, such as bacteria-fungal cells or bacteria-animal cells (e. g. the Gateway system available at Invitrogen). An expression vector according to this invention is capable of directing the replication, and the expression, of the polynucleotide and encoded peptide or fusion protein of this invention. Apart from introduction via vectors such as phage vectors or viral vectors (e.g. adenoviral, retroviral), the nucleic acid molecules as described herein above may be designed for direct introduction or for introduction via liposomes into a cell. Additionally, baculoviral systems or systems based on vaccinia virus or Semliki Forest virus can be used as eukaryotic expression systems for the nucleic acid molecules of the invention.

However, it is also possible to genetically modify a blastocyst, extraembryonic endoderm stem (XEN) cells or XEN-like cells such that a nucleic acid molecule expressing Bmp 4 and/or Fgf 4 is integrated into the genome such that Bmp 4 and/or Fgf 4 are expressed in the blastocyst, extraembryonic endoderm stem (XEN) cells or XEN-like cells. Means and methods for genetically engineering a target cell such that it expressed a gene of interest are known in the art. Most preferred is the CRISPR-Cas technology as discussed herein above, noting that the CRISPR-Cas technology can also be used for a gen knock-in. Modified Cas nucleases, such as modified Cas9 can also be used for gene activation, by recruiting to transcriptional activators to the promotor region, without any modification (deletion, insertions) of the DNA itself.

In accordance with another preferred embodiment of the first aspect of the invention the blastocyst, XEN cells and/or XEN-like cells is/are cultured in the medium for at least 24h, preferably at least 48h, more preferably at least 72h and most preferably at least 96h.

Since the transformation of a blastocyst, XEN cells and/or XEN-like cells in the presence of GSK-3 inhibitor and optionally one or more of Bmp 4, Fgf 4, Heparin and Activin into XTE cells takes some time the culture time is with increasing preference at least 24h, at least 48h, at least 72h and at least 96h. In particular with XEN-like cells XTE cells can already been obtained after 24h.

The preferred culturing time for a blastocyst or XEN cells in the presence of GSK-3 inhibitor and optionally one or more of Bmp 4, Fgf 4, Heparin and Activin is between any of the above minimal times and a maximum of about 15 days, preferably about 9 days.

The preferred culturing time for XEN-like cells in the presence of GSK-3 inhibitor and optionally one or more of Bmp 4, Fgf 4, Heparin and Activin is between any of the above minimal times and a maximum of about 10 days, preferably about 5 days.

The term “about” as used herein is preferably ±20% and most preferably ±10%.

In accordance with a still further preferred embodiment of the first aspect of the invention the concentration of the GSK-3 inhibitor in the medium is at least 0.3 mM, preferably at least 1.5 mM, more preferably at least 3 pM, and most preferably about 3 pM; and/or the concentration of Bmp 4 if present in the medium is at least 10 ng/mL, preferably at least 25 ng/mL, more preferably at least 50 ng/mL, and most preferably about 50 ng/mL; and/or the concentration of Fgf 4 if present in the medium is at least 5 ng/mL, preferably at least 10 ng/mL, more preferably at least 25 ng/mL, and most preferably about 25 ng/mL; and/or the concentration of heparin if present in the medium is at least 0.1 pg/mL, preferably at least 0.5 pg/mL, more preferably at least 1 pg/mL, and most preferably about 1 pg/mL; and/or the concentration of activin if present in the medium is at least 2 ng/mL, preferably at least 10 ng/mL, more preferably at least 20 ng/mL, and most preferably about 20 ng/mL.

In the examples herein below the so-called “XTE-medium” was used for transforming a blastocyst, XEN cells and/or XEN-like cells into XTE cells. As discussed, the best XTE- medium comprises GSK-3 inhibitor (CHIR 99021), Bmp 4, Fgf 4/Heparin and Activin as the factors favouring the transformation into XTE cells.

While the skilled person being provided with the present disclosure is able to adjust the particular concentration of the transformation factors in a medium, wherein a blastocyst, XEN cells and/or XEN-like cells is/are transformed into XTE cells the concentrations of the above preferred embodiment are preferably used since they resemble the exemplified XTE medium. In particular, the most preferred concentrations are essentially the concentrations as used in the appended examples.

In this respect it is noted that the medium may be exchanged during the culture time or the same medium may be used during the entire culture time. It is also possible to carry out the method of the invention by exchanging medium continuously at a certain rate or partially at certain points in time. In addition, a fed or a fed-batch culturing method may be employed, wherein one or more transformation factors are fed into the medium at certain points in time.

In accordance with another preferred embodiment of the first aspect of the invention the method of the first aspect further comprises prior to converting XEN-like cells into XTE cells, converting embryonic stem cells into XEN-like cells.

In accordance with a more preferred embodiment of the first aspect of the invention the conversion of embryonic stem cells into XEN-like cells comprises contacting the embryonic stem cells with medium comprising at least one GATA transcription factor, preferably Gata 4 and/or Gata 6; and/or the expression of at least one GATA transcription factor, preferably Gata 4 and/or Gata 6 in the embryonic stem cells.

In accordance with an even more preferred embodiment of the first aspect of the invention the conversion of embryonic stem cells into XEN-like cells comprises contacting the embryonic stem cells with medium comprising at least one GATA transcription factor and/or SOX 17, preferably Gata 4 and/or Gata 6 and/or SOX 17; and/or the expression of at least one GATA transcription factor and/or SOX 17, preferably Gata 4 and/or Gata 6 and/or SOX17 in the embryonic stem cells. As discussed herein above, embryonic stem cells can be transformed into XEN-like cells by art-established methods and these method forms part of the claimed method in accordance with the above preferred and more preferred embodiment.

The XEN-like are preferably obtained from ESCs by contacting the embryonic stem cells with a medium comprising at least one GATA transcription factor, preferably Gata 4 and/or Gata 6; and/or the expression of at least one GATA transcription factor, preferably Gata 4 and/or Gata 6 in the embryonic stem cells. For the expression of at least one GATA transcription factor, preferably Gata 4 and/or Gata 6 the same method may be used described herein above in connection with the nucleic acid molecule expressing Bmp 4 and/or Fgf 4. The sequences of human Gata 4 and Gata 6 can be retrieved from the gene bank entries ENSG00000136574 and ENSG00000141448, respectively.

More preferably the XEN-like are obtained from ESCs by contacting the embryonic stem cells with a medium comprising Gata4, Gata6 and PDFGRa and even more preferably by the expression of Gata4, Gata6 and PDFGRa in ESCs that carry a doxycyclin inducible Gata4 transgene and Histione H2B:venus knock-in cassette in the Gata 6 locus.

As compared to ESCs XEN-like cells are characterized by the underexpression of Nanog and the overexpression of the genes Gata6 and Sox'! 7 (McDonald et al. (2014), Cell Rep. 9(2):780-93).

GATA transcription factors are a family of transcription factors characterized by their ability to bind to the DNA sequence "GATA". GATA6 is important in the endodermal differentiation of organ tissues. It is also indicated in proper lung development by controlling the late differentiation stages of alveolar epithelium and aquaporin-5 promoter activation. Furthermore, GATA-6 has been linked to the production of LIF, a cytokine that encourages proliferation of endodermal embryonic stem cells and blocks early epiblast differentiation. Transcription factor GATA4 is a critical transcription factor for proper mammalian cardiac development and essential for survival of the embryo. GATA4 works in combination with other essential cardiac transcription factors as well, such as Nkx2-5 and Tbx5. GATA4 is expressed in both embryo and adult cardiomyocytes where it functions as a transcriptional regulator for many cardiac genes, and also regulates hypertrophic growth of the heart.

SOX17 is a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. It acts as a transcriptional regulator after forming a protein complex with other proteins. The sequence of human Sox17 can be retrieved from the gene bank entry ENSG00000164736.

The present invention relates in a second aspect to a trophectoderm-like cell that has been obtained or is obtainable by the method of the first aspect.

The definitions and preferred embodiments of the first aspect apply mutatis mutandis to the second aspect as far as being applicable to the second aspect and vice versa.

As discussed, XTE cells functionally and structurally resemble trophectoderm cells but are not identical to naturally occurring trophectoderm cells. To the best knowledge of the inventors XTE cells as obtained or as being obtainable by the method of the first aspect are not only distinct from trophectoderm cells but also from any other known cell-type, including in vivo and in vitro cells. Hence, XTE cells constitute a novel type of cells.

In accordance with preferred embodiment of the second aspect of the invention the trophectoderm-like cell expresses Gata 6, Cdx2, Pdgfra and Cd40.

In accordance with preferred embodiment of the second aspect of the invention further expresses Gata 4, Sox 17 and Cytokeratin 8.

1 In accordance with preferred embodiment of the second aspect of the invention the trophectoderm-like cell does not expresses Sox2, Oct4 and Nanog.

The fact that XTE cells constitute a novel cell type is at least evident from the particular gene expression profile of these cells which is not shared by any other known cell type. Means and methods for determining the gene expression profile of a cell or whether certain genes are expressed in a cell are known in the art. For instance, a DNA microarray comprising the required genes or RNA-seq or a PCR-based method may be used, in particular quantitative PCR. Quantitative PCR is used in the appended example and in particular one or more primers pairs as shown in Table 1 may be used in a quantitative PCR to check for the expression profile of XTE cells.

The function of GATA6 has been described above and Gata 6 is the gene encoding GATA6. The Cdx- gene is a member of the caudal-related homeobox transcription factor family that is expressed in the nuclei of intestinal epithelial cells. Cdx2 is the gene that directs early embryogenesis and is required to form the placenta. Platelet-derived growth factor receptors alpha (PDGFRa) is a cell surface tyrosine kinase receptor for members of the platelet- derived growth factor (PDGF) family. PDGFRa is regulator of cell proliferation, cellular differentiation, cell growth, and development. Cluster of differentiation 40 (CD40) is a costimulatory protein usually found on antigen-presenting cells and is required for their activation. The binding of CD154 (CD40L) on TH cells to CD40 usually activates antigen presenting cells and induces a variety of downstream effects. The sequence of human Pdgfra and CD40 can be retrieved from the gene bank entries ENSG00000134853 and ENSG00000101017, respectively.

The functions of GATA4 and SOX17 have been described above and Gata 4 and Sox 17 are the genes encoding GATA6 and SOX17, respectively. Cytokeratin-8 (also known as keratin, type II cytoskeletal 8, cytokeratin-8 (CK-8) or keratin-8 (K8)) is a keratin protein that is encoded in humans by the KRT8 gene. It is often paired with keratin 18. In normal tissue, it reacts mainly with secretory epithelia, but not with squamous epithelium, such as that found in the skin, cervix, and esophagus. The sequence of human Cytokeratin-8 can be retrieved from the gene bank entry ENSG00000170421.

SOX2 (or SRY (sex determining region Y)-box 2) is a transcription factor that is essential for maintaining self-renewal, or pluripotency, of undifferentiated embryonic stem cells. Sox2 gene expression has a critical role in maintenance of embryonic and neural stem cells. Oct-4 (octamer-binding transcription factor 4; also known as POU5F1 (POU domain, class 5, transcription factor 1)) is a homeodomain transcription factor of the POU family. It is critically involved in the self-renewal of undifferentiated embryonic stem cells. Nanog is a transcriptional factor that helps embryonic stem cells (ESCs) maintain pluripotency by suppressing cell determination factors. Therefore, NANOG deletion will trigger differentiation of ESCs. The sequences of human Sox2, Oct4 and Nanog can be retrieved from the gene bank entries ENSG00000181449, ENSG00000204531 and ENSG00000111704, respectively.

The present invention relates in a third aspect to a vesicle or synthetic embryoid assembled from the trophectoderm-like cells of the invention.

The present invention relates in a fourth aspect to a method for assembling a vesicle or a synthetic embryoid comprising culturing trophectoderm-like cells of the invention under conditions, wherein the trophectoderm-like cells self-assemble into a vesicle or a synthetic embryoid, wherein the method optionally further comprises preparing trophectoderm-like cells according to the method of the first aspect. The synthetic embryoid comprises stem cells as an inner cell mass and outer XTE cells forming a vesicle. While it is also possible to obtain a synthetic embryoid comprising stem cells as an inner cell mass by injecting stem cells into a vesicle of the invention, the method of the fourth aspect being for assembling a synthetic embryoid preferably comprises culturing trophectoderm-like cells of the invention and stem cells under conditions, wherein the trophectoderm-like cells and the stem cells self-assemble into an embryoid, wherein the trophectoderm-like cells are the outer cell layer of the embryoid and the stem cells are the inner cell mass of the embryoid.

The definitions and preferred embodiments of the first and second aspect apply mutatis mutandis to the third and fourth aspect as far as being applicable to the second aspect and vice versa.

As defined herein above XTE cells are characterized by the capability to self-organize into an embryoid or a vesicle, said embryoid or vesicle resembling the outer cell-layer or cell wall of the blastocyst. Since the XTE cells are self-organizing no further differentiation or transformation factors are required in order to assemble a vesicle.

In accordance with the invention a vesicle comprises XTE cells and in particular the XTE cells from the outer layer or surface of the vesicle.

In case the vesicle of the invention encloses stem cells (such as pluripotent embryonic stem cells (ECSs) or induced pluripotent stem cells (iPSCs)) the vesicle is designated herein an embryoid. An embryoid is generally a three-dimensional aggregation of cells comprising cells derived from the blastocyst stage of embryos or cells that resemble cells derived from the blastocyst stage of embryos. As also mentioned, the stem cells in the embryoid of the invention resemble the inner cell mass of the blastocyst.

The XTE cells simply need to be cultured (in the case of a embryoid preferably along with the stem cells to be incorporated) for a time being sufficient to obtain a vesicle or an embryoid. This time is preferably at least 24h and more preferably at least 48h. It is of note that the size of the vesicles or embryoids can be adjusted by adjusting the culturing time. While at the minimum time first small vesicles or embryoids appear, vesicles or embryoids having the size of a mouse blastocyst are obtained after a culturing time of about 3 days to about 5 days. By a further prolongation of the culturing time vesicles or embryoids having the size of a human blastocyst will be obtained. During the formation of the vesicles or embryoids one or more test compounds may be added in order to check its/their effect on the formation of the vesicles or embryoids. This ex vivo test may be used to test the influence of test compounds on blastocyst formation. During the formation of the a vesicle or embryoid also cells other then XTE cells (e.g. stem cells, such as induced pluripotent stem cells, embryonic stem cells or stem cells of another cell linage) may be added in order arrive at embryoids which enclose these other cells as an “inner cell mass”. Such an ex vivo test may be used to arrive at structure which resembles a blastocyst. It also possible to use a test compounds and cells other then XTE cells at the same time.

The blastocyst stage is the embryonic stage where the embryo comes into contact with the mother, which is known as implantation. The implantation is critical for the survival and development of the early embryo. The established connection between the mother and the early embryo continues through the remainder of the pregnancy. Implantation is made possible through structural changes in both the blastocyst and endometrial wall of the mother. Many natural pregnancies fail due to an implantation failure and an implantation failure is in particular a problem during IVF (in vitro fertilization).

Hence, the XTE cells of the invention and the vesicles and embryoids formed by the XTE cells of the invention are an important novel tool for studying the embryonic blastocyst stage and in particular the implantation. This in turn might result in new treatment options for preventing an implantation failure.

In addition, the XTE cells of the invention and the vesicles and embryoids formed by the XTE cells of the invention allow the reduction of the use blastocysts for scientific research and, hence, the reduction of the use of test animals, such as mice.

Regarding the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.

Similarly, and also in those cases where independent and/or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1 , and a dependent claim 3 referring back to both claims 2 and 1 , it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1 , of claims 4, 2 and 1 , of claims 4, 3 and 1 , as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.

The above considerations apply mutatis mutandis to all appended claims.

The figures show.

The Examples illustrate the invention.

Figure 1. Derivation of TE-like cells from mouse blastocysts.

(A) Blastocyst-stage embryos stained for Cdx2, Sox2 and Gata6. Arrow indicates Gata6 and Cdx2 colocalization. Nuclei were counterstained with DAPI.

(B) E5.5 egg cylinders stained for Cdx2, Sox2 and Gata6. Nuclei were counterstained with DAPI.

(C) TSC (E3.5) stained for Cdx2, Sox2 and Gata6.

(D) TSC (E6.5) stained for Cdx2, Sox2 and Gata6.

(E) Schematic representation of the experimental workflow used for TE-like cell derivation.

(F) Snapshot images of mouse blastocyst cultured in XTE medium and the subsequent establishment of epithelial colonies following the dissociation of the blastocyst outgrowth.

(G) Number of Cdx2/Gata6 double-positive colonies formed in medium supplemented with different combinations of factors. Error bars represent SEM.

(H) Efficiency of TE-like cell derivation from blastocyst-stage embryos using XTE medium.

(I) TE-like cells stained for Cdx2, Gata6, Cytokeratin-8 (Tromal) and Sox2.

Scale bar A, B, C, D = 10 pm; F = 40 miti; I = 20 pm.

Figure 2. Origin and developmental potential of the TE-like cells.

(A) Schematic representation of the TE-specific Tat-Cre/loxP recombination of the Rosa26 mT/mG locus (top panel); live imaging of mT/mG embryos after Tat-Cre treatment (middle panel) and live imaging of cells derived from the Tat-Cre treated embryos (bottom panel).

(B) Schematic representation of TE immunosurgery using mT/mG embryos subjected to Tat- Cre mediated recombination (top panel); live images of embryo before and after removal of TE by immunosurgery (middle panel); mTom+ ICM derived TE-like cells stained for Cdx2 and Gata6 (bottom panel).

(C) FACS analysis of XTE cells and ESC using PDGFRa and CD40 surface markers.

(D) Quantification of PDGFRa- and CD40-expressing cells; 3 independent experiments, error bars represent SEM.

(E) qPCR analysis of Cdx2, Gata6, Sox17 and Nanog in XTE cells and ESC. b-actin was used for normalization, error bars represent SEM, significance was calculated using unpaired student’s t-test, n=3.

(F) XTE cells stained for TE markers - Cdx2, Tromal , Eomes, PE markers- Gata4 and Sox17 and epiblast markers - Oct4 and Nanog; nuclei were counterstained with DAPI.

(G) Schematic representation of the XTE cells / morula aggregation and formation of a chimeric blastocyst (top panel); live imaging of chimeric blastocyst with incorporated XTE cells, arrows indicate the mTom-expressing XTE cells (middle panel); the chimeric embryos (n = 13) were stained for mTom, Gata6, Tromal and DAPI (bottom panel).

(H) Schematic representation of the transfer of chimeric blastocysts into pseudopregnant females (left panel). After implantation, the embryos were harvested at E6.5 (n = 19) and stained for mTom and DAPI; yellow boxes outline epiblast (a) and ExE (b) regions; the incorporated XTE cells are indicated with an arrow (right panel).

Scale bar A, B, D, E, G = 20 pm; H = 40 pm.

Figure 3. Establishment of XEN state is required for the activation of core TE genes.

(A) Schematic representation of conversion of XEN (PDGFRa+) to XTE (PDGFRa+/CD40+) cells.

(B) FACS analysis of XEN reprogramming to XTE cells using surface marker expression of PDGFRa and CD40.

(C) Quantification of PDGFRa- and CD40-expressing cells based on FACS analysis; error bars represent SEM, n=4.

(D) XEN and XEN-derived XTE cells stained for Cdx2, Eomes and DAPI.

(E) XEN and XEN-derived XTE cells stained for Gata6, Tromal and DAPI.

(F) Chimeric blastocysts generated by morula aggregation using XEN-derived XTE cells constitutively expressing Histone H2B:Cerulean. The embryos (n = 18) were stained for Cdx2 and DAPI. Arrows indicate the Histone H2B:Cerulean-positive XTE cells.

(G) Developmental capacity of XEN-derived XTE cells assessed by transferring the chimeric blastocysts into foster mothers. Embryos (n = 18) were harvested at E6.5 and examined for the presence of Histone H2B:Cerulean-positive cells .

(H) Schematic representation of ESC reprogramming to XTE cells via an intermediate XEN- like state. The ESC carry a Dox-inducible Gata4 transgene and a Histone H2B:Venus knock- in cassette in the Gata6 locus (Gata6-H2B:Venus). The XEN-like state was induced after 24- h treatment with Dox. The XEN-like cells were sorted for Venus and PDGFRa and cultured in XTE medium to give rise to PDGFRa+/CD40+ XTE cells.

(I) FACS analysis for PDGFRa and CD40 expression in ESC, XEN-like cells and XTE cells.

(J) Quantification of PDGFRa- and CD40-expressing cells based on the FACS analysis; error bars represent SEM, n= 3.

(K) ESC, XEN-like and XTE cells stained for Gata6 H2B;Venus, Nanog and DAPI.

(L) ESC, XEN-like and XTE cells stained for Gata6 H2B:Venus, Cdx2 and DAPI.

(M) Incorporation of Venus+ ESC-derived XTE cells in chimeric blastocyst (n = 18) stained for Cdx2 and DAPI.

(N) The chimeric blastocysts were transferred into pseudopregnant female mice and later isolated at E6.5. The egg cylinder-stage embryos (n = 20) were examined for the incorporation of Venus+ XTE cells. Laminin marks the Reichert’s membrane, nuclei were counterstained with DAPI.

Scale bar D, E, F, K, L, M = 20 pm; G, N = 40 pm. See also Figure 7.

Figure 4. Transcriptomic profiling of XTE cells.

(A) Principal component analysis of gene expression in embryo-, ESC- and XEN cell-derived XTE cells and ESC/XTE vesicles, including the parental cell lines, namely XEN cells, ESC and XEN-like cells.

(B) K-means clustering of gene expression reveals three major clusters corresponding to gene expression enriched in XEN cells (cluster 1), ESC (cluster 2) and XTE cells (cluster 3).

(C) Expression of epiblast, PE and TE markers and factors involved in the formation of adherens junctions, tight junctions and epithelial polarity in XTE cells, ESC, XEN-like and XEN cells.

(D) Gene ontology (GO) “cellular component” enrichment analysis for each gene cluster defined in (B).

See also Figure 8.

Figure 5. Mechanism of XEN-state reprogramming into XTE cells.

(A) Methylation status of the Elf5 promoter in ESC, XEN-like cells, XEN-cells, XTE cells and TSC determined by bisulfite sequencing.

(B) Quantification of Elf5 promoter methylation in ESC, XEN-like cells, XEN-cells, XTE cells and TSC

(C) qPCR analysis of Elf5 expression in ESC and embryo-derived XTE normalized to b-actin expression; error bars represent SEM, n= 4.

(D) Schematic representation of the 8- to 16-cell-stage transition during mouse pre implantation embryogenesis including the process of E-cad mediated compaction and Yap- mediated Cdx2 activation in the outer cells.

(E) Schematic representation of the potential mechanism of XEN state reprogramming to XTE cells, following the principles of the TE specification in mouse embryos.

(F) Bright field images of XEN cells and XEN-derived XTE cells.

(G) Western blot analysis for E-cad expression in XEN and XTE cells a- tubulin was used an internal control.

(H) XEN and XEN-derived XTE cells stained for E-cad and DAPI.

(I) Expression of E-cad in ESC, XEN-like cells and ESC-derived XTE cells. DAPI was used to mark the nuclei.

(J) Expression of E-cadherin, Gata6, Tromal and DAPI in E-cad fl/fl XTE cells and E-cad D/D XTE cells.

(K) E-cad fl/fl XTE cells and E-cad D/D XTE cells stained for Cdx2, Yap and DAPI.

(L) Expression of Yap in ESC, XEN-like cells and XTE cells. Nuclei were counterstained with DAPI.

(M) Yap/Taz fl/fl XTE cells and Yap/Taz D/D XTE cells stained for Cdx2, Yap, Sox17 and DAPI.

Scale bars H, I, J, K, L, M = 20 pm. See also Figure 9.

Figure 6. Self-organisation properties of XTE cells and assembly of blastocyst-like embryoids

(A) XTE cells were grown on cell-repellent plates for a period of four days in XTE medium to form multicellular vesicles. The vesicles were fixed at 24-h intervals and stained for Tromal and DAPI.

(B) Day 4 XTE vesicles stained for Cdx2 and DAPI.

(C) Bright field images of mouse blastocyst and an XTE vesicle.

(D) Percentage of cavitation representing the efficiency of vesicle formation of XTE cells derived from embryo, XEN cells and ESC. The regular vesicles are represented in black and irregular ones in grey. Error bars represent SEM, three independent experiments.

(E) Blastocyst and XTE vesicles stained for Cdx2, Phall and DAPI.

(F) Blastocyst and XTE vesicles stained for Gata6 and DAPI.

(G) Blastocyst and XTE vesicles stained for Yap and DAPI. (H) Blastocyst and XTE vesicles stained for Par6, E-cad and DAPI.

(I) Bright field images of a blastocyst and XTE vesicle placed in serum-containing medium

(J) Schematic representation of ESC / morula aggregation and formation of chimeric blastocyst (left panel); chimeric blastocyst with incorporated ESC (right panel).

(K) Schematic representation of ESC / XTE cell aggregation and formation of blastocyst-like embryoids (left panel); XTE cell-based embryoids with incorporated ESC (right panel).

(L) Blastocysts and embryoids stained for Cdx2 or Oct4 and DAPI. 3D reconstruction of blastocyst and embryoid stained for Oct4 and DAPI is represented in the right panel.

(M) Embryoids transferred into the uterus of pseudopregnant females induce decidualization, arrows indicate deciduae.

(N) Sections of decidua induced by embryoid transfer and stained for E-cad and XTE cells expressing Venus. DAPI was used to counterstain the nuclei.

(O) TE lineage specification and incorporation of ESC (top panel). Reprogramming of XEN state cells to XTE cells, subsequent cavitation and embryoids’ self-assembly (bottom panel). Scale bar A, B, C, E, F, G, H, I, J, K, L = 20 pm; M, N = 40 pm. See also Figure 10.

Figure 7. Establishment of XEN state is required for the activation of the TE program, related to Figure 3.

(A) FACS analysis of XEN cells grown in XTE medium for the surface markers PDGFRa and CD40 across consecutive passages. XEN cells maintained in basal N2B27 medium was used as control. Error bars represent SEM, n=3.

(B) qPCR analysis of Cdx2, Gata6, Sox17 and Nanog expression in XEN cells and XTE cells derived from XEN cells b-actin was used as an internal control. Error bars represent SEM, n=3.

(C) qPCR analysis of Cdx2, Gata6, Sox17 and Nanog expression in XTE cells derived from ESC in comparison to the expression levels in ESC and XEN-like cells b-actin was used as an internal control. Error bars represent SEM and significance was calculated using unpaired student’s t-test. n=3.

(D) FACS analysis of PDGFRa and CD40 expression in ESC grown in XTE medium.

(E) FACS analysis for expression of PDGFRa and CD40 in XTE cells derived from ES cells. After conversion of ESC into XEN-like cells, they were cultured in XTE medium either for 4 days (Passage 1 , Day 4), 5 days (passage 1 , Day 5) or passaged on day 4 and maintained for 24 h more (Passage 2, Day 1 ) and then analysed by FACS.

Figure 8. Transcriptional state of the XTE cells, related to Figure 4.

(A) “Elbow plot” method assessing the appropriate number of clusters for the gene expression clustering shown in Figure 4B. The variability within clusters was measured using the total within-cluster sum of squares.

(B) GO “biological process” enrichment analysis for each cluster in Figure 4B.

(C) GO “molecular function” enrichment analysis for each cluster in Figure 4B.

Figure 9. Mechanism of XEN-state reprogramming to XTE cells, related to Figure 5.

(A) Embryo-derived XTE cells stained for E-cad and DAPI.

(B) XEN cells and XTE cells derived from XEN cells stained for b-catenin and DAPI.

(C) XEN cells and XTE cells derived from ESC cells stained for b-catenin and DAPI.

(D) Genotyping PCR for recombination of the conditional E-cad allele. GAPDH was used as loading control and 1 Kb ladder was used for determining the size of the PCR products.

(E) XEN cells and XTE cells derived from XEN cells stained for Yap and DAPI.

(F) Genotyping PCR for recombination of the conditional Yap allele. GAPDH was used as loading control and 1 Kb ladder was used for determining the size of the PCR products.

(G) Genotyping PCR for recombination of the conditional Taz allele. GAPDH was used as loading control and 1 Kb ladder was used for determining the size of the PCR products.

(H) Control and Peptide 17 treated XTE cells stained for Gata6 H2B:Venus, Yap, Cdx2 and DAPI.

Figure 10. Self-organization of XTE cells, related to Figure 6.

(A) XTE vesicles stained for E-cad and DAPI.

(B) Snapshot images of time lapse microscopy of blastocyst and XTE vesicles cultured in the presence of serum containing medium

Figure 11. Incorporation of human pluripotent cells into XTE vesicles and generation of blastocyst-like embryoids.

Figure 12. Single cell RNA-seq analysis. (A) UMAP plot of the single cell transcriptomes of E4.5 blastocysts (orange) and XTE/ESC based embryoids (blue). (B) UMAP plot displaying cells clustering. (C) UMAP plots of lineage markers expression. (D) Violin plot of E-cad, Gata6 and Sox2 expression in the different cell clusters.

The Examples illustrate the invention.

Example 1 - Derivation of TE-like cells from mouse blastocysts

As conventional TSC more closely represent the post-implantation ExE, it was aimed to design culture conditions that enable derivation of cells with pre-implantation TE-like properties. In order to establish such cells from mouse blastocysts, first a set of markers was defined to discriminate between the pre-implantation (TE) and the post-implantation (ExE) trophoblast. Blastocyst stage embryos showed mutually exclusive expression of Cdx2 in the TE and Sox2 in the epiblast. In addition to Cdx2, the TE was also positive for Gata6 (Figure 1A). After implantation, Sox2 was detectable in both epiblast and ExE, whereas Gata6 expression was maintained only in the visceral endoderm (Figure 1B). Thus, the TE were defined as Cdx2+/Sox2-/Gata6+ and the ExE as Cdx2+/Sox2+/Gata6- cell populations. Similar to the ExE, both blastocyst-derived (E3.5) and egg cylinder-derived (E6.5) TSC co expressed Cdx2 and Sox2 but were Gata6 negative (Figures 1C and 1D), confirming that TSC capture features of the post-implantation trophoblast. In order to identify factors enabling derivation of TE-like cells directly from blastocyst stage embryos, an array of ligands and small molecules that stimulate key developmental signalling pathways were tested. N2B27 was used as a basal, chemically defined medium that was supplemented with either single or a combination of soluble factors. For each culture condition 8 wells of a 96- well plate were used containing individual Zona pellucida-free E3.5 blastocysts. The embryos were cultured for 4 days on mitotically inactivated mouse embryonic fibroblasts (MEFs), and after that the outgrowths were dissociated and the cells re-plated into fresh wells. Following an additional 4 days of culture, the emerging colonies were fixed and stained for Cdx2 and Gata6 (Figure 1E).

It was found that blastocysts cultured in medium supplemented with Bmp4, CH (GSK-3 inhibitor, CHIR99021), Fgf4, heparin and activin (XTE medium) gave rise to flat epithelial colonies that co-express Cdx2 and Gata6 (Figures 1F and 1G). The efficiency of derivation of TE-like cells was approximately 80%, with 26 embryos giving rise to 21 individual cell lines (Figure 1H). These cells were positive for the trophoblast-specific intermediate filament Cytokeratin-8 (Tromal) and negative for Sox2 (Figure 11). Thus, in contrast to the E3.5 and E6.5 TSC, the blastocyst-derived TE-like cells expressed a set of markers akin to the preimplantation trophoblast.

Example 2 - Origin and developmental potential of the TE-like cells

Although the marker signature of the TE-like cells indicated that they most likely originate from the pre-implantation trophoblast, all cell lineages of the early embryo were exposed to the XTE medium. As the TE-like cells’ derivation procedure did not allow for tracing back the lineage of origin, there were two feasible options: either the TE-like cells derived directly from the TE or they arose via reprogramming of the ICM lineages (PE or epiblast). To tackle this distinction, a lineage-tracing approach was established using double-fluorescent reporter embryos expressing membrane-targeted tandem dimer Tomato (mTom) flanked by LoxP sites, followed by membrane-targeted GFP (mGFP) ⁸ . Intact embryos express only the mTom cassette, which can be excised via Cre-mediated recombination resulting in de novo expression of mGFP and loss of mTom fluorescence. As the blastocoel cavity is sealed by tight junctions ⁹ , it was hypothesized that treatment with cell-permeant Cre protein (Tat-Cre) would result in Cre uptake only by the directly exposed TE, whereas the ICM will remain out of reach (Figure 2A). To test this, Zona pellucida of E3.5 embryos was removed and after 2 h of incubation with Tat-Cre, the blastocysts were transferred into individual wells containing MEFs and XTE medium. The next day, it was observed that the TE gained mGFP expression, indicating successful excision of the mTom cassette, whereas the ICM remained mTom+ (Figure 2A). Thus, this strategy allowed for permanent genetic labelling of the TE (mGFP+) and the ICM (mTom+), labelling that was also inherited by the cells derived from the respective compartments. Surprisingly, the TE-like cell colonies established after dissociation of the labelled blastocysts were mTom+, indicating they originated from the ICM (Figure 2A).

As an additional approach to verify the ICM as the source of TE-like cells, the TE of Tat-Cre labelled mTom/mGFP blastocysts was eliminated via immunosurgery (Figure 2B). ICM clumps without any residual mGFP+ trophoblast cells were selected for further analysis. Following culture in the XTE medium, each of these clumps gave rise to colonies that coexpressed mTom, Cdx2 and Gata6, confirming the ICM origin of the TE-like cells (Figure 2B).

Although the ICM and TE in mTom/mGFP blastocysts could be clearly distinguished, the Tat- Cre mediated labelling strategy did not allow for direct discrimination between epiblast and PE, as the whole ICM was mTom+. Still, it was hypothesized that the TE-like cells may co express epiblast or PE markers that can point to the specific lineage of the ICM. It was found that in contrast to the epiblast-derived ESC, the TE-like cells were positive for the PE surface marker PDGFRa, and almost half of these cells co-expressed the trophoblast marker CD40 (Figures 2C and 2D). On both the transcriptional and protein levels, the TE-like cells expressed core PE genes, such as Gata4, Gata6 and Sox'! 7, alongside trophoblast genes such as Cdx2, Eomes and Cytokeratin-8 (Tromal). At the same time, these cells were negative for epiblast markers such as Oct4 and Nanog (Figures 2E and 2F). Thus, altogether, the marker gene analysis indicates that the TE-like cells are derived from the PE. Therefore, to properly acknowledge their PE origin, these cells will be further referred to as extraembryonic endoderm-derived TE-like (XTE) cells.

As the XTE cells simultaneously express core PE and TE factors, the two extraembryonic developmental programs may co-exist, allowing for re-integration into both extraembryonic lineages of the pre-implantation embryo. To test this, the XTE cells (mTom+) with 8-cell- stage morulae were aggregated and generated chimeric embryos. At the late blastocyst stage, it was found mTom-expressing cells incorporated in both the TE (mural and polar) and the PE (Figure 2G). However, after embryo transfer into a foster mother, the egg cylinder stage embryos showed mTom+ cells residing only in the mural part of the Reichert’s membrane; no mTom+ cells were maintained in the ExE or the visceral endoderm (Figure 2H). This shows that the XTE cells have an extended integration capacity in the context of the pre-implantation embryo, but over the long term their development is restricted to the mural compartment of the post-implantation conceptus.

Example 3- Establishment of XEN state is required for the activation of core TE genes

As the three cell lineages that build the blastocyst exist only transiently during embryonic development, it was asked whether the XTE cells emerge from the PE only during direct derivation from pre-implantation embryos or whether they can emerge from the reprogramming of already established XEN cell lines. To address this question, XEN cells were cultured in XTE medium and used the cell surface makers PDGFRa and CD40 as a readout for the establishment of XTE cells. The XEN cells were PDGFRa+/CD40- but within 3 to 4 passages in XTE medium they gradually gained CD40 expression, and approximately 30% to 60% of them became PDGFRa+/CD40+ XTE cells (Figures 3A-3C and 7A). At the same time, they upregulated additional TE markers such as Cdx2, Eomes and Tromal while maintaining the expression of XEN-specific genes such as Gata6 and Sox17 on both the transcriptional and protein levels (Figures 3D-3E and 7B). The XEN-derived PDGFRa+/CD40+ XTE cells showed extended integration capacity to populate both the TE and PE of pre-implantation embryos, and, similarly, the embryo-derived XTE cells were maintained only in the mural part of the Reichert’s membrane after implantation (Figures 3F and 3G).

Next, it was asked whether the establishment of the XEN state is a prerequisite for reprogramming to XTE cells. To generate the XEN state de novo, ESC were used that carry a doxycycline (Dox)-inducible Gata4 transgene and a Histone H2B:Venus knock-in cassette in the Gata6 locus (Gata6-H2B:Venus) ¹⁰ . Following a pulse of Dox driving transient Gata4 expression, the ESC were converted into XEN-like cells, marked by the upregulation of the Gata6-H2B:Venus reporter and gain of PDGFRa expression (Figures 3H-3K). In addition, the XEN-like cells downregulated Nanog and upregulated Gata6 and Sox'! 7 expression (Figures 3K and 7C).

Using this system, it was examined whether an intermediate XEN state is required for the conversion of ESC into XTE cells. It was found that directly exposing ESC to the reprogramming cocktail failed to generate XTE cells (Figure 7D). However, culturing the Gata6-H2B:Venus+ (XEN-like) cells in the XTE medium resulted in the establishment of PDGFRa+/CD40+ cells, which also activated Cdx2 expression (Figures 3H-3L, 7C and 7E). Upon engraftment into pre-implantation embryos, these XTE cells showed similar integration capacity as the PDGFRa+/CD40+ XTE cells derived from embryos or generated from XEN cells (Figures 3M and 3N).

Taken together, these analyses confirm the PE origin of the XTE cells and show that a XEN state, either induced de novo in ESC or already established in vivo (PE) or in vitro (XEN cells) is a prerequisite for the subsequent activation of TE genes.

Example 4 - Transcriptional state of the XTE cells

To further characterize the XTE cells, the PDGFRa+/CD40+ cell populations derived from embryos, XEN or ESC/XEN-like cells were collected and analysed their transcriptome using RNA-seq. Principal component analysis (PCA) showed that all XTE cells clustered together, aside from the parental cell lines, namely XEN, ESC and XEN-like cells, indicating that a common transcriptional state is established regardless of the source of XTE cells (Figures 4A and 8A).

Differential expression analysis delineated three large groups of actively transcribed genes enriched in XEN cells (cluster 1), ESC (cluster 2) and XTE cells (cluster 3), respectively (Figure 4B). In contrast to ESC and in accord with their XEN state of origin, the XTE cells were negative for epiblast markers but expressed an array of PE-specific genes. In addition, the expression cluster enriched in XTE cells contained trophoblast genes, including the master TE factor Cdx2 (Figures 4B and 4C). Although the PE-specific gene activity was maintained in the XTE cells, the expression level of the PE genes was toned down in comparison to XEN cells (Figure 4C). This fine tuning of the PE transcriptional circuit may allow the TE programme to co-exist, thus combining features of both extraembryonic lineages in a shared XTE state.

Gene ontology (GO) analysis revealed that the XTE cells upregulate sets of genes that are associated with intercellular junctions and apical cellular compartments (Figures 4D, 8B and 8C). More specifically, it was found that expression of key adherens junction components, such as E-cadherin ( Cdh1 ) and b-catenin ( Ctnnbl ), tight junction proteins and apical polarity determinants such as Cdc42 ( Cdc42 ) and the aPKC zeta isoform ( Prkcz ) was enriched in XTE cells (Figure 4C). As these are bona fide epithelial factors, which suggests that reprogramming to XTE cells is associated with a concomitant process of epithelialization.

Example 5 - Reprogramming to XTE cells follows the in vivo TE specification programme

During reprogramming to XTE cells, the XEN state acquires TE-specific gene expression manifested by the upregulation of trophoblast markers, in particular Cdx2. Cdx2 is the master regulator of the TE programme in the early embryo and is both indispensable and sufficient to drive the TE fate ¹¹ . Thus, it was next aimed to determine the mechanism of Cdx2 activation in XTE cells. A previously reported genome-wide screen for promoter methylation identified Elf5 as a gatekeeper of Cdx2 expression. In wild type ESC, the Elf5 promoter is methylated and Elf5 expression is low. However, in ESC with a DNA Methyltransferase 1 knock out (Dnmtl ko ESC), the Elf5 promoter is hypomethylated, resulting in Elf5 upregulation. In turn, Elf5 directly binds and activates Cdx2, which enables trophoblast and pluripotent fates to co-exist in Dnmtl ko ESC ¹² . To understand whether Elf5 drives the TE programme in the XTE cells, was analysed and compared the methylation status of the Elf5 promoter in TSC, ESC, XEN-like, XEN and XTE cells. It was found that in contrast to TSC, where the Elf5 promoter is hypomethylated, the Elf5 regulatory sequences in XTE cells were hypermethylated, and the levels of methylation were comparable to levels in XEN, XEN-like cells and ESC (Figures 5A and 5B). Also, similar to ESC, the XTE cells had low Elf5 transcript levels (Figure 5C), indicating that the Cdx2 expression in these cells is activated via an alternative mechanism.

During the pre-implantation development, the blastomeres of the late 8-cell stage embryo undergo a process of compaction, dependent on E-cadherin (E-cad)-mediated intercellular adhesion ¹³ . At the 16- to 32-cell stage, the epithelial phenotype of the outer cells suppresses the activity of the Hippo signalling pathway, which results in the transcriptional co-activator Yap translocating to the nucleus; there, together with Tead4, Yap triggers Cdx2 expression and subsequent TE fate specification ¹⁴ (Figure 5D). As the RNA-seq analysis revealed that reprogramming to XTE cells is associated with an elevated expression of epithelial factors, it was hypothesised that Cdx2 activation in XTE cells follows similar principles as the TE specification programme in vivo. Therefore, it was examined whether E-cad mediated epithelialization of XTE cells is associated with nuclear accumulation of Yap that would, in turn, drive Cdx2 upregulation (Figure 5E).

To test this hypothesis, first E-cad expression dynamics during reprogramming of XEN cells to XTE cells were analysed. The XEN cells typically grow as single loosely connected cells, but conversion to XTE cells resulted in E-cad upregulation and formation of an epithelial monolayer (Figures 5F-5H). Similarly, the embryo-derived XTE cells also expressed E-cad and formed epithelial colonies (Figure 9A).

In addition, E-cad expression patterns during ESC differentiation into XEN-like cells and subsequent reprogramming into XTE cells were examined. E-cad was downregulated during the transition from ESC to XEN-like cells, and then it was upregulated during the conversion from XEN-like to XTE cells (Figure 5I). b-catenin, which is another key element of the adherens junctions complex, also followed a similar expression pattern (Figures 9B and C). To understand whether E-cad mediated adhesion is required for activating Cdx2 expression, E-cad floxed ESC ¹⁵ expressing 4-hydroxy tamoxifen (4-OHT)-inducible Cre-ERT2 and a Dox-inducible Gata6 transgene was used. Following a pulse of Dox, the E-cad floxed CreERT2 ESC were converted into PDGFRa+ XEN-like cells. After that, the XEN-like cells were cultured in XTE medium in the presence of 40HT to induce E-cad deletion (Figures 5J and 9D). As a result, the E-cad deficient cells (+40HT) failed to efficiently accumulate Yap in the nucleus and upregulate Cdx2 expression (Figure 5K).

Next, it was analysed the dynamics of Yap localization during the conversion of XEN to XTE cells, as well as during the reprogramming of ESC/XEN-like to XTE cells. It was found that Yap accumulates in the nucleus of the resulting XTE cells in both reprogramming approaches (Figures 5L and 9E). To analyse whether Yap signalling promotes Cdx2 expression, Yap/Taz double-floxed ESC ¹⁶ that express Cre-ERT2 and Dox-inducible Gata6 were used. After conversion to XEN-like cells and subsequent culture in XTE medium, Yap/Taz were depleted, resulting in loss of Cdx2 expression (Figures 5M, 9F and 9G). As an alternative approach XTE cells were treated with Peptide 17, an inhibitor of Yap-Tead interactions, and that also diminished Cdx2 expression (Figure 9H).

Altogether, these results show that the establishment of an epithelial phenotype during reprogramming to XTE cells enables Yap-mediated upregulation of Cdx2, similar to the process of TE lineage specification during the first cell fate decision in vivo.

Example 6 - XTE cells’ self-organization properties enable the assembly of blastocystlike embryoids

The TE has two major functions in the pre-implantation embryo: the formation of the blastocoel cavity, which defines the hollow-shaped architecture of the blastocyst, and the subsequent differentiation into invasive trophoblast cells, which mediate the process of implantation. Next it was aimed to determine whether XTE cells capture these key TE features.

To examine the self-organization properties of XTE cells, the cells were cultured on cell- repellent plates and within 24 h, small clumps were formed instead of the typical flat colonies. In the next days, a central cavity emerged and expanded, transforming the clumps into multicellular vesicles, closely resembling the TE of E3.5-E4.5 blastocyst stage embryos (Figures 6A-6C). Independent of the source of origin, all XTE cells were able to form cavities with close to absolute efficiency. The vesicles were classified into two groups - regular, spherical structures containing a cavity surrounded by a continuous single cell layer and irregular, deformed oval structures with one or more smaller cavities containing few cells or cell debris (Figure 10A). Regular vesicles were established with up to 85% efficiency, showing that the XTE cells have a very robust self-organization capacity (Figure 6D). The XTE vesicles were Cdx2 and Gata6 positive and exhibited nuclear accumulation of Yap similar to the TE of pre-implantation embryos (Figures 6E-G). The transcriptome and the Elf5 promoter methylation status of the XTE vesicles were similar to the XTE cells grown as epithelial colonies (Figures 4A, 4B, 5A and 5B). The vesicles showed proper orientation of the apical-basal polarity axis, with Par6 and cortical actin localized on the outer membrane and E-cad localized on the basolateral membrane, closely mimicking the general architecture of the TE of blastocyst-stage embryos (Figures 6H).

Since a major feature of the mural TE is the differentiation into the migratory trophoblast that initiates implantation, it was asked whether the XTE vesicles can also give rise to migratory cells. The differentiation process of the mural TE can be induced in vitro by culturing blastocysts in serum-containing medium (Figures 61 and 10B). Similarly, XTE vesicles cultured on tissue culture plates in the presence of serum quickly lost their spherical structure and transformed into migratory cells, resembling the invasive trophoblast (Figures 6I and 10B).

Finally, it was analysed whether the XTE cells can incorporate ESC for complementing the vesicles with an “artificial ICM”. As a control, 8-cell stage embryos aggregated with fluorescently labelled (Histone H2B-Cerulean) ESC were used that integrated into the ICM and established chimeric blastocysts (Figures 6J and 6L). The same approach was used to generate artificial blastocyst-like embryoids. After 24 h of culture in cell-repellent plates, small clumps of XTE cells were placed into individual microwells. Histone H2B-Cerulean+ ESC were added to the XTE clumps and subsequently internalized and positioned at one side of the emerging cavity, assembling blastocyst-like embryoids (Figures 6K and 6L). Upon transfer into the pseudopregnant females, the embryoids induced uterine decidualization (Figure 6M), but egg cylinder-like structures were not formed (Figures 6N). This is in accord with the restricted developmental potential of the XTE cells, which were not able to generate functional ExE, therefore setting a time frame of embryoid “development” from morula-like up to blastocyst-like stages (Figure 60).

Example 7 - Incorporation of human pluripotent cells into XTE vesicles and generation of blastocyst-like embryoids.

XTE cells expressing membrane tdTomato were co-aggregated with human induced pluripotent stem cells, expressing Venus fluorescent protein and cultured on cell repellent plate. Similar to the ESC of Example 6, the human pluripotent cells were incorporated and position on one side of the XTE vesicle, establishing an artificial ICM and together with the XTE cells, forming a blastocyst-like embryoid (Figure 11).

Example 8 - Discussion

During the 8- to 16-cell stage transition, two cell populations are established in the early mouse embryo: outside cells that form the TE and the inside ICM cells. The outside cells are not restricted to the TE fate until the 32-cell stage, as they can divide asymmetrically and give rise to ICM cells. Even an additional minor wave of asymmetric division has been found as late as the 64-cell stage ¹ · ² . Thus, the 16- to 64-cell stage TE has the capacity to generate both epiblast and PE progenitors, and this potential rapidly decreases after E3.5. Here it is shown that in addition to the master TE factor Cdx2, the pre-implantation TE expresses the PE determinant Gata6. Therefore, the early TE cells may occupy a state where more than one developmental programme co-exists, enabling developmental flexibility that allows the early embryo to adapt and compensate for alterations in cell position and overall cell number. It was found that the PE-derived XEN cells show analogous developmental flexibility. These cells can upregulate Cdx2, establishing Gata6+/Cdx2+ XTE cells that combine features of both TE and PE lineages. In addition, previous studies showed that the XEN cells can reprogramme into chemically induced pluripotent stem cells (ciPSC) ¹⁷ - ¹⁸ , acquiring characteristics akin to the pre-implantation epiblast. The generation of both ciPSC and XTE cells does not require forced expression of transgenes but depends on the establishment of the XEN state, which enables reprogramming by small molecules and ligands. Moreover, the XEN-like cells can be directly converted into functional neurons and hepatocyte-like cells, bypassing establishment of pluripotency ¹⁹ . This shows that the XEN state has a remarkable potential to respond to external signalling cues and adopt embryonic and extraembryonic fates.

It was determined that XEN and XEN-like cells acquire TE properties following similar principles as the TE specification in vivo. Activation of Cdx2 in XTE cells requires epithelialization and accumulation of Yap in the nucleus (Figure 60). At the same time, these cells maintain the PE transcriptional circuit, enabling extended integration capacity of the XTE cells in both extraembryonic lineages of the blastocyst. However, after implantation, the XTE cells are maintained only in the mural part of the Reichert’s membrane and do not contribute to the ExE and visceral endoderm. Thus, the XTE cells are not bona fide stem cells of either trophoblast or PE linages but instead exhibit mural TE characteristics and terminal developmental capacity. This also sets the margin of the XTE-based embryoids “development” up to a blastocyst-like stage but not beyond.

The XTE cells showed robust self-organization potential, enabling highly efficient formation of multicellular vesicles that resemble the overall 3D architecture of the TE. Previous reports utilized conventional TSC or extended pluripotent stem (EPS) cells to form similar vesicles with overall much lower efficiency of cavitation in comparison to the XTE cells ^20~22 . This low efficiency indicates that the TSC and EPS cells may contain a subpopulation of vesicle- initiating cells that manifest cavitation properties under specific culture conditions. The culture media used for cavity induction in these pioneering studies contains factors such as Bmp4, CHIR99021 , Fgf4 and heparin, a composition that is strikingly similar to our XTE medium, which induces TE-like properties in PE, XEN and XEN-like cells. Moreover, it was previously reported that EPS cells can give rise to XEN cells ²⁰ , and, in addition, TSC are often co-derived together with XEN cells ²³ - ²⁴ . Thus, it is plausible that a vesicle-initiating subpopulation with the XEN cell identity may exist or emerge in TSC or EPS cell cultures. Although such a subpopulation can gain TE properties and trigger decidual response, these cells will subsequently fail to generate functional placental tissues. This can provide one explanation why despite uterine decidualization, none of the artificial blastocyst-like structures reported to date can properly develop further, following transfer into a foster mother.

In summary, it is shown herein that the PE of the pre-implantation embryo, as well as conventional XEN and ESC-derived XEN-like cells, can acquire TE properties. The XEN state activates the pre-implantation TE programme following the trophoblast specification cascade of the first lineage segregation. The resulting XTE cells combine characteristics of the two extraembryonic lineages, enabling integration into both the TE and PE domains. The outer cells of the early embryo also co-express TE and PE markers and may reside in a similar state that enables extended developmental flexibility. Mimicking the TE of morula/blastocyst stage embryos, the XTE cells can establish a blastocoel-like cavity and integrate pluripotent cells, forming a self-organizing entity. Thus, taken together, the XTE cells provide a platform for deciphering the processes of cell fate specification, cell-cell recognition, lineage segregation and cavitation of the mouse embryo, as well as a blueprint for the establishment of in vitro models of pre-implantation embryogenesis in other mammalian species.

Example 9 - Single cell RNA-seq analysis of XTE based embryo-like structures

To further characterise the XTE based embryo-like structures single cell RNA-seq analysis was performed. As a reference, E4.5 blastocysts were sequenced and analysed. The cells of the E4.5 embryos distributed into three distinct groups - epiblast (Sox2 and Nanog positive), trophectoderm (TE) (Krt8 and Krt18 positive) and primitive endoderm (PE) (Gata4 and Sox17 positive) (Figures 12A and 12C). Importantly, the XTE cells positioned between the TE and PE lineages, whereas the ESC clustered together with the epiblast and non-reprogrammed cells (E-cadherin negative) were positioned separately away from all other clusters (Figures 12A-D). Essentially, the XTE cells expressed both TE and PE-specific genes, as well as shared markers, such as Dab2 and Gata6 (Figure 12C), altogether showing that the XTE cells transcriptionally capture features of both PE and TE lineages of the pre-implantation embryo. Example 10 - Methods

Mice

The mice used in the study were at age from 6 weeks to 5 months. The animals were maintained under a 14-hour light/10-hour dark cycle with free access to food and water. Male mice were kept individually, whereas the female mice were housed in groups of up to 4 per cage. Embryos for experiments were obtained from wild-type and transgenic strains from matings using females with natural ovulation cycle or after superovulation in case of morula aggregations. The mouse strains used in the study are B6C3F1 , CD1 , mT/mG ⁸ and Yap ^fl/fl /Taz ^{fl/fl 16} . Animal experiments and husbandry were performed according to the German Animal Welfare guidelines and approved by the Landesamt fur Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen (State Agency for Nature, Environment and Consumer Protection of North Rhine-Westphalia).

Cell lines

XEN cells were maintained in DMEM supplemented with 15% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 50 U/ml penicillin-streptomycin, 0.1 mM 2-mercaptoethanol. For reprogramming experiments, the XEN cells were passaged and maintained in N2B27 medium. TSC were grown on mitotically inactivated MEFs in the presence of 25 ng/ml Fgf4 and 1 pg/ml Heparin. ESC were maintained in DMEM medium supplemented with 15% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM non- essential amino acids, 50 U/ml penicillin-streptomycin, 0.1 mM 2-mercaptoethanol, 0.4 mM PD0325901 , 3 mM CHIR99021 and 4 ng/ml Lif on gelatin coated culture plates. All cell types were grown at 37 °C / 5% C0 ₂ and passaged using 0.05% Trypsin-EDTA. Yap/Taz double- floxed ESC were derived from Yap/Taz double-floxed mouse strain ¹⁶ . E3.5 embryos were plated into individual wells of a 96-well plate with inactivated MEFs and grown in ESC medium. After 4 days of culture, the blastocyst outgrowths were trypsinised, transferred into fresh wells and expanded once ESC colonies emerged. Yap/Taz double floxed ESC were stably transfected with Cre-ERT2 and Dox-inducible Gata6 cloned into a plB12-PB-hCMV1- cHA-IRES-Venus plasmid, with lipofectamine 2000 (Invitrogen) using manufacturer’s protocol. Expression of Tet-on Gata6 transgene was stimulated using 1 pg/ml of Dox and Cre/loxP recombination was induced using 500 nM of 40HT. Ecad fl/fl ESC were stably transfected with Cre-ERT2 and transiently transfected with Dox-inducible Gata6 cloned into a plB12-PB-hCMV1-cHA-IRES-Venus plasmid using lipofectamine 2000 (Invitrogen) following manufacturer’s protocol. Establishment of XTE cells

XTE were derived from E3.5 blastocysts by plating embryos into individual wells of 96-well plate coated with mitotically inactivated MEFs in XTE medium (N2B27 supplemented with 3 mM CHIR99021, 50 ng/ml BMP4, 25 ng/ml Fgf4,1 pg/ml Heparin and 20 ng/ml Activin) The blastocyst outgrowths were dissociated after 4 days using 0.05% Trypsin-EDTA and seeded into fresh wells to allow the emergence of XTE colonies. The XTE cells were then sorted by FACS to select for PDGFRa/CD40 double positive population and maintained in XTE medium on fibronectin-coated wells.

Conversion of ESC to XTE cells: ESC that carries Dox inducible Gata4 transgene and Histone H2B:Venus knock-in cassette in the Gata6 locus (Gata6-H2B:Venus) ¹⁰ or Dox inducible Gata6 were converted to XEN-like cells by a 24 h pulse of Dox. After that the XEN- like cells were sorted for expression of Venus and PDGFRa and seeded on fibronectin- coated plates either in N2B27 medium (for experiments using XEN-like cells) or in XTE medium (for conversion to XTE cells). The XEN-like cells were cultured in XTE medium for 5 days allowing conversion to XTE cells that were subsequently sorted by FACS for PDGFRa/CD40 expression.

Conversion of XEN cells to XTE cells: XEN cells were grown in XTE medium on fibronectin- coated plates for 3-4 passages followed by sorting for PDGFRa/CD40 double-positive population of XTE cells.

Lineage tracing mT/mG reporter mouse strain ⁸ was used for lineage tracing experiment. This strain harbours membrane-targeted tandem dimer Tomato (mT) cassette flanked by loxP sites, followed by membrane-targeted GFP (mG), integrated in the Rosa26 locus. Zona-free mT/mG blastocysts were incubated with 1.5 mM of recombinant cell-permeant Cre protein (Tat-Cre, Millipore) in pre-warmed KSOM medium (Millipore) for 2h at 37 °C in 5% CO2 atmosphere in air. After that the embryos were washed and cultured in KSOM overnight at 37°C in 5% CO2. The expression of mTom and mGFP was examined on the next day.

Immunosurgery for TE removal

ICMs of E3.5 mT/mG embryos subjected to Tat-cre treatment were isolated by immunosurgery ²⁵ and the ICM was then placed on inactivated MEFs in XTE medium for derivation of XTE cells. Vesicle formation

For generation of multicellular vesicles, 10,000-20,000 PDGFRa/CD40 double-positive XTE cells were seeded per well of a 96-well plate (CELLSTAR® cell repellent plates, Greiner Bio- One) containing 100 pi of XTE medium. The cells were allowed to self-organise for 4 days.

Embryoid generation

Embryoids were grown by seeding ES cells (10,000 cells) and XTEs (50,000-80,000) in an AggreWell™400 plates (StemCell Technologies) in 24-well format for 48 h and then the aggregates were transferred to cell repellent plates for 48 h to facilitate cavitation and formation of embryoids.

RNA sequencing and bioinformatic analysis

RNA was isolated from cells using NucleoSpin® RNA isolation kit following the manufacturer’s protocol (Macherery and Nagel) with a purity ratio of 2 for absorbances at 260 nm and 280 nm, measured using Nanodrop 2000c. 1 pg of total RNA was then used as the starting material for mRNA enrichment which was done using NEBNext® Poly(A) mRNA Magnetic Isolation Module and cDNA library was prepared using NEBNext® Ultra™ II Directional RNA Library Prep Kit. Sequencing was performed on the NextSeq 500 system (75 cycles, high output, v2.5) in the Core Facility Genomics of the Medical Faculty, University of Munster.

Transcript expression from RNA-seq was quantified using Salmon ²⁶ (version 0.13.0) with parameters "-seqBias -I A" using a transcriptome index created from Mus musculus genome version GRCm38 (Ensembl release 93). Transcript quantifications were imported into R and associated with genes using the tximport package (version 1.13.12, ²⁷ ). Differential expression analysis was performed using DESeq2 (version 1.25.10, ²⁸ ). Genes were considered significantly differentially-expressed between two conditions if the comparison had an absolute log2 fold change of at least 2, and an adjusted p-value less than 0.05.

The variance stabilising transformation was applied to data for the purposes of visualisation using PCA or heatmaps. PCA was performed using the "prcomp" R function on the top 500 most variable genes across all samples. For gene expression clustering, genes that were significantly differentially expressed in at least one comparison were considered. Gene expression matrices were transformed to row Z-scores and clustered using k-means clustering using the "kmeans" R function. The appropriate number of clusters was assessed using the elbow method (Figure 8A).

Gene Ontology enrichment analysis was carried out using the "compareCluster" function from the clusterProfiler package (version 3.13.0, ²⁹ ) with a q-value threshold of 0.1. Results were simplified to remove highly similar GO terms based on semantic similarity using the "simplify" function with the Wang method and a similarity threshold of 0.7 (GOSemSim version 2.11 .0 ³⁰ ).

RNA-seq data analysis and visualisation were carried out using R (version 3.6.1 ³¹ ). The ggplot2 (version 3.2.1 ³² ) and ComplexHeatmap (version 2.1.0, ³³ ) R packages were used for data visualisation and the dplyr (version 0.8.3, ³⁴ ) and purrr (version 0.3.2, ³⁵ ) packages were used for general data analysis.

Quantitative PCR

Total RNA was isolated using NucleoSpin® RNA isolation kit following the manufacturer’s protocol (Macherery and Nagel) and reverse transcribed using MMLV-Reverse transcriptase (Applied Biosystems). Transcript levels were quantified using iTaq SYBR Green Supermix (Bio-Rad) and the gene expression was normalized to the housekeeping gene b-actin. The calculations were done using the delta Ct algorithm. The primer sequences are listed in Table 1.

Genomic DNA isolation and PCR

PureLink ™ Genomic DNA Mini Kit was used to isolate genomic DNA according to the manufacturer’s protocol. PCR was performed using the primers listed in Table 2.

Bisulfite sequencing

To determine the DNA methylation status at regulatory regions of Elf5 gene, genomic DNA was isolated using PureLink ™ Genomic DNA Mini Kit and bisulfite conversion was carried out using 2 pg of isolated genomic DNA with EZ DNA methylation kit (Zymo Research) according to the manufacturer's protocol. The bisulfite-converted DNA was amplified by PCR using the previously described primers ¹² . The PCR products were cloned using the TOPO- TA kit (Invitrogen) according to the manufacturer's protocol. Individual clones were then sequenced and sequences were analysed using the Quantification Tool for Methylation Analysis (QUMA, http://quma.cdb.riken.jp).

Morula aggregation

The Zona pellucida of E2.5 embryos was removed via brief exposure to Tyrode’s solution (Sigma). After that ESC or XTE cells were aggregated with the zona-free morulae in individual microwells filled with KSOM medium and covered with mineral oil. The embryos were cultured to blastocyst stage in vitro at 37 °C in a humidified atmosphere of 5% CO2. Immunofluorescence labelling and Microscopy

The samples were fixed using 4% PFA for 20 min, washed twice with 1% FCS in PBS (wash buffer) and permeabilised with 0.1 M Glycin/0.3% TritonX-100 (3-5 min for cells and preimplantation embryos and 10 mins for post-implantation embryos). After washing, the samples were incubated with primary antibodies diluted in blocking buffer (2% FCS in PBS) for 24h at 4°C. The specimens were then washed twice and incubated with secondary antibody and DAPI overnight at 4°C. On the following day, the samples were washed again twice and kept in the wash buffer for imaging. The embryos were mounted in drops of 1% FCS in PBS on glass-bottom plates and covered with mineral oil, whereas cells were directly grown on the ibidi m-plates coated with fibronectin and processed further for imaging. The antibodies used in the study are listed in Table 3. Conventional epifluorescence microscopy was performed using Leica AF600, confocal microscopy was performed using Leica SP5 and Zeiss LSM780 systems. Images were processed using Fiji, Icy and IMARIS (Bitplane) software.

Fluorescence-activated cell sorting (FACS)

Cells were dissociated using 0.05% trypsin and resuspended in PBS supplemented with 3% FCS (dilution buffer). For sorting cells based on PDGFRa and CD40 expression, the cells were incubated with the respective antibodies (Table 2) for 1h on ice and washed three times with dilution buffer to remove traces of unbound antibodies. After that, the cells were resuspended in the dilution buffer and subjected to sorting in FACSAria llu sorter (BD biosciences). Single viable cells were first selected based on FSC- and SSC-gating and either PDGFRa+ and Venus+ positive cells or PDGFRa+ and CD40+ cells were collected depending on the experimental setup. Flowjo software was used for data analysis and plotting.

Western blot

Cells were lysed using buffer containing 10 mM Tris-HCI pH 7.6, 150 mM NaCI, 2 mM MgCh, 2 mM EDTA, 0.1% Triton-X-100, 10% Glycerol and 1x protease inhibitors cocktail (Complete ultra). The lysis buffer was added directly to the culture dish and the cells were scraped off the surface. The lysate was kept on ice for 20 min and then sonicated for 5 min. The total protein concentration was measured using Pierce™ BCA Protein Assay Kit. 25 pg of the total protein per sample was run on SDS-Polyacrylamide gel alongside with Precision Plus Protein Kaleidoscope Standard marker and subsequently transferred onto a PVDF membrane. Next, the membrane was incubated in 5% dry milk in PBST for 30 min at room temperature for blocking and then incubated with primary antibodies at 4 °C, overnight. On the next day, the membrane was washed tree times with PBST and incubated with secondary antibodies conjugated to HRP for 2h at room temperature. The proteins were detected using the ECL Prime kit (GE Healthcare) by exposing the membranes to ECL Hyperfilms (GE Healthcare).

Quantification and Statistical analysis Values represented in bar graphs are shown as mean and error bars represent standard error of the mean (SEM). Graphs were generated using GraphPad Prism. All significance was calculated using two-tailed unpaired Student’s t-test and are represented as * p< 0.05, ^* * p<0.01 , *** p<0.001 , * ^* ** p<0.0001

Table 1. qPCR primers used in this study. Gene Forward Reverse

Cdx2 ACCGGAATT GTTT GCTGCT GT T CCCGACTT CCCTT CACCAT

Gata6 AGACGGCACCGGTCATTACC T CACCCT CAGCATTT CT ACGCC

Sox17 GCTAGGCAAGTCTTGGAAGG CTT GT AGTT GGGGTGGT CCT

Nanog AGGGT CT GCT ACT GAGAT GCTCTG CAACC ACT GGTTTTT CT GCCACCG b-actin GGTCATCACTATTGGCAACG T CCAT ACCC AAG AAGGAAG G

Table 2. Primers used for genotyping.

Gene Forward Reverse Product size

Yap CTTTT GT CCCT CACCCAGCT A GCT GAAAGAAT GCACAAGG Floxed -1446bp TCC Del - 432bp

Taz AAGCAGTTT CC ACTT CAT G AAAC AGTCAAGAGGGGCAAAGTT Floxed- 330bp

GTGA

E-cad CTTATACCGCTCGAGAGCCGGA; T GACACAT GCCTTT ACTTT A Floxed - 297bp T GTT CCAAGCCT GCTTT CTT GT Del - 444bp

GAPDH ACCACAGTCCAT GCCAT CACT GT CCACCACCCT GTT GCT G 450bp TA

Table 3. List of antibodies. Antibody Vendor Catalogue number Dilution

Cdx2 (mouse) Biogenex MU392A-5UC 1 :300 b-catenin (mouse) BD Biosciences 610154 1 :300 E-cadherin (mouse) BD Biosciences 610182 1 :300 Nanog (mouse) Cell signaling technology 8822 1 :300

Oct4 (mouse) Santa Cruz Biotechnology sc-5279 1 :300

Oct4 (rabbit) Cell signaling technology 83932S 1 :300

Yap (rabbit) Cell signaling technology 14074S 1 :300

RFP (rabbit) Biomol 600-401-379 1 :300 Eomes (rabbit) Abeam ab23345 1 :300 Pard6B1 (rabbit) Santa Cruz Biotechnology sc-67393 1:300

Sox2 (rabbit) Cell signaling technology 23064S 1 :300

Gata6 (rabbit) Thermo Fisher Scientific PA1-104 1:300

Gata4 (rabbit) Santa Cruz Biotechnology SC-9053 1 :300

Sox17 (goat) R&D AF1924 1 :300

GFP (goat) R&D AF4240 1:200

Tromal (rat) Home made 1 :200

F-actin (Alexa Fluor® 647 Cell signaling technology 8940S 1:200 Phalloidin)

Alexa 594 (donkey Anti- Thermo Fisher Scientific A-21207 1 :200 Rabbit)

Alexa 488 (donkey Anti- Thermo Fisher Scientific A-21208 1 :200 Rabbit)

Alexa 488 (donkey Anti- Thermo Fisher Scientific A-21202 1:200 Mouse)

Alexa 647 (donkey Anti-Rat) Thermo Fisher Scientific A-21247 1 :200 Alexa 647 (donkey AntiThermo Fisher Scientific A-31571 1:200 mouse)

Alexa 488 (donkey Anti-Goat) Thermo Fisher Scientific A-11055 1 :200 Alexa 647 (donkey Anti-Goat ) Thermo Fisher Scientific A-21447 1:200 Alexa 488 (donkey Anti- Thermo Fisher Scientific A-21206 1 :200 Rabbit)

Pdgfra (mouse, PE-tagged) E-biosciences 12-1401-81 1 :200

CD40 (rabbit, APC-tagged) Thermo Fisher Scientific 17-0401-82 1 :100 a-tubulin (mouse) Sigma T6199 1:500

Secondary HRP Anti-Mouse Jackson 115-035-044 1:10000

IgG References

1 Morris, S. A et al. Origin and formation of the first two distinct cell types of the inner cell mass in the mouse embryo. Proc Natl Acad Sci U S A 107, 6364-6369, doi:10.1073/pnas.0915063107 (2010).

2 Yamanaka, Y., Lanner, F. & Rossant, J. FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development 137, 715-724, doi: 10.1242/dev 043471 (2010).

3 Govindasamy, N., Duethorn, B., Oezgueldez, H. O., Kim, Y. S. & Bedzhov, I. Test- tube embryos - mouse and human development in vitro to blastocyst stage and beyond. I nt J Dev Biol 63, 203-215, doi: 10.1387/ijdb.180379ib (2019). Nichols, J. & Smith, A. Pluripotency in the embryo and in culture. Cold Spring Harb Perspect Biol 4, a008128, doi: 10.1101/cshperspect.a008128 (2012).

5 Tanaka, S., Kunath, T., Hadjantonakis, A. K., Nagy, A. & Rossant, J. Promotion of trophoblast stem cell proliferation by FGF4. Science 282, 2072-2075 (1998). Adachi, K. et al. Context-dependent wiring of Sox2 regulatory networks for selfrenewal of embryonic and trophoblast stem cells. Mol Cell 52, 380-392, doi:10.1016/j.molcel.2013.09.002 (2013). Rayon, T. et al. Distinct mechanisms regulate Cdx2 expression in the blastocyst and in trophoblast stem cells. Sci Rep 6, 27139, doi:10.1038/srep27139 (2016). Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L. & Luo, L. A global double- fluorescent Cre reporter mouse. Genesis 45, 593-605, doi: 10.1002/dvg.20335 (2007). Kan, N. G. et al. Gene replacement reveals a specific role for E-cadherin in the formation of a functional trophectoderm. Development 134, 31-41, doi: 10.1242/dev.02722 (2007).

10 Schroter, C., Rue, P., Mackenzie, J. P. & Martinez Arias, A. FGF/MAPK signaling sets the switching threshold of a bistable circuit controlling cell fate decisions in embryonic stem cells. Development 142, 4205-4216, doi: 10.1242/dev.127530 (2015).

11 Strumpf, D. et al. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 132, 2093-2102, doi: 10.1242/dev.01801 (2005).

12 Ng, R. K. et al. Epigenetic restriction of embryonic cell lineage fate by methylation of Elf5. Nat Cell Biol 10, 1280-1290, doi:10.1038/ncb1786 (2008).

13 Vestweber, D. & Kemler, R. Identification of a putative cell adhesion domain of uvomorulin. EMBO J 4, 3393-3398 (1985). 4 Nishioka, N. et al. The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell 16, 398-410, doi: 10.1016/j.devcel.2009.02.003 (2009). 5 Boussadia, O., Kutsch, S., Hierholzer, A., Delmas, V. & Kemler, R. E-cadherin is a survival factor for the lactating mouse mammary gland. Mech Develop 115, 53-62, doi:Pii S0925-4773(02)00090-4, Doi 10.1016/S0925-4773(02)00090-4 (2002). 6 Reginensi, A. et al. Yap- and Cdc42-dependent nephrogenesis and morphogenesis during mouse kidney development. PLoS Genet 9, e1003380, doi: 10.1371 /journal. pgen.1003380 (2013). 7 Hou, P. et al. Pluripotent stem cells induced from mouse somatic cells by small- molecule compounds. Science 341, 651-654, doi: 10.1126/science.1239278 (2013). 8 Zhao, Y. et al. A XEN-like State Bridges Somatic Cells to Pluripotency during Chemical Reprogramming. Cell 163, 1678-1691 , doi: 10.1016/j.cell.2015.11.017 (2015). 9 Li, X. et al. Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State. Cell Stem Cell 21, 264-273 e267, doi:10 1016/j.stem.2017.05.019 (2017). 0 Li, R. et al. Generation of Blastocyst-like Structures from Mouse Embryonic and Adult Cell Cultures. Cell 179, 687-702 e618, doi: 10.1016/j.cell.2019.09.029 (2019). 21 Rivron, N. C. et at. Blastocyst-like structures generated solely from stem cells. Nature 557, 106-111 , doi: 10.1038/S41586-018-0051-0 (2018).

22 Sozen, B. et at. Self-Organization of Mouse Stem Cells into an Extended Potential Blastoid. Dev Cell 51, 698-712 e698, doi: 10.1016/j.devcel.2019.11.014 (2019).

23 Golding, M. C. Generation of trophoblast stem cells. Methods Mol Biol 925, 49-59, doi: 10.1007/978-1-62703-011 -3_3 (2012).

24 Himeno, E., Tanaka, S. & Kunath, T. Isolation and manipulation of mouse trophoblast stem cells. Curr Protoc Stem Cell Biol Chapter 1, Unit 1E 4, doi: 10.1002/9780470151808.sc01 e04s7 (2008).

25 Solter, D. & Knowles, B. B. Immunosurgery of mouse blastocyst. Proc Natl Acad Sci U SA 72, 5099-5102 (1975).

26 Patro, R., Duggal, G., Love, M. I., Irizarry, R. A. & Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods 14, 417-419, doi:10.1038/nmeth.4197 (2017).

27 Soneson, C., Love, M. I. & Robinson, M. D. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. FIOOORes 4, 1521, doi: 10.12688/P OOOresearch.7563.2 (2015).

28 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550, doi:10.1186/s13059-014-0550-8 (2014).

29 Yu, G. C., Wang, L. G., Han, Y. Y. & He, Q. Y. clusterProfiler: an R Package for Comparing Biological Themes Among Gene Clusters. Omics 16, 284-287, doi:10.1089/omi.2011.0118 (2012).

30 Yu, G. C. et al. GOSemSim: an R package for measuring semantic similarity among

GO terms and gene products. Bioinformatics 26, 976-978, doi: 10.1093/bioinformatics/btq064 (2010).

31 Team, R. C. (R Foundation for Statistical Computing, 2019).

32 Wickham, H. ggplot2: Elegant Graphics for Data Analysis. (Springer-Verlag New York, 2016).

33 Gu, Z., Eils, R. & Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 32, 2847-2849, doi: 10.1093/bioinformatics/btw313 (2016).

34 Wickham, H., Frangois, R., Henry, L., Muller, K. & (2018).

35 Henry, L. & Wickham, H. (2019).