Background of the Invention Malignant tumors (cancers) are the second leading cause of death in the United States, after heart disease (Boring et al., CA Cancel J. Clin. 43, 7,[1993]).

Cancer is characterized by the increase in the number of abnormal, or neoplastic, cells derived from a normal tissue which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells, and the generation of malignant cells which eventually spread via the blood or lymphatic system to regional lymph nodes and to distant sites (metastasis). In a cancerous state a cell proliferates under conditions in which normal cells would not grow. Cancer manifests itself in a wide variety of forms. characterized by different degrees of invasiveness and aggressiveness.

Alteration of gene expression is intimately related to the uncontrolled cell growth and de- differentiation which are a common feature of all cancers. The genomes of certain well studied tumors have been found to show decreased expression of recessive genes, usually referred to as tumor suppression genes, which would normally function to prevent malignant cell growth, and/or overexpression of certain dominant genes, such as oncogenes, that act to promote malignant growth. Each of these genetic changes appears to be responsible <BR> <BR> <BR> <BR> for importing some of the traits that, in aggregate, represent the full neoplastic phenotype (Hunter, fuzz 64. 1129 [1991]; Bishop, Cell 64. 235-248 [1991]).

A well known mechanism of gene (e.g. oncogene) overexpression in cancer cells is gene amplification. This is a process where in the chromosome of the ancestral cell multiple copies of a particular gene are produced. The process involves unscheduled replication of the region of chromosome comprising the gene, followed by recombination of the replicated segments back into the chromosome (Alitalo et al., Adv. <BR> <BR> <BR> <BR> <P> Cancer 47 235-281 [1986]). It is believed that the overexpression ofthe gene parallels gene amplification, i.e. is proportionate to the number of copies made.

Proto-oncogenes that encode growth factors and growth factor receptors have been identified to play important roles in the pathogenesis of various human malignancies, including breast cancer. For example, it has been found that the human ErbB2 gene (erbB2, also known as her2, or c-erbB-2), which encodes a 185-kd transmembrane glycoprotein receptor (pl85HER2; HER2) related to the epidermal growth factor receptor (EGFR), is overexpressed in about 25% to 30% of human breast cancer (Slamon etal., Science 235:177-182 [1987]; Slamon et al., Science 244:707-712 [1989]).

It has been reported that gene amplification of a protooncogen is an event typically involved in the more malignant forms of cancer, and could act as a predictor of clinical outcome (Schwab etna!., Genes Chromosomes Cancer 1, 181-193 [1990]; Alitalo et aL, supra). Thus, erbB2 overexpression is commonly regarded as a predictor of a poor prognosis, especially in patients with primary disease that involves axillary lymph nodes (Slamon etna!., [1987] and [1989], supra; Ravdin and Chamness, Gene 159:19-27 [1995]; and Hynes and Stern, Biochim Biophys Acta 1198:165-184 [1994]), and has been linked to sensitivity and/or resistance to hormone therapy and chemotherapeutic regimens, including CMF (cyclophosphamide, methotrexate. and fluoruracil) and anthracyclines (Baselga et al.. Oncology 11(3 Suppl 1):43-48 [1997]). However, despite the association of

erbB2 overexpression with poor prognosis, the odds of HER2-positive patients responding clinically to treatment with taxanes were greater than three times those of HER2-negative patients (Ibid). A recombinant humanized anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 or Herceptin) has been clinically active in patients with ErbB2-overexpressing metastatic breast cancers that had received extensive prior anticancer therapy. (Baselga et al., J. C!in. Oncol.

14:737-744 [1996]).

Summarv of the Invention The present invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans. The present invention is based on the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the overexpression of the gene product and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act of predictors of the prognosis of tumor treatment.

In one embodiment, the present invention concerns an isolated antibody which binds a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide. In one aspect, the antibody induces death of a cell overexpressing a PRO187, PRO533, PRO2 14, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 polypeptide. In another aspect, the antibody is a monoclonal antibody, which preferably has nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support. In a further aspect, the antibody is an antibody fragment, a single-chain antibody, or an anti-idiotypic antibody.

In another embodiment, the invention concerns a composition comprising an antibody which binds a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide in admixture with a pharmaceutically acceptable carrier. In one aspect, the composition comprises a therapeutically effective amount of the antibody. In another aspect, the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent. Preferably, the composition is sterile.

In a further embodiment, the invention concerns nucleic acid encoding an anti-PRO 187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody, and vectors and recombinant host cells comprising such nucleic acid.

In a still further embodiment, the invention concerns a method for producing an anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody by culturing a host cell transformed with nucleic acid encoding the antibody under conditions such that the antibody is expressed, and recovering the antibody from the cell culture.

The invention further concerns antagonists and agonists of a PR0187, PR0533, PRO214, PRO240, PRO2 11, PRO23 0, PRO26 1, PR0246, or EBAF-2 polypeptide that inhibit one or more ofthe functions or activities of the PR0187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PR0246, or EBAF-2 polypeptide.

In a further embodiment, the invention concerns isolated nucleic acid molecules that hybridize to the complement of the nucleic acid molecules encoding the PRO187, PR0533, PRO2 14, PR0240, PRO2 11, PRO230, PRO26 1, PR0246, or EBAF-2 polypeptides. The nucleic acid preferably is DNA. and hybridization

preferably occurs under stringent conditions. Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herein, which, in turn, can find use in the modulation of the respective amplified genes, or as antisense primers in amplification reactions. Furthermore, such sequences can be used as part of ribozyme and/or triple helix sequence which, in turn, may be used in regulation of the amplified genes.

In another embodiment, the invention concerns a method for determining the presence of a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide comprising exposing a cell suspected of containing the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide to an anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody and determining binding of the antibody to the cell.

In yet another embodiment, the present invention concerns a method of diagnosing tumor in a mammal, comprising detecting the level of expression of a gene encoding a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher expression level in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained.

In another embodiment, the present invention concerns a method of diagnosing tumor in a mammal, comprising (a) contacting an anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the anti-PRO 187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody and the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide in the test sample. The detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type. A larger quantity of complexes formed in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained. The antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art.

The test sample is usually obtained from an individual suspected to have neoplastic cell growth or proliferation (e.g. cancerous cells).

In another embodiment, the present invention concerns a cancer diagnostic kit, comprising an anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody and a carrier (e.g. a buffer) in suitable packaging. The kit preferably contains instructions for using the antibody to detect the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide.

In yet another embodiment, the invention concerns a method for inhibiting the growth of tumor cells comprising exposing a cell which overexpresses a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide to an effective amount of an agent inhibiting the expression and/or activity of the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide. The agent preferably is an anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody, a small organic and inorganic molecule, peptide, phosphopeptide, antisense or ribozyme molecule, or a triple helix molecule. In a specific aspect, the agent, e.g. anti-PRO187,

PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody induces cell death.

In a further aspect, the tumor cells are further exposed to radiation treatment and/or a cytotoxic or chemotherapeutic agent.

In a further embodiment, the invention concerns an article of manufacture, comprising: a container; a label on the container; and a composition comprising an active agent contained within the container; wherein the composition is effective for inhibiting the growth of tumor cells, the label on the container indicates that the composition can be used for treating conditions characterized by overexpression of a PRO187, PRO533, PRO214, PRO240, PRO2 11, PRO23 0, PRO26 1, PRO246, or EBAF-2 polypeptide, and the active agent in the composition is an agent inhibiting the expression and/or activity of the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide. In a preferred aspect, the active agent is an anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibody.

A method for identifying a compound capable of inhibiting the expression and/or activity of a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide, comprising contacting a candidate compound with a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide under conditions and for a time sufficient to allow these two components to interact. In a specific aspect, either the candidate compound or the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide is immobilized on a solid support.

In another aspect, the non-immobilized component carries a detectable label.

Brief Description of the Drawings Figure 1 (SEQ ID NO: 1) shows the nucleotide sequence of DNA27864 that is a cDNA encoding a native sequence FGF-8 homologue (PRO 187).

Figure 2 (SEQ ID NO: 2) shows the derived amino acid sequence of a native sequence FGF-8 homologue (PRO187).

Figure 3 describes the Blast score, match and percent homology alignment between the sequence of DNA26645 (SEQ ID NO: 3; a virtual sequence used in the isolation of DNA27864) and the GenBank sequence S78462S3 (SEQ ID NO: 4).

Figure 4 demonstrates the specific binding of PRO533 (UNQ334) encoded by DNA49435 to FGF Receptor 3 (FGFR3).

Figure 5 shows the single stranded nucleotide sequence of a native sequence DNA49435 cDNA (SEQ ID NO: 5).

Figure 6 shows the derived amino acid sequence of a native sequence PRO533 FGF homologue polypeptide (SEQ ID NO: 6).

Figure 7 describes the Blast score, match and percent homology alignment between amino acid residues 3 to 216 of PRO533 (SEQ ID NO: 6) encoded by DNA49435 with residues 6 to 218 of AF007268~1, a fibroblast growth factor sequence (SEQ ID NO: 7).

Figure 8 shows AF007268, an FGF-15 EST sequence (SEQ ID NO: 8) which was used to search various public EST databases (e.g., GenBank, Dayhoff, etc.).

Figure 9 shows the nucleotide sequence of a native sequence EGF-like homologue cDNA DNA32286 (SEQ ID NO: 9).

Figure 10 shows the derived amino acid sequence of a native sequence EGF-like homologue (PRO214; SEQ ID NO: 10) as encoded by the coding sequence of Fig. 9.

Figure 11 shows the nucleotide sequence (SEQ ID NO: 11) of a native sequence PRO240 cDNA, wherein the nucleotide sequence is designated herein as "UNQ214" and/or "DNA34387".

Figure 12 shows the amino acid sequence (PRO240; SEQ ID NO: 12) derived from the nucleotide sequence shown in Figure 11.

Figure 13 shows the consensus nucleotide sequence designated "DNA30873" (SEQ ID NO: 13) derived from a variety of expressed sequence tags (EST's).

Figure 14 shows a BLAST sequence alignment analysis of a portion of the PRO240 amino acid sequence derived from the DNA34387 molecule ("DNA34387") (SEQ ID NO: 14) with the serrate protein precursor from Drosophilia melanogaster ("SERR~DROME) (SEQ ID NO: 15).

Figure 15 shows a BLAST sequence alignment analysis of a portion of the PRO240 amino acid sequence derived from the DNA34387 molecule ("DNA34387") (SEQ ID NO: 16) with the C-serrate-l protein of Gallus gallus ("GGCSERRAT 1") (SEQ ID NO: 17).

Figure 16 shows the nucleotide sequence (SEQ ID NO: 18) of a native sequence EGF-like homologue (designated "DNA32292").

Figure 17 shows the amino acid sequence (PRO2 11; SEQ ID NO: 19) derived from the nucleotide sequence shown in Figure 16.

Figure 18 shows the amino acid sequence (SEQ ID NO: 20) of PRO230 derived from the nucleotide sequence "DNA33223".

Figure 19 shows the consensus nucleotide sequence "DNA30857" (SEQ ID NO: 21) derived from the alignment of nucleotide sequence from a variety of expressed sequence tags (ESTs).

Figure 20 shows the nucleotide sequence (SEQ ID NO: 22) of a native sequence PRO230 cDNA, wherein the nucleotide sequence is designated herein as "DNA33223". As used herein, "DNA33223" is used interchangeably with "UNQ204".

Figure 21 shows an amino acid sequence alignment of PRO230 (residues 44-463; SEQ ID NO: 23) with a portion of a rabbit tubulointerstitial nephritis antigen precursor (SEQ ID NO: 24).

Figure 22 shows a nucleotide sequence (SEQ ID NO: 25) containing the nucleotide sequence (SEQ ID NO: 26, beginning with nucleotide 10 of SEQ ID NO: 25) of a native sequence PRO261 cDNA, wherein the nucleotide sequence (SEQ ID NO: 25) is a clone, designated as "UNQ228" and/or "DNA33473-se min". Also presented is the position of the initiator methionine residue, circled, at positions 1-3 of SEQ ID NO: 26.

Figure 23 shows the amino acid sequence (PRO26 1; SEQ ID NO: 27) derived from SEQ ID NO: 26.

Figure 24 shows a consensus nucleotide sequence designated "DNA308430 from dna" (SEQ ID No: 28) derived from the alignment of a number of EST sequences.

Figure 25 shows a BLAST alignment of a portion of the PRO26 1 amino acid sequence derived from the DNA33473-seq min molecule (SEQ ID No: 29) with a portion of human CTGF (SEQ ID NO: 30).

Figure 26 shows a nucleotide sequence (SEQ ID No: 31) containing the nucleotide sequence (SEQ ID NO: 32) of a native sequence PRO246 cDNA (nucleotides 126-1295), wherein the nucleotide sequence (SEQ ID No: 31) is designated herein as "UNQ220" and/or "DNA35639". The putative transmembrane domain of the protein is encoded by nucleotides beginning at nucleotide 855 in the figure.

Figure 27 shows the amino acid sequence (PRO 246; SEQ ID NO: 33) derived from nucleotides 126-1295 of the nucleotide sequence shown in Figure 26.

Figure 28 shows a consensus nucleotide sequence designated "DNA30955" (SEQ ID NO: 34) derived from the alignment of various EST sequences.

Figure 29 shows a BLAST sequence alignment of a portion of the PRO246 amino acid sequence derived from the DNA35639 molecule ("DNA35639") (SEQ ID NO: 35) with a portion of the human cell surface protein HCAR ("HSU907161~1 ", SEQ SEQ ID NO: 36).

Figure 30 shows the nucleotide sequence of a native-sequence EBAF-2 cDNA (SEQ ID NO: 40), its complementary sequence (SEQ ID NO: 38), the nucleotide sequence encoding residues 1-366 of the deduced amino acid sequence of a native-sequence EBAF-2 (SEQ ID NO: 39), and the derived amino acid sequence of a native-sequence EBAF-2 (SEQ ID NO: 40).

Figure 31 shows the virtual DNA 28722 (SEQ ID NO: 41) from which the oligonucleotide PCR primers were generated to screen various libraries to isolate a full-length sequence.

Figure 32 describes the BLASTTM score, match, and percent homology alignment between the protein human EBAF-2 (SEQ ID NO: 40), encoded by DNA33461 (SEQ ID NO: 37), and human EBAF (hereafter called EBAF-I) (SEQ ID NO: 42).

Figure 33 is a family tree showing the relationship between the EBAF-2 protein and other members of the TGF- superfamily.

Figure 34 is an in situ image showing the expression of DNA49435 over the gallbladder epithelium in adult tissues.

Figure 35 is an in situ image showing moderate expression of DNA32286 in placental stromal cells in membranous tissues.

Figure 36 is an in situ image showing moderate expression of DNA32286 in thyroid.

Figure 37 is an in situ image showing low level expression of DNA32286 in cortical neurons.

Figure 38 is an in situ image showing an intense signal associated with the expression of DNA33223 in arterial and venous vessels in the fetus. In arteries, the signal appeared to be confined to smooth- muscle/pericytic cells.

Figure 39 is an in situ image showing strong expression of DNA33223 in cells within placental trophoblastic villi.

Figure 40 in an in situ image showing strong expression of DNA35639 in fetal vascular endothelium.

Figure 41 shows the consensus sequence DNA28744 used in the identification of cDNA (DNA32286) encoding PRO2 14 (an EGF-like homologue).

Figure 42 shows the results of framework and epicenter mapping of PRO230.

Figure 43 shows the results of epicenter and framework mapping of PR0240.

Detailed Description of the Invention I. Definitions The phrases "gene amplification" and "gene duplication" are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as "amplicon." Usually, the amount of the messenger RNA (mRNA) produced, i.e. the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed.

"Tumor", as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.

The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometrial carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer.

"Treatment" is an intervention performed with the intention of preventing the development or altering the pathology of a disorder. Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. In tumor (e.g. cancer) treatment, a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e.g. radiation and/or chemotherapy.

The "pathology" of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, etc.

"Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc.

Preferably, the mammal is human.

"Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed.

Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt- forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICSTM.

Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.

The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes (e.g.

1131, 1125, y90 and Re 186t, chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof.

A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer.

Examples of chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g. paclitaxel (Taxol, Bristol- Myers Squibb Oncology, Princeton, NJ), and doxetaxel (Taxotere, Rhone-Poulenc Rorer, Antony, Rnace), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycins, esperamicins (see U.S. Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also included in this definition are hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone.

A "growth inhibitory agent" when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo. Thus, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce G I arrest and M-phase arrest. Classical M-phase blockers include the vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Those agents that arrest G I also spill over into S-phase arrest, for example, DNA allrylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further information can be found in The Molecular Basis ofCancer, Mendelsohn and Israel, eds., Chapter 1, entitled "Cell cycle regulation, oncogens, and antineoplastic drugs" by Murakami et al. (WB Saunders: Philadelphia, 1995), especially p. 13.

"Doxorubicin" is an athracycline antibiotic. The full chemical name of doxorubicin is (8S-cis)- 10-[(3-amino-2,3,6-trideoxy-a-L-lyxo-hexapyranosyl)oxy]-7,8, 9,10-tetrahydro-6,8,11 -trihydroxy-8- (hydroxyacetyl)- 1 -methoxy-5, 1 2-naphthacenedione.

The term "cytokine" is a generic term for proteins released by one cell population which act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor-a and -p; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF-P; platelet-growth factor; transforming growth factors (TGFs) such as TGF-a and TGF- ; insulin-like growth factor-I and -II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon-a, -p, and -y; colony stimulating factors (CSFs) such as macrophage-CSF (M-

CSF); granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF); interleukins (ILs) such as IL-I, IL-I a, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-lI, IL-12; a tumor necrosis factor such as TNF-a or TNF-P; and other polypeptide factors including LIF and kit ligand (KL). As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture and biologically active equivalents of the native sequence cytokines.

As used herein, the terms a "PRO187" polypeptide ("UNQ161", an FGF-8 homologue); a "PRO533" polypeptide ("UNQ334", an FGF homologue); a "PRO214" polypeptide ("UNQ188", an EGF-like homologue); a "PRO240" polypeptide "UNQ214"; a serrate homologue); a "PRO211" polypeptide ("UNQ185", an EGF-like homologue); a "PRO230" polypeptide ("UNQ204", a polypeptide having homology to tubulointerstitial nephritis antigen (TIN)); a "PRO261" polypeptide ("UNQ228", a polypeptide having homology to the connective tissue growth factor (CTGF)); a "PRO246" polypeptide ("UNQ220", a polypeptide having homology to the cell surface protein HCAR); and an "EBAF-2" polypeptide (a TGF- superfamily member) are used to refer to a polypeptide comprising a native sequence polypeptide having the same amino acid sequence as a corresponding PRO187, PR0533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide derived from nature, and fragments of such native sequence polypeptides. Such native sequence PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can be isolated from nature or, along with the respective fragments, can be produced by recombinant and/or synthetic means. The term specifically encompasses naturally-occurring truncated or secreted forms (e.g., an extracellular domain sequence), naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants of the PRO187, PRO533, PR0214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide. In one embodiment of the invention, the native sequence PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 is a full-length native presequence or a mature form of a PRO 187 polypeptide shown in Figure 2 (SEQ ID NO: 2); PRO533 polypeptide shown in Figure 6 (SEQ ID NO: 6); PRO214 polypeptide shown in Figure 10 (SEQ ID NO: 10); PRO240 polypeptide shown in Figure 12 (SEQ ID NO: 12); PRO211, polypeptide shown in Figure 17 (SEQ ID NO: 19); PRO230 polypeptide shown in Figure 18 (SEQ ID NO: 20); PRO26 1 polypeptide shown in Figure 23 (SEQ ID NO: 27); PRO246 polypeptide shown in Figure 27 (SEQ ID NO: 33), and EBAF-2 polypeptide shown in Figure 30 (SEQ ID NO: 40), respectively.

Fragments of the respective native polypeptides herein include, but are not limited, to polypeptide variants from which the native N-terminal signal sequence has been fully or partially deleted or replaced by another sequence, and extracellular domains of the respective native sequences, regardless whether such truncated (secreted) forms occur in nature.

An "isolated" nucleic acid molecule encoding a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2- encoding nucleic acid. An isolated PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated nucleic acid molecules therefore are distinguished from the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2-encoding nucleic acid molecule as it exists in natural cells. However, an isolated nucleic acid molecule encoding a PRO187, PRO533, PRO214, PRO240,

PRO2 11, PRO23 0, PRO26 1, PRO246, or EBAF-2 polypeptide includes nucleic acid molecules contained in cells that ordinarily express PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF- 2, where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.

The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site.

Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.

"Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biologv, Wiley Interscience Publishers, (1995).

"Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50"C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.l% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42"C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (5011g/ml),0.1 SDS, and 10% dextran sulfate at 42"C, with washes at 42"C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55 °C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55"C.

"Moderately stringent conditions" may be identified as described by Sambrook et al., Molecular Clowning: A Laboratorv Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and % SDS) less stringent than those described above. An example of moderately stringent conditions is overnight incubation at 370C in a

solution comprising: 20% formamide, 5 x SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in I x SSC at about 37-50"C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.

The term "epitope tagged" when used herein refers to a chimeric polypeptide comprising a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide fused to a "tag polypeptide". The tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused. The tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably, between about 10 and 20 amino acid residues).

"Active" or "activity" in the context of molecules identified based upon the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptides (or their coding sequences) refers to polypeptides (e.g. antibodies) or organic or inorganic small molecules, peptides, etc. which retain the biological and/or immunological activities/properties of a native or naturally-occurring PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2.

"Biological activity" in the context of an antibody or another molecule that can be identified by the screening assays disclosed herein (e.g. an organic or inorganic small molecule, peptide, etc.) is used to refer to the ability of such molecules to bind or complex with the polypeptides encoded by the amplified genes identified herein, or otherwise interfere with the interaction of the encoded pulypeptides with other cellular proteins. A preferred biological activity is growth inhibition of a target tumor cell. Another preferred biological activity is cytotoxic activity resulting in the death of the target tumor cell.

The phrase "immunological property" means immunological cross-reactivity with at least one epitope of a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide.

"Immunological cross-reactivity" as used herein means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological activity of a PRO187, PRO533, PRO214, PRO240, PRO2 11, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide having this activity with polyclonal antisera raised against the known active PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide. Such antisera are prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analogue in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds. The immunological cross-reactivity preferably is "specific", which means that the binding affinity of the immunologically cross-reactive molecule (e.g. antibody) identified, to the corresponding PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide is significantly higher (preferably at least about 2-times, more preferably at least about 4-times, even more preferably at least about 8-times, most preferably at least about 8-times higher) than the binding affinity of that molecule to any other known native polypeptide.

The term "antagonist" is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native PRO187, PRO533, PRO214, PRO240,

PRO2 11, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide disclosed herein. In a similar manner, the term "agonist" is used in the broadest sense and includes any molecule that mimics a biological activity of a native PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 polypeptide disclosed herein. Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native polypeptides, peptides, small organic molecules, etc.

A "small molecule" is defined herein to have a molecular weight below about 500 daltons.

"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas. The term "antibody" is used in the broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g bispecific antibodies) formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity.

"Native antibodies" and "native immunoglobulins" are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains. Each light chain has a variable domain at one end (VL) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains.

The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework (FR). The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a P-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the P-sheet structure. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat etna!., NIH Publ. No. 91-3242, Vol. I, pages 647- 669 (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.

"Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab' F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et aL, Protein Enp. 8(10):1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.

Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.

"Fv" is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non- covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.

The Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHi domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (A), based on the amino acid sequences of their constant domains.

Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g, IgGI, IgG2, IgG3, IgG4, IgA, and IgA2. The heavy-chain constant domains that correspond to the different classes of immunoglobulins are called a, o, e, y, and ,u, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.

Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et aL, Nature,256:495 [1975], or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567). The "monoclonal antibodies" may also be isolated from phage antibody

libraries using the techniques described in Clackson etna!., Nature 352:624-628 [1991] and Marks etna!., J. Mol.

Biol., 222:581-597 (1991), for example.

The monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567; Morrison etna!., Proc. Natl. Acad. Sci. USA, 81:6851-6855 [1984]).

"Humanized" forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a CDR of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv FR residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and maximize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence.

The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature. 321:522-525 (1986); Reichmann etna!., Nature, 332:323-329 [1988]; and Presta, Curr. Op. Struct. Biol.. 2:593-596 (1992).

The humanized antibody includes a PRIMATIZEDfMantibody wherein the antigen-binding region of the antibody is derived from an antibody produced by immunizing macaque monkeys with the antigen of interest.

"Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding. For a review of sFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994).

The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH - VL). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et aL, Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).

An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and

other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

The word "label" when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.

By "solid phase" is meant a non-aqueous matrix to which the antibody of the present invention can adhere. Examples of solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g, agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones. In certain embodiments, depending on the context, the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g., an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149.

A "liposome" is a small vesicle composed of various types of lipids, phospholipids and/or surfactantwhich is useful for delivery of a drug (such as an PROl87, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide or an antibody thereto and, optionally, a chemotherapeutic agent) to a mammal. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.

As used herein, the term "immunoadhesin" designates antibody-like molecules which combine the binding specificity of a heterologous protein (an "adhesion") with the effector functions of immunoglobulin constant domains. Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous"), and an immunoglobulin constant domain sequence. The adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-I, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-I and IgA-2), IgE, IgD or IgM.

II. Compositions and Methods of the Invention 1. Preparation of the PRO187. PRO533. PRO214. PRO240. PRO211. PRO230. PRO261.

PRO246. and EBAF-2 polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO187 (UNQ161), PRO533 (UNQ334), PRO214 (UNQ188), PRO240 (UNQ214), PRO211 (UNQl8S), PRO230 (UNQ204), PRO261 (UNQ228), PRO246 (UNQ220), or EBAF-2. In particular, cDNAs encoding certain PRO187, PRO533, PRO214, PRO240, PRO211, PRO23 0, PRO26 1, PRO246, and EBAF-2 polypeptides have been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separate expression rounds may be given

different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for sake of simplicity, in the present specification the proteins encoded by nucleic acid referred to as "DNA27864", "DNA49435", "DNA32286", "DNA34387", "DNA32292", "DNA33223", "DNA33473", "DNA35639", and "DNA33461", as well as all further native homologues and variants included in the foregoing definition of PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 polypeptide, will be referred to as "PR0187", "PRO533", "PRO214", "PRO240", "PRO211", "PRO230", "PRO261", "PRO246", or "EBAF-2" polypeptide, regardless of their origin or mode of expression.

The description below relates primarily to production of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, and EBAF-2 polypeptides by culturing cells transformed or transfected with a vector containing PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2-encoding nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptides. For instance, the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart et al., Solid-Phase Pentide Svnthesis, W.H.

Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., 85:2149-2154 (1963)]. In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2. i. Isolation of DNA Encoding a PRO187. PRO533. PRO214. PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide, DNA encoding PRO 187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 may be obtained from a cDNA library prepared from tissue believed to possess the PRO187, PRO533, PRO214, PRO240, PRO211, PR0230, PRO261, PRO246, or EBAF-2 mRNA and to express it at a detectable level. Accordingly, human PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples. The PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2-encoding gene may also be obtained from a genomic library or by oligonucleotide synthesis.

Libraries can be screened with probes (such as antibodies to the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide, or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al., Molecular Cloning A Laboratorv Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An alternative means to isolate the gene encoding PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 is to use PCR methodology [Sambrook et al., supra; Dieffenbach et al., PCR Primer: A Laboratorv Manual (Cold Spring Harbor Laboratory Press. 1995)].

The Examples below describe techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 32P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supra.

Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined through sequence alignment using computer software programs such as ALIGN, DNAstar, and INHERIT which employ various algorithms to measure homology.

Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA. ii. Selection and Transformation of Host Cells Host cells are transfected or transformed with expression or cloning vectors described herein for PRO 187, PRO533, PRO2 14, PRO240, PRO2 11, PRO23 0, PRO26 1, PRO246, or EBAF-2 production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnologv: a Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al., supra.

Methods of transfection are known to the ordinarily skilled artisan, for example, CaPO4 and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al., Gene,23:315 (1983) and WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52:456-457 (1978) can be employed. General aspects of mammalian cell host system transformations have been described in U.S. Patent No. 4,399,216. Transformations into yeast are typically carried out according to the method of Van Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA). 76:3829 (1979).

However, other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g, polybrene, polyornithine, may also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzvmologv, 185:527-537 (1990) and Mansour et al., Nature,336:348-352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include but are not limited to eubacteria, such as Gram- negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains

are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635).

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism.

Suitable host cells for the expression of glycosylated PRO 187, PRO533, PRO214, PR0240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562, ATCC CCL51).

The selection of the appropriate host cell is deemed to be within the skill in the art. iii. Selection and Use of a Replicable Vector The nucleic acid (e.g, cDNA or genomic DNA) encoding PRO187, PR0533, PRO2 14, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan.

The PRO 187, PRO533, PRO2 14, PRO240, PRO2 11, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence may be a component of the vector, or it may be a part of the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2-encoding DNA that is inserted into the vector. The signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat- stable enterotoxin II leaders. For yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces a-factor leaders, the latter described in U.S.

Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990. In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2p plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.

Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g, the gene encoding D-alanine racemase for Bacilli.

An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246, or EBAF-2-encoding nucleic acid, such as DHFR or thymidine kinase. An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 27:4216 (1980). A suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 2:141(1979); Tschemper et al., Gene, 10:157 (1980)]. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics. 85:12 (1977)].

Expression and cloning vectors usually contain a promoter operably linked to the PRO 187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the -lactamase and lactose promoter systems [Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature 281:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in bacterial systems also will contain a Shine-Dalgamo (S.D.) sequence operably linked to the DNA encoding PRO 187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2.

Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem.,255:2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzvme Reg., 2:149 (1968); Holland, Biochemistrv, 17:4900 (1978)], such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose- 6-phosphate isomerase, 3 -phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.

Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism. metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.

Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.

PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the

genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g, the actin promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.

Transcription ofa DNA encoding a PROI87, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100- 270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 coding sequence, but is preferably located at a site 5' from the promoter.

Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO 187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2.

Still other methods, vectors, and host cells suitable for adaptation to the synthesis of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 in recombinant vertebrate cell culture are described in Gething et al., Nature, 293:620-625 (1981); Mantei et al., Nature,281:40-46 (1979); EP 117,060; and EP 117,058. iv. Detecting Gene Amplification/Expression Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl.

Acad. Sci. USA 77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.

Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide or against a synthetic peptide based on the DNA sequences provided

herein or against exogenous sequence fused to PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO26 1, PRO246, or EBAF-2 DNA and encoding a specific antibody epitope. v. Purification of Polypeptide Forms of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptides may be recovered from culture medium or from host cell lysates. If membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g. Triton-X 100) or by enzymatic cleavage. Cells employed in expression of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.

It may be desired to purify PRO187, PRO533, PRO214, PRO240, PRO21 1, PR0230, PRO261, PRO246, or EBAF-2 from recombinant cell proteins or polypeptides. The following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptides. Various methods of protein purification may be employed and such methods are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular PRO187, PRO533, PRO214, PRO240, PRO211, PRO23 0, PRO26 1, PRO246, or EBAF-2 polypeptide produced.

2. Amplification of Genes Encoding the PRO187. PRO533. PRO214. PRO240.

PRO2 11. PRO230. PRO26 1. PRO246. or EBAF-2 Polvpeptides in Tumor Tissues and Cell Lines The present invention is based on the identification and characterization of genes which are amplified in certain cancer cells.

The genome ofprokaryotic and eukaryotic organisms is subjected to two seemingly conflicting requirements. One is the preservation and propagation of DNA as the genetic information in its original form, to guarantee stable inheritance through multiple generations. On the other hand, cells or organisms must be able to adapt to lasting environmental changes. The adaptive mechanisms can include qualitative or quantitative modifications of the genetic material. Qualitative modifications include DNA mutations, in which coding sequences are altered resulting in a structurally and/or functionally different protein. Gene amplification is a quantitative modification, whereby the actual number of complete coding sequence, i.e. a gene, increases, leading to an increased number of available templates for transcription, an increased number of translatable transcripts, and, ultimately, to an increased abundance of the protein encoded by the amplified gene.

The phenomenon of gene amplification and its underlying mechanisms have been investigated in vitro in several prokaryotic and eukaryotic culture systems. The best-characterized example of gene amplification involves the culture of eukaryotic cells in medium containing variable concentrations of the cytotoxic drug methotrexate (MTX). MTX is a folic acid analogue and interferes with DNA synthesis by blocking the enzyme dihydrofolate reductase (DHFR). During the initial exposure to low concentrations of MTX

most cells (>99.9%) will die. A small number of cells survive, and are capable of growing in increasing concentrations of MTX by producing large amounts of DHFR-RNA and protein. The basis of this overproduction is the amplification of the single DHFR gene. The additional copies of the gene are found as extrachromosomal copies in the form of small, supernumerary chromosomes (double minutes) or as integrated chromosomal copies.

Gene amplification is most commonly encountered in the development of resistance to cytotoxic drugs (antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells) and neoplastic transformation. Transformation of a eukaryotic cell as a spontaneous event or due to a viral or chemical/environmental insult is typically associated with changes in the genetic material of that cell. One of the most common genetic changes observed in human malignancies are mutations of the p53 protein. p53 controls the transition of cells from the stationary (G 1) to the replicative (S) phase and prevents this transition in the presence of DNA damage. In other words, one of the main consequences of disabling p53 mutations is the accumulation and propagation of DNA damage, i.e. genetic changes. Common types of genetic changes in neoplastic cells are, in addition to point mutations, amplifications and gross, structural alterations, such as translocations.

The amplification of DNA sequences may indicate specific functional requirement as illustrated in the DHFR experimental system. Therefore, the amplification of certain oncogenes in malignancies points toward a causative role of these genes in the process of malignant transformation and maintenance of the transformed phenotype. This hypothesis has gained support in recent studies. For example, the bcl-2 protein was found to be amplified in certain types of non-Hodgkin's lymphoma. This protein inhibits apoptosis and leads to the progressive accumulation of neoplastic cells. Members of the gene family of growth factor receptors have been found to be amplified in various types of cancers suggesting that overexpression of these receptors may make neoplastic cells less susceptible to limiting amounts of available growth factor. Examples include the amplification of the androgen receptor in recurrent prostate cancer during androgen deprivation therapy and the amplification of the growth factor receptor homologue ERB2 in breast cancer. Lastly, genes involved in intracellular signaling and control of cell cycle progression can undergo amplification during malignant transformation. This is illustrated by the amplification of the bcl-l and ras genes in various epithelial and lymphoid neoplasms.

These earlier studies illustrate the feasibility of identifying amplified DNA sequences in neoplasms, because this approach can identify genes important for malignant transformation. The case of ERB2 also demonstrates the feasibility from a therapeutic standpoint, since transforming proteins may represent novel and specific targets for tumor therapy.

Several different techniques can be used to demonstrate amplified genomic sequences.

Classical cytogenetic analysis of chromosome spreads prepared from cancer cells is adequate to identify gross structural alterations, such as translocations, deletions and inversions. Amplified genomic regions can only be visualized, if they involve large regions with high copy numbers or are present as extrachromosomal material.

While cytogenetics was the first technique to demonstrate the consistent association of specific chromosomal changes with particular neoplasms, it is inadequate for the identification and isolation of manageable DNA sequences. The more recently developed technique of comparative genomic hybridization (CGH) has illustrated the widespread phenomenon of genomic amplification in neoplasms. Tumor and normal DNA are hybridized

simultaneously onto metaphases of normal cells and the entire genome can be screened by image analysis for DNA sequences that are present in the tumor at an increased frequency. (WO 93/18,186; Gray et al., Radiation Res. 137,275-289 [1994]). As a screening method, this type of analysis has revealed a large number of recurring amplicons (a stretch of amplified DNA) in a variety of human neoplasms. Although CGH is more sensitive than classical cytogenetic analysis in identifying amplified stretches of DNA, it does not allow a rapid identification and isolation of coding sequences within the amplicon by standard molecular genetic techniques.

The most sensitive methods to detect gene amplification are polymerase chain reaction (PCR)- based assays. These assays utilize very small amount of tumor DNA as starting material, are exquisitely sensitive, provide DNA that is amenable to further analysis, such as sequencing and are suitable for high-volume throughput analysis.

The above-mentioned assays are not mutually exclusive, but are frequently used in combination to identify amplifications in neoplasms. While cytogenetic analysis and CGH represent screening methods to survey the entire genome for amplified regions, PCR-based assays are most suitable for the final identification of coding sequences, i.e. genes in amplified regions.

According to the present invention, such genes have been identified by quantitative PCR (S.

Gelmini et al., Clin. Chem. 43, 752 [1997]), by comparing DNA from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc. tumor, or tumor cell lines, with pooled DNA from healthy donors. Quantitative PCR was performed using a TaqMan instrument (ABI). Gene-specific primers and fluorogenic probes were designed based upon the coding sequences of the DNAs.

Human lung carcinoma cell lines include A549 (SRCC768), Calu-l (SRCC769), Calu-6 (SRCC770), H157 (SRCC771), H441 (SRCC772), H460 (SRCC773), SKMES-1 (SRCC774) and SW900 (SRCC775), all available from ATCC. Primary human lung tumor cells usually derive from adenocarcinomas, squamous cell carcinomas, large cell carcinomas, non-small cell carcinomas, small cell carcinomas, and broncho alveolar carcinomas, and include, for example, SRCC724 (squamous cell carcinoma abbreviated as "SqCCa"), SRCC725 (non-small cell carcinoma, abbreviated as "NSCCa"), SRCC726 (adenocarcinoma, abbreviated as "AdenoCa"), SRCC727 (adenocarcinoma), SRCC728 (squamous cell carcinoma), SRCC729 (adenocarcinoma), SRCC730 (adeno/squamous cell carcinoma), SRCC731 (adenocarcinoma), SRCC732 (squamous cell carcinoma), SRCC733 (adenocarcinoma), SRCC734 (adenocarcinoma), SRCC735 (broncho alveolar carcinoma, abbreviated as "BAC"), SRCC736 (squamous cell carcinoma), SRCC738 (squamous cell carcinoma), SRCC739 (squamous cell carcinoma), SRCC740 (squamous cell carcinoma), SRCC740 (lung cell carcinoma abbreviated as "LCCa").

Colon cancer cell lines include, for example, ATCC cell lines SW480 (adenocarcinoma, SRCC776), SW620 (lymph node metastasis of colon adenocarcinoma, SRCC777), COLO320 (adenocarcinoma, SRCC778), HT29 (adenocarcinoma, SRCC779), HM7 (carcinoma, SRCC780), CaWiDr (adenocarcinoma, srcc781), HCTl 16 (carcinoma, SRCC782), SKCOI (adenocarcinoma, SRCC783), SW403 (adenocarcinoma, SRCC784), LS174T (carcinoma, SRCC785), and HM7 (a high mucin producing variant of ATCC colon adenocarcinoma cell line LS 174T, obtained from Dr. Robert Warren, UCSF). Primary colon tumors include colon adenoocarcinomas designated C72 (SRCC742), CT3 (SRCC743), CT8 (SRCC744), CT10 (SRCC745), CT12 (SRCC746), CT14 (SRCC747), CT15 (SRCC748), CTl7 (SRCC750), CTl (SRCC751), CT4 (SRCC752),

CT5 (SRCC753), CT6 (SRCC754), CT7 (SRCC755), CT9 (SRCC756), CTl 1 (SRCC757), CT18 (SRCC758), and DcR3, BACrev, BACfwd, T160, and T159.

Human breast carcinoma cell lines include, for example, HBL100 (SRCC759), MB435s (SRCC760), T47D (SRCC761), MB468(SRCC762), MB175 (SRCC763), MB361 (SRCC764), BT20 (SRCC765), MCF7 (SRCC766), SKBR3 (SRCC767).

3. Tissue Distribution The results of the gene amplification assays herein can be verified by further studies, such as, by determining mRNA expression in various human tissues.

As noted before, gene amplification and/or gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc.

Natl. Acad. Sci. USA. 77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.

Gene expression in various tissues, alternatively, may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to PRO187, PRO533, PRO214, PRO240, PRO21 1, PR0230, PRO26 1, PR0246, or EBAF-2 DNA and encoding a specific antibody epitope. General techniques for generating antibodies, and special protocols for Northern blotting and in situ hybridization are provided hereinbelow.

4. Chromosome Mapping If the amplification of a given gene is functionally relevant, then that gene should be amplified more than neighboring genomic regions which are not important for tumor survival. To test this, the gene can be mapped to a particular chromosome, e.g. by radiation-hybrid analysis. The amplification level is then determined at the location identified, and at neighboring genomic region. Selective or preferential amplification at the genomic region to which to gene has been mapped is consistent with the possibility that the gene amplification observed promotes tumor growth or survival. Chromosome mapping includes both framework and epicenter mapping. For further details see e.g., Stewart et al., Genome Research 2, 422-433 (1997).

5. Antibodv Binding Studies The results of the gene amplification study can be further verified by antibody binding studies, in which the ability of anti-PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 antibodies to inhibit the effect of the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptides on tumor (cancer) cells is tested. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies, the preparation of which will be described hereinbelow.

Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).

Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody. The amount of target protein (encoded by a gene amplified in a tumor cell) in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.

Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex. See, e.g., US Pat No. 4,376,110. The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti- immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.

For immunohistochemistry, the tumor sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.

6. Cell-Based Tumor Assavs Cell-based assays and animal models for tumors (e.g. cancers) can be used to verify the findings of the gene amplification assay, and further understand the relationship between the genes identified herein and the development and pathogenesis of neoplastic cell growth. The role of gene products identified herein in the development and pathology of tumor or cancer can be tested by using primary tumor cells or cells lines that have been identified to amplify the genes herein. Such cells include, for example, the breast, colon and lung cancer cells and cell lines listed above.

In a different approach, cells of a cell type known to be involved in a particular tumor are transfected with the cDNAs herein, and the ability of these cDNAs to induce excessive growth is analyzed.

Suitable cells include, for example, stable tumor cells lines such as, the B 104- 1 - I cell line (stable NIH-3T3 cell line transfected with the neu protooncogene) and ras-transfected NIH-3T3 cells, which can be transfected with the desired gene, and monitored for tumorogenic growth. Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit tumorogenic cell growth by exerting cytostatic or cytotoxic activity on the growth of the transformed cells, or by mediating antibody-dependent cellular cytotoxicity (ADCC). Cells transfected with the coding sequences of the genes identified herein can further be used to identify drug candidates for the treatment of cancer.

In addition, primary cultures derived from tumors in transgenic animals (as described below) can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques to derive continuous cell lines from transgenic animals are well known in the art (see, e.g. Small et al., Mol. Cell. Biol.

5 642-648 [1985]).

7. Animal Models

A variety of well known animal models can be used to further understand the role of the genes identified herein in the development and pathogenesis of tumors, and to test the efficacy of candidate therapeutic agents, including antibodies, and other antagonists of the native polypeptides, including small molecule antagonists. The in vivo nature of such models makes them particularly predictive of responses in human patients. Animal models of tumors and cancers (e.g. breast cancer, colon cancer, prostate cancer, lung cancer, etc.) include both non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodent, e.g., murine models. Such models can be generated by introducing tumor cells into syngeneic mice using standard techniques, e.g. subcutaneous injection, tail vein injection, spleen implantation, intraperitoneal implantation, implantation under the renal capsule, or orthopin implantation, e.g. colon cancer cells implanted in colonic tissue. (See, e.g. PCT publication No. WO 97/33551, published September 18, 1997).

Probably the most often used animal species in oncological studies are immunodeficient mice and, in particular, nude mice. The observation that the nude mouse with hypo/aplasia could successfully act as a host for human tumor xenografts has lead to its widespread use for this purpose. The autosomal recessive nu gene has been introduced into a very large number of distinct congenic strains of nude mouse, including, for example, ASW, A/He, AKR, BALB/c, B10.LP, C17, C3H, C57BL, C57, CBA, DBA, DDD, I/st, NC, NFR, NFS, NFS/N, NZB, NZC, NZW, P, RIII and SJL. In addition, a wide variety of other animals with inherited immunological defects other than the nude mouse have been bred and used as recipients of tumor xenografts.

For further details see, e.g. The Nude Mouse in Oncology Research, E. Boven and B. Winograd, eds., CRC Press, Inc., 1991.

The cells introduced into such animals can be derived from known tumor/cancer cell lines, such as, any ofthe above-listed tumor cell lines, and, for example, the B 104- 1 - I cell line (stable NIH-3T3 cell line transfected with the neu protooncogene); ras-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-37); a moderately well-differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-38), or from tumors and cancers. Samples oftumor or cancer cells can be obtained from patients undergoing surgery, using standard conditions, involving freezing and storing in liquid nitrogen (Karmali et al., Br. J. Cancer 48 689- 696 [1983]).

Tumor cells can be introduced into animals, such as nude mice, by a variety of procedures.

The subcutaneous (s.c.) space in mice is very suitable for tumor implantation. Tumors can be transplanted s.c. as solid blocks, as needle biopsies by use of a trochar, or as cell suspensions. For solid block or trochar implantation, tumor tissue fragments of suitable size are introduced into the s.c. space. Cell suspensions are freshly prepared from primary tumors or stable tumor cell lines, and injected subcutaneously. Tumor cells can also be injected as subdermal implants. In this location, the inoculum is deposited between the lower part of the dermal connective tissue and the s.c. tissue. Boven and Winograd (1991), supra.

Animal models of breast cancer can be generated, for example, by implanting rat neuroblastoma cells (from which the neu oncogen was initially isolated), or neu -transformed NIH-3T3 cells into nude mice, essentially as described by Drebin et al. PNAS USA 83 9129-9133 (1986).

Similarly, animal models of colon cancer can be generated by passaging colon cancer cells in animals, e.g. nude mice, leading to the appearance of tumors in these animals. An orthotopic transplant model of human colon cancer in nude mice has been described, for example, by Wang etna!., Cancer Research 54, 4726-

4728 (1994) and Too et al., Cancer Research 55 681-684 (1995). This model is based on the so-called "METAMOUSE" sold by AntiCancer, Inc. (San Diego, California).

Tumors that arise in animals can be removed and cultured in vitro. Cells from the in vitro cultures can then be passaged to animals. Such tumors can serve as targets for further testing or drug screening.

Alternatively, the tumors resulting from the passage can be isolated and RNA from pre-passage cells and cells isolated after one or more rounds of passage analyzed for differential expression of genes of interest. Such passaging techniques can be performed with any known tumor or cancer cell lines.

For example, Meth A, CMS4, CMS5, CMS21, and WEHI-164 are chemically induced fibrosarcomas of BALB/c female mice (DeLeo et al., J. Exp. Med. 146, 720 [1977]), which provide a highly controllable model system for studying the anti-tumor activities of various agents (Palladino et al., J. Immunol.

138 4023-4032 [1987]). Briefly, tumor cells are propagated in vitro in cell culture. Prior to injection into the animals, the cell lines are washed and suspended in buffer, at a cell density of about 10x106 to 10x107 cells/ml.

The animals are then infected subcutaneously with 10 to 100 ,ul of the cell suspension, allowing one to three weeks for a tumor to appear.

In addition, the Lewis lung (3LL) carcinoma of mice, which is one of the most thoroughly studied experimental tumors, can be used as an investigational tumor model. Efficacy in this tumor model has been correlated with beneficial effects in the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL). This tumor can be introduced in normal mice upon injection of tumor fragments from an affected mouse or of cells maintained in culture (Zupi etna!., Br. J. Cancer 41, suppl. 4, 309 [1980]), and evidence <BR> <BR> <BR> <BR> indicates that tumors can be started from injection of even a single cell and that a s ery high proportion of infected tumor cells survive. For further information about this tumor model see Zacharski, Haemostasis 16 300-320 [1986]).

One way of evaluating the efficacy of a test compound in an animal model is implanted tumor is to measure the size of the tumor before and after treatment. Traditionally, the size of implanted tumors has been measured with a slide caliper in two or three dimensions. The measure limited to two dimensions does not accurately reflect the size of the tumor, therefore, it is usually converted into the corresponding volume by using a mathematical formula. However, the measurement of tumor size is very inaccurate. The therapeutic effects of a drug candidate can be better described as treatment-induced growth delay and specific growth delay.

Another important variable in the description of tumor growth is the tumor volume doubling time. Computer programs for the calculation and description of tumor growth are also available, such as the program reported by Rygaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Animals, Wu and Sheng eds., Basel, 1989, 301. It is noted, however, that necrosis and inflammatory responses following treatment may actually result in an increase in tumor size, at least initially. Therefore, these changes need to be carefully monitored, by a combination of a morphometric method and flow cytometric analysis.

Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals. Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g. baboons, chimpanzees and monkeys. Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ

lines (e.g., Van der Putten etna!., Proc. Natl. Acad. Sci. USA 82,6148-615 [1985]); gene targeting in embryonic stem cells (Thompson etna!., Cell 56,313-321 [1989]); electroporation of embryos (Lo, Mol. Cel.. Biol. 3, 1803- 1814 [1983]); sperm-mediated gene transfer (Lavitrano et aL, Cell 51, 717-73 [1989]). For review, see, for example, U.S. Patent No. 4,736,866.

For the purpose of the present invention, transgenic animals include those that carry the transgene only in part of their cells ("mosaic animals"). The transgene can be integrated either as a single transgene, or in concatamers, e.g., head-to-head or head-to-tail tandems. Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al., Proc. Natl.

Acad. Sci. USA 89 6232-636 (1992).

The expression ofthe transgene in transgenic animals can be monitored by standard techniques.

For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene.

The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, or immunocytochemistry. The animals are further examined for signs of tumor or cancer development.

Alternatively, "knock out" animals can be constructed which have a defective or altered gene encoding a PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal. For example, cDNA encoding a particular PRO1 87, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques. A portion of the genomic DNA encoding a particular PRO 187, PRO533, PRO2 14, PRO240, PRO2 11, PRO23 0, PRO26 1, PRO246, or EBAF-2 polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors]. The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e.g., Li et al., Cell. 69:915 (1992)]. The selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knockout animals can be characterized for instance, by their ability to defend against certain pathological conditions and by their development of pathological conditions due to absence of the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 polypeptide.

The efficacy of antibodies specifically binding the polypeptides identified herein and other drug candidates, can be tested also in the treatment of spontaneous animal tumors. A suitable target for such studies is the feline oral squamous cell carcinoma (SCC). Feline oral SCC is a highly invasive, malignant tumor that is the most common oral malignancy of cats, accounting for over 60% of the oral tumors reported in this

species. It rarely metastasizes to distant sites, although this low incidence of metastasis may merely be a reflection of the short survival times for cats with this tumor. These tumors are usually not amenable to surgery, primarily because of the anatomy of the feline oral cavity. At present, there is no effective treatment for this tumor. Prior to entry into the study, each cat undergoes complete clinical examination, biopsy, and is scanned by computed tomography (CT). Cats diagnosed with sublingual oral squamous cell tumors are excluded from the study. The tongue can become paralyzed as a result of such tumor, and even if the treatment kills the tumor, the animals may not be able to feed themselves. Each cat is treated repeatedly, over a longer period of time.

Photographs of the tumors will be taken daily during the treatment period, and at each subsequent recheck. After treatment, each cat undergoes another CT scan. CT scans and thoracic radiograms are evaluated every 8 weeks thereafter. The data are evaluated for differences in survival, response and toxicity as compared to control groups. Positive response may require evidence of tumor regression, preferably with improvement of quality of life and/or increased life span.

In addition, other spontaneous animal tumors, such as fibrosarcoma, adenocarcinoma, lymphoma, chrondroma, leiomyosarcoma of dogs, cats, and baboons can also be tested. Of these mammary adenocarcinoma in dogs and cats is a preferred model as its appearance and behavior are very similar to those in humans. However, the use of this model is limited by the rare occurrence of this type of tumor in animals.

8. Screening Assavs for Drug Candidates Screening assays for drug candidates are designed to identify compounds that bind or complex with the polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screening assays will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)peptide-immunoglobulin fusions, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. The assays can be performed in a variety of formats, including protein- protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art.

All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact.

In binding assays, the interaction is binding and the complex formed can be isolated or detected in the reaction mixture. In a particular embodiment, the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g. on a microtiter plate, by covalent or non-covalent attachments. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody, e.g. a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g. the coated surface containing the anchored component. When the reaction is complete. the non-reacted components are removed, e.g. by washing, and complexes anchored on the solid surface are detected. When the

originally non-immobilized component carries a detectable label, the detection of label immobilized on the surface indicates that complexing occurred. Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex.

If the candidate compound interacts with but does not bind to a particular PROl 87, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions. Such assays include traditional approaches, such as, cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers [Fields and Song, Nature (London) 340 245-246 (1989); Chien etna!., Proc. Natl. Acad. Sci. USA 88, 9578-9582 (1991)] as disclosed by Chevray and Nathans [Proc. Natl. Acad. Sci. USA 89,5789-5793 (1991)]. Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transcription activation domain. The yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain. The expression of a GAL1-lacZ reporter gene under control of a GAM-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for -galactosidase. A complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions.

Compounds that interfere with the interaction of a PRO187, PRO533, PRO2 14, PRO240, PRO2 11, PRO230, PRO26 1, PRO246, or EBAF-2-encoding gene identified herein and other intra- or extracellular components can be tested as follows: usually a reaction mixture is prepared containing the product of the amplified gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products. To test the ability of a test compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound. In addition, a placebo may be added to a third reaction mixture, to serve as positive control. The binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove. The formation of a complex in the control reaction(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.

9. Compositions and Methods for the Treatment of Tumors The compositions useful in the treatment of tumors associated with the amplification of the genes identified herein include, without limitation, antibodies. small organic and inorganic molecules, peptides, phosphopeptides, antisense and ribozyme molecules, triple helix molecules, etc. that inhibit the expression and/or activity of the target gene product.

For example, antisense RNA and RNA molecule act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. When antisense DNA is used,

oligodeoxyribonucleotides derived from the translation initiation site, e.g. between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.

Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, e.g. Rossi, Current Biologv 4, 469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997).

Nucleic acid molecules in triple helix formation used to inhibit transcription should be single- stranded and composed of deoxynucleotides. The base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex. For further details see, e.g. PCT publication No.

WO 97/33551, supra.

These molecules can be identified by any or any combination ofthe screening assays discussed hereinabove and/or by any other screening techniques well known for those skilled in the art.

9.1 Antibodies Some of the most promising drug candidates according to the present invention are antibodies and antibody fragments which may inhibit the production or the gene product of the amplified genes identified herein and/or reduce the activity of the gene products. i. Polvclonal Antibodies Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 polypeptide or a fusion protein thereof.

It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation. ii. Monoclonal Antibodies The anti-PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature 256:495 (1975). In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro.

The immunizing agent will typically include the PRO187, PRO533, PRO214, PRO240, PRO2 11, PRO230, PRO26 1, PRO246, or EBAF-2 polypeptide, including fragments, or a fusion protein of such protein or a fragment thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of

human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection (ATCC), Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibodv Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63].

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against PRO 187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO26 1, PRO246, or EBAF-2. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such techniques and assays are known in the art.

The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 107:220 (1980).

After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra]. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.

The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for

example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al., supra] or by covalentlyjoining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide.

Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.

The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.

In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. iii. Human and Humanized Antibodies The anti-PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 antibodies may further comprise humanized antibodies or human antibodies. Humanized forms of non- human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.

In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human.

These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature,332:323-327 (1988); Verhoeyen et al., Science,239:1534-1536 (1988)1, by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human

antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581(1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1!:86-95 (1991)j. Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio/Technologv 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368. 812-13 (1994); Fishwild et al., Nature Biotechnologv 14, 845-51 (1996); Neuberger, Nature Biotechnologv 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995). iv. Bisqecific Antibodies Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the PRO187, PRO533, PRO214, PRO240, PR0211, PRO230, PRO261, PRO246, or EBAF-2, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.

Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, Nature, 305:537-539 [1983j).

Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps.

Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy-chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzvmologv, 121:210 (1986).

v. Heteroconiueate Antibodies Heteroconjugate antibodies are composed oftwo covalentlyjoined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980. vi. Effector function engineering It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance the effectiveness of the antibody in treating cancer, for example. For example cysteine residue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron metal, J.Exo Med. 176:1191-1195 (1992) and Shopes, B. J. Immunol. 148:2918-2922(1992). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as described in Wolff et al. Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti- Cancer Drug Design 3:219-230 (1989). vii. Immunoconiugates The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a radioactive isotope (i.e., a radioconjugate).

Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above. Enzymaticaily active toxins and fragments thereof which can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleuritesfordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and the tricothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Examples include 212Bi, 131 I, 1311n, 90Y and 186Re.

Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis- diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2,6- diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, a ricin <BR> <BR> <BR> immunotoxin can be prepared as described in Vitetta et al. , Science 238: 1098 (1987). Carbon-l4-labeled 1- isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO94/1 1026.

In another embodiment, the antibody may be conjugated to a "receptor" (such streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand" (e.g. avidin) which is conjugated to a cytotoxic agent (e.g. a radionucleotide). viii. lmmunoliposomes The antibodies disclosed herein may also be formulated as immunoliposomes. Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et aL, Proc. Natl.

Acad. Sci. USA,82:3688 (1985); Hwang etna!., Proc. Natl Acad. Sci. USA 77:4030 (1980); and U.S. Pat. Nos.

4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556.

Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al ., J. Biol. Chem. 257: 286-288 (1982) via a disulfide interchange reaction. A chemotherapeutic agent (such as Doxorubicin) is optionally contained within the liposome. See Gabizon et al.., J. National Cancer Inst. 81(19)1484 (1989).

10. Pharmaceutical Compositions Antibodies specifically binding the product of an amplified gene identified herein, as well as other molecules identified by the screening assays disclosed hereinbefore, can be administered for the treatment of tumors, including cancers, in the form of pharmaceutical compositions.

If the protein encoded by the amplified gene is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred. However, lipofections or liposomes can also be used to deliver the antibody, or an antibody fragment, into cells. Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred. For example, based upon the variable region sequences of an antibody, peptide molecules can be designed which retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e.g. Marasco etna!., Proc. Natl. Acad. Sci. USA 90, 7889-7893 [1993]).

Therapeutic formulations of the antibody are prepared for storage by mixing the antibody having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol,

trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as TWEENTM, PLURONICSTM or polyethylene glycol (PEG).

Non-antibody compounds identified by the screening assays of the present invention can be formulated in an analogous manner, using standard techniques well known in the art.

The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may comprise a cytotoxic agent, cytokine or growth inhibitory agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's PharmaceuticalSciences 16th edition, Osol, A.

Ed. (1980).

The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and y ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT TM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(- )-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37"C, resulting in a loss of biological activity and possible changes in immunogenicity.

Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.

11. Methods of Treatment It is contemplated that the antibodies and other anti-tumor compounds of the present invention may be used to treat various conditions, including those characterized by overexpression and/or activation of the amplified genes identified herein. Exemplary conditions or disorders to be treated with such antibodies and other compounds, including, but not limited to, small organic and inorganic molecules, peptides, antisense molecules, etc. include benign or malignant tumors (e.g. renal, liver, kidney, bladder, breast, gastric, ovarian, colorectal, prostate, pancreatic, ling, vulval, thyroid, hepatic carcinomas; sarcomas; glioblastomas; and various head and neck tumors); leukemias and lymphoid malignancies; other disorders such as neuronal, glial, astrocytal,

hypothalamic and other glandular, macrophagal, epithelial, stromal and blastocoelic disorders; and inflammatory, angiogenic and immunologic disorders.

The anti-tumor agents of the present invention, e.g. antibodies, are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes. Intravenous administration of the antibody is preferred.

Other therapeutic regimens may be combined with the administration of the anti-cancer agents, e.g. antibodies of the instant invention. For example, the patient to be treated with such anti-cancer agents may also receive radiation therapy. Alternatively, or in addition, a chemotherapeutic agent may be administered to the patient. Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992). The chemotherapeutic agent may precede, or follow administration of the anti- tumor agent, e.g. antibody, or may be given simultaneously therewith. The antibody may be combined with an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapristone (see, EP 616812) in dosages known for such molecules.

It may be desirable to also administer antibodies against other tumor associated antigens, such as antibodies which bind to theErbB2, EGFR, ErbB3, ErbB4, or vascular endothelial factor (VEGF).

Alternatively, or in addition, two or more antibodies binding the same or two or more different antigens disclosed herein may be co-administered to the patient. Sometimes, it may be beneficial lo also administer one or more cytokines to the patient. In a preferred embodiment, the antibodies herein are co-administered with a growth inhibitory agent. For example, the growth inhibitory agent may be administered first, followed by an antibody of the present invention. However, simultaneous administration or administration of the antibody of the present invention first is also contemplated. Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the antibody herein.

For the prevention or treatment of disease, the appropriate dosage of an anti-tumor agent, e.g. an antibody herein will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, and the discretion of the attending physician. The agent is suitably administered to the patient at one time or over a series of treatments.

For example, depending on the type and severity of the disease, about 1 llg/kg to 15 mg/kg (e.g. 0.1-20mg/kg) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion. A typical daily dosage might range from about 1 ,lg/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.

12. Articles of Manufacture In another embodiment of the invention, an article of manufacture containing materials useful for the diagnosis or treatment ofthe disorders described above is provided. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The active agent in the composition is usually an anti-tumor agent capable of interfering with the activity of a gene product identified herein, e.g. an antibody. The label on, or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.

13. Diagnosis and Prognosis of Tumors While cell surface proteins, such as growth receptors overexpressed in certain tumors are excellent targets for drug candidates or tumor (e.g. cancer) treatment, the same proteins along with secreted proteins encoded by the genes amplified in tumor cells find additional use in the diagnosis and prognosis of tumors. For example, antibodies directed against the proteins products of genes amplified in tumor cells can be used as tumor diagnostics or prognostics.

For example, antibodies, including antibody fragments, can be used to qualitatively or quantitatively detect the expression of proteins encoded by the amplified genes ("marker gene products"). The antibody preferably is equipped with a detectable, e.g. fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art. These techniques are particularly suitable, if the amplified gene encodes a cell surface protein, e.g. a growth factor. Such binding assays are performed essentially as described in section 5 above.

In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or immunoelectron microscopy. For this purpose, a histological specimen is removed from the patient, and a labeled antibody is applied to it, preferably by overlaying the antibody on a biological sample. This procedure also allows for determining the distribution of the marker gene product in the tissue examined. It will be apparent for those skilled in the art that a wide variety of histological methods are readily available for in situ detection.

***************************** The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

EXAMPLES Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of those cells identified in the following

examples, and throughout the specification, by ATCC accession numbers is the American Type Culture Collection, Manassas, VA. Unless otherwise noted, the present invention uses standard procedures of recombinant DNA technology, such as those described hereinabove and in the following textbooks: Sambrook etna!., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press N.Y., 1989; Ausubel etna!., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y., 1989; Innis etna!., PCR Protocols: A Guide to Methods and Applications, Academic Press, inc., N.Y., 1990; Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, 1988; Gait, M.J., Oligonucleotide Synthesis, IRL Press, Oxford, 1984; R.I. Freshney, Animal Cell Culture, 1987; Coligan et al., Current Protocols in Immunology, 1991.

EXAMPLE 1 Isolation of cDNA clones Encoding Human PRO187. PRO533. PRO214. PRO240. PRO211. PRO230.

PRO26 1. PRO246. and EBAF-2 1. Isolation of cDNA clones encoding human PRO 187 (an FGF-8 homoloue) A proprietary expressed sequence tag (EST) DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST (#843193) was identified which showed homology to fibroblast growth factor (FGF-8) also known as androgen-induced growth factor. mRNA was isolated from human fetal lung tissue using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents. (E.g., Invitrogen, San Diego, CA, Life Technologies, Gaithersburg, MD). The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with Note, sized appropriately by gel electrophoresis, and cloned in a defined orientation into the cloning vector pRKSD using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). The double stranded cDNA was sized to greater than 1000 bp and the SaWNotI linkered cDNA was cloned into XhoI/NotI cleaved vector. pRKSD is a cloning vector that has an sp6 transcription initiation site followed by an SfiI restriction enzyme site preceding the XhoI/NotI cDNA cloning sites.

Several libraries from various tissue sources were screened by PCR amplification with the following oligonucleotide probes: IN843193.f(OLI315) (SEQ ID NO: 55) CAGTACGTGAGGGACCAGGGCGCCATGA IN843193.r (OLI 317) (SEQ ID NO: 56) CCGGTGACCTGCACGTGCTTGCCA A positive library was then used to isolate clones encoding the FGF-8 homologue gene using one of the above oligonucleotides and the following oligonucleotide probe: IN843193.p (OLI 316) (SEQ ID NO: 57) GCGGATCTGCCGCCTGCTCANCTGGTCGGTCATGGCGCCCT

A cDNA clone was sequenced in entirety. The entire nucleotide sequence of FGF-8 homologue is shown in Figure 1 (SEQ ID NO: 1). Clone DNA27864 contains a single open reading frame with an apparent translational initiation site at nucleotide position 26 (Fig. 1; SEQ ID NO: 1). The predicted polypeptide precursor is 205 amino acids long. Clone DNA27864 has been deposited with the ATCC (designation: DNA27864-1155) on October 16, 1997, and is assigned ATCC deposit no. 209375.

2. Isolation of cDNA clones encoding human PRO533 (an FGF homologue) The EST sequence accession number AF007268, a murine fibroblast growth factor (FGF-15) was used to search various public EST databases (e.g., GenBank, Dayhoff, etc.). The search was performed using the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzvmologv,266:460-480 (1996); http://blast.wastl/edu/'blast/README.html] as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. The search resulted in a hit with GenBank EST AA220994, which has been identified as stratagene NT2 neuronal precursor 937230.

Based on this sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence. Forward and reverse PCR primers (notated as *.f and *.r, respectively) may range from 20 to 30 nucleotides (typically about 24), and are designed to give a PCR product of 100-1000 bp in length. The probe sequences (notated as *.p) are typically 40-55 bp (typically about 50) in length. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedure suing the probe oligonucleotide and one of the PCR primers.

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO533 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction ofthe cDNA libraries was isolated from human fetal retina. The cDNA libraries used to isolated the cDNA clones were constructed by standard methods using commercially available reagents (e.g., Invitrogen, San Diego, CA; Clontech, etc.) The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with Note, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor ofpRKSD that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites.

A cDNA clone was sequenced in its entirety. The full length nucleotide sequence of PRO533 is shown in Figure 5 (SEQ ID NO: 5). Clone DNA49435 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 459-461 (Fig. 5; SEQ ID NO: 5). The predicted polypeptide precursor is 216 amino acids long. Clone DNA49435-1219 has been deposited with ATCC (November 21, 1997) and is assigned ATCC deposit no. 209480.

Based on a BLAST-2 and FastA sequence alignment analysis of the full-length sequence, PRO533 shows amino acid sequence identity to fibroblast growth factor (FGF) (53%).

The oligonucleotide sequences used in the above procedure were the following: FGFl5.f: ATCCGCCCAGATGGCTACAATGTGTA (SEQ ID NO: 58) FGF15.p: GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA (SEQ ID NO: 59)

FGF15.r: CCAGTCCGGTGACAAGCCCAAA (SEQ ID NO: 60) PRO533 (UNQ334) encoded by DNA49435 has been identified as a specific ligand for FGF receptor 3, exhibiting exclusive binding to this receptor. As mice deficient in FGF receptor 3 are known to have major defects in bone growth and are deaf, PRO533 is anticipated to play a role in cartilage and bone growth and may be useful to prevent and/or treat hearing loss.

3. Isolation of cDNA clones encoding human PRO2 14 (an EGF-like homologue) The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases.

The EST databases included public EST databases (e.g., GenBank), and a proprietary EST database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzvmoloev, 266:460-480 (1996); http://blast.wustl/edu/blast(README.htmlj as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle. Washington; http://bozeman.mbt.washington. edu/phrap.docs/phrap.html).

A consensus DNA sequence encoding EGF-like homologue was assembled using phrap. This consensus DNA sequence is indicated as DNA28744 (SEQ ID NO: 61) in Fig. 41.

Based on this consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full- length coding sequence. Forward and reverse PCR primers (notated as *.f and *.r, respectively) may range from 20 to 30 nucleotides (typically about 24), and are designed to give a PCR product of 100-1000 bp in length. The probe sequences (notated as *.p) are typically 40-55 bp (typically about 50) in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than 1-1.5 kbp. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedure suing the probe oligonucleotide and one of the PCR primers. The library used to isolate DNA32286 was human fetal lung.

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the EGF-like homologue gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from identify tissue type. The cDNA libraries used to isolated the cDNA clones were constructed by standard methods using commercially available reagents (e.g., Invitrogen, San Diego, CA; Clontech, etc.) The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites.

A cDNA clone was sequenced in its entirety. The full length nucleotide sequence of EGF-like homologue is shown in Figure 9 (SEQ ID NO: 9). DNA32286 contains a single open reading frame with an apparent translational initiation site at nucleotide position 103 (Fig. 9; SEQ ID NO: 9). The predicted polypeptide precursor is 420 amino acids long (Fig. 10, SEQ ID NO: 10).

Based on a BLAST and FastA sequence alignment analysis of the full-length sequence, EGF- like homologue DNA32286 shows amino acid sequence identity to HT protein and/or Fibulin (49% and 38%, respectively).

Clone DNA32286-1191 has been deposited with ATCC (October 16, 1997) and is assigned ATCC no. 209385.

The oligonucleotide sequences used in the above procedure were the following: 28744.p (OLI555) CCTGGCTATCAGCAGGTGGGCTCCAAGTGTCTCGATGTGGATGAGTGTGA (SEQ ID NO: 62) 28744.f (OLI556) ATTCTGCGTGAACACTGAGGGC (SEQ ID NO: 63) 28744.r (OLI557) ATCTGCTTGTAGCCCTCGGCAC (SEQ ID NO: 64) 4. Isolation of cDNA clones encoding human PRO240 (a serrate homologue) The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzvmologv 266:460- 480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).

A consensus DNA sequence encoding PRO240 was assembled relative to the other identified EST sequences, wherein the consensus sequence was designated herein as DNA30873 (see Fig. 13, SEQ ID NO: 13). Based on this consensus sequence, oligonucleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PRO240.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TCAGCTCCAGACTCTGATACTGCC-3' (SEQ ID NO: 65) reverse PCR Drimer 5'-TGCCTTTCTAGGAGGCAGAGCTCC-3' (SEQ ID NO: 66) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30873 sequence which had the following nucleotide sequence hybridization probe 5'-GGACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAG-3' (SEQ ID NO: 67)

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO240 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites.

DNA sequencing ofthe clones isolated as described above gave the full-length DNA sequence for PRO240 [herein designated as UNQ214 (DNA34387)] and the derived protein sequence for PRO240.

The entire nucleotide sequence ofUNQ214 (DNA34387) is shown in Figure 11 (SEQ ID NO: 11). Clone UNQ214 (DNA34387) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 12-14, and ending at the stop codon at nucleotide positions 699-701 (Fig. 11; SEQ ID NO: 11). The predicted polypeptide precursor is 229 amino acids long (Fig. 12, SEQ ID NO: 12). Clone UNQ214 (DNA34387) has been deposited with ATCC on September 17, 1997 and is assigned ATCC deposit no. 209260.

Analysis of the amino acid sequence of the full-length PRO240 suggests that it possesses 30% and 35% amino acid identity with the serrate precursor protein from Drospohilia melanogaster (SEQ ID NO: 15) and the C-serrate-l protein from Gallus gallus (SEQ ID NO: 17), respectively (see Figures 14 and 15, respectively).

5. Isolation of cDNA clones encoding human PRO211 (an EGF-like homologue! The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases.

The EST databases included public databases (e.g., Dayhoff, GenBank), and proprietary databases (e.g.

LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altschul, SF and Gish (1996), Methods in Enzymology 266: 460-80 (1996); http://blast.wustl/edu/blast/README.html) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons with a Blast score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, WA; (http://bozeman.mbt.washington.edu/phrap.docs/phrap.html).

A consensus DNA sequences encoding an EGF-like homologue was assembled using phrap.

The consensus DNA sequence (DNA28730) was extended by repeated cycles of blast and phrap as far as possible using the three sources of EST sequences listed above.

Based on this consensus sequence, oligonucleotides were synthesized: I) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full- length coding sequence. The pair of forward and reverse PCR primers (notated as *.f and *.r, respectively) may range from 20 to 30 nucleotides (typically 24), and are designed to give a PCR product of 100-1000 bp in length.

The probe sequences (notated as *.p) are typically 40-55 bp (typically 50) in length. In some cases additional oligonucleotides are synthesized when the consensus sequence is greater than 1-1.5 kbp. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedure using the probe oligonucleotide and one of the PCR primers. This library used to isolate DNA32292 fetal lung.

RNA for the construction ofthe cDNA libraries was isolated using standard isolation protocols, e.g., Ausubel et al., supra, from tissue or cell line sources or it was purchased from commercial sources (e.g., Clontech). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods (e.g., Ausubel etna!.) using commercially available reagents (e.g., Invitrogen). The cDNA was primed with oligo dT containing a Noti site, linked with blunt to Sall hemikinased adaptors, cleaved with Note, sized appropriately by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (pRKSB or pRKSD) in the unique Xhol and NotI sites.

A cDNA clone was sequenced in its entirety. The entire nucleotide sequence (DNA32292) of an EGF-like homologue (PRO21 1) is shown in Figure 16 (SEQ ID NO: 18). The predicted polypeptide is 353 amino acids in length, respectively, with a molecule weight of approximately 38.19kDa. cDNA clone 32292-1131 has been deposited at ATCC (September 16, 1997) and assigned ATCC no. 209258.

The oligonucleotide sequences used in the above procedure were the following: 28730.p (OLI 516) (SEQ ID NO: 68) AGGGAGCACGGACAGTGTGCAGATGTGGACGAGTGCTCACTAGCA 28730.f(OLI 517) (SEQ ID NO: 69) AGAGTGTATCTCTGGCTACGC 28730.r (OLI 518) (SEQ ID NO: 70) TAAGTCCGGCACATTACAGGTC 6. Isolation of cDNA clones encoding human PRO230 (having homologv to tubulointerstitial nephritis antigen The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzvmologv 266:460- 480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).

A consensus DNA sequence encoding PRO230 was assembled relative to the other identified EST sequences, wherein the consensus sequence was designated herein as DNA30857 (SEQ. ID NO: 21) (see Figure 19). An EST proprietary to Genentech was employed in the consensus assembly.

Based on the DNA30857 consensus sequence, oligonucleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full- length coding sequence for PRO230.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TTCGAGGCCTCTGAGAAGTGGCCC-3' (SEQ ID NO: 71) reverse PCR Drimer 5'-GGCGGTATCTCTCTGGCCTCCC-3' (SEQ ID NO: 72) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30857 sequence which had the following nucleotide sequence hybridization probe 5'-TTCTCCACAGCAGCTGTGGCATCCGATCGTGTCTCAATCCATTCTCTGGG-3' (SEQ ID NO: 73) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO230 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and No sites.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO230 (herein designated as UNQ204 (DNA33223) and the derived protein sequence for PRO230.

The entire nucleotide sequence of UNQ204 (DNA33223) is shown in Figure 20 (SEQ ID NO: 22). Clone UNQ204 (DNA33223) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 100-103, and ending at the stop codon at nucleotide positions 1501-1503 (Figure 20 and SEQ ID NO: 22). The predicted polypeptide precursor is 467 amino acids long (Figure 18, SEQ ID NO: 20). A cDNA clone designated 32223-1136 has beeen deposited with ATCC (September 16, 1997), and was given ATCC accession no. 209264.

7. Isolation of cDNA clones encoding human PRO261 (a CTGF homologue/WISP-2) The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzvmologv 266:460-

480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html).

A consensus DNA sequence was assembled relative to other EST sequences using phrap. This consensus sequence is herein designated DNA30843-from dna (see Figure 24, SEQ ID No: 28). Based on the DNA30843-from dna consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO26 1. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about l-l.Skbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., Current Protocols in Molecular Biologvb with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedure using the probe oligonucleotide and one of the primer pairs.

A pair of PCR primers, forward (SEQ ID NO: 74) and reverse (SEQ ID NO: 75), were synthesized. Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30843-from dna sequence which has the sequence of SEQ ID NO: 76.

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO26 1 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with Note, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO261 [herein designated as UNQ228 (DNA33473-seq min)] (Figure 22; SEQ ID NO: 25) and the derived protein sequence for PRO261 (SEQ ID NO: 27).

The synthetic oligonucleotides used in this process were: 30843.f: AAAGGTGCGTACCCAGCTGTGCC (SEQ ID NO: 74) 30843.r: TCCAGTCGGCAGAAGCGGTTCTGG (SEQ ID NO: 75) 30843 p: CCTGGTGCTGGATGGCTGTGGCTGCTGCCGGGTATGTGCACGGCGGCTGGG (SEQ ID NO: 76) The entire nucleotide sequence ofUNQ228 (DNA33473-seq min) is shown in Figure 22 (SEQ ID NO:SEQ ID NO: 25). Clone UNQ228 (DNA33473-seq min) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1-3 of SEQ ID NO: 26 and ending at the stop codon

after nucleotide 750 of SEQ ID NO: 26. The predicted polypeptide precursor is 250 amino acids long (Figure 23). Clone UNQ228 (DNA33473-seq min) has been deposited with ATCC and is assigned ATCC deposit no.

209391.

Analysis of the amino acid sequence of the full-length PRO261 polypeptide suggests that portions of it possess significant homology to CTGF, thereby indicating that PRO26 1 is a novel growth factor.

8. Isolation or cDNA clones encoding human PRO246 (an HCAR homoloue) The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymologv 266:460- 480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).

A consensus DNA sequence was assembled relative to other EST sequences using phrap. This consensus sequence is herein designated DNA30955 (Figure 28, SEQ ID NO: 34). Based on the DNA30955 consensus sequence, oligonucleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PRO246.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-AGGGTCTCCAGGAGAAAGACTC-' (SEQ ID NO: 77) reverse PCR primer 5'-ATTGTGGGCCTTGCAGACATAGAC-3' (SEQ ID NO: 78) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30955 sequence which had the following nucleotide sequence hybridization probe 5'-GGCCACAGCATCAAAACCTTAGAACTCAATGTACTGGTTCCTCCAGCTCC-3' (SEQ ID NO: 79) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO246 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO246 therein designated as UNQ220 (DNA35639)] (SEQ ID NO: 31) and the derived protein sequence for PRO246 (SEQ ID NO: 33).

The entire nucleotide sequence of UNQ220 (DNA35639) is shown in Figure 26 (SEQ ID NO: 31). Clone UNQ220 (DNA35639) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 126-128, and ending at the stop codon at nucleotide positions 1296-1298 (Fig. 26).

The predicted polypeptide precursor is 390 amino acids long (Figure 27). Clone UNQ220 (DNA35639) has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no. 209396.

Analysis of the amino acid sequence of the full-length PRO240 suggests that it possesses significant amino acid identity with the human cell surface protein HCAR as shown in Figure 29, thereby indicating that PRO246 may be a novel cell surface virus receptor.

9. Isolation of cDNA clones encoding human EBAF-2 The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the SWISS-PROTTM public database were used to search EST databases. The EST databases included public EST databases (e.g., GenBank), and a proprietary EST database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST TM or BLAST2TM (Altschul et al., Methods in Enzvmologv, 266:460480 (1996); http://blast.wustl/edu/blast/README.html) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLASTTM score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html).

A consensus DNA sequence encoding EBAF-2 (DNA 28722) was assembled using phrap, as shown in Figure 31 (SEQ ID NO: 41). Based on this consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence. The forward and reverse PCR primers synthesized for this purpose were: 5'-AGGACTGCCATAACTTGCCTG (OLI489) (SEQ ID NO: 80) and 5'-ATAGGAGTTGAAGCAGCGCTGC (OLI490) (SEQ ID NO: 81).

The probe synthesized for this purpose was: 5' -TGTGTGGACATAGACGAGTGCCGCTACCGCTACTGCCAGCACCGC (OLI488) (SEQ ID NO: 82) mRNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (Invitrogen, San Diego, CA; Clontech, etc.) The RNA was used to generate an oligo-dT primed cDNA library in the cloning vector pRKSB using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid SystemTM). PRKSB is a cloning vector that has an sp6 transcription initiation site and unique

XhoIlNotI cDNA cloning sites. It is a precursor of pRKSD that does not contain the SfiI site (Holmes et al., Science, 253:1278-1280 (1991)).

In this procedure, the double-stranded cDNA was primed with oligo dT containing a NotI site, linked with blunt to Sall hemikinased adaptors, cleaved with NotI, sized to greater than 1000 bp appropriately by gel electrophoresis, and cloned in a defmed orientation into the XhoI/NotI-cleaved pRKSB vector. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., supra, with the PCR primer pair identified above. A positive library was then used to isolate clones containing the ebaf-l gene using the probe oligonucleotide identified above and one of the PCR primers.

A cDNA clone was sequenced in its entirety. The entire nucleotide sequence of DNA33461 (encoding EBAF-2) is shown in Figure 30 (SEQ ID NO: 37). Clone DNA33461 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 68-70 (Fig. 30; SEQ ID NO: 37). The predicted polypeptide precursor is 366 amino acids long. The predicted signal sequence is amino acids 1-18 of Figure 30 (SEQ ID NO: 40). There is one predicted N-linked glycosylation site at amino acid residue 160.

Clone DNA33461 (designated DNA33461-1199) has been deposited with ATCC (October 15, 1997) and is assigned ATCC deposit no. 209367.

Figure 32 shows the BLASTTM score, match, and percent homology alignment between protein EBAF-2 (SEQ ID NO: 40), encoded by DNA33461 (SEQ ID NO: 37), and human EBAF- 1 (SEQ ID NO: 42). Based on this BLASTTM and FastATM sequence alignment analysis (using the ALIGN TOM computer program) of the full-length sequence, EBAF-2 shows the most amino acid sequence identity to EBAF-1 (92%).

The results also demonstrate a significant homology between human EBAF-2 and mouse LEFTY protein.

EXAMPLE 2 Gene Amplification This example shows that the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246, and EBAF-2-encoding genes are amplified in the genome of certain human lung, colon and/or breast cancers and/or cell lines. Amplification is associated with overexpression of the gene product, indicating that the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, and EBAF-2 proteins are useful targets for therapeutic intervention in certain cancers such as colon, lung, breast and other cancers.

Therapeutic agent may take the form of antagonists of PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246, or EBAF-2-encoding genes, for example, murine-human chimeric, humanized or human antibodies against a PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 (PRO3 17) polypeptide.

The starting material for the screen was genomic DNA isolated from a variety cancers. The DNA is quantitated precisely, e.g fluorometrically. As a negative control, DNA was isolated from the cells of ten normal healthy individuals which was pooled and used as assay controls for the gene copy in healthy individuals (not shown). The 5' nuclease assay (for example, TaqManTM) and real-time quantitative PCR (for example, ABI Prizm 7700 Sequence Detection SystemTM (Perkin Elmer, Applied Biosystems Division, Foster City, CA)), were used to find genes potentially amplified in certain cancers. The results were used to determine whether the DNA encoding PRO187, PRO533, PRO214, PRO240, PRO21 1 PRO230, PRO261, PRO246 or PRO3 17 is over-represented in any of the primary lung or colon cancers or cancer cell lines or breast cancer cell

lines that were screened. The primary lung cancers were obtained from individuals with tumors of the type and stage as indicated in Table 1. An explanation of the abbreviations used for the designation of the primary tumors listed in Table 1 and the primary tumors and cell lines referred to throughout this example has been given hereinbefore.

The results ofthe TaqmanTM are reported in delta (A) CT units. One unit corresponds 1 PCR cycle or approximately a 2-fold amplification relative to normal, two units corresponds to 4-fold, 3 units to 8-fold amplification and so on. Quantitation was obtained using primers and a TaqmanTM fluorescent prove derived from the PRO187-, PRO533-, PRO214-, PRO240-, PRO211-, PRO230-, PRO261-, PRO246- or PRO317- encoding gene. Regions of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246 or PRO3 17 which are most likely to contain unique nucleic acid sequences and which are least likely to have spliced out introns are preferred for the primer and probe derivation, e.g 3-untranslated region. The sequences for the primers and probes (forward, reverse and probe) used for the PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO26 1, PRO246 and PRO3 17 gene amplification were as follows: PRO187 (DNA27864): 27864.tm.f 5'-GGCCTTGCAGACAACCGT-3' (SEQ ID NO: 83) 27864.tm.r 5'-CAGACTGAGGGAGATCCGAGA-3' (SEQ ID NO: 84) 27864.tm.p (OLI6914) 5'-GCAGATTTTGAGGACAGCCACCTCCA-3' (SEQ ID NO: 85) PRO533 (DNA49435 DNA49435.tm.f 5'GGGACGTGCTTCTACAAGAACAG-3' (SEQ ID NO: 86) DNA49435.tm.r 5'-CAGGCTTACAATGTTATGATCAGACA-3' (SEQ ID NO: 87) DNA49435.tm.p 5'-TATTCAGAGTTTTCCATTGGCAGTGCCAGTT-3' (SEQ ID NO: 88) PRO214 (DNA32286) DNA32286.3utr-5 5'-GGGCCATCACAGCTCCCT-3' (SEQ ID NO: 89) DNA32286.3utr-3b 5'-GGGATGTGGTGAACACAGAACA-3' (SEQ ID NO: 90) DNA32286.3utr-probe 5'-TGCCAGCTGCA TGCTGCCAGTT-3' (SEQ ID NO: 91) PRO240 (DNA34387) DNA34387.3utr-5 5'-GTCAGGGAGCTCTGCTTCCTAG-3' (SEQ ID NO: 92)

DNA34387.3utr-3 5'-AAT GGCGGCCTCA ACCTT-3' (SEQ ID NO: 93) DNA343 87.3utr-probe.rc 5'-CGAATCCACTGGCGAAAGATGCCTT-3' (SEQ ID NO: 94) PRO211 (DNA32292) DNA32292.3utr-5 5'-CAGAAGGATGTCCCGTGGAA-3' (SEQ ID NO: 95) DNA32292.3utr-3 5'-GCCGCTGTCCACTGCAG-3' (SEQ ID NO: 96) DNA32292.3utr-probe.rc 5'-GACGGC ATCCTCAGGG CCACA-3' (SEQ ID NO: 97) PRO230 (DNA33223) DNA33223 .3utr-5 5'-GAAGAGCACAGCTGCAGATCC-3' (SEQ ID NO: 101) DNA33223.3utr-3 5'-GAGGTGTCCTGGCTTTGGTAGT-3' (SEQ ID NO: 102) DNA33223.3utr-probe 5'-CCTCTGGCGCCCCCACTCAA-3' (SEQ ID NO: 103) An alternate set of primers and probes was also used for PRO230: 33223 .tm.f3 5'GAGTGCGACATCGAGAGCTT-3' (SEQ ID NO: 98) 33323.tm.r3 5'-CCGCAGCCTCAGTGATGA-3' (SEQ ID NO: 99) 33323.tm.p3 5'-ATGTCCTCCATGCCCACGCG-3' (SEQ ID NO: 100) PRO261 (DNA33473) DNA33473.3utr-5 5'-TCTAGCCCACTCCCTGCCT-3' (SEQ ID NO: 104) DNA33473 .3utr-3 5'-GAAGTCGGAGAGAAAGCTCGC-3' (SEQ ID NO: 105) DNA33473.3utr-probe 5'-CACACACAGCCTATATCAAACATGCACACG-3' (SEQ ID NO: 106) PRO246 (DNA35639) DNA35639.3utr-5 5'-GGCAGAGACTTCCAGTCACTGA-3' (SEQ ID NO: 107)

DNA35639.3utr-3 5'-GCCAAGGGTGGTGTTAGATAGG-3' (SEQ ID NO: 108) DNA35639.3utr-probe 5'-CAGGCCCCCTTGATCTGTACCCCA-3' (SEQ ID NO: 109) <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> PRO317 (DNA3346l) <BR> <BR> <BR> <BR> <BR> <BR> DNA33461.tm.f 5'-CCAGGAGAGCTGGCGATG-3' (SEQ ID NO: 110) DNA33461.tm.r 5'-GCAAATTCAG GGCTCACTAG AGA-3' (SEQ ID NO: 111) DNA33461.tm.p 5'-CACAGAGCATTTGTCCATCAGCAGTTCAG-3' (SEQ ID NO: 112) The 5' nuclease assay reaction is a fluorescent PCR-based technique which makes use of the 5' exonuclease activity of Taq DNA polymerase enzyme to monitor amplification in real time. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the TAQ DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

The 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI Prism 7700TM Sequence Detection. The system consists of a thermocycler, laser, charge-coupled device (CCD) camera and computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.

5' Nuclease assay data are initially expressed as Ct, or the threshold cycle. This is defined as the cycle at which the reporter signal accumulates above the background level of fluorescence. The ACt values are used as quantitative measurement of the relative number of starting copies of a particular target sequence in a nucleic acid sample when comparing cancer DNA results to normal human DNA results.

Table 1 describes the stage, T stage and N stage of various primary tumors which were used to screen the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246 and PRO317 compounds of the invention.

Table 1 Primary Lung and Colon Tumor Profiles Primary Tumor Stage Other Stage Dukes T N Stage Stage Stage Human lung tumor SqCCA (SRCC724) [LTI] IB T1 N1 Human lung tumor NSCCa (SRCC725) [LTla] IA -- T3 NO Human lung tumor AdenoCa (SRCC726) [LT2] IB -- -- T2 NO Human lung tumor AdenoCa (SRCC727) [LT3] IB T1 N2 Human lung tumor SqCCq (SRCC728) [LT4] IIB Th N0 Human lung tumor AdenoCa (SRCC729) [LT6] IV T1 NO Human lung tumor Aden/SqCCa (SRCC730) IB Tl NO [LT7] Human lung tumor AdenoCa (SRCC731) [LT9] IIB -- -- T2 NO Human lung tumor SqCCa (SRCC732) [LT10] IA T2 Nl Human lung tumor AdenoCa (SRCC733) IB -- -- T1 N1 [LT11] Human lung tumor AdenoCa (SRCC734) IIA -- -- T2 N0 [LT12] Human lung tumor BAC (SRCC735) [LT13] IB -- -- T2 NO Human lung tumor SqCCa (SRCC736) [LT15] IB -- -- T2 NO Human lung tumor SqCCa (SRCC737) [LT16] IB -- -- T2 NO Human lung tumor SqCCa (SRCC738) [LT17] IIB -- -- T2 N1 Human lung tumor SqCCa (SRCC739) [LT18] IB -- -- T2 NO Human lung tumor SqCCa (SRCC740) [LT19] IB -- -- T2 N0 Human lung tumor LCCa (SRCC741) [LT21] IIB -- -- T3 N1 Human colon AdenoCa (SRCC742) [CT2] -- M1 D pT4 N0 Human colon AdenoCa (SRCC743) [CT3] -- B pT3 NO Human colon AdenoCa (SRCC 744) [CT8] B T3 NO

Human colon AdenoCa (SRCC745) [CT10] A pT2 N0 Human colon AdenoCa (SRCC746) [CT12] MO, RI B T3 N0 Human colon AdenoCa (SRCC747) [CT14] pMO, RO B pT3 pN0 Human colon AdenoCa (SRCC748) [CT15] M1, R2 D T4 N2 Human colon AdenoCa (SRCC749) [CT16] pMO B pT3 pNO Human colon AdenoCa (SRCC750) [CT17] cl pT3 pN1 Human colon AdenoCa (SRCC751) [CTl] MO, R1 B pT3 NO Human colon AdenoCa (SRCC752) [CT4] B pT3 MO Human colon AdenoCa (SRCC753) [CT5] G2 Cl pT3 pN0 Human colon AdenoCa (SRCC754) [CT6] pMO, RO B pT3 pN0 Human colon AdenoCa (SRCC755) [CT7] Gi A pT2 pN0 Human colon AdenoCa (SRCC756) [CT9] G3 D pT4 pN2 Human colon AdenoCa (SRCC757) [CTl 1] B T3 NO Human colon AdenoCa (SRCC758) [CT18] MO,RO B pT3 pN0 DNA Preparation: DNA was prepared from cultured cell lines, primary tumors, normal human blood. The isolation was performed using purification kit, buffer set and protease and all from Quiagen, according to the manufacturer's instructions and the description below.

Cell culture isis: Cells were washed and trypsinized at a concentration of 7.5 x 108 per tip and pelleted by centrifuging at 1000 rpm for 5 minutes at 4°C, followed by washing again with 1/2 volume of PBS recentrifugation. The pellets were washed a third time, the suspended cells collected and washed 2x with PBS.

The cells were then suspended into 10 mL PBS. Buffer C1 was equilibrated at 4°C. Quiagen protease #19155 was diluted into 6.25 ml cold ddH20 to a final concentration of 20 mg/ml and equilibrated at 4°C. 10 mL of G2 Buffer was prepared by diluting Quiagen RNAse A stock (100 mg/ml) to a final concentration of 200 µg/ml.

Buffer Cl (10 mL, 4°C and ddH20 (40 mL, 4"C ) were then added to the 10 mL of cell suspension, mixed by inverting and incubated on ice for 10 minutes. The cell nuclei were pelleted by centrifuging in a Beckman swinging bucket rotor at 2500 rpm at 4"C for 15 minutes. The supernatant was discarded and the nuclei were suspended with a vortex into 2 mL Buffer C1 (at 4"C) and 6 mL ddH2O, followed by a second 4°C centrifugation at 2500 rpm for 15 minutes. The nuclei were then resuspended into the residual buffer using 200 ,ul per tip. G2 buffer (10 ml) was added to the suspended nuclei while gentle vortexing was applied. Upon completion of buffer addition, vigorous vortexing was applied for 30 seconds. Quiagen protease (200 ul, prepared as indicated above) was added and incubated at 50"C for 60 minutes. The incubation and centrifugation was repeated until the lysates were clear (e.g., incubating additional 30-60 minutes, pelleting at 3000 x g for 10 min., 4"C).

Solid human tumor sample preparation and lysis: Tumor samples were weighed and placed into 50 ml conical tubes and held on ice. Processing was limited to no more than 250 mg tissue per preparation (1 tip/preparation). The protease solution was freshly prepared by diluting into 6.25 ml cold ddH2O to a final concentration of 20 mg/ml and stored at 4"C. G2 buffer (20 ml) was prepared by diluting DNAse A to a final concentration of 200 mg/ml (from 100 mg/ml stock). The tumor tissue was homogenated in 19 ml G2 buffer for 60 seconds using the large tip of the polytron in a laminar- flow TC hood to order to avoid inhalation of aerosols, and held at room temperature. Between samples, the polytron was cleaned by spinning at 2 x 30 seconds each in 2L ddH20, followed by G2 buffer (50 ml). If tissue was still present on the generator tip, the apparatus was disassembled and cleaned.

Quiagen protease (prepared as indicated above, 1.0 ml) was added, followed by vortexing and incubation at 50"C for 3 hours. The incubation and centrifugation was repeated until the lysates were clear (e.g., incubating additional 30-60 minutes, pelleting at 3000 x g for 10 min., 4"C).

Human blood preparation and lysis: Blood was drawn from healthy volunteers using standard infectious agent protocols and citrated into 10 ml samples per tip. Quiagen protease was freshly prepared by dilution into 6.25 ml cold ddH2O to a final concentration of 20 mg/ml and stored at 40C. G2 buffer was prepared by diluting RNAse A to a final concentration of 200,ug/ml from 100 mg/ml stock. The blood (10 ml) was placed into a 50 ml conical tube and 10 ml Cl buffer and 30 ml ddH2O (both previously equilibrated to 4"C) were added, and the components mixed by inverting and held on ice for 10 minutes. The nuclei were pelleted with a Beckman swinging bucket rotor at 2500 rpm, 4"C for 15 minutes and the supernatant discarded. With a vortex, the nuclei were suspended into 2 ml Cl buffer (4°C) and 6 ml ddH2O (4"C). Vortexing was repeated until the pellet was white. The nuclei were then suspended into the residual buffer using a 200 Ful tip. G2 buffer (10 ml) were added to the suspended nuclei while gently vortexing, followed by vigorous vortexing for 30 seconds. Quiagen protease was added (200 ul) and incubated at 50"C for 60 minutes. The incubation and centrifugation was repeated until the lysates were clear (e.g., incubating additional 30-60 minutes, pelleting at 3000 x g for 10 min., 40 C).

Purification of cleared lysates: (1) Isolation of genomic DNA: Genomic DNA was equilibrated (1 sample per maxi tip preparation) with 10 ml QBT buffer.

QF elution buffer was equilibrated at 500C. The samples were vortexed for 30 seconds, then loaded onto equilibrated tips and drained by gravity. The tips were washed with 2 x 15 ml QC buffer. The DNA was eluted into 30 ml silanized, autoclaved 30 ml Corex tubes with 15 ml QF buffer (500 C). Isopropanol (10.5 ml) was added to each sample, the tubes covered with parafin and mixed by repeated inversion until the DNA precipitated. Samples were pelleted by centrifugation in the SS-34 rotor at 15,000 rpm for 10 minutes at 4"C.

The pellet location was marked, the supernatant discarded, and 10 ml 70% ethanol (4"C) was added. Samples were pelleted again by centrifugation on the SS-34 rotor at 10,000 rpm for 10 minutes at 4"C. The pellet location was marked and the supernatant discarded. The tubes were then placed on their side in a drying rack and dried 10 minutes at 37"C, taking care not to overdry the samples.

After drying, the pellets were dissolved into 1.0 ml TE (pH 8.5) and placed at 50"C for 1-2 hours. Samples were held overnight at 4"C as dissolution continued. The DNA solution was then transferred

to 1.5 ml tubes with a 26 gauge needle on a tuberculin syringe. The transfer was repeated 5x in order to shear the DNA. Samples were then placed at 50"C for 1-2 hours.

Quantitation ofgenomic DNA and preparation for gene amplification assay: The DNA levels in each tube were quantified by standard A260, A280 spectrophotometry on a 1:20 dilution (5 u1 DNA + 95 ul ddH20) using the 0.1 ml quartz cuvetts in the Beckman DU640 spectrophotometer. A260/A280 ratios were in the range of 1.8-1.9. Each DNA samples was then diluted further to approximately 200 ng/ml in TE (pH 8.5). If the original material was highly concentrated (about 700 ng/l), the material was placed at 50"C for several hours until resuspended.

Fluorometric DNA quantitation was then performed on the diluted material (20-600 ng/ml) using the manufacturer's guidelines as modified below. This was accomplished by allowing a Hoeffer DyNA Quant 200 fluorometer to warm-up for about 15 minutes. The Hoechst dye working solution (#H33258, 10 u1, prepared within 12 hours of use) was diluted into 100 ml 1 x TNE buffer. A 2 ml cuvette was filled with the fluorometer solution, placed into the machine, and the machine was zeroed. pGEM 3Zf(+) (2 ,u1, lot &num 360851026) was added to 2 ml of fluorometer solution and calibrated at 200 units. An additional 2 u1 of pGEM 3Zf(+) DNA was then tested and the reading confirmed at 400 +/- 10 units. Each sample was then read at least in triplicate. When 3 samples were found to be within 10% of each other, their average was taken and this value was used as the quantification value.

The fluorometricly determined concentration was then used to dilute each sample to 10 ng/ul in ddH2O. This was done simultaneously on all template samples for a single TaqMan plate assay, and with enough material to run 500-1000 assays. The samples were tested in triplicate with TaqmanTM primers and probe both B-actin and GAPDH on a single plate with normal human DNA and no-template controls. The diluted samples were used provided that the CT value of normal human DNA subtracted from test DNA was +/- 1 CT. The diluted, lot-qualified genomic DNA was stored in 1.0 ml aliquots at -80°C. Aliquots which were subsequently to be used in the gene amplification assay were stored at 4"C. Each 1 ml aliquot is enough for 8-9 plates or 64 tests.

Gene amplification assay: The PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246 and EBAF- 2 (PRO3 17) compounds of the invention were screened in the following primary tumors and the resulting ACt values are reported in Table 2.

Table 2 ACt values in lung and colon primary tumor models Primary PRO187 PRO533 PRO214 PRO240 PRO21 1 PRO230 PRO261 PRO246 PRO3 7 Tumor LTI -1.53 -0.05 0.14, 0.02 0.40, -0.24 0.41 0.31, 0.52 0.13 -0.48 0.85 LTla -0.17 1.02 0.85 1.36 1.18 0.45 1.08 0.89 1.29 LTh -1.75 -0.17 -0.09 0.52 0.56 -0.24 0.27 -0.13 0.69 LT3 0.32 0.78 1.57 1.22 1.97 0.86 0.98 1.06 1.86 LT4 -1.80 0.14 0.28 0.13 1.17 -0.44 0.32 0.64 1.18 LT6 -0.12 -0.02 0.66 1.12 0.75 0.83 0.45 0.60 1.93 LT7 -1.09 1.04 0.87 0.89 0.51 0.73 0.03 0.10 1.52 LT9 -0.42 0.80 0.89 0.88 1.42 0.54 0.18 0.27 1.04 LT10 0.31 0.79 0.96 1.24 1.96 0.31 1.16 1.07 2.57 LT11 0.54, 1.09 1.67, 1.98, 2.05, 1.32, 0.67, 3.43, 2.20, 0.22 1.80 2.38, 1.89 1.14, 1.59, 1.41 2.33 2.78, 0.83, 0.63, 1.99, 1.54, 0.19, 1.90 0.80 LT12 2.70, 0.76 1.38, 2.32, 1.51, 2.86, 0.80, 2.47, 2.54, 2.90 1.49 2.54, 1.27 2.96, 1.73, 1.54 1.74 2.42, 2.92, 1.08, 3.02, 2.68, 2.23 3.07 2.28 LT13 2.74, 0.91 1.85, 2.01, 1.88, 3.42, 1.02, 1.63, 1.90, 2.98 1.83 2.37, 2.26 3.22, 1.13, 1.68 2.24 2.13, 2.84, 1.01, 2.46, 2.75, 0.29 2.58 2.53 LTI 5 3.75, 0.50 1.77, 2.44, 2.44, 4.32, 0.97, 2.11, 2.06, 3.92 1.58 2.77, 2.16 4.47, 2.64, 1.56 2.76 2.79, 3.64, 0.56, 3.25, 3.56, 2.38 3.30 3.32 LT16 -0.23, 1.66 0.91, 0.95, 1.25, 1.15, 0.80, 0.92, 1.55, -0.28 0.82 1.11, 0.86 0.97, 0.75, 0.18 1.08 1.05, 0.29, 0.82, 1.37, 0.72, 2.05 1.20 0.54 LT17 0.71, 1.32 1.93, 1.24, 1.85, 1.26, 1.67, 2.68, 2.29, 0.47 1.87 2.47, 2.30 1.39, 2.01, 1.69 2.03 2.03, 1.30, 1.43, 1.95, 1.33, 0.93 1.79 1.30

LT18 -1.29, 0.34 -0.11, -0.44, 0.48, -0.21, 1.22, 0.36. -0.66 -1.58 -0.27 0.40, 0.53 -0.50 0.46, -0.28 -0.38 0.07, -1.19, 0.15, 0.33, 0.07, -0.17 0.30 -0.44 LT19 4.05, 1.67 2.09, 3.07, 2.42, 4.92, 0.78, 1.91, 2.51, 3.99 1.98 3.35, 2.55 4.93, 1.38, 1.68 2.03 3.64, 3.78, 1.39, 3.07, 4.76, 2.33 3.44 4.05 LT21 -0.43, 0.92 0.97, -0.04, 1.26, 0.03, 0.04, 1.50, 0.08, -0.72 0.94 1.22, 0.98 0.44, 1.14, 0.60 0.45 0.80, -1.48, 0.48, 0.50, 0.49, 3.40 0.52 1.09 CT2 -- -- 2.49 1.89 -- 0.82 1.66 -- -- CT3 -- -- 2.06 1.65 -- 1.34 2.14 -- -- CT8 -- -- 1.48 1.21 -- 0.60 0.55 -- -- CT10 -- -- 1.84 1.81 -- 1.00 1.00 -- -- CT12 -- -- 1.81 1.37 -- 1.13 0.34 -- -- CT14 -- -- 2.48 2.20 -- 0.79 1.03 -- -- CT15 -- -- 1.63 1.85 -- 0.96 0.67 -- -- CT16 -- -- 1.95 1.83 -- 1.40 0.87 -- -- CT17 -- -- 2.04 1.76 -- 1.74 -0.19 -- -- CT1 -- -- 1.22 1.50 1.27 1.25 -0.06 -- -- CT4 -- -- 1.36 1.86 1.33 1.32 1.00 -- -- CT5 -- -- 1.56 2.41 1.76 2.27 1.07 -- -- CT6 -- -- 1.33 1.58 1.01 0.97 -0.08 -- -- CT7 -- -- 0.64 1.09 0.70 1.39 0.15 -- -- CT9 -- -- 0.38 -0.05 0.21 -0.18 0.68 -- -- CT11 -- -- 2.05 3.08 2.01 1.75 0.59 -- -- CT18 -- -- 0.63 0.26 0.76 0.75 0.73 -- -- A549 -- -- -0.30 -- -0.71 -- -- -1.67 -- Calu-l -- -- 0.10 -- -0.40 -- -- -0.79 -- Calu-6 -- -- -0.62 -- -0.78 -- -- -0.80 -- H157 -- -- 0.10 -- -0.70 -- -- -0.08 -- H441 -- -- -0.45 -- -0.44 -- -- -0.13 -- H460 -- -- -0.51 -- -0.61 -- -- -0.48 --

SKMES1 -- -- -0.09 -- 0.31 -- -- 0.85 -- SW900 -- -- -0.05 -- 1.86 -- -- -0.32 -- SW480 -- -- -- -- -- -- 0.62, -- 1.90, 1.20, 1.57, 1.68, 1.36, 1.59, 1.86, 1.91, 2.36, 1.68, 1.53, 2.50 SW620 -- -- -- -- -- -- 0.66, -- -- 1.65, 1.85, 1.63, 1.61, 1.24, 1.52, 1.98, 1.57, 1.83, 1.41, 1.42, 1.59 Colo320 -- -- -- -- -- -- -0.33, -- -- 0.66, 0.48, 0.91, 0.72, 0.33, 2.49, 0.99, 1.06, 1.24, 1.04, 0.46, 0.27 HT29 -- -- -- -- -- -- 0.46, -- -- 1.95, 1.61, 2.58, 1.49, 1.38, 1.40, 2.00, 2.59, 2.59, 1.39, 1.32 HM7 -- -- -- -- -- -- -0.70, -- -- 0.74, -0.29, 0.66, 0.27, 0.08, 0.54, 0.67, 0.64, 0.34, 0.09, 0.29, 0.21 WiDr -- -- -- -- -- -- 0.19, -- -- 1.64, 1.00, 1.71, 1.44, 1.57, 0.93, 1.84, 1.58, 0.91, 0.87 HCT116 16 -- -- -- -- -- -- 0.25, -- -- 1.29, 1.04, 2.01, 1.29, 1.07, 1.08, 2.05, 1.81, 1.56, 1.05, 1.09, 0.96 0.73, 1.99, 1.33, 1.00, 1.33, 1.26, 1.19, 2.10, 1.50, 2.13, 1.33, 1.29

SW403 -- -- -- -- 0.26, -- -- 1.98, 1.42, 2.20, 2A0, 1.50, 1.43, 2.15, 1.52, 1.67, 2.19, 1.40, 1.29 LS174T -- -- -- -- -- -- 1.48 HBL100 -- -- -- -- -- -- lAO -- -- MB435s -- -- -- -- -- -- 1.43 -- -- T47D -- -- -- -- -- -- 0.38 -- -- MB468 -- -- -- -- -- -- -0.08 -- -- MB175 -- -- -- -- -- -- 0.23 -- -- MB361 -- -- -- -- -- -- 0.37 -- -- BT20 -- -- -- -- -- -- 1.66 -- -- MCF7 -- -- -- 0 -- -- 0.53 -- -- SKBR3 -- -- -- -- -- -- 1.73 -- -- PRO230: PRO230 (DNA33223) was also reexamined with both framework and epicenter mapping. Selected tumors from the above initial screen were reexamined with both framework and epicenter mapping. Figure 42 and Table 3 indicate the chromosomal mapping of both the framework and epicenter markers that were used in the present example. The framework markers are located approximately every 20 megabases and were used to control aneuploidy.

Table 3 Framework Markers Map Position Stanford Human Genome Center Marker Name Al SHGC-33169 A40 SHGC-3901 A84 AFM234tb6 A129 ACT1B03 A180 SHGC-34001 A220 AFM338wb5 A263 EST00691 A312 SHGC-7599 A355 SHGC-32839 A398 SHGC-37552 A443 SHGC-l 1921 A485 SHGC-9327 A520 SHGC-30345 A553 SHGC-3055 The ACt values of the above described framework markers along Chromosome 1 relative for PRO230 are indicated for selected tumors in Table 4.

Table 4<BR> Amplification of framework markers relative to DNA33223 - Framework Markers (#Ct) Framework Markers Tumor A1 A40 A84 A129 A180 A220 A263 A312 A355 A398 A443 A484 A520 A553 DNA 33223-utr LT1 0.64 0.11 0.03 -0.19 --- 0.35 -- 0.11 0.23 0.22 0.58 0.42 0.31 0.20 -0.38 LT1a 0.76 0.32 -0.18 -0.28 --- 0.29 --- -0.54 -0.04 -4.27 -0.08 0.22 0.05 0.11 0.45 LT2 0.54 0.48 -0.03 -0.14 --- 0.33 --- 0.07 0.19 0.46 0.30 0.42 0.07 0.27 -0.32 LT3 1.14 0.51 -0.13 -0.21 --- 0.65 --- -0.15 -0.05 -0.34 0.00 0.01 -0.05 0.02 0.87 LT4 0.73 0.21 -0.40 -0.10 --- 0.45 --- -0.25 0.32 0.37 0.20 0.42 0.05 0.23 -0.63 LT6 0.55 0.44 -0.40 0.02 --- 0.63 --- -0.56 0.43 0.83 -0.17 0.02 -0.16 -0.31 0.63 LT7 0.53 -0.04 -0.15 -0.25 --- 0.63 --- -0.27 -.56 -0.58 0.87 0.96 0.70 0.54 0.86 LT9 0.55 -0.31 -0.08 -0.28 --- 0.51 --- -0.63 -0.01 -0.12 -0.17 0.01 -0.30 -0.25 -0.07 LT10 0.78 0.11 0.16 0.11 --- 0.90 --- -0.18 -0.18 0.00 0.15 -0.15 -0.09 -0.22 0.77 LT11 0.63 0.32 -0.48 -0.16 0.00 0.07 0.00 -0.15 0.18 0.13 -0.11 0.35 0.35 0.00 1.30 LT12 0.29 0.30 -0.32 -0.51 0.00 -0.18 0.00 -0.72 0.04 0.02 -0.21 -0.06 0.27 -0.10 2.76 LT13 0.66 0.39 -0.04 -0.47 0.00 -0.65 0.00 -0.04 -0.12 -0.24 -0.20 0.01 0.02 -0.08 3.42 LT15 0.53 0.29 0.00 -0.16 0.00 0.25 0.00 -0.38 -0.02 -0.03 -0.11 -0.11 0.65 0.18 4.64 LT16 0.89 0.57 0.73 -0.22 0.00 0.64 0.00 -0.97 0.37 0.12 -0.04 -0.03 0.83 0.35 0.73 LT17 0.66 0.41 -0.51 0.04 0.00 0.69 0.00 -0.22 0.09 0.22 -0.01 -0.25 0.60 0.26 1.24 LT18 -0.21 0.56 -0.11 -1.99 0.00 0.32 0.00 -0.83 0.02 -0.19 -0.04 -0.22 0.63 -0.01 -0.24 LT19 0.26 -13.38 -.17 -0.31 0.00 0.02 0.00 -0.51 -0.10 0.28 -0.41 -0.29 0.41 0.04 4.74 LT21 0.03 0.23 -0.17 -0.09 0.00 0.69 0.00 -0.09 -0.10 -0.08 -0.04 -0.17 0.61 -0.07 0.28

Table 5 describes the epicenter markers that were employed in association with PRO230 (DNA33223). These markers are located in close proximity to DNA33223 and are used to assess the amplification status of the region of chromosome 1 in which DNA33223 is located. The distance between individual markers is measured in centirays, which is a radiation breakage unit approximately equal to a 1% chance of a breakage between two markers. One cR is very roughly equivalent to 20 kilobases. The marker SHGC-35321 is the marker found to be the closest to the location on chromosome 1 where DNA33223 most closely maps.

Table 5 Epicenter Markers Map Position on Chromosome 1 Stanford Human Genome Center CR Distance to Next Marker Marker Name A83 SHGC-37693 97 (gap) A84 AFM234tb6 9 A85 AFM240za9 46 A86 AFM199zd2 10 A87 SHGC-35321 11 A88 SHGC-3252 12 A89 SHGC-11204 173 A102 SHGC-11219 Table 6 indicates the ACt values for results of epicenter mapping relative to DNA33223, indicating the relative amplification in the region more immediate to the actual location of DNA33223 along chromosome 1.

Table 6 Amplification of Epicenter Markers Relative to DNA33223 A83 A84 A85 A86 A87 A88 A89 A102 DNA33223. DNA33223. 3'utr tm3 LTl -0.22 -0.05 -0.15 -0.05 1.14 -0.82 0.12 -0.07 -1.42 -0.58 LT1a -0.35 -1.23 -0.48 -0.02 1.32 0.90 -0.27 0.69 2.11 2.02 LT2 -0.23 -1.70 -0.32 -0.05 0.97 0.72 -0.03 0.32 -1.35 -0.73 LT3 0.09 -0.60 0.00 -0.26 1.53 1.17 0.22 1.01 1.51 1.68 LT4 -0.05 -0.44 -0.15 -0.08 0.90 0.90 -0.02 0.6 -1.70 -0.66 LT6 -0.20 -0.10 -0.19 -0.11 1.67 1.20 0.27 1.4 3.79 3.52 LT7 -0.28 0.22 -0.09 0.26 1.59 0.90 0.09 -14.51 0.97 0.73 LT9 -0.22 0.02 -0.23 0.07 1.90 143 0.04 2.02 4.44 4.26

LT10 -0.29 -1.07 -0.27 -0.09 2.09 1.19 0.09 1.85 4.41 4.19 LT11 -0.15 -0.02 -0.09 0.43 0.65 1.15 0.10 0.88 0.90 0.91 LT12 -0.03 0.09 -0.20 0.16 0.59 1.00 0.13 0.36 2.39 1.74 LT13 -0.01 -0.17 -0.25 0.23 0.68 1.06 0.06 0.81 2.70 2.15 LT15 -0.02 0.14 -0.18 -0.02 0.34 0.96 0.07 1.28 3.89 2.91 LT16 0.22 0.49 0.43 0.47 0.94 1.12 0.34 1.37 0.18 0.31 LT17 0.13 0.85 0.21 0.04 1.06 0.39 0.30 0.98 0.63 0.95 LT18 -0.07 0.36 0.14 -0.11 0.47 -4.77 0.27 0.09 -0.82 -0.66 LT19 -0.29 -0.44 -0.35 -0.30 0.19 -0.13 0.17 1.35 4.09 3.23 LT21 -0.22 -0.59 -0.13 -0.16 0.88 0.91 -0.05 0.44 -0.54 0.29 PRO240: PRO240 was also reexamined with epicenter mapping. Table 7 describes the epicenter markers that were employed in association with PRO240 (DNA34387). These markers are located in close proximity to DNA34387 and are used to assess the amplification status of the region of chromosome 2 in which DNA34387 is located. The distance between individual markers is measured in centirays, which is a radiation breakage unit approximately equal to a 1% chance of a breakage between two markers. One cR is very roughly equivalent to 20 kilobases. The marker SHGC-14626 is the marker along chromosome 2 which most closely maps to DNA34387; however, the TaqmanTM primers and probes for SHGC-1426 failed in our assay, due to technical difficulties related to PCR. DNA34387 was also found to be contained with a BAC (Bacterial Artificial Chromosome). The full BAC was about 100 Kb. The 5' and 3' ends were sequenced and used to generated the BAC primers indicated in Table 8. This confirms the validity of our original epicenter mapping results.

Table 7 Epicenter Markers Stanford Human Genome Map Position on Chromosome 2 Stanford Human Genome Center Distance to next marker (cR) Marker Name B60 AFMa136wh9 65 (gap) B63 AFM254vc9 6 B64 SHGC-14574 28 B65 SHGC-14626 7 B66 SHGC-11736 7 B67 SHGC-35430 17 B68 AFM234YA9 32 B71 CHLC.GATA8F07.440 --

Table 8 indicates the DCt values for results of epicenter mapping relative to DNA34387, indicating the relative amplification in the immediate chromosomal region along Chromosome 2.

Table 8 Amplification of Epicenter and BAC Markers Relative DNA34387 Framework Markers (ACt) Lung B63 B64 B66 B67 B68 BAC BAC DNA34387 tumor (for.) (rev.) LT1 0.22 0.34 0.10 0.65 0.64 0.11 0.91 0.65 LTla -0.04 0.03 -0.21 -0.03 0.22 | 1.29 0.61 1.63 LT2 0.15 -0.01 0.14 0.43 0.49 0.08 0.68 0.54 LT3 0.04 0.07 -0.30 0.16 0.29 0.98 0.89 1.97 LT4 -0.13 -0.09 -0.26 0.70 0.82 -0.26 0.82 0.70 LT6 -0.41 0.07 -0.71 0.06 0.35 0.81 0.69 1.26 LT7 -0.29 0.22 -0.32 0.29 0.32 0.74 0.42 1.06 LT9 -0.21 0.66 -0.15 0.38 0.32 0.62 0.48 1.58 LT10 -0.32 0.18 -0.28 0.76 0.28 0.99 0.38 1.41 LT11 0.08 0.76 0.24 0.05 0.88 2.13 0.72 2.25 LT12 -0.11 0.38 0.18 0.27 0.70 2.86 0.42 3.11 LT13 0.03 0.46 -0.02 0.00 0.68 2.84 0.53 2.85 LT15 -0.03 0.35 0.00 -0.08 0.52 3.73 0.71 3.78 LT16 -0.03 -16.55 0.02 0.23 0.63 0.91 0.47 1.33 LT17 0.20 0.45 0.19 0.58 0.86 1.99 0.80 2.20 LT18 -0.09 -0.45 0.11 0.46 0.32 -0.39 0.57 0.18 LT19 -0.18 0.32 -0.10 0.30 0.66 3.91 0.58 3.93 LT21 -0.02 0.40 -0.06 0.45 0.77 0.66 0.71 1.10 DISCUSSION and CONCLUSION: PRO187: The ACt values for DNA27864 (PRO 187) in a variety of lung tumors are reported in Table 2.

A ACt value of > 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that significant amplification of DNA 27864 occurred in primary lung tumors LT12, LT13, LT15, and LT19. The average ACt values were 2.80, 2.86, 3.84 and 4.02. This represents approximately a 7.0, 7.3, 14.3 and 16.2 fold increase in gene copy relative to normal tissue. Because amplification of DNA27864 (PRO187) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA27864 (PRO187) would be expected to be useful in cancer therapy.

PRO533: The ACt values for DNA49435 (PRO533) in a variety of lung tumors are reported in Table 2.

A ACt value of >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that amplification ofDNA49435 occurred in primary lung tumors LTla, LT7, LT11, LT16, LT17 and LT19. The ACt values in these tumors were 1.02, 1.04, 1.09, 1.66, 1.32 and 1.67. This represents approximately a 2.0, 2.1, 2.1, 3.2, 2.5 and 3.2, respectively, fold increase in gene copy relative to normal tissue. Because amplification of DNA49435 (PRO533) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA49435 (PRO533) would be expected to be useful in cancer therapy.

PRO214: The ACt values for DNA32286 (PRO2 14) in a variety of lung and colon tumors are reported in Table 2. A ACt value of > 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that significant amplification of DNA32286 occurred in: (1) primary lung tumors LT3, LTl 1, LTl2, LT13, LT15, LT17, LT19; and (2) primary colon tumors CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT1, CT4, CT5, CT6 and CT1 1. The ACt and average ACt values for the lung tumors were the following: 1.57, 1.74, 1.44, 1.84, 1.68, 1.90, 2.04, respectively; while the those for the primary colon tumors were: 2.49, 2.06, 1.48, 1.84, 1.81, 2.48, 1.63, 1.95, 2.04, 1.22, 1.36, 1.56, 1.33 and 2.05, respectively. For the lung tumors, this represents approximately a 3.0, 3.3, 2.7, 3.6., 3.2,3.7 and 4.1, respectively, fold increase in gene copy relative to normal tissue. For the colon tumors, this represents approximately a 5.6,4.2,2.8,3.6,3.5, 5.6,3.1,3.9,4.1,2.3, 2.6,2.9,2.5 and 4.1, respectively, fold increase in gene copy relative to normal tissue. Because amplification of DNA32286 (PRO214) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA32286 (PRO214) would be expected to be useful in cancer therapy.

PRO240: The Act values for DNA34387 (PRO240) in a variety of lung and colon tumors are reported in Table 2. A ACt value of> 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that significant amplification of DNA34387 occurred in: (1) primary lung tumors LTla, LT3, LT6, LT10, LT11, LT12, LT13, LT15, LT16, LT17 and LT19; and (2) primary colon tumors CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CTI, CT4, CT5, CT6, CT7 and CT11.

The ACt and average ACt values for the primary lung tumors were the following: 1.36, 1.22, 1.12, <BR> <BR> <BR> <BR> 1.24,2.21, 2.67,2.31,2.91, 2.91, 1.14, 1.90,3.31, respectively; while those for the primary colon tumors were: 1.89, 1.65, 1.21, 1.81, 1.37, 2.20, 1.85, 1.83, 1.76, 1.50, 1.86, 2.41, 1.58, 1.09 and 3.08.

For the lung tumors, this represents approximately a 2.6, 2.3, 2.2, 2.4, 4.6, 6.4, 5.0, 7.5, 2.2, 3.7 and 9.9, respectively, fold increase in gene copy relative to normal tissue. For th: colon tumors, this represents approximately a3.7, 3.1,2.3,3.5,2.6,4.6, 3.6.3.6,3.4,2.8,3.6, 3.0,2.1 and 8.5, respectively, fold increase in gene copy relative to normal tissue.

Additional epicenter mapping amplfication reported in Table 10 indicate that significant amplification of DNA34387 occured in primary lung tumors LTla, LT3, LT6, LT7, LT9, LT10, LT1 1, LT12, LT13, LTI5, LT16, LT17, LT19 and LT21, which report ACt's of 1.63, 1.97, 1.26, 1.06, 1.58, 1.41, 2.25, 3.11,

2.85, 3.78, 1.33,2.20,3.93 and 1.10, respectively. This represents approximately a 3.1, 3.9, 2.4, 2.1, 3.0, 2.6, 4.8, 8.6, 7.2, 13.7, 2.5, 4.6, 15.2 and 2.1, respectively, amplification in gene copy relative to normal tissue.

In contrast, the amplification of the closest known markers (Table 10) are not amplified to a greater extent than DNA34387. Moreover, it appers that DNA34387 is very close to the BAC marker 208K21Forl, as the maker is amplification in the same pattern of tumors as DNA34387, and the degree of amplification is similar.

With the exception of 208K2 1 For 1, amplifiation of the closest markers to DNA343 87 does not occur to a greater extent than that of DNA34387. This strongly suggests that DNA34387 is the gene that is the cause for the amplification of the particular region on Chromosome 2. Because amplification of DNA34387 (PRO240) occurs in various tumors, it is likely to play a significant role in tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA34387 (PRO240) would be expected to be useful in cancer therapy.

Because amplification of DNA34387 (PRO240) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA34387 (PRO240) would be expected to be useful in cancer therapy.

PRO211: The ACt values for DNA32292 (PRO21 1) in a variety of primary lung and colon tumors as well as lung tumor cell lines are reported in Table 2. A ACt value of> 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that significant amplification of DNA32292 in: (1) primary lung tumors LTla, LT3, LT4, LT9, LT10, LT11, LT12, LT13, LT15, LT16, LT17, LT19, LT21; (2) primary colon tumors CTI, CT4, CT5, CT6, CT11; and (3) lung tumor cell line SW900.

The ACt and average ACt values for the primary lung tumors were the following: 1.18,1.97, 1.17, 1.42, 1.96, 1.97, 1.39, 2.07, 2.30, 1.06, 2.08, 2.49 and 1.12, respectively; while those for the primary colon tumors were: 1.27, 1.33, 1.76, 1.01 and 2.01; and the lung tumor cell line SW900 gave a ACt value of 1.86.

For the lung tumors, this represents approximately a 2.3, 3.9, 2.2, 2.7, 3.9, 3.9,2.6, 4.2, 4.9,2.1, 4.2, 5.6 and 2.2, respectively, fold increase in gene copy relative to normal tissue. For colon tumors, this represents approximately a 2.4, 2.5, 3.4, 2.0, 4.0, respectively, fold increase in gene copy relative to normal tissue. For the lung tumor cell line SW900, DNA32292 is present in approximately 3.6 fold above normal levels.

Because amplification of DNA32292 (PRO21 1) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA32292 (PRO2 11) would be expected to be useful in cancer therapy.

PRO230: The ACt values for DNA33223 (PRO230) in a variety of lung and colon tumors are shown in Table 2. PRO230 were subjected to further framework and epicenter analysis. A Act value of> 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. The framework markers analysis reports the relative amplification of particular regions of chromosome 1 in the indicated tumors, while the epicenter markers analysis gives a more precise reading of the relative amplification in the region immediately in the vicinity of the gene of interest.

Based on the initial screening data reported in Table 2 as well as framework and epicenter mapping data in Tables 3 and 5, DNA33223 (PRO230) shows amplification in lung tumors LTla, LT3, LT6, LT9, LT10, LT12, LT13, LT15 and LT19. DNA33223 (PRO230) also shows amplification in colon tumors CT3, CT10, CT12, CT16, CT17, CT1, CT4, CT5, CT7 and Cm1 1. The greatest amplification occurred in lung tumors LT6, LT9, LT10, LT12, LT13, LT15 and LT19, which reported confirmed average ACt values of 3.66, 4.35,4.30,2.07, 2.43, 3.40 and 3.66. This represents approximately a 12.6, 20.4, 19.7, 4.2, 5.4, 10.6 and 12.6, respectively, fold increase in gene copy in these samples relative to the normal samples. Confirmatory framework and epicenter amplification of the colon tumors was not performed, as amplification in the colon tumors did not appear to occur to as great an extent as in the lung.

In contrast, the amplification results for the closest known markers (Tables 4 and 6) are not amplified to a greater extend than DNA33223. This very strongly suggests that DNA33223 is the gene that is the cause for the amplification of that particular region on Chromosome 1. Because DNA33223 is the cause of amplification in a number of different tumors, it is likely to play a significant role in tumor formation or growth.

As a result, antagonists (e.g., antibodies) directed against the protein encoded by DNA33223 (PRO230) would be expected to be useful in cancer therapy.

PRO261: The Act values for DNA33473 (PRO261) in a variety of primary lung and colon tumors as well as lung tumor cell lines are reported in Table 2. A bCt value of> 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that significant amplification ofDNA33474 in: (1) primary lung tumors LTla, LT10, LT12, LT15, LT17 and LT19; (2) primary colon tumors CT2, CT3, CT14, CT5; (3) colon tumor cell lines SW480, SW620, HT29, WiDr, HCT1 16, SKCO1, SW403, LS174T and (4) breast tumor cell lines HBL100, MB435s, BT20 and SKBR3.

The ACt and average ACt values for the primary lung tumors were the following: 1.08, 1.16, 1.17, 1.64, 1.50 and 1.47, respectively; those for the primary colon tumors were 1.16, 2.14, 1.03 and 1.07, respectively; those for the colon tumor cell lines 1.67, 1.54, 1.73, 1.24, 1.32, 1.35, 1.65, and 1.48, respectively; and those for the breast tumor cell lines were 1.40, 1.43, 1.66 and 1.73, respectively.

For the lung tumors, this represents approximately a 2.1, 2.2, 2.2, 3.1, 2.8 and 2.8, respectively, fold increase in gene copy relative to normal tissue. For the colon tumors, this represents 2.2, 4.4, 2.0 and 2.1, respectively, fold increase in gene copy relative to normal tissue. For the colon tumor cell lines, this represents a 3.2,2.9, 3.3,2.4, 2.5,2.5, 3.1 and 2.8, respectively, fold increase in gene copy relative to normal tissue. For the breast tumor cell lines, this represents a 2.6, 2.7, 3.2 and 3.3, respectively, fold increase in gene copy relative to normal tissue. Because amplification of DNA33473 (PRO261) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA33473 (PRO261) would be expected to be useful in cancer therapy.

PRO246: The Act values for DNA35639 (PRO246) in a variety of primary lung tumors and lung tumor cell lines are reported in Table 2. A ACt value of> 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates that significant amplification of DNA35639 in primary lung tumors LT3, LT10, LTI 1, LT12, LT13, LT15, LT17, LT19 and LT21.

The But and average #Ct values for the primary lung tumors were the following: 1.06, 1.07,2.42, 2.00, 1.65, 1.83, 2.18, 1.79 and 1.05, which represents a 2.1, 2.1, 5.3,4.0, 3.1, 3.6,4.5, 3.5 and 2.1, respectively, fold increase in gene copy relative to normal tissue.

Because amplification of DNA35639 (PRO246) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA35639 (PRO246) would be expected to be useful in cancer therapy.

EBAF-2 (PRO3 17): The ACt values for DNA33461 (PRO3 17) in a variety of primary lung tumors and lung tumor cell lines are reported in Table 2. A Act value of> 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of the gene copy. Table 2 indicates significant amplification ofDNA33461 in primary lung tumors LTla, LT3, LT4, LT6, LT7, LT9, LT10, LT11, LT12, LT13, LT15, LT16, LT17 and LT19.

The ACt and average ACt values for the primary lung tumors were the following: 1.29, 1.86,1.18, 1.93, 1.52, 1.04, 2.57, 2.26, 2.14, 2.07, 2.41, 1.31, 2.16 and 2.27, which represents a 2.4, 3.6, 2.3, 3.8, 2.9, 2.1, 5.9, 4.8, 4.4, 4.2, 5.3, 2.5, 4.5 and 4.8, respectively, fold increase in gene copy relative to normal tissue Because amplification of DNA33461 (PRO3 17) occurs in various tumors, it is likely associated with tumor formation or growth. As a result, antagonists (e.g, antibodies) directed against the protein encoded by DNA33461 (PRO3 17) would be expected to be useful in cancer therapy.

EXAMPLE 3 In situ Hvbridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It may be useful, for example, to identify sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection, follow changes in specific mRNA synthesis and aid in chromosome mapping.

In situ hybridization was performed following an optimized version of the protocol by Lu and Gillett, Cell Vision 1: 169-176(1994), using PCR-generated 33P-labeled riboprobes. Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinated in proteinase K (20 g/ml) for 15 minutes at 37°C, and further processed for in situ hybridization as described by Lu and Gillett, supra. A [33 P] UTP-labeled antisense riboprobe was generated from a PCR product and hybridized at 550C overnight. The slides were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.

33P-Riboprobe svnthesis 6.0 p1 (125 mCi) of 33P-UTP (Amersham BF 1002, SA<2000 Ci/mmol) were speed vac dried.

To each tube containing dried 33P-UTP, the following ingredients were added: 2.0 ul 5x transcription buffer 1.0 u1 DTT (100 mM) 2.0 µl NTP mix (2.5 mM : 10 ,u1; each of 10 mM GTP, CTP & ATP + 10 Ill H2O) 1.0 ul UTP (50 ,uM) 1.0 u1 Rnasin 1.0 u1 DNA template (llug) 1.0 µl H2O

1.0 u1 RNA polymerase (for PCR products T3 = AS, T7 = S, usually) The tubes were incubated at 37°C for one hour. 1.0 u1 RQ1 DNase were added, followed by incubation at 37°C for 15 minutes. 90 u1 TE (10 mM Tris pH 7.6/lmM EDTA pH 8.0) were added, and the mixture was pipetted onto DE81 paper. The remaining solution was loaded in a Microcon-50 ultrafiltration unit, and spun using program 10 (6 minutes). The filtration unit was inverted over a second tube and spun using program 2 (3 minutes). After the final recovery spin, 100 u1 TE were added. 1 u1 of the final product was pipetted on DE81 paper and counted in 6 ml of Biofluor II.

The probe was run on a TBE/urea gel. 1-3 µl of the probe or 5 ,11 of RNA Mrk III were added to 3 u1 of loading buffer. After heating on a 95°C heat block for three minutes. the gel was immediately placed on ice. The wells of gel were flushed, the sample loaded, and run at 180-250 volts for 45 minutes. The gel was wrapped in saran wrap and exposed to XAR film with an intensifying screen in -70°C freezer one hour to overnight.

33P-Hybridization Prefreatment offrozen sections The slides were removed from the freezer, placed on aluminium trays and thawed at room temperature for 5 minutes. The trays were placed in 55°C incubator for five minutes to reduce condensation. The slides were fixed for 10 minutes in 4% paraformaldehyde on ice in the fume hood, and washed in 0.5 x SSC for 5 minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ H2O).

After deproteination in 0.5 ,ug/ml proteinase K for 10 minutes at 37°C (12.5 µl of 10 mg/ml stock in 250 ml prewarmed RNase-free RNAse buffer), the sections were washed in 0.5 x SSC for 10 minutes at room temperature. The sections were dehydrated in 70%, 95%, 100% ethanol, 2 minutes each.

Pretreatment ofparaffin-embedded sections The slides were deparaffmized, placed in SQ H2O, and rinsed twice in 2 x SSC at room temperature, for 5 minutes each time. The sections were deproteinated in 20 ,ug/ml proteinase K (500 µl of 10 mg/ml in 250 ml RNase-free RNase buffer; 37"C, 15 minutes ) - human embryo, or 8 x proteinase K (100 u1 in 250 ml Rnase buffer, 37°C, 30 minutes) - formalin tissues. Subsequent rinsing in 0.5 x SSC and dehydration were performed as described above.

Prehybridization The slides were laid out in plastic box lined with Box buffer (4 x SSC, 50% formamide) - saturated filter paper. The tissue was covered with 50 u1 of hybridization buffer (3.75g Dextran Sulfate + 6 ml SQ H2O), vortexed and heated in the microwave for 2 minutes with the cap loosened. After cooling on ice, 18.75 ml formamide, 3.75 ml 20 x SSC and 9 ml SQ H2O were added, the tissue was vortexed well, and incubated at 420C for 1-4 hours.

Hybridization 1.0 x 106 cpm probe and 1.0 ul tRNA (50 mg/ml stock) per slide were heated at 95°C for 3 minutes. The slides were cooled on ice, and 48 u1 hybridization buffer were added per slide. After vortexing, 50 u1 33P mix were added to 50 u1 prehybridization on slide. The slides were incubated overnight at 55°C.

Washes Washing was done 2x10 minutes with 2xSSC, EDTA at room temperature (400 ml 20 x SSC + 16 ml 0.25M EDTA, Vt=4L), followed by RNaseA treatment at 37°C for 30 minutes (500 u1 of 10 mg/ml in 250 ml Rnase buffer = 20 ug/mI), The slides were washed 2x10 minutes with 2 x SSC, EDTA at room temperature. The stringency wash conditions were as follows: 2 hours at 55°C, 0.1 x SSC, EDTA (20 ml 20 x SSC + 16 ml EDTA, Vf=4L).

DNA49435 (FGF homologue. FGF receptor 3 ligand) Oligo A-251G 46mer: GGA TTC TAA TAC GAC TCA CTA TAG GGC GGA TCC TGG CCG GCC TCG G (SEQ ID NO: 43) Oligo A-251H 48mer: CTA TGA AAT TAA CCC TCA CTA AAG GGA GCC CGG GCA TGG TCT CAG TTA (SEQ ID NO: 44) Moderate expression was observed over cortical neurons in the fetal brain. Expression was observed over the inner aspect of the fetal retina, and possibly in the developing lens. Expression was seen over fetal skin, cartilage, small intestine, placental villi and umbilical cord. It adult tissues, there was an extremely high level of expression over the gallbladder epithelium (see Figure 34). Moderate expression was seen over the adult kidney, gastric and colonic epithelia. These data are consistent with the potential role of this molecule in cartilage and bone growth.

DNA32286 (EGF-like homoloue) Oligo B-138U 47mer: GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC TCC TGC CTT CCC TGT CC (SEQ ID NO: 45) Oligo A-134R 48mer: CTA TGA AAT TAA CCC TCA CTA AAG GGA GTG GTG GCC GCG ATT ATC TGC (SEQ ID NO: 46) In fetal tissues, low level expression was observed throughout the mesenchyme. Moderate expression was seen in placental stromal cells in membraneous tissues (Figure 35), and in thyroid (Figure 36).

Low level expression was seen in cortical neurons (Figure 37).

DNA 34387 (Jagaed/EGF homologue) Oligo B-231 W 48mer: GGA TTC TAA TAC GAC TCA CTA TAG GGC CCG AGA TAT GCA CCC AAT GTC (SEQ ID NO: 47) Oligo B-231-X 47mer: CTA TGA AAT TAA CCC TCA CTA AAG GGA TCC CAG AAT CCC GAA GAA CA (SEQ ID NO: 48).

Elevated signal was observed at the following sites: Fetal issues - thyroid epithelium, small intestinal epithelium, gonad, pancreatic epithelium, hepatocytes in liver and renal tubules. Expression was also seen in vascular tissue in developing bones.

Adult tissues - moderate signal in placental cytotrophoblast, renal tubular epithelium, bladder epithelium, parathyroid and epithelial tumors.

DNA33223 (tubulointerstitial nephritis antigen homologue) Oligo DNA33223-pl: GGA TTC TAA TAC GAC TCA CTA TAG GGC GGC GAT GTC CAC TGG GGC TAC (SEQ ID NO: 49) Oligo DNA33223-p2: CTA TGA AAT TAA CCC TCA CTA AAG GGA CGA GGA AGA TGG GCG GAT GGT (SEQ ID NO: 50) Tissue sections showed an intense signal associated with arterial and venous vessels in the fetus.

In arteries, the signal appeared to be confined to smooth-muscle/pericytic cells. (Figure 38.) The signal was also seen in capillary vessels and in glomeruli. Expression was also observed in epithelium cells in the fetal lens.

Strong expression was also seen in cells within placental trophoblastic villi (Figure 34). These cells lie between the trophoblast and the fibroblast-like cells that express HGF, and have an uncertain histogenesis.

In the adult, there was no evidence of expression and the wall of the aorta and most vessels appeared to be negative. However, expression was seen over vascular channels in the normal prostate and in the epithelium lining the gallbladder. Some expression was seen in the vessels of the soft-tissue sarcoma and the renal cell carcinoma.

In summary, this molecule shows relatively specific vascular expression in the fetus as well as in some adult organs.

In a second experiment, vascular expression, similar to the foregoing results, was observed in fetal blocks. Expression was seen on vascular smooth muscle, rather than endothelium. Expression was also seen in smooth muscle of the developing oesophagus, hence this molecule is not vascular specific. Expression was examined in 4 lung and 4 breast carcinomas. Substantial expression was seen in vascular smooth muscle of at least 3 out of 4 lung cancers and 2 out of 4 breast cancers. In addition, in one breast carcinoma (IF97-0655 1 3E), expression was observed in peritumoral stromal cells of uncertain histogenesis (possibly myofibroblasts). No endothelial cell expression was observed in this study.

DNA33473 (CTGF homoloue) Oligo D-170R 45mer: GGA TTC TAA TAC GAC TCA CTA TAG GGC GCG AGG ACG GCG GCTTCA (SEQ IDNO: 51) Oligo D-170V 48mer: CTA TGA AAT TAA CCC TCA CTA AAG GGA AGA GTC GCG GCC GCC CTT TTT (SEQ ID NO: 52) Strong expression was observed in dermal fibroblasts in normal adult skin. Strong expression was seen, in two cirrhotic livers, at sites of active hepatic fibrosis. Moderate expression was found over fasiculata cells of adrenal cortex. This localization supports a role for this molecule in extracellular matrix formation or turnover.

DNA35639 (HCAR homologue! Oligo B-258M 48mer: GGA TTC TAA TAC GAC TCA CTA TAG GGC TTG CTG CGG TIT TTGTTCCTG (SEQ ID NO: 53) Oligo B-258N 48mer: CTA TGA AAT TAA CCC TCA CTA AAG GGA GCT GCC GAT CCC ACT GGT ATT (SEQ ID NO: 54) This molecule was strongly expressed in fetal vascular endothelium, including tissues of the CNS (Figure 40). Lower level of expression was observed in adult vasculature, including CNS. It was no obviously expressed at higher levels in tumor vascular endothelium. Signal was also seen over bone matrix and adult spleen, however, this signal was not obviously cell associated.

EXAMPLE 4 Use of PRO187. PRO533. PRO214. PRO240. PRO211. PRO230. PRO261. PRO246. or EBAF-2 as a hvbridization probe The following method describes use of a nucleotide sequence encoding a PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide as a hybridization probe.

DNA comprising the coding sequence of full-length or mature PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 (as shown in Figure 2, SEQ ID NO:2; Figure 6, SEQ ID NO: 6; Figure 10, SEQ ID NO: 10; Figure 12, SEQIDNO: 12; Figure 17, SEQ ID NO: 19; Figure 18, SEQ ID NO: 20; Figure 23. SEQ ID NO: 27; Figure 27, SEQ ID NO: 33; and Figure 30. SEQ ID NO: 40) is

employed as a probe to screen for homologous DNAs (such as those encoding naturally-occurring variants of PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2) in human tissue cDNA libraries or human tissue genomic libraries.

Hybridization and washing of filters containing either library DNAs is performed under the following high stringency conditions. Hybridization of radiolabeled PRO 187, PRO533, PRO214, PRO240, PRO2 11, PRO230, PRO261, PRO246, or EBAF-2-derived probe to the filters is performed in a solution of 50% formamide, 5x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate at 420C for 20 hours. Washing of the filters is performed in an aqueous solution of 0.1x SSC and 0.1% SDS at420C.

DNAs having a desired sequence identity with the DNA encoding full-length native sequence PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can then be identified using standard techniques known in the art.

EXAMPLE 5 Expression of PRO187. PRO533. PRO214. PRO240, PRO211, PRO230. PRO261. PRO246. or EBAF-2 in E. coli This example illustrates preparation of an unglycosylated form of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 by recombinant expression in E. coli.

The DNA sequence encoding PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 (SEQ ID NOs: 1; 8; 12; 14; 16; 25; 29; 35; and 40, respectively) is initially amplified using selected PCR primers. The primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector. A variety of expression vectors may be employed. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene 2:95 (1977)) which contains genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzyme and dephosphorylated. The PCR amplified sequences are then ligated into the vector. The vector will preferably include sequences which encode for an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first six STII codons, polyhis sequence, and enterokinase cleavage site), the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 coding region, lambda transcriptional terminator, and an argU gene.

The ligation mixture is then used to transform a selected E. coli strain using the methods described in Sambrook et al., supra. Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing.

Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics. The overnight culture may subsequently be used to inoculate a larger scale culture. The cells are then grown to a desired optical density, during which the expression promoter is turned on.

After culturing the cells for several more hours, the cells can be harvested by centrifugation. The cell pellet obtained by the centrifugation can be solubilized using various agents known in the art, and the solubilized PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 protein can then be purified using a metal chelating column under conditions that allow tight binding of the protein.

PRO 187(UNQl61) and EBAF-2 (UNQ278) were expressed inE. coli in a poly-His tagged form, using the following procedure. The DNA encoding PRO187 or EBAF-2 was initially amplified using selected PCR primers. The primers contained restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector, and other useful sequences providing for efficient and reliable translation initiation, rapid purification on a metal chelation column, and proteolytic removal with enterokinase. The PCR- amplified, poly-His tagged sequences were then ligated into an expression vector, which was used to transform an E. coli host based on strain 52 (W3 110 fuhA(tonA) lon galE rpoHts(htpRts) clpP(lacIq). Transformants were first grown in LB containing 50 mg/ml carbenicillin at 30"C with shaking until an O.D.600 of 3-5 was reached.

Cultures were then diluted 50-100 fold into CRAP media (prepared by mixing 3.57 g (NH4)2SO4, 0.71 g sodium citrate-2H20,1.07 g KCI, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS, pH 7.3,0.55% (w/v) glucose and 7 mM MgSO4) and grown for approximately 20-30 hours at 300C with shaking. Samples were removed to verify expression by SDS-PAGE analysis, and the bulk culture is centrifuged to pellet the cells. Cell pellets were frozen until purification and refolding.

E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) was resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added to make final concentrations of 0.1M and 0.02 M, respectively, and the solution was stirred overnight at 40C. This step results in a denatured protein with all cysteine residues blocked by sulfitolization. The solution was centrifuged at 40,000 rpm in a Beckman Ultracentifuge for 30 min. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered through 0.22 micron filters to clarify.

Depending the clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated in the metal chelate column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4"C. Protein concentration was estimated by its absorbance at 280 nm using the calculated extinction coefficient based on its amino acid sequence.

The proteins were refolded by diluting sample slowly into freshly prepared refolding buffer consisting of: 20 mM Tris, pH 8.6, 0.3 M NaCI, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA.

Refolding volumes were chosen so that the final protein concentration was between 50 to 100 micrograms/ml.

The refolding solution was stirred gently at 40C for 12-36 hours. The refolding reaction was quenched by the addition of TFA to a final concentration of 0.4% (pH of approximately 3). Before further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to 2-10% final concentration. The refolded protein was chromatographed on a Poros Ri/H reversed phase column using a mobile buffer of 0.1% TFA with elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions with A280 absorbance were analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein were pooled. Generally, the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitrile since those species are the most compact with their hydrophobic interiors shielded from interaction with the reversed phase resin. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to resolving misfolded forms of proteins from the desired form, the reversed phase step also removes endotoxin from the samples.

Fractions containing the desired folded PRO187 and EBAF-2 proteins, respectively, were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins were formulated

into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine (Pharmacia) resins equilibrated in the formulation buffer and sterile filtered.

EXAMPLE 6 Expression of PRO 187. PRO533, PRO214. PRO240. PRO21 1. PRO230. PR0261. PRO246. or EBAF-2 in mammalian cells This example illustrates preparation of a potentially glycosylated form of PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 by recombinant expression in mammalian cells.

The vector, pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector. Optionally, the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF- 2 DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 DNA using ligation methods such as described in Sambrook et al., supra. The resulting vector is called pRK5-PROl87, pRK5-PRO533, pRK5- PRO214, pRK5-PRO240, pRK5-PRO211, pRK5-PRO230, pRK5-PRO261, pRK5-PRO246, or pRK5-EBAF-2.

In one embodiment, the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics. About 10 ug pRK5-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 DNA is mixed with about I µg DNA encoding the VA RNA gene [Thimmappaya et al., Cell, 31:543 (1982)] and dissolved in 500 µl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl2 To this mixture is added, dropwise, 500 ul of 50 mM HEPES (pH 7.35), 280 mM NaCI, 1.5 mM NaPO4, and a precipitate is allowed to form for 10 minutes at 250C. The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 370C. The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for about 5 days.

Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 µCi/ml 35S-cysteine and 200 ,uCi/ml 35S-methionine.

After a 12 hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide. The cultures containing transfected cells may undergo further incubation (in serum free medium) and the medium is tested in selected bioassays.

In an alternative technique, PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PR0261, PRO246, or EBAF-2 DNA may be introduced into 293 cells transiently using the dextran sulfate method described by Somparyrac et al., Proc. Natl. Acad. Sci., 12:7575 (1981). 293 cells are grown to maximal density in a spinner flask and 700 ug pRK5- PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 DNA is added. The cells are first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate is incubated on the cell pellet for four hours. The cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 µg/ml bovine insulin and 0.1 ug/ml bovine transfenin. After about four days. the conditioned media is centrifuged and filtered to remove cells and debris. The sample containing

expressed PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography.

In another embodiment, PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can be expressed in CHO cells. The pRK5- PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 vector can be transfected into CHO cells using known reagents such as CaPO4 or DEAE-dextran. As described above, the cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as 35S-methionine. After determining the presence of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 polypeptide, the culture medium may be replaced with serum free medium. Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested. The medium containing the expressed PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can then be concentrated and purified by any selected method.

Epitope-tagged PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 may also be expressed in host CHO cells. The PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO26 1, PRO246, or EBAF-2 may be subcloned out of the pRK5 vector. The subclone insert can undergo PCR to fuse in frame with a selected epitope tag such as a poly-His tag into a Baculovirus expression vector. The poly-His tagged PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 insert can then be subcloned into a SV40 driven vector containing a selection marker such as DHFR for selection of stable clones. Finally, the CHO cells can be transfected (as described above) with the SV40 driven vector. Labeling may be performed, as described above, to verify expression. The culture medium containing the expressed poly-His tagged PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PR0261, PRO246, or EBAF-2 can then be concentrated and purified by any selected method, such as by Ni2+-chelate affinity chromatography.

PRO214 (UNQ188); PRO240 (UNQ214); PRO211, (UNQ185); PRO230 (UNQ204); and PRO26 1 (UNQ228) were expressed in CHO cells by both a transient and a stable expression procedure. In addition, PRO246 (UNQ220) was transiently expressed in CHO cells.

Stable expression in CHO cells was performed using the following procedure. The proteins were expressed as an IgG construct (immunoadhesin), in which the coding sequences for the soluble forms (e.g. extracellular domains) ofthe respective proteins were fused to an IgG1 constant region sequence containing the hinge, CH2 and CH2 domains and/or is a poly-His tagged form.

Following PCR amplification, the respective DNAs were subcloned in a CHO expression vector using standard techniques as described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression vectors are constructed to have compatible restriction sites 5' and 3' of the DNA of interest to allow the convenient shuttling of cDNA's. The vector used expression in CHO cells is as described in Lucas et al., Nucl. Acids Res. 24: 9 (1774-1779 (1996), and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reductase (DHFR). DHFR expression permits selection for stable maintenance of the plasmid following transfection.

Twelve micrograms of the desired plasmid DNA were introduced into approximately 10 million CHO cells using commercially available transfection reagents Superfect# (Quiagen), Dosper# or Fugene

(Boehringer Mannheim). The cells were grown and described in Lucas et a!. ,.supra. Approximately 3 x 10-7 cells are frozen in an ampule for further growth and production as described below.

The ampules containing the plasmid DNA were thawed by placement into water bath and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mLs of media and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells were resuspended in 10 mL of selective media (0.2 um filtered PS20 with 5% 0.2 um diafiltered fetal bovine serum). The cells were then aliquoted into a 100 mL spinner containing 90 mL of selective media. After 1-2 days, the cells were transferred into a 250 mL spinner filled with 150 mL selective growth medium and incubated at 37"C. After another 2-3 days, a 250 mL, 500 mL and 2000 mL spinners were seeded with 3 x 105 cells/mL. The cell media was exchanged with fresh media by centrifugation and resuspension in production medium. Although any suitable CHO media may be employed, a production medium described in US Patent No. 5,122,469, issued June 16, 1992 was actually used.

3L production spinner is seeded at 1.2 x 106 cells/mL. On day 0, the cell number pH were determined. On day 1, the spinner was sampled and sparging with filtered air was commenced. On day 2, the spinner was sampled, the temperature shifted to 33"C, and 30 mL of 500 g/L glucose and 0.6 mL of 10% antifoam (e.g., 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion). Throughout the production, pH was adjusted as necessary to keep at around 7.2. After 10 days, or until viability dropped below 70%, the cell culture was harvested by centrifugtion and filtering through a 0.22 um filter. The filtrate was either stored at 4"C or immediately loaded onto columns for purification.

For the poly-His tagged constructs, the proteins were purified using a Ni-NTA column (Qiagen).

Before purification, imidazole was added to the conditioned media to a concentration of 5 mM. The conditioned media was pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5 mM imidazole at a flow rate of 4-5 mi/min. at 4"C. After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCI and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C.

Immunoadhesin (Fc containing) constructs of were purified from the conditioned media as follows. The conditioned medium was pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into tubes containing 275 ,uL of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity was assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation.

PRO187 (UNQ161); PRO533 (UNQ334); PRO214 (UNQ188): PRO240 (UNQ214); PRO21 1 (UNQ185); PRO230 (UNQ204); PRO26 1 (UNQ228); PRO246 (UNQ220), and EBAF-2 (UNQ278) were also produced by transient expression in COS cells.

EXAMPLE 7 Expression of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, and EBAF-2 in Yeast The following method describes recombinant expression of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 in yeast.

First, yeast expression vectors are constructed for intracellular production or secretion of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 from the ADH2/GAPDH promoter. DNA encoding PRO187, PRO533, PRO214, PR0240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 and the promoter is inserted into suitable restriction enzyme sites in the selected plasmid to direct intracellular expression of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2. For secretion, DNA encoding PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can be cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter, a native PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 signal peptide or other mammalian signal peptide, or, for example, a yeast alpha-factor or invertase secretory signal/leader sequence, and linker sequences (if needed) for expression of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2.

Yeast cells, such as yeast strain AB 110, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with Coomassie Blue stain.

Recombinant PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 may further be purified using selected column chromatography resins.

EXAMPLE 8 Expression of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, and BEAF-2 in Baculovirus-Infected Insect Cells The following method describes recombinant expression in Baculovirus-infected insect cells.

The sequence coding for PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 is fused upstream of an epitope tag contained within a baculovirus expression vector. Such epitope tags include poly-His tags and immunoglobulin tags (like Fc regions of IgG). A variety of plasmids may be employed, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen).

Briefly, the sequence encoding PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 or the desired portion of the coding sequence of PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 [such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protein if the protein is extracellular) is amplified by PCR with primers complementary to the 5' and 3' regions. The 5' primer may incorporate flanking (selected) restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the expression vector.

Recombinant baculovirus is generated by co-transfecting the above plasmid and BaculoGoldTM virus DNA (Pharmingen) into Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). After 4 - 5 days of incubation at 28 C, the released viruses are harvested and used for further amplifications. Viral infection and protein expression are performed as described by O'Reilley et al., Baculovirus exDression vectors: A Laboratorv Manual, Oxford: Oxford University Press (1994).

Expressed poly-His tagged PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2 can then be purified, for example, by Ni2+-chelate affinity chromatography as follows.

Extracts are prepared from recombinant virus-infected Sf9 cells as described by Rupert et al., Nature, 362:175- 179 (1993). Briefly, Sf9 cells are washed, resuspended in sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgC12; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M KC1), and sonicated twice for 20 seconds on ice.

The sonicates are cleared by centrifugation, and the supernatant is diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCI, 10% glycerol, pH 7.8) and filtered through a 0.45 Fm filter. A Ni2+-NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer. The filtered cell extract is loaded onto the column at 0.5 mL per minute. The column is washed to baseline A280 with loading buffer, at which point fraction collection is started. Next, the column is washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCI, 10% glycerol, pH 6.0), which elutes nonspecifically bound protein. After reaching A280 baseline again, the column is developed with a 0 to 500 mM Imidazole gradient in the secondary wash buffer. One mL fractions are collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni2+-NTA-conjugated to alkaline phosphatase (Qiagen). Fractions containing the eluted Hisl0-tagged PRO 187, PRO53 3, PRO2 14, PRO240, PRO2 11, PRO23 0, PRO26 1, PRO246, or EBAF-2, respectively are pooled and dialyzed against loading buffer.

Alternatively, purification of the IgG tagged (or Fc tagged) PRO187, PRO533, PRO214, PRO240, PRO2 11, PRO23 0, PRO26 1, PRO246, or EBAF-2 can be performed using known chromatography techniques, including for instance, Protein A or protein G column chromatography.

PRO187 (UNQ161); PRO533 (UNQ334); PRO214 (UNQ188); PRO240 (UNQ214); PRO21 1 (UNQ185); PRO230 (UNQ204); PRO246 (UNQ220); and EBAF-2 (UNQ278) were expressed in baculovirus infected Sf9 insect cells. While the expression was actually performed in a 0.5-2 L scale, it can be readily scaled up for larger (e.g. 8 L) preparations. The proteins were expressed as an IgG construct (immunoadhesin), in which the protein extracellular region was fused to an IgGI constant region sequence containing the hinge, CH2 and CH3 domains and/or in poly-His tagged forms.

Following PCR amplification, the respective coding sequences were subcloned into a baculovirus expression vector (pb.PH.IgG for IgG fusions and pb.PH.His.c for poly-His tagged proteins), and the vector and BaculogoldX baculovirus DNA (Pharmingen) were co-transfected into 105 Spodopterafrugiperda ("Sf9") cells (ATCC CRL 1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His are modifications of the commercially available baculovirus expression vector pVL 1393 (Pharmingen), with modified polylinker regions to include the His or Fc tag sequences. The cells were grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone). Cells were incubated for 5 days at 28"C. The supernatant was harvested and subsequently used for the first viral amplification by infecting Sf9 cells in Hink's TNM-FH medium supplemented with 10% FBS at an approximate multiplicity of infection (MOI) of 10. Cells were incubated for 3 days at 28"C. The

supernatant was harvested and the expression of the constructs in the baculovirus expression vector was determined by batch binding of I ml of supernatant to 25 mL of Ni-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining.

The first viral amplification supernatant was used to infect a spinner culture (500 ml) of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells were incubated for 3 days at 280C. The supernatant was harvested and filtered. Batch binding and SDS-PAGE analysis was repeated, as necessary, until expression of the spinner culture was confirmed.

The conditioned medium from the transfected cells (0.5 to 3 L) was harvested by centrifugation to remove the cells and filtered through 0.22 micron filters. For the poly-His tagged constructs, the protein construct were purified using a Ni-NTA column (Qiagen). Before purification, imidazole was added to the conditioned media to a concentration of 5 mM. The conditioned media were pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5 mM imidazole at a flow rate of 4-5 ml/min. at 40C. After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCI and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -800C.

Immunoadhesin (Fc containing) constructs of proteins were purified from the conditioned media as follows. The conditioned media were pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into tubes containing 275 mL of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity of the proteins was verified by SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid sequencing by Edman degradation.

EXAMPLE 9 Demonstration of binding of PRO533 (UNO334! to FGF Receptor 3 PRO533 was expressed in baculovirus in a C-terminal His8 epitope tagged form as described in Example 8, as was a control C-terminal His8 epitope protein. The extracellular domains of FGF receptors 1-4 and TIE1 receptor were expressed as Fc fusion proteins. Proteins were allowed to interact in binding buffer (DMEM media + 1 0mM Hepes pH 7.4 + 0.1% albumin + 200 ng/ml heparin) at room temperature for one hour.

Protein A Sepharose (Pharmacia) was added (0.01 ml) and binding continued for 30 minutes. Protein A Sepharose beads were collected and washed twice in binding buffer. Samples were then resolved by SDS PAGE under reducing conditions. Western blot analysis was conducted with anti-His antibody (Qiagen) as recommended by manufacturer. The results are shown in Figure 4. The specific binding components are as indicated above lanes 1-8 in Figure 4. Lane 9 contains PRO533-His (UNQ334-His) loaded directly onto gel for comparison. The position of the molecular weight markers is indicated on the left side of the gel for comparison.

The results demonstrate a high specificity binding to FGF Receptor 3 (FGFR3-Fc). This is very significant, since most FGF ligands bind more than one FGF receptor.

EXAMPLE 10 Preparation of Antibodies that Bind PRO187, PRO533. PRO214. PRO240. PRO21 1. PRO230. PRO261.

PRO246. or EBAF-2 This example illustrates preparation of monoclonal antibodies which can specifically bind PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2.

Techniques for producing the monoclonal antibodies are known in the art and are described, for instance, in Goding, supra. Immunogens that may be employed include purified PRO187, PRO533, PRO214, PR0240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2, fusion proteins containing PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2, and cells expressing recombinant PRO187, PRO533, PRO214, PRO240, PRO211, PR0230, PRO261, PRO246, or EBAF-2 on the cell surface.

Selection of the immunogen can be made by the skilled artisan without undue experimentation.

Mice, such as Balb/c, are immunized with the PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount from 1-100 micrograms. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hind foot pads. The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice may also be boosted with additional immunization injections. Serum samples may be periodically obtained from the mice by retro-orbital bleeding for testing in ELISA assays to detect anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 antibodies.

After a suitable antibody titer has been detected, the animals "positive" for antibodies can be injected with a final intravenous injection of PRO187, PRO533, PRO214, PRO240, PRO21 1, PRO230, PRO261, PRO246, or EBAF-2. Three to four days later, the mice are sacrificed and the spleen cells are harvested. The spleen cells are then fused (using 35% polyethylene glycol) to a selected murine myeloma cell line such as P3X63AgU.1, available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which can then be plated in 96 well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.

The hybridoma cells will be screened in an ELISA for reactivity against PRO187, PRO533, PRO214, PRO240, PRO211, PR0230, PRO261, PRO246, orEBAF-2. Determination of "positive" hybridoma cells secreting the desired monoclonal antibodies against PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 is within the skill in the art.

The positive hybridoma cells can be injected intraperitoneally into syngeneic Balb/c mice to produce ascites containing the anti-PRO187, PRO533, PRO214, PRO240, PRO211, PRO230, PRO261, PRO246, or EBAF-2 monoclonal antibodies. Alternatively, the hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibodies produced in the ascites can be accomplished using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based upon binding of antibody to protein A or protein G can be employed.

* * * *

Deposit of Material The following materials have been deposited with the American Type Culture Collection, 10801 University Blvd., Manassas, VA 20110-2209, USA (ATCC): Material ATCC Dep. No. Deposit Date DNA27864-1155 209375 October 16, 1997 DNA49435-1219 209480 November21, 1997 DNA32286-1191 209385 October 16, 1997 DNA34387-1138 209260 September 16, 1997 DNA32292-1131 209258 September 16, 1997 DNA33223-1136 209264 September 16, 1997 DNA33473-1176 209391 October 17, 1997 DNA35639-1172 209396 October 17, 1997 DNA33461-1199 209367 October 15, 1997 This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture of the deposit for 30 years from the date of deposit. The deposit will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and ATCC, which assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC 122 and the Commissioner's rules pursuant thereto (including 37 CFR 1.14 with particular reference to 886 OG 638).

The assignee of the present application has agreed that if a culture of the materials on deposit should die or be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same. Availability of the deposited material is not to be construed as a license to practice the invention in contravention ofthe rights granted under the authority of any government in accordance with its patent laws.

The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionally equivalent are within the scope of this invention. The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof nor is it to be construed as limiting the scope of the claims to the specific illustrations that it represents. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.