Chronic periodontitis is one of the commonest human diseases affecting approximately 90% of the population. It is characterised by loss of connective tissue attachment to the teeth in presence of inflammation and ultimately results in tooth loss. With decreasing caries rate, chronic periodontitis is now the major cause of tooth loss in adults. Considerable health service resources are spent in preventing and treating chronic periodontitis and also in rehabilitation after tooth lose.

Chronic periodontitis is caused by specific bacteria in plaque (reviewed by American Academy of Periodontology, 1999). The bacteria produce enzymes such as proteases which can cause direct damage but more importantly, these enzymes activate inflammatory mechanisms in the host which result in destruction of the connective tissues.

Proteases produced by bacteria in the mouth have been linked to periodontitis. There are several disclosures of methods of detecting periodontitis by assaying for increased protease activity (e. g. EP-A-255-341, WO-A-9732035, WO-A-9747642 and WO-A- 97643).

EP-A-255 341 describes a method for testing for periodontal disease by assaying for certain pathogenic oral micro-organisms specific for periodontitis. Such micro- organisms are detected by assaying a sample for aminopeptidase-like activity, which is said to be specific to the pathogenic micro-organisms. If the aminopeptidase activity is found or is increased the person from which the sample was taken is diagnosed with periodontitis.

WO-A-9732035 describes a protease assay for use in diagnosing periodontitis, where increased protease activity in a sample is indicative of periodontitis. WO-A-9747642 and WO-A-9747643 describes a protease, Cathepsin K, which is used to treat or diagnose diseases characterised by aberrant expression of cathepsin K, such as periodontitis.

Wide variations in the severity of periodontitis that are observed cannot be explained simply by the variation in the quantity or the types of bacteria in the mouth. It is clear that other environmental factors such as smoking influence the host susceptibility and the course of disease. However, it is also clear that inherited differences in susceptibility are also important. Support for a heritable component to periodontitis risk comes from the consistent association of periodontitis with certain inherited single gene disorders, as well as from genetic studies of both twins and early onset periodontitis (reviewed by Hart and Kornmann, 1997). It is likely that genetic factors may be important in severe and early onset periodontitis which affects between 7 and 15% of the population and also in chronic periodontitis, which affects approximately 90% of the human population.

There are several single gene disorders in which periodontitis is observed. These typically include disorders in which there are defects of the connective tissue or more commonly leukocyte function. Papillon Lefevre syndrome (PLS) or keratosis palmoplantaris with periodontopathia is an autosomal recessive disorder that is characterised by diffuse palmoplantar keratosis and severe periodontitis (reviewed by Hart and Shapira, 1994). It is a rare condition with the estimated prevalence of 1 in 4 million. The palmoplantar keratosis usually develops within the first three years of life and other sites such as elbows and knees may also be typically affected. The periodontitis affects both the deciduous and permanent dentition resulting in premature loss of the teeth. Most affected individuals are edentulous by the second decade. Additional reported features of the PLS include recurrent bacterial infections, hypotrichosis, calcification of the dura matter, and eyelid cysts.

Genetic testing is now possible for diseases associated with or caused by one or two genes, once those genes are identified, to determine the risk of a person carrying a given gene for the disease (see for example US 4,801,531).

It is an aim of the present invention to determine a genetic test for periodontitis and to provide a treatment for patients diagnosed or detected as having a predisposition to periodontitis.

According to a first aspect of the invention there is provided a method for diagnosing or detecting a predisposition to periodontitis comprising assaying a bodily sample in vitro directly or indirectly for a reduced level of cathepsin.

The invention is based on the identification by the inventors of the gene that is mutated in PLS. This gene codes for a cysteine protease termed a cathepsin. The level of cathepsin is severely reduced in affected individuals and moderately reduced in heterozygote carriers of PLS. As PLS is characterised by just two major features: hyperkeratosis and severe periodontitis the identification of defect in PLS condition provides a marker for periodontitis in the general population.

Cathepsins are cysteine proteinases involved in many normal cellular processes and a number of pathologic conditions. Cathepsins H (CTSH; 116820), L (CTSL; 116880), B (CTSB; 116810) and S (CTSS ; 116845) are papain family cysteine proteases involved in a variety of physiologic processes such as proenzyme activation, enzyme inactivation, antigen presentation, hormone maturation, tissue remodelling and bone matrix resorption (Shi et al., 1995). In addition, cysteine proteases appear to be involved in a variety of pathologic processes, such as rheumatoid arthritis, glomerulonephritis, Alzheimer disease, and cancer invasion and metastasis.

Cathepsins have been previously implicated in periodontitis in that their levels are increased in patients suffering from periodontitis (see WO-A-9747642 for example), possibly due to the production of the cathepsins by the bacteria involved in periodontitis. The inventors show that cathepsins are involved in a predisposition to periodontitis but that surprisingly it is a reduced level of cathepsin is that is indicative of a genetic predisposition to periodontitis.

According to the first aspect of the invention patients with or without overt periodontitis are identified as having a genetic predisposition to the disease by detecting a reduced level of cathepsin in a sample from the patient. Preferably, the cathepsin level is determined as reduced by comparison with a basal level of cathepsin found in a patient unaffected by periodontitis.

The bodily sample is taken from bodily fluid or tissue samples, for example a sample of tissue taken from the buccal cavity or gingival cavity, or fluid including whole blood, plasma, serum, urine, tears, sputum, saliva, gingival, lymph or synovial fluid.

In a preferred embodiment the sample will be obtained from blood cells obtained from a finger prick of the patient with the blood collected on absorbent paper. In another preferred embodiment a sample from the buccal cavity, such as gingival fluid or saliva may be obtained from a mouthwash or filter paper, with dental plaque being collected with a swab or scaler.

The assay according to the first aspect of the invention may be for cathepsin protein to determine the concentration or activity thereof, for cathepsin DNA to determine the level of expression thereof or a mutation or polymorphism therein which encodes an altered cathepsin protein of reduced activity; or to determine a change in concentration or activity of a cathepsin modulator, for example the cystatins, cathepsin inhibitors.

In its embodiment relating to detection of the concentration of protein in a sample the assay according to the first aspect of the invention may comprise methods including radioimmunoassay, Western Blot analysis, competitive-binding assays and ELISA.

In its embodiment relating to detection of the concentration of protein in a sample the assay according to the first aspect of the invention may comprise. methods including a substrate cleavage or hydrolysis assay. In such an assay the activity of the protein is determined by the cleavage of a substrate specific for the protein. Preferably the cleavage product is electrochemically detectable. The cleavage product is preferably labelled with, for example, a visual, e. g. coloured, or fluorescent label.

A suitable assay for cathepsin C activity is described in EP-A-255-341 In its embodiment relating to the level of nucleic acid in the sample suitable methods include hybridisation, sequencing or amplification techniques.

For detecting a mutation or polymorphism that causes a reduction in activity of the encoded protein suitable methods include DNA sequencing, restriction fragment length study by electrophoresis, nuclease protection assays, such as RNase and Sl protection, chemical cleavage, hybridisation, single strand confirmation polymorphism analysis and heteroduplex analysis, HPLC analysis and Southern blotting.

The term"polymorphism"refers to a different gene sequence from the wild type.

Polymorphisms can be variants which are generally found between individuals of different ethnic backgrounds or from different geographical areas, those polymorphisms not affecting the function of the gene. Other polymorphisms are those which lead to differences in the function of the gene or may produce an inactive gene product or may modulate the production of the gene product.

Specific mutations found to cause loss of function of cathepsin C and therefore whose presence is particularly diagnostic of a genetic predisposition to periodontitis include in exon 1 72C>A, intron 3 IVS3-1 G>A, exon 3 467 C>T, exon 4 566-572 delCATACAT, exon 6 815 G>C, exon 7 901G>A and in exon 7 1268G>A.

Specific polymorphisms found in cathepsin C whose presence is particularly diagnostic of a genetic predisposition to periodontitis include C230T in exon 3 and C259T in intron 5.

The above assays can be provided in kit form to diagnose or detect a predisposition to periodontitis. A particularly suitable kit is one which includes PCR primers for all of the mutations or polymorphisms described above or for the cathespsin C gene, along with suitable reagents for carrying out PCR. Details of suitable PCR primers are provided in the Examples section.

The identification of those at risk of developing periodontitis allows preventative measures to be initiated before disease onset. Further, those patients who have two risk factors, e. g. smoking and a genetic susceptibility, can be particularly monitored since their risk of periodontitis is high.

As periodontitis has been shown to be associated with reduced levels of cathepsin it follows that administration to a patient of cathepsin or means of increasing cathepsin levels could be useful for the prophylaxis or treatment of periodontitis.

Accordingly, the second aspect of the invention provides a method of prophylaxis or treatment for individuals who either have or are predisposed to periodontitis comprising administering cathepsin or a cathepsin activator.

According to the third and fourth aspects of the invention cathepsin protein or an activator thereof can be used for the manufacture of a medicament for use in the prophylaxis or treatment of periodontitis.

According to the fifth aspect of the invention the cathepsin gene or an activator of expression thereof can be used for the manufacture of a medicament for use in the prophylaxis or treatment of periodontitis.

According to the sixth aspect of the invention an inhibitor of cystatin protein or cystatin gene expression can be used for the manufacture of a medicament for use in the prophylaxis or treatment of periodontitis.

The compounds may be used to treat existing periodontitis but may also be used when prophylactic treatment is considered medically necessary.

Treatment of periodontitis with compounds according to the invention may be either as a monotherapy or in combination with other therapeutic agents.

The modulators of cathepsin activity used according to the second aspect of the invention may take a number of different forms depending, in particular on the manner in which the composition is to be used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micelle, liposome or any other suitable form that may be administered to a person or animal. It will be appreciated that the vehicle of the composition of the invention should be one which is well tolerated by the subject to whom it is given and enables delivery of the compounds to the site of action.

Compositions that are cathepsin modulators may be used in a number of ways. For instance, systemic administration may be required in which case a suitable compound may be contained within a composition which may, for example, be ingested orally in the form of a tablet, capsule or liquid. Alternatively the composition may be administered by injection into the blood stream. Injections may be intravenous (bolus or infusion) or subcutaneous (bolus or infusion).

The cathepsin modulator may also be incorporated within a slow or delayed release device. Such devices may, for example, be inserted under the skin and the compound which modulates cathepsin activity may be released over weeks or even months. The devices may be particularly advantageous when a compound is used which would normally require frequent administration (e. g. at least daily ingestion of a tablet or daily injection).

It will be appreciated that the amount of a compound required is determined by biological activity and bioavailability which in turn depends on the mode of administration, the physicochemical properties of the compound employed and whether the compound is being used as a monotherapy or in a combined therapy. The frequency of administration will also be influence by the above mentioned factors and particularly the half-life of the compound within the subject being treated.

Known procedures, such as those conventionally employed by the pharmaceutical industry (e. g. in vivo experimentation, clinical trials etc), may be used to establish specific formulations of compositions and precise therapeutic regimes (such as daily doses of the compounds and the frequency of administration).

Generally, a daily dose of between 0. Olu. g/kg of body weight and 1. Og/kg of body weight of a compound which modulates cathepsin activity may be used depending upon which specific compound is used and the condition to be treated. More preferably the daily dose is between O. Olmg/kg of body weight and 100mg/kg of body weight.

Daily doses may be given as a single administration (e. g. a daily tablet for oral consumption or as a single daily injection). Alternatively the compound used may require administration twice or more times during a day. A patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3 or 4 hourly intervals thereafter. Alternatively a slow release device may be used to provide optimal doses to a patient without the need to administer repeated doses.

The preferred marker to which the assay and method of treatment or prophylaxis is directed is the amino-peptidase cathepsin C. This is a known oligomeric lysosomal protease capable of removing dipeptides from the amino terminus of protein substrates. Cathepsin C was the initial marker identified for periodontitis susceptibility. Experiments (see below) suggest that cathepsin C activity in PLS patients is completely abolished.

Although PLS is rare, the identification of mutants in the cathepsin C gene and demonstration of loss of its function in this condition has implications in periodontitis as discussed herein and also in hyperkeratosis. The work carried out by the inventors shows involvement of a cysteine protease in keratin processing, suggesting that these, particularly cathepsins, such as cathepsin C may have utility in assays and treatment for hyperkeratosis, recurrent bacterial infections, hypotrichosis, calcification of the dura matter, and eyelid cysts, these being symptoms of PLS along with periodontitis.

The invention will be further described, by way of example only, with reference to the accompanying drawing, in which: Figure 1 shows fine mapping of the PLS locus in a genetic map showing relative order of 10 microsatellite DNA markers at llql4-q21 and inter-marker distances (http://www. marshmed. org/genetics/). Bars represent limits of linkage intervals for the PLS gene as reported by 1) Fischer et al. ', 2) Hart et al. 9 and 3) this study. Markers used in this study are highlighted in bold. Annotated pedigrees for families 2 and 8 with genotypes are shown with homozygous regions boxed and flanking markers highlighted in italics (Dl ISX'2-DI IS1332). Combining data from all studies indicates the minimal critical region containing the PLS gene (shaded box).

Figure 2 a and b show a reduction of cathepsin C activity in PLS. Activity in peripheral blood leukocytes was measured by hydrolysis of fluorogenic substrate H- gly-arg-NHMEC. The cathepsin C activity is expressed as n. mo) NHMec produced/min/mg protein (ymol mini'mg-'). rr, data from duplicate analysis of samples from seven healthy control individuals, three heterozygotes and two affected individuals. b, The columns show mean I standard error of cathepsin C activity (µmol mini'mg-') in control (+/+), heterozygote (+/-) and affected (-/-) groups. There is near complete loss of activity in the affected individuals and a substantial reduction of activity in the heterozygotes compared to the controls.

Figure 3 shows a representation of the Cathepsin C gene with SNPs highlighted.

EXAMPLES: The gene for PLS has been localise to chromosome l lql4-213~'. A maximum two- point logarithm of the odds (LOD) score of 8.24 was reported for microsatellite Dl 11S1367 at a recombination fraction of theta=0.00. Multipoint analysis resulted in a LOD score of 10.45 placing the PLS gene within a 4-5 cM genetic interval flanked by DllS4197andDllS931".

We report here autozygosity mapping in eight additional families to refine the map location and identified the cause of PLS as a loss of function of a cathepsin. Loss of function mutations in cathepsin C were identified as outlined below and each of these may be particularly useful as a marker for periodontitis.

68 DNA samples from patients with early onset periodontitis were scanned for DNA polymorphisms across the entire coding region of the cathepsin C gene including 1084 bp 5'UTR and 100 bp 3'UTR. Two polymorphisms were identified as outlined below and each of these may be particularly useful as a marker for periodontitis.

Sequence Numbering The numbering of the Cathepsin C gene, for example, of the sites of the polymorphisms, is based on the sequences of Cathepsin C published by Paris el al., FEBS Lett. 369,326-330 (1995) with Genbank accession number X87212 and by Rao et cil., J. Biol. Chem. 272,10260-10265 (1997) with Genbank accession number U79415.

Patient Selection Eight families with affected children were studied: 3 Egyptian and 3 Indian/Pakistani with known parental consanguinity and 2 Lebanese where consanguinity was not reported. Families with PLS were ascertained on the basis of at least one affected member with typical manifestations of PLS (palmoplantar keratosis and early-onset periodontitis). Venous blood samples were collected with informed consent in EDTA and lithium heparin for DNA and CTSC functional analysis respectively.

Genotyping DNA was extracted from peripheral blood by conventional automated procedures.

DNA samples from PLS families were genotyped at 6 microsatellite loci (DllS1365, DlIS1354, DIIS4082, DIISl332, DIIS1311, DIIS919) mapping to chromosome 1 lql4-q21. Two methods were used for analysis: samples were PCR amplified either with 1) unlabelled primers, size fractionated by denaturing polyacrylamide gel electrophoresis and products visualised by silver staining or 2) with fluorescence dye labelled primers and resolved on an Applied Biosystems automated DNA sequencing system (ABI 377) and analysed by Genescan and Genotyper software. Haplotypes were then constructed to define the critical PLS region.

Linlcage Analysis DNA marker information was obtained from the CEPH-Genethon web site (http://www. cephb. fr/cgi-biuwdb/ceph/systeme/form). Inter-marker distances and map orders were obtained from the Marshfield web site (http://www. marshmed. org/genetics/) and the Genetics Location Database web site (http://cedar. genetics. soton. ac. uk). Two-point LOD scores were generated using the LINKAGE analysis programs33 assuming a fully penetrant autosomal recessive mode of inheritance with a disease gene frequency of 0.001.

Families were typed with 6 microsatellite markers (D11S1365. D11S1354, D11S4082, D11S1332, D11S1311, D11S919) spanning approximately 11. 3 cM on chromosome 11 q 14-q21. Significant linkage was demonstrated, with no evidence of genetic heterogeneity (Table 1). In all families, including the two not known to be consanguineous, a region of homozygosity at llql4-q21 was observed. Families 2 and 8 define a minimal region of homozygosity common to all affected individuals between markers D11S4082 and D1151332, a region of approximately 3.4 cM on the Marshfield map (Fig. 1). All genetic linkage studies to date indicate that PLS is a genetically homogeneous condition7~9. Therefore, we combined our data with those of Hart et al.'which further narrowed the minimal critical region to a 1.2 cM interval bounded proximally by D1154082 and distally by D115931 (Fig. 1).

Database analysis indicated the presence of several genes and ESTs in the interval flanked by D11S4082 and DllS931. One of these genes, cathepsin C (CTSC) or dipeptidyl aminopeptidase I, is close to DIIS931 and was selected for further study.

Table 1 Combined two-point LOD scores' Recombination fraction (0) Marker 0.0 0.05 0.1 0.2 0.3 0.4 Dl lS1365-5. 03 4. 16 1.81 0.68 DI IS 1354 7.04 8.92 7.91 5.60 3. 28 1.18 D11S4082 4.37 6.71 6.05 4.36 2.59 1. 00 D11S1332-00 9.14 8.23 5.87 3.47 1.34 D 11 S 1311-oo 5.67 6.06 3.90 2.28 0.85 Dl lS919-oo-0.25 0.35 0.45 0. 34 0.06 'data from genotyping in 8 families Analysis of the genomic organisation of CTSC.

Using primers exon 7-1F 5'-CGG CTT CCT GGT AAT TCT TC-3' (SEQ ID NO. 1) and exon 7-1R 5'-GTA GTG GAG GAA GTC ATC ATA TAC-3' (SEQ ID NO. 2) in a PCR assay, clone 133M2 was isolated from the Research genetics BAC library. This clone was digested with Aluni, BamHI/Bg/II, PstI, Sau3Al or SstI and the resulting fragments cloned into pBluescript. Recombinant colonies were screened with end- labelled oligonucleotides designed using the CTSC cDNA sequence. cDNA and genomic sequences were compared and intron-exon boundaries identified by comparison with the published consensus sequence'7. Alternatively, flanking intronic sequence was determined by direct sequencing of BAC 133M2.

Genomic organisation of Cathepsin C gene The CTSC gene was reported to consist of 2 exons'°. Amplification of exon 2 for mutation analysis using the reported sequence was successful (see below). However, attempts to amplify exon 1 of the gene using a variety of exonic and flanking intronic primers repeatedly failed. Thus the genomic organisation of CTSC was re- characterised. Sequence analysis of CTSC-containing BAC clone 133M2 revealed that the cDNA sequence previously referred to as"exon 1"is actually divided into six exons. The CTSC gene is therefore encoded by seven exons that are separated by six introns all of which fall in identical positions to those described for the murine gene".

All of the splice donor and acceptor sites conformed to the published consensus sequences'2 (Table 2). Mutation analysis of the newly identified exons was subsequently undertaken.

Table 2 Intron-exon boundary sequences of the human cathepsin C genea Exon CDNA position Splice acceptor Splice Donor 1 5'UTR-172 5'UTR-ATGGGTGCT CGGTTATGGgtaagccgc 2 173-318 tttctttagGACCACAAG TTTTTTAAGgttagtttt 3 319-485 tgtttgcagTATAAAGAA TCAGGAAAAgtgagttgc 4 486-641 ttggggcagGTATTCTAA AATCCCAAGgtaatcaag 5 642-757 cctttctagGCCCAAACC GAAACCAAGgtaaaaaaa 6 758-889 catcgccagCATCCTGTG ATGCTCAAGgtaagtgtt 7 890-3'UTR aatcttcagGCTGTGAAG AAATTGTAG-3'UTR a Intronic sequence is indicated in lowercase, exonic sequence in uppercase Loss of Function Mutations in Cathepsin C All exons were screened for sequence variations by direct cycle sequencing of both forward and reverse strands on an ABI 373 sequencer using the Applied Biosystems DyeDeoxy terminator kit. The PCR primers for each exon were as follows: Exon 2F 5'-GAC TGT GCT CAA ACT GGG TAG-3' (SEQ ID NO. 3); Exon2R 5'-CTA CTA ATC AGA AGA GGT TTC AG-3' (SEQ ID NO. 4); Exon 3F 5'-GGG GCA CAT TTA CTG TGA ATG-3' (SEQ ID NO. 5); Exon 3R 5'-CGT ATG TCT CAT TTG TAG CAA C-3' (SEQ ID NO 6); Exon 4F 5'-GTA CCA CTT TCC ACT TAG GCA-3' (SEQ ID NO. 7); Exon 4R 5'-GGA GGA TGG TAT TCA GCA TTC-3' (SEQ ID NO. 8); Exon 5F 5'-CCT AGC TAG TCT GGT AGC TG-3' (SEQ ID NO. 9); Exon 5R 5'-GTA TCC CCG AAA TCC ATC ACA-3' (SEQ ID NO. 10); Exon 6F 5'-CTC TGT GAG GCT TCA GAT GTC-3' (SEQ ID NO. 11); Exon 6R 5'-CAA CAG CCA GCT GCA CAC AG-3' (SEQ ID NO. 12); Exon 7-1 F 5'-CGG CTT CCT GGT AAT TCT TC-3 (SEQ ID NO. 1)' ; Exon 7-1R 5'-GTA GTG GAG GAA GTC ATC ATA TAC-3' (SEQ ID NO. 2); Exon 7-2F 5'-CAA TGA AGC CCT GAT CAA GC-3' (SEQ ID NO. 13); Exon 7-2R 5'-CTT CTG AGA TTG CTG CTG AAA G-3' (SEQ ID NO. 14).

Testing of the segregation of the mutations within the families and for presence of the mutation in the controls, was done by PCR amplification of the exons followed by either a mutation-specific restriction fragment polymorphism (RFLP) analysis or a combined single strand conformation-heteroduplex (SSCP-HD) analysis. For mutation-specific RFLP analysis, PCR products were restriction digested and size fractionated by agarose gel electrophoresis. For SSCP-HD analysis, the PCR products were denatured, electrophoresed through a 0.7x Hydrolink-MDE gel (AT Biochem) at 250 V for 13-16 hours and visualise by silver staining.

Mutation analysis of the eight families used for autozygosity mapping was undertaken and homozygous sequence changes were identified in the affected individuals in all cases (Table 3). In each case, the parents were heterozygous; the other non-affected members were either heterozygous or homozygous for the wild-type allele. The mutations include a nonsense mutation in Family 8, mutation of an AG acceptor splice site in Family 3, and six missense mutations. The missense mutations were not present in 100 Egyptian, 50 Pakistani/Indian and 50 Caucasian controls. All missense changes are in the region coding for the mature protein and each replaces an amino acid that is highly conserved across species. The 755A>T and 901G>A mutations in Family 1 and 6 respectively replace amino acids that are conserved in all cysteine proteinases and the 745G>T mutation in Family 4 replaces an amino acid that is conserved in all but one cysteine proteinase'3. In addition, the 901G>A mutation in Family 6 replaces glycine that is probably part of a substrate binding site in CTSC'4.

Table 3 Loss of Function Mutations in the cathepsin C gene Family Site Mutation Amino acid Predicted Effect 1 Exon 5 755A>T Q249L Glutamine>Leucine 2 Exon 7 1015C>T R339C Arginine>Cysteine 3 Intron 3 IVS3-1G>A-Altered splicing 4 Exon 5 745G>T V252F Valine>Phenylalanine 5 Exon 7 1040A>G Y347C Tyrosine>Cysteine 6 Exon 7 901G>A G301S Glycine>Serine 7 Exon 4 628C>T R210X Arginine>Stop 8 Exon 6 815G>C R272P Arginine>Proline Additional studies were carried out on a further 8 families and the results provided in table 4.

Table 4 Loss of Function Mutations in the cathepsin C gene Family Site Mutation Amino acid Predicted Effect 9 Exon 7 1268G>A W429X Nonsense 10 Exon 7 901G>A G301R Missense 11 Exon 6 815G>C R272P Missense 12 Exon 1 72C>A C24X Nonsense 13 Exon 6 815G>C R272P Missense 14 Exon 4 566-Frameshift resulting 572delCATACAT in a stop codon 7 bases downstream 15 Intron 3 IVS3-1G>A Splice site 16 Exon 3 467C>T T153I Missense 17 Exon 7 901G>A G301R Missense Each of the loss of function mutations described above in tables 3 and 4 provides a marker for periodontitis. Accordingly, an in vitro assay using PCR primers for the cathepsin C gene which indicates the presence of at least one loss of function mutations, is diagnostic of a genetic predisposition to periodontitis in the patient under test.

Functional analysis of CTSC We were able to obtain fresh blood for functional studies from affected individuals in Families 4 and 5. Leukocyte pellets were prepared for functional assay as follows.

Briefly, lithium heparinised blood samples were mixed with an equal volume of a solution comprising 1.5 parts acid citrate dextrose [0.136 M glucose, 0.075 M sodium citrate, 0.035 M citric acid in 0.9% NaCI], 5 parts dextran (6% w/v in 0.9% NaCl), 3.5 parts glucose (5% w/v in 0.9% NaCI). After 60 minutes at room temperature the upper layer only was transferred to pre-chilled tubes and centrifuged for 10 minutes at 4°C at 2000 rpm. The supernatant was discarded. The cell pellet was resuspended initially with 2 ml iced-cold 0.9% NaCl, followed by 1 ml ice cold distilled deionised water and left to stand for 2 minutes. A further 1 ml of iced cold 3.6% NaCI was added and gently mixed before the cell suspension was centrifuged for 10 minutes at 4°C at 2000 rpm. The final supernatant was removed and the cell pellet of viable leucocytes stored at-70°C.

The synthetic substrate glycyl-L-arginine-7-amido-4-methylcoumarin (H-gly-arg- NHMec) and 7-amino-4-methylcoumarin (NHMec) were purchased from Bachem (Saffron Walden, UK). Dithiothreiotol and Triton X-100 were obtained from Sigma (Poole, UK).

Leukocyte pellets were resuspended in 500 pl of 0.1 M sodium phosphate buffer pH 6.5 containing 0.1% Triton X-100. The suspension was sonicated on ice for 5 seconds using an MSE Soniprep 150. The protein content of the preparation was determined by the bicinchoninic acid method with a kit supplied by the Pierce Chemical Company (Rockford, IL).

Determination of activity of leukocyte CTSC was carried out by measuring the amount of NHMec released by hydrolysis of H-gly-arg-NHMEC using the method of Smyth and O'Cuinn34 with minor modifications. The amount of NHMec produced from the substrate (5 mM) by 20 pll leukocyte sonicate was measured in 200 il of 0.1 M sodium phosphate buffer (pH6.5) containing 2 mM NaCI and 2 mM dithiothreitol.

Substrate hydrolysis was monitored for one hour at 25°C in the microtitre plate reader of a Perkin Elmer LS50B luminescence spectrometer at 370 nm excitation and 460 nm emission. The fluorescence measurement was converted to mmol NHMec using a calibration line obtained from NHMec under identical conditions. Each assay included controls in which either substrate or cell sonicate was omitted from the reaction mixture. Cathepsin C specific activity was calculated as mmol NHMec produced/ min/mg protein.

Using a fluorometric assay and synthetic CTSC-specific fluorogenic substrates, we measured CTSC activity in peripheral blood leukocytes in at least one affected and one unaffected member of each family, together with ethnically matched controls (Fig. 2a, b). The mean activity of CTSC in seven healthy control individuals was 733.98 mmol mg~'min~ (1S. D. 48. 37). In the two unrelated affected individuals <BR> <BR> <BR> <BR> CTSC activity was severely reduced, with a mean of 12.89 mmol mg''min'' (1S. D. i 7.39). This very small residual activity is probably not in fact due to CTSC as it was unaffected by CTSC inhibitors guanidinium chloride or E-64 (Ref. 15) (data not shown). In contrast, activity in the control and heterozygote samples was reduced by approximately 30% with E-64 and 50% with guanidinium chloride (data not shown).

Most likely, the affected individuals tested here have total loss of cathepsin C activity.

As expected, 3 obligate or known (by mutation analysis) heterozygotes also had reduced activity. The mean activity of CTSC in this group was 268. 33 mmol mg-' min~' (1S. D. 69. 38).

Polymorphisms in Cathepsin C 68 DNA samples from patients with early onset periodontitis were received in March from Newcastle. These have been scanned for DNA polymorphisms across the entire coding region of the cathepsin C gene including 1084bp 5'UTR and 100bp 3'UTR.

SNP identification in Control DNAs PCR fragments were designed to scan for polymorphisms across the Cathepsin C gene by DHPLC (Transgenomic WAVE) analysis and direct sequencing. The results showed the presence of two polymorphisms, one in Exon 3, a C to T mutation at position 230, designated CatCx3. C230T, and one in intron 5, a C to T mutation at position 259, designated CatcX5. C259T.

PCR Primers for Cathepsin C exon 3 Forward: GCA CAT TTA CTG TGA ATG AGA GC (SEQ ID NO. 15) Reverse: CAG TAA GGT TTT ACA TAG CAT GCC (SEQ ID NO. 16) PCR was carried out according to standard procedure using the above forward and reverse primers for Cathepsin C exon 3, using an MD temperature of 57OC for 35 cycles. This resulted in a PCR product of 399 base pairs.

PCR Primers for Cathepsin C intron 5 Forward: TCC TAG CTA GTC TGG TAG CTG (SEQ ID NO. 17) Reverse: CCG AAA TCC ATC ACA CAG AGC (SEQ ID NO. 18) PCR was carried out according to standard procedure using the above forward and reverse primers for Cathepsin C intron 5, using an MD temperature of 57°C for 35 cycles. This resulted in a PCR product of 301 base pairs.

During the DHPLC scan of 29 control DNAs the following SNPs were identified as heterozygous traces and sequenced. SNP name Location Flanking Sequence AC01877 AC01108 CatC. x3. C Exon 3 GAACTGCCTCTGAGAATGTGTAT 491 125028 230T (T to I) GTCAACA [C/T] AGCACACCTTAA GAATTCTCAGGAAAAGTG Catc. 5. C25Intron5 AATAAGCCTAAGTTTTTTGTTAA 113106 9T TTTGTT [C/T] GGAACTATTTATTG AACAGTTGCTCTGTGT The positions of the SNPs in reported sequences are shown: GenBank sequences AC018775 and AC011088 are from genomic DNA clones; Nu001814 is mRNA sequence.

SNP identification in Patient DNAs: During the analysis of the patient DNAs the above SNPs were observed. This was done by comparing heterozygous traces in patient samples with a positive control for each SNP. In general these predicted genotypes were confirmed by sequencing. The analysis performed for each of the scanning fragments is summarised below Exon 3 This fragment contains an exonic SNP that causes an amino acid change from threonine to isoleucine. This SNP was found at quite a high frequency in the control population. The WAVE trace pattern seen in the patient population was matched to a positive control heterozygote. Sequence analysis of a few patients with these traces confirmed that the patients had the same SNP as seen in the control DNAs.

The remaining patients were genotyped by the presence of a heterozygous trace on the TG wave. Using this method to genotype may miss any homozygous mutants. For a better idea of the true frequency of this SNP a SBE or RFLP assay could be designed and typed over the patient population.

Exon (Intron) 5 This fragment contais an intronic SNP. This SNP was previously observed at quite a high frequency in the control population. The WAVE trace pattern seen in the patient population was matched to a positive control heterozygote. Sequence analysis of a few patients with these traces confirmed that the patients had the same SNP as seen in the control DNAs.

The remaining patients were genotyped for this SNP by the WAVE traces. As for exon 3 an assay for this SNP could be typed throughout the patient population for a true idea of the frequency.

Each of the polymorphisms described above provides a marker for periodontitis.

Accordingly, an in vitro assay using PCR primers for the cathepsin C gene which indicates the presence of at least one of the polymorphisms is diagnostic of a genetic predisposition to periodontitis in the patient under test.

Discussion Cathepsins are papain-family cysteine proteinases involved in a variety of physiologic processes such as enzyme inactivation, antigen presentation, hormone maturation, tissue remodeling and bone matrix resorption'4. They have also been reported to be involved in a variety of pathological processes such as Alzheimer disease, inflammatory conditions such as rheumatoid arthritis and cancer invasion and metastasis'4. All cysteine proteinases contain an essential cysteine residue in their active site but differ in enzymatic properties and substrate specificities Cathepsin C is an oligomeric lysosomal protease capable of removing dipeptides from the amino terminus of protein substrates. It appears also to have an endopeptidase activity'6. The CTSC gene was selected as a candidate because other conditions with lysosomal defects such as Chediak-Higashi syndrome (MIM 214500) also feature severe early onset periodontitis'7'8. CTSC is expressed at high levels in many tissues including lung, kidney, placenta and cells involved in the immune response such as polymorphonuclear leukocytes, alveolar macrophages and their precursors'°. It is also expressed in various epithelia'° although expression in skin in humans has not been reported. The main functions of cathepsin C are thought to be protein degradation and pro-enzyme activation'°.

CTSC plays an essential role in the activation of granule serine proteases expressed in bone marrow-derived effector cells of both myeloid and lymphoid series'9. These proteases are implicated in a wide variety of immune and inflammatory processes including cell-mediated cytotoxicity, phagocytic destruction of bacteria, local activation or deactivation of cytokines and other inflammatory mediators, and extracellular matrix degradation. Activation of these enzymes involves cleavage of short propeptides and subsequent removal of two amino acid residues20.

Lack of functional CTSC in PLS may be associated with reduced host response against bacteria in dental plaque and also possibly at other sites2'. Two likely targets are neutrophil cathepsin G and elastase, both serine proteases that are implicated in host antibacterial responses2223. Cathepsin G concentration in gingival crevicular fluid correlates directly with both plaque accumulation and severity of periodontal disease24. Furthermore, in vitro, killing of the periodontal pathogen Capnocytophaga by granule fractions of leukocytes is due to cathepsin G25. Chediak-Higashi syndrome, which is associated with severe early-onset periodontitis, is characterised by a deficiency of cathepsin G and elastase in polymorphonuclear leukocytes26, caused by mutations in the LYST gene2728. Similarly, in chronic familial neutropenia there is severe early-onset periodontitis.

CTSC is also required for processing and activation of granzymes A and B in cytotoxic T lymphocytes29. The granzymes are the key agents of T-cell mediated cell killing, inducing apoptosis in target cells30. The role, if any, of T cell mediated cytotoxicity in periodontitis remains to be elucidated.

Our findings suggest that cathepsin C also plays a role in keratin processing. There is some evidence for proteolytic modification of keratins in the outer epidermal layers during differentiation, although the exact nature of this modification and the processes involved in it are not known". Expression of the serine protease inhibitor PI-6 (Ref.

32) correlates positively with epithelial differentiation, with maximal expression in the stratum granulosa where it is found in a complex with an as yet unidentified serine protease. Thus it is possible that a CTSC-activated serine protease is involved in keratin modification in the superficial layers of the epithelium and a deficiency of CTSC leads to abnormal keratinisation. Aberrant epithelial differentiation may also affect the junctional epithelium that binds the gingiva to the tooth surface, possibly weakening the mechanical barrier to periodontal pathogens.

Although PLS is rare, the demonstration that it is caused by loss of cathepsin C function has wider implications. First, the restricted phenotype in patients with total loss of CTSC function shows that other pathways can compensate for loss of cathepsin C in most tissues. In particular, there is no generalised T-cell immunodeficiency in PLS. Second, it provides evidence for a role for proteases in keratin processing and identifies a new group of candidates for other Mendelian conditions involving hyperkeratosis. Until now these conditions were thought be largely associated with mutation of keratins, epithelial cell adhesion molecules or related proteins. Finally, elucidation of the role of cathepsin C in periodontitis may help clarify the pathogenesis of periodontitis which affects nearly 90% of the general population and is the main cause of tooth loss in adults, with associated huge economic costs to health services world-wide.

REFERENCES 1. Gorlin, R. J., Sedano, H. & Anderson, V. E. The syndrome of palmar-plantar hyperkeratosis and premature periodontal destruction of teeth. J. Pediatl. 65,895- 908 (1964).

2. Hart T. C. & Shapira L. Papillon-Lefevre syndrome Periodontoloy 2000 6,88- 100 (1994).

3. Brown, R. S. et al. A possible late onset variation of Papillon syndrome : report of 3 cases. J. Periodontol. 64,379-386 (1993).

4. Bullon, P. et al. Late onset Papillon-Lefevre syndrome? J. Clin. Periodontol. 20, 662-667 (1993).

5. Aubrey Soskolne, W., Stabholz, A., Van Dyke, T. E, Hart, T. C. & Meyle, J. Partial expression of Papillon-Lefevre syndrome in 2 unrelated families. J. Clin.

Periodontol. 23,764-769 (1996).

6. Fardal, O., Drangsholt, E. & Olsen 1. Palmar plantar keratosis and unusual periodontal findings. J. Clin. Periodontol. 25,181-184 (1998).

7. Fischer, J. et al. Mapping of Papillon-Lefevre syndrome to the chromosome 11q14 region. Eur. J. Hum Genet. 51, 56-60 (1997).

8. Laass, M. W. et al. Localisation of a gene for Papillon-Lefevre syndrome to chromosome llql4-q21 by homozygosity mapping. Hum. Genet. 101,376-382 (1997).

9. Hart, T. C. et al. Sublocalization of the Papillon-Lefevre syndrome locus on 1 lql4-q21. Am. J. Med. Genet. 79,134-139 (1998).

10. Rao, N. V., Rao, G. V. & Hoidal, J. R. Human dipeptidyl-peptidase I. Gene characterization, localization, and expression. J. Biol. Chem. 272,10260-10265 (1997).

11. Pham, C. T. N., Armstrong, R. J., Zimonjic, D. B., Popescu, N. C., Payan, D. G., Ley, T. J. Molecular cloning, chromosomal localization, and expression of murine dipeptidyl peptidase I. J. Biol. Chem. 272,10695-10703 (1997).

12. Breathnach, R. & Chambon, P. Organization and expression of eukaryotic split genes coding for proteins. Annu. Rev. Biochem. 50,349-383 (1981).

13. Paris, A. et al. Molecular cloning and sequence analysis of human preprocathepsin C. FEBSLett. 369,326-330 (1995).

14. Turk, B., Turk, V & Turk, D. Structural and functional aspects of papain like cysteine proteinases and their protein inhibitors. Biol. Chenl. 378, 141-150 (1997).

15. Cigic, B. & Pain R. H. Competitive inhibition of Cathepsin C by guanidinium ions and reexamination of substrate inhibition. Biochem. Biop7y. s. Res. Comnz. 258,6- 10 (1999).

16. Kuribayash, M., Yamada, H., Ohmori, T., Yanai, M. & Imoto, T. Endopeptidase activity of cathepsin C, dipeptidyl aminopeptidase I, from bovine spleen. J.

Biochenl. 113,441-449 (1993).

17. Tempel, T. R., Kimball, H. R., Kakenashi, S. & Amen. C. R. Host factors in periodontal disease: periodontal manifestations of Chediak-Higashi Syndrome. J.

Periodontal Res. 7 (supp) 26-27 (1972).

18. Hamilton, R. E. Jr. & Giansanti, J. S. The Chediak-Higashi syndrome. Report of a case and review of the literature. Oral Surg. Oral Med. Oral Pathol. 37,754-761 (1974).

19. McGuire M. J., Lipsky P. E. & Thiele D. L. Generation of active myeloid and lymphoid granule serine proteases requires processing by the granule thiol protease dipeptidyl peptidase I. JBiol. Chenu. 268,2458-2467, (1993).

20. Salvesen, G. & Enghild, J. J. An unusual specificity in the activation of neutrophil serine proteinase zymogens. Biochemistry 29,5304-5308 (1990).

21. Oguzkurt P., Tanyel F. C., Buyukpamukcu N. & Hicsonmez A. J. Increased risk of pyogenic liver abscess in children with Papillon-Lefevre syndrome. Pediatr. Surg.

31,955-956 (1996).

22. Bangalore, N., Travis, J., Onunka, V. C., Pohl, J., & Shafer, W. M. Identification of primary antimicrobial domains in human neutrophil cathepsin G. J. Biol. Chef.

265,13584-13588 (1990).

23. Belaaouaj, A. et al. Mice lacking neutrophil elastase reveal impaired host defense against gram negative bacterial sepsis. Nature Med. 4,615-618 (1998).

24. Kunimatsu, K. et al. Identification and possible function of cathepsin G in gingival crevicular fluid from chronic adult periodontitis patients and from experimental gingivitis subjects. JPeriodontal Res. 30, 51-57 (1995).

25. Miyasaki, K. T. & Bodeau, A. L. In vitro killing of oral capnocytophaga by granule fractions of human neutrophils is associated with cathepsin G activity. J. Clin.

Invest. 87,1585-1593 (1991).

26. Ganz, T., Metcalf, J. A., Gallin, J. I., Boxer, L. A. & Lehrer, R. I.

Microbicidal/cytotoxic proteins of neutrophils are deficient in two disorders: Chediak-Higashi syndrome and"specific"granule deficiency. J. Clin. Invest. 82, 552-556 (1988).

27. Nagle, D. L. el al. (1996) Identification and mutation analysis of the complete gene for Chediak-Higashi syndrome. Natul e Genet. 14, 307-311 (1996).

28. Barbosa, M. D. et til. Identification of mutations in two major mRNA isoforms of the Chediak-Higashi syndrome gene in human and mouse. Hum. Mol. Genet. 7, 1091-1098 (1997).

29. Pham, C. T. & Ley, T. J. Dipeptidyl peptidase I is required for the processing and activation of granzymes A and B in vivo. Proc. Natl. Acad Sci. U S A 96,8627- 8632 (1999).

30. Shresta, S., Pham, C. T., Thomas, D. A., Graubert, T. A. & Ley, T. J. How do cytotoxic lymphocytes kill their targets? Curr. Opin. Immunol. 10,581-587 (1998).

31. Bowden, P. E., Quinlan, R. A., Breitkrutz, D., & Fusenig N. E. Proteolytic modification of acidic and basic keratins during terminal differentiation of mouse and human epidermis. Eur. J Biochem. 142,29-36 (1984).

32. Scott, F. L. et al. Proteinase inhibitor 6 (PI-6) expression in human skin: induction of PI-6 and a PI-6/proteinase complex during keratinocyte differentiation. Exp.

Cell. Res. 245,263-271 (1998).

33. Lathrop G. M., Lalouel J. M., Julier C. & Ott J. Strategies for multilocus linkage analysis in humans. Proc. Natl. Acad. Sci. USA 81,3443-3446 (1984).

34. Smyth, M. & O'Cuiml, G. Dipeptidyl aminopeptidase III of guinea-pig brain: specificity for short oligopeptide sequences. J. Neurochem. 63,1439-1445 (1994).