The damage inflicted to crops by insects and other plant pathogens, (e. g. nematodes, viruses, fungi and bacteria) has resulted in considerable economic losses and decreases in yield. Man has employed various methods to combat these pathogens, typically by the use of controlling agents such as insecticides, bactericides antivirals and anti-fungals. There is a desire to discover alternative means to control plant pathogens which does not require the use of chemicals which are potentially harmful to both the environment and to animals which consume plant material which has been treated in this way. The use of chemicals also has cost implications for the farmer. An approach is to genetically engineer plant species so that they are resistant to infection by the above mentioned pathogens.

Plants are unable to avoid pathogens by moving to a more favourable environment.

Plants have therefore evolved defence mechanisms to provide protection from pathogen invasion. The mechanisms include physical barriers and inducible responses to pathogen attack which involve systemic signalling molecules which mobilise endogenous plant defence mechanisms which results typically in the production of small effector molecules which activate signal transduction cascades.

This can result in systemic acquired resistance (SAR).

It has long been thought that the benzoate salicylic acid is implicated in plant stress responses to pathogen attack. The accumulation of salicylic acid occurs in pathogen challenged plant tissues and is thought to correlate with SAR.

Glucosyltransferases or GTases are enzymes which post-translationally transfer glucosyl residues from an activated nucleotide sugar to monomeric and polymeric

acceptor molecules such as other sugars, proteins, lipids and other organic substrates.

These glucosylated molecules take part in diverse metabolic pathways and processes.

The transfer of a glucosyl moiety can alter the acceptor's bioactivity, solubility and transport properties within the cell and throughout the plant. One family of GTases in higher plants is defined by the presence of a C-terminal consensus sequence. The GTases of this family function in the cytosol of plant cells and catalyse the transfer of glucose to small molecular weight substrates, such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones.

We herein disclose a GTase which modifies salicylic acid. There is a correlation between the extent of modification of salicylic acid and the sensitivity of a plant to pathogen challenge. The discovery of this sequence provides an opportunity to engineer plant species to alter their resistance to a particular pathogen by modulating the amount of glucosylated salicylic acid.

According to an aspect of the invention there is provided a transgenic plant cell characterised in that the genome of said cell is modified such that the activity of a glucosyltransferase which modifies salicylic acid is altered or modulated when compared to a non-transgenic reference cell of the same species.

In a preferred embodiment of the invention said cell is genetically modified such that the enzyme activity of a polypeptide encoded by a nucleic acid molecule selected from the group consisting of : i) a nucleic acid molecule comprising a nucleic acid sequence represented in Figure la or lb ; ii) a nucleic acid molecule which hybridises to the sequence in Figure la or 1b and which glucosylates salicylic acid; and iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) in codon usage due to the degeneracy in the genetic code, is modulated.

In a preferred embodiment of the invention said nucleic acid hybridises under stringent hybridisation conditions to the sequences represented in Figure la or lb.

Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in 0. 1x SSC, 0.1% SDS at 60°C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is: Tm = 81. 5° C + 16.6 Log [Na+] + 0.41 [% G + C] -0. 63 (% formamide).

Typically, hybridisation conditions uses 4-6 x SSPE (20x SSPE contains 175.3g NaCl, 88.2g NaH2P04 H2O and 7.4g EDTA dissolved to 1 litre and the pH adjusted to 7.4) ; 5-1Ox Denhardts solution (50x Denhardts solution contains 5g Ficoll (type 400, Pharmacia), 5g polyvinylpyrrolidone abd 5g bovine serum albumen; 1001lg- 1. 0mg/ml sonicated salmon/herring DNA; 0.1-1. 0% sodium dodecyl sulphate; optionally 40-60% deionised formamide. Hybridisation temperature will vary depending on the GC content of the nucleic acid target sequence but will typically be between 42°-65° C.

In a preferred embodiment of the invention said cell is modified so that it has reduced glucosyltransferase activity. Preferably said activity is reduced by at least 10%.

Preferably said activity is reduced by between about 10%-90%. More preferably said activity is reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or at least 90% when compared to a non-transgenic reference cell.

In a further preferred embodiment of the invention said transgenic cell is null for a nucleic acid molecule comprising a sequence selected from the group consisting of : i) the nucleic acid molecule comprising a sequence as represented by Figure la or lb ; ii) nucleic acids which hybridise to the sequences of (i) above and which glucosylates salicylic acid; and iii) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.

Null refers to a cell which includes a non-functional copy of the nucleic acid sequence described above wherein the activity of the polypeptide encoded by said nucleic acid is ablated. Methods to provide such a cell are well known in the art and include the use of antisense genes to regulate the expression of specific targets; insertional mutagenesis using T-DNA; the introduction of point mutations and small deletions into open reading frames and regulatory sequences; and double stranded inhibitory RNA (RNAi).

A number of techniques have been developed in recent years which purport to specifically ablate genes and/or gene products. A recent technique to specifically ablate gene function is through the introduction of double stranded RNA, also referred to as inhibitory RNA (RNAi), into a cell which results in the destruction of mRNA complementary to the sequence included in the RNAi molecule. The RNAi molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule.

The RNAi molecule is typically derived from exonic or coding sequence of the gene which is to be ablated. Surprisingly, only a few molecules of RNAi are required to block gene expression which implies the mechanism is catalytic. The site of action appears to be nuclear as little if any RNAi is detectable in the cytoplasm of cells indicating that RNAi exerts its effect during mRNA synthesis or processing.

An alternative embodiment of RNAi involves the synthesis of so called"stem loop RNAi"molecules which are synthesised from expression cassettes carried in vectors.

The DNA molecule encoding the stem-loop RNA is constructed in two parts, a first part which is derived from a gene the regulation of which is desired. The second part is provided with a DNA sequence which is complementary to the sequence of the first part. The cassette is typically under the control of a promoter which transcribes the DNA into RNA. The complementary nature of the first and second parts of the RNA molecule results in base pairing over at least part of the length of the RNA molecule to form a double stranded hairpin RNA structure or stem-loop. The first and second parts can be provided with a linker sequence. Stem loop RNAi has been successfully used in plants to ablate specific mRNA's and thereby affect the phenotype of the plant, see, Smith et al (2000) Nature 407,319-320.

In a preferred embodiment of the invention said cell is transfected with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of a glucosyltransferase which glucosylates salicylic acid wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.

In a preferred embodiment of the invention said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.

In a further preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.

In a further preferred embodiment of the invention said nucleic acid molecule is selected from the group consisting of : i) the nucleic acid molecule comprising a sequence as represented by Figure la or lb ; ii) nucleic acids which hybridise to the sequences of (i) above and which glucosylates salicylic acid; and iii) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.

In an alternative preferred embodiment of the invention said cell is transfected with a nucleic acid molecule comprising a nucleic acid sequence which hybridises with the sense sequence presented in Figure 1 a or lb. Preferably said nucleic acid molecule is provided as an expression cassette wherein the transcription of said nucleic acid molecule produces an antisense nucleic acid molecule which inhibits the expression of a glucosyltransferase which glucosylates salicylic acid.

According to a further aspect of the invention there is provided a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of a glucosyltransferase which glucosylates salicylic acid wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.

In a preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.

In a preferred embodiment of the invention said first and second parts are linked by at least one nucleotide base. In a further preferred embodiment of the invention said

first and second parts are linked by 2,3, 4,5, 6,7, 8,9, or 10 nucleotide bases. In a yet further preferred embodiment of the invention said linker is at least 10 nucleotide bases.

In a further preferred embodiment of the invention the length of the RNA molecule or antisense RNA is between 10 nucleotide bases (nb) and 1000nb. Preferably said RNA molecule or antisense RNA is 100nb ; 200nb; 300nb; 400nb; 500nb ; 600nb; 700nb; 800nb ; 900nb; or 1000nb in length. More preferably still said RNA molecule or antisense RNA is at least 1000nb in length. Preferably still said RNA molecule is 21nb in length.

In a preferred embodiment of the invention said enzyme activity is increased.

Preferably said activity is increased by at least about 2-fold above a basal level of activity. More preferably said activity is increased by at least about 5 fold; 10 fold; 20 fold, 30 fold, 40 fold, 50 fold. Preferably said activity is increased by between at least 50 fold and 100 fold. Preferably said increase is greater than 100-fold.

It will be apparent that means to increase the activity of a polypeptide encoded by a nucleic acid molecule are known to the skilled artisan. For example, and not by limitation, increasing the gene dosage by providing a cell with multiple copies of said gene. Alternatively or in addition, a gene (s) may be placed under the control of a powerful promoter sequence or an inducible promoter sequence to elevate expression of mRNA encoded by said gene. The modulation of mRNA stability is also a mechanism used to alter the steady state levels of an mRNA molecule, typically via alteration to the 5'or 3'untranslated regions of the mRNA.

According to a further aspect of the invention there is provided a vector comprising a nucleic acid molecule according to the invention.

Suitable vectors can be constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences,

enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: Laboratory Manual: 2nd edition, Sambrook et al. 1989, Cold Spring Habor Laboratory Press or Current Protocols in <BR> <BR> Molecular Biology, Second Edition, Ausubel et al. Eds. , John Wiley & Sons, 1992.

Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e. g. higher plant, mammalian, yeast or fungal cells).

Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e. g. bacterial), or plant cell. The vector may be a bi- functional expression vector which functions in multiple hosts. In the case of GTase genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.

By"promoter"is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription.

Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.

Constitutive promoters include, for example CaMV 35S promoter (Odell et al.

(1985) Nature 313,9810-812) ; rice actin (McElroy et al. (1990) Plant Cell 2: 163- 171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689) ; pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588) ; MAS (Velten et al. (1984) EMBO J. 3.

2723-2730); ALS promoter (U. S. Application Seriel No. 08/409,297), and the like.

Other constitutive promoters include those in U. S. Patent Nos. 5, 608, 149; 5, 608, 144; 5,604, 121; 5,569, 597; 5,466, 785 ; 5,399, 680,5, 268,463 ; and 5,608, 142.

Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-la promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid- responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88 : 10421-10425 and McNellis et al.

(1998) Plant J. 14 (2): 247-257) and tetracycline-inducible and tetracycline- repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and US Patent Nos. 5,814, 618 and 5,789, 156, herein incorporated by reference.

Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12 (2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38 (7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254 (3): 337-343; Russell et al.

(1997) Transgenic Res. 6 (2): 157-168; Rinehart et al. (1996) Plant Physiol. 112 (3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112 (2): 525-535; Canevascni et al.

(1996) Plant Physiol. 112 (2): 513-524; Yamamoto et al. (1994) Plant Cell Physiol.

35 (5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al.

(1993) Plant Mol. Biol. 23 (6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad.

Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4 (3): 495-50.

"Operably linked"means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is"under transcriptional initiation regulation"of the promoter. In a preferred aspect, the promoter is an inducible promoter or a developmentally regulated promoter.

Particular of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In : Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant viral- derived vectors (see e. g. EP-A-194809).

If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e. g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).

Plants transformed with a DNA construct of the invention may be produced by standard techniques known in the art for the genetic manipulation of plants. DNA can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transferability (EP-A-270355, EP-A-0116718, NAR 12 (22): 8711-87215 (1984), Townsend et al., US Patent No. 5,563, 055); particle or microprojectile bombardment (US Patent No.

5,100, 792, EP-A-444882, EP-A-434616; Sanford et al, US Patent No. 4,945, 050; <BR> <BR> Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment", in Plant Cell, Tissue and Organ Culture: Fundamental Methods, ed.

Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6: 923-926); microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al. 91987) Plant Tissue and Cell Culture, Academic Press, Crossway et al. (1986) Biotechniques 4: 320-334); electroporation (EP 290395, WO 8706614, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83: 5602-5606;

D'Halluin et al. 91992). Plant Cell 4: 1495-1505) other forms of direct DNA uptake (DE 4005152, WO 9012096, US Patent No. 4,684, 611, Paszkowski et al. (1984) EMBO J. 3: 2717-2722); liposome-mediated DNA uptake (e. g. Freeman et al (1984) Plant Cell Physiol, 29: 1353); or the vortexing method (e. g. Kindle (1990) Proc. Nat.

Acad. Sci. USA 87: 1228). Physical methods for the transformation of plant cells are reviewed in Oard (1991) Biotech. Adv. 9: 1-11. See generally, Weissinger et al.

(1988) Ann. Rev. Genet. 22: 421-477; Sanford et al. (1987) Particulate Sciences and Technology 5: 27-37; Christou et al. (1988) Plant Physiol. 87: 671-674; McCabe et al.

(1988) Bio/Technology 6: 923-926; Finer and McMullen (1991) In Vitro Cell Dev.

Biol. 27P: 175-182; Singh et al. (1988) Theor. Appl. Genet. 96: 319-324; Datta et al.

(1990) Biotechnology 8: 736-740; Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85: 4305-4309; Klein et al. (1988) Biotechnology 6: 559-563; Tomes, US Patent No.

5,240, 855; Buising et al. US Patent Nos. 5,322, 783 and 5,324, 646; Klein et al.

(1988) Plant Physiol 91: 440-444; Fromm et al (1990) Biotechnology 8: 833-839 ; Hooykaas-Von Slogteren et al. 91984). Nature (London) 311: 763-764; Bytebier et al.

(1987) Proc. Natl. Acad. Sci. USA 84: 5345-5349; De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues ed. Chapman et al. (Longman, New York), pp. 197-209; Kaeppler et al. (1990) Plant Cell Reports 9: 415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84: 560-566; Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407- 413; 0sjoda et al. (1996) Nature Biotechnology 14: 745-750, all of which are herein incorporated by reference.

Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl. Genet.

76: 835-840 ; Shimamoto et al. (1989) Nature 338 : 274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9: 957-962; Peng et al (1991) International Rice Research Institute, Manila, Philippines, pp. 563-574;

Cao et al. (1992) Plant Cell Rep. 11: 585-591 ; Li et al. (1993) Plant Cell Rep. 12: 250-255; Rathore et al. (1993) Plant Mol. Biol. 21: 871-884 ; Fromm et al (1990) Bio/Technology 8: 833-839 ; Gordon Kamm et al. (1990) Plant Cell 2: 603-618 ; D'Halluin et al. (1992) Plant Cell 4: 1495-1505; Walters et al. (1992) Plant Mol. Biol.

18: 189-200 ; Koziel et al. (1993). Biotechnology 11194-200; Vasil, I. K. (1994) Plant Mol. Biol. 25: 925-937; Weeks et al (1993) Plant Physiol. 102: 1077-1084; Somers et al. (1992) Bio/Technology 10: 1589-1594 ; WO 92/14828. In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient transformation method in monocots. (Hiei, et al. (1994) The Plant Journal 6: 271- 282). See also, Shimamoto, K. (1994) Current Opinion in Biotechnology 5: 158-162; Vasil, et al. (1992) Bio/Technology 10: 667-674; Vain, et al. (1995) Biotechnology Advances 13 (4): 653-671; Vasil, et al. (1996) Nature Biotechnology 14: 702).

Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, e. g. bombardment with Agf°obacterium-coated microparticles (EP-A- 486234) or microprojectile bombardment to induce wounding followed by co- cultivation with Agrobacterium (EP-A-486233).

According to a further aspect of the invention there is provided a plant comprising a plant cell according to the invention.

In a preferred embodiment of the invention there is provided a plant selected from the group consisting of : corn (Zea mays), canola (Brassica napus, Brassica rapa <BR> <BR> ssp. ), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuls), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanu7m tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Iopmoea battus), cassava (Manihot <BR> <BR> esculenta), coffee (Cofea spp. ), coconut (Cocos nucifera), pineapple (Anana

comosus), citris tree (Citrus spp. ) cocoa (T1>eobroma cacao), tea (Camellia senensis),<BR> banana (Musa spp. ), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardiu77l occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables.

Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea), and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, sorghum, and flax (linseed).

Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower.

The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper. Also included are ornamental plants.

Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.

According to a yet further aspect of the invention there is provided a seed comprising a cell according to the invention.

According to a further aspect of the invention there is provided a method to modulate the activity of a glucosyltransferase which glucosylates salicylic acid comprising the steps of : i) providing a cell according to the invention; ii) regenerating said cell into a plant; and

iii) monitoring the activity of glucosyltransferase activity in said plant.

In a preferred method of the invention said plant has altered pathogen resistance.

Preferably said plant has increased pathogen resistance.

In a preferred method of the invention said plant has increased resistance to a pathogen selected from the following group; an insect; a nematode; a virus; a bacterium; a fungus.

According to a yet further aspect of the invention there is provided a screening method for the identification of agents which modulate the activity of a salicylic acid glucosyltransferase comprising the steps of : i) providing a cell according to the invention; ii) exposing said cell to an agent to be tested; and iii) monitoring the activity of said salicylic acid glucosyltransferase when compared to a non-transgenic reference cell of the same species.

It will be apparent that agents identified by the screening method may modulate the activity of said glucosyltransferase at different potential sites. For example, agents which inhibit or stimulate transcription ; agents which destabilise or stabilise mRNA encoding said glucosyltransferase ; agents which destabilise or stabilise said glucosyltransferase ; agents which affect the enzyme activity of said glucosyltransferase. Methods are known in the art which would allow the rapid screening of agents with the requisite activity. For example, PCR based methods to monitor mRNA abundance either by in situ hybridisation or after RNA extraction and amplification ; ELISA's to determine the abundance of protein in said cell; enzyme assays to determine the glucosyltransferase activity with respect to salicylic acid or salicylic acid analogues In a preferred method of the invention said agent increases the activity of said salicylic acid glucosyltransferase.

In an alternative preferred method of the invention said agent decreases the activity of said salicylic acid glucosyltransferase.

According to a further aspect of the invention there is provided a method to test the efficacy of an agent identified by the screening method of the invention to modulate the activity of a salicylic acid glucosyltransferase comprising the steps of : i) providing an agent identified by said screening method; ii) exposing said agent to a plant to be tested; and iii) determining the activity of said salicylic acid glucosyltransferase.

In a preferred method of the invention said method comprises the additional step of exposing said plant to a pathogen to determine if said plant is more or less susceptible to pathogen infection when compared to a reference plant which has not been thus exposed.

In a preferred method of the invention said pathogen is selected from the group consisting of ; a fungal pathogen; a bacterial pathogen ; a viral pathogen; an insect pathogen ; a nematode pathogen.

In a preferred method of the invention said plant has increased resistance to pathogen infection.

An embodiment of the invention will know be described by example only and with reference to the following Figures: Figure la is the DNA sequence of glucosyltransferase 74F1 which glucosylates salicylic acid; Figure lb is the glucosyltransferase 74F2; Figure 2: RNA extracted was extracted from agroinfiltrated N. benthamiana leaves and analyzed by Northern blot assays. 1,35S : 74F1 ; 2,35S : 74F1 and 74F1-IR ; 3, 35S: 74F1 and 74F2-IR ; 4,35S : 74F2; 5,35S : 74F2 and 74F1-IR ; 6,35S : 74F2 and

74F2-IR. Top panel, 74F1-specific probe; middle panel, 74F2-specific probe; lower panel, equal loading control (ribosomal RNA stained with ethidium bromide).

Figure 3: RNA was extracted from wt (1,2 and 3); 74F1-IR line 3/2 (4,5 and 6) and 74F2-IR line 3/1 (7, 8 and 9) plants treated (as described in Quiel and Bender, 2003) with water (1,4 and 7), SA (2,5 and 8) or ABA (3,6 and 9). Top panel, 74F2- specific probe; bottom panel, equal loading control (rRNA stained with EtBr).

Table 1 illustrates the activity of a glucosyltransferase encoded by the DNA of Figure 1 with respect to salicylic acid.

Materials and Methods Identification of GTase sequences The GTase sequence identification was carried out using GCG software (Wisconsin package, version 8.1). Blasta programme was used to search Arabidopsis protein sequences containing a PSPG (plant secondary product UDP-glucose glucosyltransferase) signature motif (Hughes and Hughes (1994) DNA Sequence 5, 41-49) in EMBL and sequence database.

Amplification and clonins of the GTase sequences The GTase sequences were amplified from Arabidopsis thaliana Columbia genomic DNA with specific primers following standard methodologies (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). 50ng of genomic DNA isolated from Arabidopsis thaliana Columbia were incubated with 1 x pfu PCR buffer (Stratagene), 250 1M dNTPS, 50 pmole primer for each end, and 5 units of pfu DNA polymerase (Stratagene) in a total of 100 ui The PCR reactions were carried out using standard methods used in the art.

After PCR amplification, the products were double digested by appropriate restriction enzymes. The digested DNA fragments were purified using an electro- elution method (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd <BR> <BR> Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and ligated into the corresponding cloning site on pGEX2T plasmid DNA (Pharmacia) by T4 DNA ligase (NEB) at 16°C overnight. The resulting recombinant plasmid DNA was amplified in E. coli XLl-blue cells and was confirmed with the restriction enzymes following the method described by Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2 Ed. , Cold Spring Habor Laboratory, Cold Spring Harbor, NY).

Preparation of glucosyltransferase recombinant proteins E. coli cells carrying recombinant plasmid DNA as described above were grown at 37°C overnight on 2YT (16 g bacto tryptone, 10 g bacto-yeast extract, 5 g NaCl per litre) agar (1. 8% w/v) plate which contained 50 pg/ml ampicillin. A single colony was picked into 2 ml of 2YT containing the same concentration of ampicillin. The bacterial culture was incubated at 37°C with moderate agitation for 6h. The bacterial culture was transferred into 1 L of 2YT and incubated at 20°C subsequently. 0.1 mM IPTG was added when the culture reached logarithmic growth phase (A 600 nm ~ 0 5) The bacterial culture was incubated for another 24 h. The cells were collected by a centrifugation at 7,000 x g for 5 min at 4°C and resuspended in 5 ml spheroblast buffer (0.5 mM EDTA, 750 mM sucrose, 200 mM Tris, pH 8.0). Lysozyme solution was added to a final concentration of 1 mg/ml. 7-fold volume of 0.5 x spheroblast buffer was poured into the suspension immediately and the suspension was incubated for 4°C for 30 min under gentle shaking. The spheroblasts were collected by a centrifugation at 12,000 x g for 5 min at 4°C, and resuspended in 5 ml ice cold PBL buffer (140 mM NaCl, 80 mM, NA2 HP04, 15 mM KH2PO4). 2 mM of PMSF was added into suspension immediately and the suspension was centrifuged at 12,000 x g for 20 min at 4°C in order to remove the cell debris. After the centrifugation, the supernatant was transferred to a 15 ml tube. 200 , l of 50% (v/v) slurry of

Glutathione-coupled Sepharose 4B were added into the tube and the mixture was mixed gently for 30 min at room temperature. The mixture was then centrifuged at a very slow speed (500 x g) for 1 min. the supernatant was discarded. The beads were washed with 5 ml ice cold PBS buffer three times. After each wash, a short centrifugation was applied as described above to sediment the Sepharose beads. To recover the expressed protein from Sepharose beads, 100 all of 20 mM reduced glutathione were used to resuspend the beads. After 10 min incubation at room temperature, the beads were collected and the supernatant containing the expressed protein was collected. The elution step was repeated once, and both supernatant fractions were combined and stored at 4°C for protein assay and further studies.

Protein concentration assay The protein assays were carried out by adding 10 jj. l of protein solution into 900 jul of distilled water and 200 1ll of Bio-Rad Protein Assay Dye. The absorbance at 595 nm was read. A series of BSA (bovine serium albumin) at different concentration was used as standard. Regression line was plotted based on the coordinates of the BSA concentration against the reading at 595 nm. The concentration of protein sample was therefore estimated from the regression line after the protein assay.

Hivh-Performance Liquid Chromatographic Reverse-phase HPLC was conducted using a standard HPLC machine in accordance with the manufactures instructions (Waters Separator 2690 and Waters Tunable Absorbance Detector 486, Waters Limited, Herts, UK) using a Columbus 5 p Cis column (250 x 4.60 mm, Phenomenex).

Assay for Glucosyltransferase Activity towards Benzoates Three different benzoate derivatives, i. e. 3,4-DHBA, 4-HBA and 2-HBA were included in the screen for glucosyltransferase activity. Each assay (200 p1) contained 1 pg of UGT, 1 mM hydroxybenzoate, 5 mM UDP-glucose, 1.4 mM 2-

mercaptoethanol and 50 mM TRIS-HC1, pH 7.0. The mix was incubated at 30 °C for 30 min. The reaction was stopped by the addition of 20 J. l oftrichloroacetic acid (240 mg/ml) and was analyzed by reverse-phase HPLC subsequently. The specific enzyme activity was expressed as nanomoles of substrate converted to its glucose conjugate per second (nkat) by 1 mg of protein in 30 min of reaction time. The data represent the mean of two independent experiments.''indicates activity not detected.

UGT74F1-and UGT74F2-RNAi vector construction: Both UGT74F1-and UGT74F2-RNAi constructs were made as follows: 1. The corresponding sequences (see below) were PCR amplified from genomic Arabidopsis thaliana DNA.

- 74F1 sequence (part of the open reading frame; underlined, part of the 3'UTR) TGGACTGATCAACCAATGAATGCAAAGTATATACAAGATGTATGGAAGG TTGGGGTTCGTGTGAAAGCAGAGAAAGAAAGTGGCATTTGCAAAAGAGA GGAGATTGAGTTTAGCATCAAGGAAGTGATGGAAGGAGAGAAGAGCAAA GAGATGAAAGAGAATGCGGGAAAATGGAGAGACTTGGCTGTGAAGTCAC TCAGTGAAGGAGGTTCTACAGATATCAACATTAACGAATTTGTATCAAAA ATTCA AATCAAATAAGTTAAGCACA TGATAAAGTA GC Primers used to amplify by PCR : Right hand : ccatcgatggtaccGCTACTTTATCATGTGCTTAACTTATTTG Left hand : ccggatccctcgagTGGACTGATCAACCAATGAAT 74F2 sequence (part of the open reading frame ; underlined, part of the 3'UTR) GATACATTTGTATCAAGGGTTCAGAGCAAATAGGTAACTCACATACAGTA GCAAAGGTCCTTCTATAATATCTTGTTTTGTACGTCTTTCATTCAGCATAA TCTTTTGTTGACTTTTCTTATGTTGTATGTTCAAATCCCCAT ATTGCTTCTT GTTGTAT Primers used to amplify by PCR: Right hand: ccatcgatggtacccATACAACAAGAAGCAATATGGG Left hand: ccggatccctcgagGATACATTTGTATCAAGGGTTCAGAG

The corresponding amplified DNA fragments were cloned into pHannibal vector to create the inverted-repeat (IR) necessary for silencing. The restriction enzymes used were: XhoIlKpnI for the sense insert and BamHI/ClaI for the antisense insert.

The NotI fragments (comprising the IR flanked by the CaMV35S promoter and the OCS terminator) from pHannibal-74Fl or pHannibal-74F2 were then cloned into the pART27 binary vector.

Both pART27-74FlIR (74F1-IR) and pART27-74F2IR (74F2-IR) were transformed into Agrobacterium (GV3101) and used to transform Arabidopsis plants by standard floral dipping methods.

Analysis of UGT74F1-and UGT74F2-RNAi construct specificity : 74F1-IR and 74F2-IR silencing sequence specificity was assessed by transient expression in Nicotiana benthamiana leaves according to Johanse and Carrington (2001). Figure 2 shows that expression of 74F1-IR or 74F2-IR prevents accumulation of 35S : 74F1 or 35S: 74F2 mRNAs.

Analysis of UGT74F1-and UGT74F2-RNAi transgenic plants: Arabidopsis transgenic plants were selected in medium containing kanamycin.

Different independent transgenic lines were analyzed for UGT74F2 mRNA accumulation in 10 days old seedlings under SA or ABA treatment. Figure 3 shows that 74F2 mRNA accumulates at lower levels in 74F1-or 74F2-IR transgenic plants compare to non-transgenic plants.

TABLE 1 UGT Group Specific activity (nkat/mg protein) 2-O-glc Glucose ester 74F1 L 5.79 74F2 L 0.10 1.04