GENOTYPING AND SEQUENCING ASSAYS FOR PRRSV

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63/413,744, filed October 6, 2022; the entire contents of which is hereby incorporated by reference.

INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED

ELECTRONICALLY

[0002] Incorporated by reference in its entirety is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: 52.0 kilobytes ACII (xml) file named “85007-395566_SL.xml,” created on October 6, 2023.

BACKGROUND

[0003] Porcine reproductive and respiratory syndrome virus (PRRSV) is a singlestranded positive sense RNA virus with a genome of approximately 15kb in length classified within the family Arteriviridae. Two PRRSV species are known: PRRSV 1 (also referred to as European PRRSV) and PRRSV 2 (North American PRRSV). PRRSV is one of the most deadly and economically significant swine pathogens worldwide. The infection can lead to pregnancy failures in sows, neonatal losses, and respiratory disease in piglets. The estimated annual cost of PRRSV for the US pork industry is around 664 million dollars.

[0004] Traditional PRRSV diagnostics rely on real-time reverse transcriptase PCR (RT- PCR) detection of the virus in serum, oral fluids, semen and/or tissue samples. Given the high genetic diversity of PRRSV and the broad use of modified live vaccines (MLV), PRRSV RT-PCR is usually complemented by sequencing of the glycoprotein 5 (GP5, ORF5) followed by restriction length polymorphism (RFLP) analysis. The predicted cut pattern of three specific restrictions enzymes (Mlul, Hindi, and SacII) is used to classify PRRSV into specific RFLP profiles (i.e. 1-8-4, 1-7-4, etc). Although current methods have enabled important discoveries and advances related to PRRSV for more than a decade, this approach only provides limited information on the genetic makeup of the virus.

[0005] Sequencing of ORF5 allowed the classification of type 2 PRRSVs into nine lineages: 1 to 9. Lineage 9 was the most prevalent from 2009 to 2010, but its occurrence decreased coinciding with the emergence or re-emergence of lineage 1 as the dominant lineage, reaching about 90% of relative frequency by 2015. Viruses within lineages 1, 5, 7, and 8 are used in commercial vaccines in the United States with the vaccine belonging to lineage 5 being the most widely used historically.

[0006] Rapid evolution and the genetic diversity of PRRSV, however, are major issues affecting disease control and management. The emergence of highly pathogenic PRRSV strains in China and the constant discovery of variant viruses underscore the need for improved diagnostics and rapid sequencing approaches that enable complete genetic characterization of the viruses circulating in the field. Up to 40% of U.S. breeding herds experience PRRSV outbreaks every year. It is, therefore, important to identify the virus that is present and define whether the outbreak(s) is/are a result of a new virus introduction(s), or of the emergence of variant strain(s). During the fall of 2020, the occurrence of a PRRSV outbreak with extremely high production losses was reported in the Midwestern U.S., with the first peak occurring between October and December, and the second starting in April 2021. Results of ORF5 and whole genome sequencing suggested it represented the emergence of a new variant within Lineage 1C and showed low positive predictive values for either RFLP pattern 1-4-4 or Lineage 1C.

[0007] There is a need for new technologies and strategies that can rapidly identify PRRSV and simultaneously yield a complete genetic makeup of the virus. These new assays may contribute to improved control strategies in the field, such as modified live virus vaccine selection. Full-length genome sequencing and careful phylogenetic analyses are required to be able to make sustained conclusions on homology between the vaccine and any tested challenge strain.

[0008] The employment of a tiling amplicon multiplex PCR for genome enrichment has enabled the generation of hundreds of thousands of SARS-CoV-2 genomes that arc available at database platforms in an unprecedented effort to track virus evolution. Sequencing of PRRS V have been recently described and full length or nearly full length genomes were obtained, although using more expensive and time-consuming protocols or using viral isolates derived from cell culture.

[0009] Deep sequencing of partial genes has been described as another approach for genotyping viruses using MinlON. Enterovirus, infectious bronchitis virus, Newcastle disease virus and infectious laryngotracheitis virus were successfully sequenced and identified at genotype and lineage level.

[0010] Accordingly, the present disclosure provides novel single amplicon and whole genome PRRSV sequencing assays and kits as well as methods utilizing the assays. The present disclosure provides means for fast genetic characterization to yield a complete or near complete genome sequences of PRRSV. The present disclosure provides improvement for understanding of PRRSV epidemiology and also allows clinicians and field veterinarians to direct control measures. Further, the present disclosure provides point of care compatible assays for portable real-time genotyping of PRRSV directly from clinical samples based on partial (ORF5) and whole genome sequencing using the MinlON nanopore platform.

SUMMARY OF THE INVENTION

[0011] The present invention relates in part to an in vitro assay for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the assay comprising a forward primer and a reverse primer. In one embodiment described herein, the forward primer comprises at least 95% sequence identity to TCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 1). In another embodiment, the reverse primer comprises at least 95% sequence identity to ACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 2). In an aspect, the forward primer comprises at least 98% sequence identity to TCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 1). In another aspect, the reverse primer comprises at least 98% sequence identity to ACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 2). In yet another embodiment, the forward primer comprises SEQ ID NO: 1 and the reverse primer comprises SEQ ID NO: 2.

[0012] In one embodiment of the invention, an in vitro assay for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV) comprises a forward primer comprising at least 95% sequence identity to TTTCTGTTGGTGCTGATATTGCTCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 3). [0013] In another embodiment, an in vitro assay for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV) comprises a reverse primer comprising at least 95% sequence identity to ACTTGCCTGTCGCTCTATCTTCACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 4).

[0014] The present invention also relates in part to an in vitro assay for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the assay comprising one or more primers of at least 95% sequence identity to its corresponding SEQ ID NO selected from Table 1 described later herein.

[0015] The present invention further relates in pail to a method of genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the method comprising a step of nanopore sequencing the PRRSV. In one embodiment described herein, the sequencing utilizes a forward primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 1. In another embodiment, the sequencing utilizes a reverse primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 2. In yet another embodiment, the sequencing utilizes a forward primer comprising SEQ ID NO: 1 and a reverse primer comprising SEQ ID NO: 2.

[0016] An embodiment of the present invention is a method of genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the method comprising a step of nanopore sequencing the PRRSV, wherein the sequencing utilizes: a forward primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 1 and a reverse primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 2, or a forward primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 3 and a reverse primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 4.

[0017] Another embodiment of the present invention is a method of genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the method comprising a step of nanopore sequencing the PRRSV, wherein the sequencing utilizes one or more primers comprising at least 95% sequence identity to its corresponding SEQ ID NO selected from Table 1 as described herein.

[0018] One embodiment of the present invention is a kit comprising a forward primer comprising at least 95% sequence identity to SEQ ID NO: 1 and a reverse primer comprising at least 95% sequence identity to SEQ ID NO: 2.

[0019] Yet another embodiment of the present invention is a kit comprising one or more primers of at least 95% sequence identity to its corresponding SEQ ID NO selected from Table 1 as described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIGURE 1 shows a region of PRRSV genome covered by the TAS primers spanning ORF4, ORF5 and ORF6.

[0021] FIGURE 2 shows a phylogenetic tree based on partial sequences generated with the TAS primers/assay, spanning ORF4 to ORF6.

[0022] FIGURE 3 shows whole genome coverage at >20X and >100X sequencing depth. Percentage of PRRSV genomes covered by the long amplicon tiled sequencing (EATS) primers/assays and obtained from LATS protocol for serum (n=60), lung (n=20), processing fluid (n=39) and oral fluid (n=35) clinical samples.

[0023] FIGURE 4 shows percent genome coverage per range of Ct value.

[0024] FIGURE 5 shows a phylogenetic tree based on complete genome sequences obtained using the LATS primers/assay.

[0025] FIGURE 6 shows the percentage of PRRSV ORFs that are covered at >20X and >100X depth by the LATS protocol for serum, lung, processing fluid and oral fluid clinical samples. [0026] FIGURE 7 shows percent genome coverage at >20X and > 100X sequencing depth obtained for clinical specimens at the indicated Ct values.

DETAILED DESCRIPTION

[0027] As used herein, the articles "a," "an,” and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" can mean one element or more than one element.

[0028] The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.”

[0029] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0030] References throughout this document to "one embodiment", "certain embodiments", and “an embodiment" or similar terms means that a particular- feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments without limitation.

[0031] The present disclosure describes the successful application of two sequencing approaches using MinlON platform for accurate PRRSV genotyping directly from clinical samples with a wide range of viral load. These protocols could be useful in all swine-producing regions of the world, especially in developing countries due to the portability, low initial cost and possibility of real-time analysis. The LATS protocol in special, may also be useful for research and surveillance purposes, tracking rapidly- evolving lineages without the need to culture the virus.

[0032] The PRRSV genome region ranging from ORF3 to ORF7 is composed by small coding regions when compared to the longer ORFla, ORFlb and ORF2a. This factor facilitates sequencing these regions, that are important for classification of strains and analyzing interlineage recombination events. ORF7 is also used for identification of strains and is fully sequenced by our LATS approach in the vast majority of samples. It means that LATS could be useful even for the classification of high Ct samples in the impossibility of obtaining whole genome coverage. LATS also allowed the detection of different deletion patterns in NSP2 region of ORFla that were previously reported. This result indicates that our primers efficiently amplified this highly variable region. A deeper detection of NSP2 polymorphism patterns is important for an enhanced classification of lineages, complementing the ORF5-based classification.

[0033] The selection of samples originating from different states of USA provides more confidence to our phylogenetic classification and is in accordance with previous studies. Classification result obtained here shows a larger prevalence of lineage 1 and its sublineages, followed by lineage 5 and 8, in accordance with previous reports showing lineages 1, 5 and 8 as the most prevalent lineages in USA and China. The viability of this set of primers for sequencing strains of these three lineages suggests that the LATS protocol presented here is suitable for using in responses to PRRSV outbreaks in USA, China and other countries where these lineages are present. Lineage classification is ORF5 based, thus, some whole genome sequences belonging to the same sublineage in the phylogenetic tree do not cluster together in the same node (figure 5). This could be due to genome recombination. Although type 2 PRRSV is the most prevalent in the U.S.A, and China, type 1 also occurs in these countries, and the same LATS approach using a set of primers designed for type 1 would be useful in outbreaks involving this genotype.

[0034] Whole-genome sequencing is highly dependent on sample quality, that is subjected to degradation during transport and the action of nucleases, especially when considering the sample type. This is a possible explanation for the variability found in the whole genome coverage analysis (figures 3 and 4), where it is possible to see that some lower Ct samples did not achieve full genome coverage when compared to higher Ct samples. These natural variables could have acted in the degradation of viral RNA. Since MinlON sequencing, however, allows larger amplicon sizes, a partial genome would provide enough information to enable genotype characterization.

[0035] In an aspect, an in vitro assay for targeted amplicon sequencing and genotyping a porcine reproductive and respiratory syndrome virus (PRRSV) is provided, the assay comprising a forward primer comprising TCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 1) and a reverse primer comprising ACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 2).

[0036] In an aspect, the forward primer comprises at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1.

[0037] In an aspect, the reverse primer comprises at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2.

[0038] In an aspect, the forward primer comprises at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3.

[0039] In an aspect, the reverse primer comprises at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4.

[0040] In an aspect, an in vitro assay for whole genome sequencing and genotyping a porcine reproductive and respiratory syndrome virus (PRRSV) is provided, the assay comprising one or more primers selected from Table 1 as described herein.

[0041] In an aspect, the one or more primers comprises at least 80%, e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding SEQ ID NO in Table 1.

[0042] In an aspect, a method of genotyping a porcine reproductive and respiratory syndrome virus (PRRSV) is provided, the method comprising a step of nanopore sequencing the PRRSV, wherein the sequencing utilizes a forward primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 1 and a reverse primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 2. In another aspect, the sequencing utilizes a forward primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 3 and a reverse primer comprising a sequence with at least 95% sequence identity to SEQ ID NO: 4.

[0043] In an aspect, a method of whole genome sequencing and genotyping a porcine reproductive and respiratory syndrome virus (PRRSV) is provided, the method comprising a step of nanopore sequencing the PRRSV, wherein the sequencing utilizes one or more primers selected from Table 1 as described herein.

[0044] In an aspect, a kit comprising a forward primer comprising a sequence with at least 95% sequence identity to TCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 1) and a reverse primer comprising a sequence with at least 95% sequence identity to ACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 2) is provided.

[0045] In an aspect, a kit comprising a forward primer comprising a sequence with at least 95% sequence identity to TTTCTGTTGGTGCTGATATTGCTCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 3) and a reverse primer comprising a sequence with at least 95% sequence identity to ACTTGCCTGTCGCTCTATCTTCACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 4) is provided.

[0046] In an aspect, a kit comprising one or more primers of at least 95% sequence identity to its corresponding SEQ ID NO selected from Table 1 is provided.

[0047] The following numbered embodiments are contemplated and are non-limiting: [0048] Clause 1 : An in vitro assay for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the assay comprising a forward primer comprising at least 80% sequence identity to TCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 1) and a reverse primer comprising at least 80% sequence identity to ACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 2).

[0049] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises at least 80% sequence identity to TTTCTGTTGGTGCTGATATTGCTCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 3). [0050] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises at least 80% sequence identity to ACTTGCCTGTCGCTCTATCTTCACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 4).

[0051] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 80% sequence identity to SEQ ID NO: 1.

[0052] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 85% sequence identity to SEQ ID NO: 1.

[0053] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 90% sequence identity to SEQ ID NO: 1.

[0054] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 91% sequence identity to SEQ ID NO: 1.

[0055] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 92% sequence identity to SEQ ID NO: 1.

[0056] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 93% sequence identity to SEQ ID NO: 1. [0057] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 94% sequence identity to SEQ ID NO: 1.

[0058] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 95% sequence identity to SEQ ID NO: 1.

[0059] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 96% sequence identity to SEQ ID NO: 1.

[0060] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 97% sequence identity to SEQ ID NO: 1.

[0061] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 98% sequence identity to SEQ ID NO: 1.

[0062] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises 99% sequence identity to SEQ ID NO: 1.

[0063] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 80% sequence identity to SEQ ID NO: 2.

[0064] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 85% sequence identity to SEQ ID NO: 2.

[0065] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 90% sequence identity to SEQ ID NO: 2. [0066] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 91% sequence identity to SEQ ID NO: 2.

[0067] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 92% sequence identity to SEQ ID NO: 2.

[0068] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 93% sequence identity to SEQ ID NO: 2.

[0069] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 94% sequence identity to SEQ ID NO: 2.

[0070] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 95% sequence identity to SEQ ID NO: 2.

[0071] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 96% sequence identity to SEQ ID NO: 2.

[0072] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 97% sequence identity to SEQ ID NO: 2.

[0073] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 98% sequence identity to SEQ ID NO: 2.

[0074] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the reverse primer comprises 99% sequence identity to SEQ ID NO: 2.

[0075] Clause 28: The in vitro assay of clause 1 , any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is a type 2 PRRSV species. [0076] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 1.

[0077] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 2.

[0078] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 3.

[0079] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 4.

[0080] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 5.

[0081] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 6.

[0082] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 7.

[0083] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 8.

[0084] The in vitro assay of clause 28, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 9.

[0085] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is a type 2 PRRSV species.

[0086] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is an amplicon-based assay.

[0087] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the amplicon-based assay is targeted amplicon sequencing (TAS).

[0088] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay comprises short or long read-based sequencing. [0089] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is a real-time assay.

[0090] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is a portable, point of care (POC) or field deploy able assay.

[0091] The in vitro assay of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is capable of sequencing the PRRSV without isolation of the PRRSV in culture media.

[0092] Clause 45: An in vitro assay for whole or partial genome sequencing a porcine reproductive and respiratory syndrome virus (PRRSV), the assay comprising one or more primers of at least 80% sequence identity to its corresponding SEQ ID NO selected from Table 1 as described herein.

[0093] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 1 or more primers selected from Table 1. [0094] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 2 or more primers selected from Table 1. [0095] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 3 or more primers selected from Table 1. [0096] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 4 or more primers selected from Table 1. [0097] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 5 or more primers selected from Table 1. [0098] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 6 or more primers selected from Table 1. [0099] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 7 or more primers selected from Table 1. [00100] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 8 or more primers selected from Table 1. [00101] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 9 or more primers selected from Table 1.

[00102] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the assay comprises 10 or more primers selected from Table 1.

[00103] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 80% sequence identity to its corresponding SEQ ID NO in Table 1.

[00104] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 85% sequence identity to its corresponding SEQ ID NO in Table 1.

[00105] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 90% sequence identity to its corresponding SEQ ID NO in Table 1.

[00106] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 91% sequence identity to its corresponding SEQ ID NO in Table 1.

[00107] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 92% sequence identity to its corresponding SEQ ID NO in Table 1.

[00108] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 93% sequence identity to its corresponding SEQ ID NO in Table 1.

[00109] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 94% sequence identity to its corresponding SEQ ID NO in Table 1. [00110] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 95% sequence identity to its corresponding SEQ ID NO in Table 1.

[00111] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 96% sequence identity to its corresponding SEQ ID NO in Table 1.

[00112] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 97% sequence identity to its corresponding SEQ ID NO in Table 1.

[00113] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 98% sequence identity to its corresponding SEQ ID NO in Table 1.

[00114] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the one or more primers comprises 99% sequence identity to its corresponding SEQ ID NO in Table 1.

[00115] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is a type 2 PRRSV species.

[00116] Clause 68: The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is an amplicon-based assay.

[00117] The in vitro assay of clause 68, any other suitable clause, or any combination of suitable clauses, wherein the amplicon-based assay is long amplicon tiling sequencing (LATS).

[00118] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay comprises short or long readbased sequencing.

[00119] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is a real-time assay. [00120] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is a portable point of care or field deployable assay.

[00121] The in vitro assay of clause 45, any other suitable clause, or any combination of suitable clauses, wherein the in vitro assay is capable of sequencing the PRRSV without isolation of the PRRSV in culture media.

[00122] Clause 74: A method of genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the method comprising a step of nanopore sequencing the PRRSV, wherein the sequencing utilizes a forward primer comprising at least 80% sequence identity to SEQ ID NO: 1 and a reverse primer comprising at least 80% sequence identity to SEQ ID NO: 2.

[00123] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the forward primer comprises at least 80% sequence identity to SEQ ID NO: 3 and the reverse primer comprises at least 80% sequence identity to SEQ ID NO: 4.

[00124] Clause 76: The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is a type 2 PRRSV species.

[00125] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 1.

[00126] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 2.

[00127] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 3.

[00128] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 4.

[00129] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 5.

[00130] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 6. [00131] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 7.

[00132] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 8.

[00133] The method of clause 76, any other suitable clause, or any combination of suitable clauses, wherein the type 2 PRRSV species is lineage 9.

[00134] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is a type 2 PRRSV species.

[00135] Clause 87: The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method comprises an amplicon-based assay. [00136] The method of clause 87, any other suitable clause, or any combination of suitable clauses, wherein the amplicon-based assay is targeted amplicon sequencing (TAS).

[00137] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method is performed in real-time.

[00138] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method is performed in the field.

[00139] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method genotypes the PRRSV without isolation of the PRRSV in culture media.

[00140] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is obtained directly from a clinical sample.

[00141] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method is capable of genotyping the PRRSV in less than 2 hours.

[00142] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method is capable of genotyping the PRRSV in less than 1 hour. [00143] The method of clause 74, any other suitable clause, or any combination of suitable clauses, wherein the method is capable of genotyping the PRRSV in less than 30 minutes.

[00144] Clause 96: A method of genotyping a porcine reproductive and respiratory syndrome virus (PRRSV), the method comprising a step of nanopore sequencing the PRRSV, wherein the sequencing utilizes one or more primers of at least 80% sequence identity to its corresponding SEQ ID NO selected from Table 1.

[00145] The method of clause 96. any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 1 or more primers selected from Table 1. [00146] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 2 or more primers selected from Table 1. [00147] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 3 or more primers selected from Table 1. [00148] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 4 or more primers selected from Table 1. [00149] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 5 or more primers selected from Table 1. [00150] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 6 or more primers selected from Table 1. [00151] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 7 or more primers selected from Table 1. [00152] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 8 or more primers selected from Table 1. [00153] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 9 or more primers selected from Table 1. [00154] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the sequencing utilizes 10 or more primers selected from Table 1. [00155] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is a type 2 PRRSV species.

[00156] Clause 107: The method of clause 95. any other suitable clause, or any combination of suitable clauses, wherein the method comprises an amplicon-based assay. [00157] The method of clause 107, any other suitable clause, or any combination of suitable clauses, wherein the amplicon-based assay is long amplicon tiling sequencing (LATS).

[00158] The method of clause 96. any other suitable clause, or any combination of suitable clauses, wherein the method is performed in real-time.

[00159] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the method is performed in the field.

[00160] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the method genotypes the PRRSV without isolation of the PRRSV in culture media.

[00161] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the PRRSV is obtained directly from a clinical sample.

[00162] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the method is capable of genotyping the PRRSV in less than 2 hours.

[00163] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the method is capable of genotyping the PRRSV in less than 1 hour.

[00164] The method of clause 96, any other suitable clause, or any combination of suitable clauses, wherein the method is capable of genotyping the PRRSV in less than 30 minutes.

[00165] Clause 116: A kit comprising a forward primer comprising at least 80% sequence identity to TCATGGTTTCTSAGGCGTTCG (SEQ ID NO: 1) and a reverse primer comprising at least 80% sequence identity to ACCACTCCTCGTTTAACAGCTC (SEQ ID NO: 2). [00166] The kit of clause 116, any other suitable clause, or any combination of suitable clauses, further comprising means for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV).

[00167] Clause 118: A kit comprising one or more primers of at least 80% sequence identity to its corresponding SEQ ID NO selected from Table 1.

[00168] The kit of clause 118, any other suitable clause, or any combination of suitable clauses, further comprising means for genotyping a porcine reproductive and respiratory syndrome virus (PRRSV).

EXAMPLES

[00169] The Examples herein utilize exemplary materials and methods for the embodiments of the present disclosure. The following examples are presented to illustrate the compositions described herein, but should not be construed as limiting the scope of the disclosure in any way. In addition, the information found in Appendix A and Appendix B are incorporated herein in their entirety.

[00170] Clinical samples and RNA extraction

[00171] Swine clinical samples originated from different herds throughout the United States between 2019 and 2021 were submitted to the Veterinary Diagnostic Laboratory at Iowa State University for diagnostic investigation using a PRRSV RT- qPCR assay. A total of 154 PRRSV positive samples were used and included: 20 lungs, 60 sera, 35 oral fluids and 39 processing fluid samples with RT-qPCR Ct values ranging from 15 to 35 (Supplementary table 1). Samples were clarified by centrifugation at 2,000 rpm for 10 minutes and subjected to nucleic acid extraction using the cador

Pathogen 96 QIAcube HT Kit (Qiagen) in a QIAcube HT automated extractor (Qiagen).

[00172] Library preparation for target amplicon sequencing (TAS)

[00173] For amplicon sequencing, targets were amplified directly from the clinical samples using the SuperScript™ IV One-Step RT-PCR System (Thermo Fisher

Scientific, Waltham, MA). Primers were designed using Primer3 in the Geneious Prime 2019 software (https://www.gcncious.com) targeting a -1,546 bp region covering the full length ORF5 (envelope protein), and partially covering ORF4 and ORF6 (membrane protein) (figure 1). Universal Oxford nanopore-compatible adapter sequences were added to the 5’ end of each primer sequence to allow PCR-based barcoding. Primer sequences are provided in Table 1.

Table 1.

[00174] The reverse transcription reaction was carried out using 5 pL of RNA and the thermocycling conditions as follows: 50°C for 10 min; 98°C for 2 min; 40 cycles of 98°C for 10 s, 70°C for 10 s, and 72°C for 45 s, followed by one cycle at 72°C for 5 min. After purification of amplicons with AMPure XP beads (Beckman Coulter, Brea, CA) at a 1.6:1 volumetric bead-to-DNA ratio and quantification using the dsDNA High Sensitivity Assay kit on a Qubit® fluorometer 3.0 (Thermo Fisher Scientific), samples were diluted to 0.5 nM in a total of 24 pl and used as input for library preparation following the PCR barcoding (96) amplicon (SQK-LSK109) protocol (Oxford Nanopore Technologies [ONT]). Final DNA libraries were loaded in a FLO-MIN106 R9.4 flow cell to start 3- hour sequencing runs. Pools of 24 or 48 barcoded samples were sequenced and the total number of reads obtained within 1 hour were analyzed.

[00175] Library preparation for Long Amplicon Tiling Sequencing (LATS) [00176] A multiplex PCR was developed following the ARTIC Network amplicon-based approach for sequencing SARS-CoV-2 (https://artic.network/ncov-2019). Forty-one custom primers were designed manually, targeting approximately 1500bp products with lOObp overlap between different amplicons, based on an alignment of 87 complete PRRSV type 2 genomes. Primers arc provided in Table 1, where sequences indicated by an asterisk (*) are added 2X volume to the pool of primers. A detailed protocol is provided at dx.doi.org/10.17504/protocols.io.bshinb4e. Libraries were generated using the Native Barcode Kit, EXP-NBD196 and Ligation Sequencing Kit, SQK-SQK109 (Oxford Nanopore Technologies) multiplexing up to 24 samples per sequencing run. Libraries were ran on R9.4 flow cells for 6 hours.

[00177] TAS analytical sensitivity

[00178] The operating range of inlON TAS was determined by sequencing six 10-fold serial dilution (10 ^-1 to 10’ ⁶ ) of two PRRSV type 1 (strains 03-15 and SD14003) and two type 2 (strains 1-7-4 and NADC20) cell culture isolates. The serial dilution was initially tested by real-time PCR (RT-qPCR) using EZ-PRRSV MPX 4.0 Master Mix and Enzyme (Tetracore Inc.) and the sensitivity of TAS was compared to this commercial PRRSV RT- qPCR kit. This process of serial dilution, extraction, library preparation and sequencing was repeated two times independently (experiment 1 and experiment 2).

[00179] Isolates sequencing by MiSeq

[00180] Complete genome sequences of two PRRSV type 1 (strains 03-15 and SD14003) and two type 2 (strains 1-7-4 and NADC20) were obtained using the Illumina Miseq platform. Briefly, viral RNA was extracted, and cDNA was prepared using SuperScript IV Reverse Transcriptase (Thermo Fisher). Libraries were prepared according to the Nextera XT (Illumina) library preparation protocol and then sequenced using the Illumina Miseq platform.

[00181] Bioinformatic analysis

[00182] Raw reads were basecalled and demultiplexed automatically in the MinIT device (Oxford Nanopore Technologies). Reads were filtered by quality and minimum size (-q 7 and -1200) using Nanofilt and then aligned to a type 2 reference genome, MN073092.1, using the mini_align utility of Pomoxis (https://github.com/nanoporetech/pomoxis). If complete coverage was not obtained, the draft genome was submitted to BLAST and the best hit was used as reference for a new alignment. Viral genome was considered for whole genome analysis if a minimum depth of coverage of 20X was obtained for at least 14kb genome length. Consensus sequences were generated using a combination of SAMtools, BCFtools, and VCFtools utilities. The commands used can be found in the Supplementary file 3. Sequences were aligned using MAFFT and phylogenetic trees were constructed using FastTree with GTR model.

[00183] TAS Analytical sensitivity

[00184] Six 10-fold serial dilution (10 ¹ to 10’ ⁶ ) were used to compare the sensitivity of TAS against RT-qPCR in each of the six dilutions (supplementary table 2). A sequence identity of 100% was obtained within the first 30 minutes of sequencing for the most diluted samples of type 1 isolates in experiment 1 and experiment 2. For type 2 isolates, a sequence identity of 99.87%-99.93% was obtained for the most diluted sample in both experiments within the first 30 minutes of sequencing. Two different PRRSV strains of both genotypes were successfully amplified, confirming the specificity and sensitivity of the tailed primers.

[00185] Noteworthy, although dilutions 10’ ⁶ resulted in RT-qPCR Cts as high as 32.76- 37.36, sequence identities higher than 99.8% were obtained in this dilution across all four isolates in 5 minutes. Altogether, these results indicate high accuracy and repeatability of the method.

[00186] TAS on clinical samples

[00187] MinlON libraries were generated directly from 134 clinical samples using the TAS protocol and consensus sequences of the full-length amplicon were obtained for all the samples. After 1 hour of sequencing, TAS enabled the classification of viruses into lineages 1,5 and 8 (figure 2).

[00188] LATS protocol

[00189] The utility of this procedure on samples from PRRSV outbreaks was assessed by generating libraries directly from sera, oral fluid and processing fluid samples, in a total of 154 field samples. Ninety-two whole genome sequences were obtained (59.7% of clinical samples) and phylogenetic analysis was performed, enabling the classification of these sequences predominantly into lineage 1 and its sublineages, and one sample into lineage 5 (figure 5). Overall, genome coverage was variable for samples with Ct values higher than 27 (figures 3 and 4). At least 80% genome coverage was obtained at >20X depth for 22 out of 35 oral fluid samples (62.8%), 26 out of 39 processing fluid (66.6%), 50 out of 60 sera (83.3%) and eighteen out of 20 lungs (90%). Only 6 serum samples had less than 60% of the genome covered at 20X depth.

[00190] Deletion patterns in NSP2 were observed. Seventy-three whole genome sequences obtained in this study exhibited a 100-aa deletion in relation to VR-2332 reference strain (characteristic of NADC34-like strains), while strain USA/IA2019072096/2019 exhibited a “111+1+19” deletion pattern (characteristic of NADC30-like strains). Sequences USA/NC2019093091/2019 and USA/NC2019095720/2019 contained a 13-aa deletion besides the 100-aa deletion.

[00191] Coverage of ORFs:

[00192] The percent coverage of each coding region of PRRSV genome was plotted in graphs (figure 6). The coverage of ORFla, ORFlb and ORF2a presented a similar pattern to the percent coverage of whole genome, with a coverage drop for Cts >27. ORF3 to ORF7 had 100% coverage in the vast majority of samples. Some samples had 0% coverage at >20X and >100X depth, most likely due to RNA degradation issues. It is also expected that higher percent coverage is achieved at 20X depth in comparison to 100X depth.

[00193] Coverage per time of sequencing:

[00194] To determine the time points when full genome coverage was obtained after starting the sequencing run, raw reads from serum samples were extracted after 0.5h, Ih, 1.5h, 3h, 4.5h, 6h and were processed as described before. Full genomes with at least 20X sequencing depth were obtained within the first hour of sequencing for samples with Cts ranging from 15 to 24.9 and >90% coverage was achieved within 4.5h for samples with Cts of 26.3 and 28.5 (Figure 7). One sample differs from the others, achieving full -Tl- coverage in 30 minutes despite the Ct of 29.9. At 100X depth, results were more variable and full coverage was obtained within 4.5h for Cts <26.3 and one sample with Ct of 28.9. [00195] Time and cost estimation

[00196] The average hands-on time of LATS protocol for processing 24 samples from first-strand synthesis to load the library on the flow cell was 7 hours and a total of 12 hours including the PCR cycling time. Considering that a flow cell can be used at least twice for 6-hours sequencing runs, the average total reagents cost per sample when multiplexing 96 samples is $22 and $26 when multiplexing 24 samples.

[00197] For TAS protocol, the estimated sequencing cost is around $23 per sample when multiplexing 24 samples and $17 when multiplexing 96 samples. The average hands-on time is estimated at 13 hours.

[00198] Given that MinlON flow cells can be washed and re-used, the waiting time for processing reduced batches of samples can be decreased, while for other technologies an optimal number of samples must be obtained to achieve the cost-efficiency of multiplexing. Results of genome coverage per time of sequencing shown in figure 7 underscore the time efficiency of MinlON technology with the possibility of obtaining nearly complete genome coverage at >20X in 1 hour for samples with Ct values lower than 26.

[00199] The sensitivity of the TAS was comparable to a commercial RT-qPCR targeting both PRRSV genotypes. As RT-qPCR assays only provide positive or negative results, however, TAS can be more informative since it provides accurate genotyping, revealing mutations at high read depth. TAS primers were designed from conserved regions, meaning that these primers will most likely be still effective even in the face of eventual genetic diversity.

[00200] While TAS allows the classification of PRRSV into both genotypes, the assay is more time-consuming than LATS. Taking into consideration the variable nature of PRRSV genome and that type 2 is the most prevalent and largely spread throughout the U.S.A, the LATS assay provides more value to the control of this virus in U.S.A and other countries where this genotype is highly prevalent. Another disadvantage of TAS in relation to LATS is the need for a PCR-barcoding step and a following clean-up, increasing the possibility of cross-contamination and increasing the turn-around time. An additional detrimental effect of PCR-barcoding is higher chance of barcode cross-talk, which could lead to wrong barcode assignment in multiplex experiments. However, the barcode cross-talk issue can be addressed by further bioinformatic options. In spite of these drawbacks, the same pair of primers can be used without the adapter tail in a native barcoding library preparation, following the same downstream steps used in the LATS protocol, thus reducing the turnaround time and chances of contamination. The performance of TAS on high Ct clinical samples depends on sample quality and an efficient first-round PCR. Clinical samples with high Cts may not have the same sequencing performance observed when sequencing isolates. The same tailed-primers approach was used previously for other viruses such as Newcastle disease virus, reaching an identity of 98.37% compared to the expected consensus within 7 minutes and also for human enterovirus, reaching an average identity >99% when comparing to the expected consensus.

[00201] An overall consensus identity >99% was obtained, and the quality was high enough for lineage-level classification of partial and complete genomes. The LATS strategy is effective at generating full genome sequences from samples with Ct values up to 30, with a turnaround time of 11 hours from RNA to final DNA library. This protocol offers a cost-effective and informative system that can be used in research laboratories and in the field, providing invaluable information for veterinarians working on the control of PRRSV. As shown by the rapid shift of prevalence from lineage 9 to lineage 1 within a 5-years frame, whole genome sequence classification complementary to ORF5 is essential. The rapid turnaround time, portability and ease of use offer significant advantages over traditional diagnostic approaches or other sequencing platforms. The protocols presented here may become valuable tools with potential for field applications during PRRSV elimination programs.

[00202] Accordingly, the various embodiments of the invention, as disclosed above, are intended to be illustrative, not limiting. Various changes may be made without departing from the spirit and scope of the invention. As a result, it will be apparent for those skilled in the art that the illustrative embodiments described are only examples and that various modifications can be made within the scope of the invention as defined in the appended claims.