LI HAODONG (US)
SOPPET DANIEL R (US)
LI HAODONG (US)
WO1994015965A1 | 1994-07-21 |
See also references of EP 0891372A4
1. | An isolated polynucleotide comprising a polynucleotide having at least a 75% identity to a member selected from the group consisting of : (a) a polynucleotide encoding a polypeptide comprising an amino acid sequence of SEQ ID NO:2; (b) a polynucleotide encoding a polypeptide comprising amino acid 1 to amino acid 348 sequence of SEQ ID NO:2; (c) a polynucleotide encoding a polypeptide comprising amino acid 235 to 348 of SEQ ID NO:2; (d) a polynucleotide which is complementary to the polynucleotide of (a) , (b) or (c) ,• and (e) a polynucleotide comprising at least 15 baseε of the polynucleotide of (a) , (b) , (c) or (d) . |
2. | The polynucleotide of Claim 1 wherein the polynucleotide is DNA. |
3. | The polynucleotide of Claim 1 wherein the polynucleotide is RNA. |
4. | The polynucleotide of Claim l wherein the polynucleotide is genomic DNA. |
5. | The polynucleotide of claim 1 compriεing nucleotide 1 to nucleotide 1213 of SEQ ID NO:l. |
6. | The polynucleotide of claim 1 comprising nucleotide 89 to nucleotide 1213 of SEQ ID NO:l. |
7. | The polynucleotide of claim 1 comprising nucleotide 791 to nucleotide 1213 of SEQ ID NO:l. |
8. | The polynucleotide of Claim 2 which encodes a polypeptide comprising amino acid 235 to 348 of SEQ ID NO:2. |
9. | An isolated polynucleotide comprising a polynucleotide having at least a 75% identity to a member selected from the group consisting of : (a) a polynucleotide encoding a mature polypeptide expresεed by human cDNA contained n ATCC Depoεit No. 97349; (b) a polynucleotide encoding a polypeptide expressed by human cDNA contained in ATCC Deposit No. 97349; (c) a polynucleotide which is complementary to the polynucleotide of (a) or (b) ,• and (d) a polynucleotide comprising at least 15 bases of the polynucleotide of (a) , (b) or (c) . |
10. | The isolated polynucleotide of claim 9 wherein said polynucleotide is the polynucleotide contained in ATCC Deposit No. 97349, which expresses mature HTTER36. |
11. | A vector comprising the DNA of Claim 2. |
12. | A host cell comprising the vector of Claim 11. |
13. | A process for producing a polypeptide comprising: expressing from the host cell of Claim 12 the polypeptide encoded by said DNA. |
14. | A process for producing a cell which expresses a polypeptide comprising introducing into the cell the vector of Claim 11. |
15. | A polypeptide compriεing a member selected from the group consisting of: (a) a polypeptide compriεing an amino acid εequence of SEQ ID NO:2 ; (b) a polypeptide comprising amino acid 1 to amino acid 348 of SEQ ID NO:2 (c) a polypeptide comprising amino acid 235 to amino acid 348 Of SEQ ID NO:2; and (d) a polypeptide which is at leaεt 70% identical to the polypeptide of (a) , (b) or (c) . |
16. | An antibody againεt the polypeptide of claim 15. |
17. | An antagonist againεt the polypeptide of claim 15. |
18. | An agonist to the polypeptide of claim 15. |
19. | The polypeptide of Claim 15 wherein the polypeptide compriεes amino acid 235 to amino acid 348 of SEQ ID NO:2. |
20. | A method for the treatment of a patient having need of HTTER36 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 15. |
21. | The method of Claim 20 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding εaid polypeptide and expreεsing εaid polypeptide in vivo . |
22. | A method for the treatment of a patient having need to inhibit HTTER36 compriεing: adminiεtering to the patient a therapeutically effective amount of the antagoniεt of claim 17. |
23. | A diagnoεtic process comprising: analyzing for the presence of the polypeptide of claim 15 in a sample derived from a host. |
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. The polypeptide of the present invention has been putatively identified as a human transforming growth factor. More particularly, the polypeptide of the present invention has been putatively identified as a member of the transforming growth factor Beta super-family and is sometimes hereafter referred to as "HTTER36". The invention also relates to inhibiting the action of such polypeptides.
This invention relates to a polynucleotide and polypeptide molecules which are structurally and functionally related to TGF-β. The transforming growth factor-beta family of peptide growth factors includes five members, termed TGF-βl through TGF-β5, all of which form homo-dimerε of approximately 25 kd. The TGF-β family belongs to a larger, extended super family of peptide signaling molecules that includes the Muellerian inhibiting substance (Cate, R. L. et al., Cell, 45:685-698 (1986)), decapentaplegic (Padgett, R. W. et al., Nature, 325:81-84 (1987)), bone morphogenic factors (Wozney, J. M. et al . , Science, 242:1528-1534 (1988)), vgl (Weeks, D. L., and Melton, D. A., Cell, 51:861-867 (1987)), activins (Vale, W. et al., Nature, 321:776-779 (1986)), and inhibins (Mason, A. J. et al., Nature, 318:659-663 (1985)) . These factors are similar to TGF-β in overall structure, but share only approximately 25% amino acid identity with the TGF-β proteins and with each other. All of these molecules are thought to play an important roles in
-ι-
modulating growth, development and differentiation. The protein of the present invention, PGF, retains the seven cysteine residues conserved in the C-terminal, active domain of TGF-/3.
TGF-β was originally described as a factor that induced normal rat kidney fibroblasts to proliferate in soft agar in the presence of epidermal growth factor (Roberts, A. B. et al., PNAS USA, 78:5339-5343 (1981)) . TGF-β has subsequently been shown to exert a number of different effects in a variety of cells. For example, TGF-β can inhibit the differentiation of certain cells of mesodermal origin (Florini, J. R. et al., J.Biol.Chem. , 261:1659- 16513 (1986)) , induced the differentiation of others (Seyedine, S. M. et al., PNAS USA, 82:2267-2271 (1985)), and potently inhibit proliferation of various types of epithelial cells, (Tucker, R. F., Science, 226:705-707 (1984)) . This last activity has lead to the speculation that one important physiologic role for TGF-β is to maintain the repressed growth state of many types of cells. Accordingly, cells that lose the ability to respond to TGF-β are more likely to exhibit uncontrolled growth and to become tumorigenic. Indeed, certain tumors such as retinoblastomas lack detectable TGF-β receptors at their cell surface and fail to respond to TGF-β, while their normal counterparts express self- surface receptors in their growth are potently inhibited by TGF-β (Kim Chi, A. et al . , Science, 240:196-198 (1988)) .
More specifically, TGF-βl stimulates the anchorage-independent growth of normal rat kidney fibroblasts (Robert et al., PNAS USA, 78:5339-5343 (1981)) . Since then it has been shown to be a multi¬ functional regulator of cell growth and differentiation (Sporn et al., Science, 233:532-534 (1986)) being capable of such diverse effects of inhibiting the growth of several human cancer cell lines (Roberts et al. , PNAS-USA, 82:119-123 (1985) ) , mouse keratinocytes, (Coffey et al., Cancer RES., 48:1596-1602 (1988)), and T and B lymphocytes (Kehrl et al., J.Exp.Med., 163:1037-1050 (1986)) . It also inhibits early hematopoietic progenitor cell proliferation (Goey et al. , J. Immunol., 143:877-880 (1989)) , stimulates the induction of differentiation of rat muscle mesenchymal cells and subsequent production of cartilage-specific macro molecules (Seyedine et al . , J.Biol . hem. , 262:1946-1949 (1986)), causes increased synthesis and secretion of collagen (Ignotz et al., J.Biol.Chem. , 261:4337-4345 (1986)) , stimulates bone formation
(Noda et al., Endocrinology, 124:2991-2995 (1989)), and accelerates the healing of incision wounds (Mustoe et al., Science, 237:1333- 1335 (1987)) .
Further, TGF-01 stimulates formation of extracellular matrix molecules in the liver and lung. When levels of TGF-j3l are higher than normal, formation of fiber occurs in the extracellular matrix of the liver and lung which can be fatal. High levels of TGF-βl occur due to chemotherapy and bone marrow transplant as an attempt to treat cancers, eg. breast cancer.
A second protein termed TGF-β2 was isolated from several sources including demineralized bone, a human prostatic adenocarcinoma cell line (Ikeda et al., Bio.Chem., 26:2406-2410 (1987) ) . TGF-β2 shared several functional similarities with TGF- βl. These proteins are now known to be members of a family of related growth modulatory proteins including TGF-β3 (Ten-Dijke et al., PNAS, USA, 85:471-4719 (1988)), Muellerian inhibitory substance and the inhibins. The polypeptide of the present invention haε been putatively identified as a member of this family of related growth modulatory proteins.
In accordance with one aspect of the present invention, there are provided novel mature polypeptides, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the polypeptides of the present invention, including mRNAs, cDNAs, genomic DNAs as well aε analogs and biologically active and diagnostically or therapeutically useful fragments thereof.
In accordance with another aspect of the present invention there is provided an isolated nucleic acid molecule encoding a mature polypeptide expressed by the human cDNA contained in ATCC Deposit No. 97349.
In accordance with yet a further aspect of the present invention, there are provided processes for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention.
In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to stimulate cellular growth and differentiation, stimulate bone formation and wound healing.
In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to nucleic acid sequences of the present invention.
In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.
In accordance with yet a further aspect of the present invention, there are provided agonists to the polypeptide of the present invention.
In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of, neoplasia of cells whose growth are stimulated by the polypeptide of the present invention and preventing formation of extracellular matrix molecules in the liver and lung.
In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to overexpression of the polypeptide of the present invention and mutations in the nucleic acid sequences encoding such polypeptide.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should be apparent to those εkilled in the art from the teachings herein.
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 depicts the cDNA sequence and corresponding deduced amino acid sequence of HTTER36. The standard one letter
abbreviations for amino acids are used. The putative signal sequence has been underlined.
Figure 2 is an illustration of comparative amino acid sequence homology between HTTER36 (top line) and Mus musculus putative transforming growth factor-beta, "GDF-3" (SEQ ID NO:9).
In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) .
The polynucleotide of this invention was discovered in a human testes tumor cDNA library. It is structurally related to the TGF/3 gene super-family. It contains an open reading frame encoding a polypeptide of 364 amino acids, of which the first 16 amino acids are a putative leader sequence, the next 234 amino acids are a pro¬ sequence and the last 114 amino acids are the active region. HTTER36 exhibits the highest degree of homology at the amino acid level to GDF-3 with 69% identity and 80% similarity.
The first 16 amino acids represent a putative transmembrane portion which is thought to be necessary to direct the polypeptide to particular target locations for the carrying out of biological functions as hereinafter described. The transmembrane portion may also be cleaved from the polypeptide.
In accordance with another aspect of the present invention there are provided iεolated polynucleotides encoding a mature polypeptide expressed by the human cDNA contained in ATCC Deposit No. 97349, deposited with the American Type Culture Collection, 12301 Park Lawn Drive, RockviUe, Maryland 20852, USA, on November 28, 1995. The deposited material is a pBluescript SK(+) plasmid that contains the full-length HTTER36 cDNA, referred to as "PF230" when deposited.
The deposit has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro¬ organisms for purposes of Patent Procedure. The strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the ammo acid sequence of the polypeptides
encoded thereby, are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted. References to "polynucleotides" throughout this specification includes the DNA of the deposit referred to above.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single- stranded, and if single stranded may be the coding strand or non- coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:l) or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:l) .
The polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID NO:2) may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non¬ coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) . The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1
(SEQ ID NO:2) . Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID N0:1) . As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains. Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence) .
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)) .
The term "gene" meanε the εegment of DNA involved in producing a polypeptide chain; it includes regions preceding and following
the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exonε) .
Fragments of the full length HTTER36 gene may be uεed as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 15 bases, more preferably at least 30 bases and even more preferably may contain, for example, at least 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete HTTER36 gene including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at leaεt 90%, and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditionε to the hereinabove-described polynucleotides. As herein used, the term "εtringent conditions" means hybridization will occur only if there ιε at least 95% and preferably at least 97% identity between the εequenceε. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the εame biological function or activity aε the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID NO:l) . Alternatively, the polynucleotide may have at least 15 bases, preferably at least 30 bases, and more preferably at least 50 baεes which hybridize to a polynucleotide of the preεent invention and which haε an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 and polynucleotides complementary thereto as well as portions thereof, which portions have at least 15 consecutive or preferably at least 30 consecutive bases and most preferably at least 50 consecutive bases and to polypeptides encoded by such polynucleotides.
The present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure l (SEQ ID NO:2) , as well as fragments, analogs and derivatives of such polypeptide.
The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID NO:2), means a polypeptide which retainε essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) may be (i) one in which one or more of the amino acid residueε are εubstituted with a conserved or non- conεerved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residueε includeε a εubstituent group, or (iii) one in which the mature polypeptide is fused with another compound, εuch aε a compound to increaεe the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acidε are uεed to the mature polypeptide, such aε a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid subεtitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full- length polypeptide by peptide synthesis,- therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be uεed to synthesize full-length polynucleotides of the present invention.
The present invention also relates to vectorε which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cellε can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expresεion, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expresεion vectors for expreεεing a polypeptide. Such vectorε include chromoεomal, nonchromoεomal and εynthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long aε it iε replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of thoεe εkilled in the art.
The DNA sequence in the expresεion vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA syntheεiε. Aε repreεentative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expresεion of genes in prokaryotic or eukaryotic cells or their viruεeε. The expreεεion vector alεo contains a ribosome binding site for tranεlation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.
In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli. Streptomyces. Salmonella typhimurium.- fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruseε; plant cellε, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly deεcribed above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inεerted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pblueεcript SK, pbsks, pNH8A, pNH16a, pNHlθA, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol tranεferaεe) vectorε or other vectorε with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the ar .
In a further embodimen , the present invention relates to host cells containing the above-described constructs. The host cell can
be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986) ) .
The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAε derived from the DNA conεtructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989) , the disclosure of which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenoviruε enhancerε.
Generally, recombinant expression vectors will include origins of replication and selectable markerε permitting tranεformation of the hoεt cell, e.g., the ampicillin reεiεtance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly- expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , α- factor, acid phosphatase, or heat shock proteins, among others. The heterologous εtructural εequence is aεsembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of
translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
Useful expresεion vectorε for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtiiiε, Salmonella typhimurium and various specieε within the genera Pεeudomonaε, Streptomyces, and Staphylococcus, although others may also be employed as. a matter of choice.
As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids compriεing genetic elements of the well known cloning vector pBR322 (ATCC 37017) . Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical meanε, and the resulting crude extract retained for further purification.
Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.
Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression
systemε include the COS-7 lineε of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necesεary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination εequences, and 5' flanking nontranscribed sequenceε. DNA εequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
The polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding εtepε can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniqueε from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non- glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.
The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics for human disease.
The specificity of HTTER36 for target cells can be exploited as a mechanism to destroy the target cell. For example, HTTER36 or soluble forms thereof can be coupled (by a wide variety of methods) to toxic molecules: for example, a radiopharmaceutical which inactivate target cells. These growth factor-toxin fusions kill the target cell (and in certain cases neighboring cells by a
variety of "byεtander" effects) . A recent example of such toxin- fuεion geneε is published by Mesri, et al., J. Biol. Chem. 268:4853-62 (1993). HTTER36 and soluble fragments thereof and related molecules may also be encapsulated in liposomes and may be conjugated to antibodies which recognize and bind to tumor or cell specific antigens, thereby provided a meanε for "targeting" cellε.
In this same manner, HTTER36 and soluble fragments thereof can be employed as an anti-neoplastic compound, since members of this family show anti-proliferative effects on transformed cells. For in vivo use, the subject polypeptide may be administered in a variety of wayε, including but not limited to, injection, infusion, topically, parenterally, etc. Administration may be in any physiologically acceptable carrier, including phosphate buffered saline, saline, sterilized water, etc.
A significant treatment involving HTTER36 and soluble fragments thereof relates to wound healing. The compositions of the present invention may be employed for treating a wide variety of wounds including substantially all cutaneous wounds, corneal wounds, and injuries to the epithelial-lined hollow organs of the body. Wounds suitable for treatment include those resulting from trauma such as burns, abrasions and cuts, as well as from surgical procedures such as surgical incisions and skin grafting. Other conditions suitable for treatment with the polypeptide of the present invention include chronic conditions, such as chronic ulcers, diabetic ulcers, and other non-healing (trophic) conditions.
HTTER36 and soluble fragments thereof may be incorporated in physiologically-acceptable carrierε for application to the affected area. The nature of the carriers may vary widely and will depend on the intended location of application. For application to the skin, a cream or ointment base is usually preferred; suitable bases include lanolin, Silvadene (Marion) (particularly for the treatment of burns) , Aquaphor (Duke Laboratories, South Norwalk, Conn.), and the like. If deεired, it will be poεsible to incorporate HTTER36 containing compositionε in bandageε and other wound dressings to provide for continuous exposure of the wound to the peptide. Aerosol applications may alεo find use.
The concentration of HTTER36 in the treatment composition iε not critical but should be enough to induce epithelial cell
proliferation. The compositions may be applied topically to the affected area, typically as eye drops to the eye or as creams, ointments or lotions to the skin. In the case of the eyes, frequent treatment is desirable, uεually being applied at intervals of 4 hours or less. On the skin, it is desirable to continually maintain the treatment composition on the affected area during the healing, with applications of the treatment composition from two to four times a day or more frequently.
The amount employed of the subject polypeptide will vary with the manner of administration, the employment of other active compounds, and the like, generally being in the range of about 1 μg to 100 μg . The subject polypeptide may be employed with a physiologically acceptable carrier, such as saline, phosphate- buffered saline, or the like. The amount of compound employed will be determined empirically, based on the response of cells in vitro and response of experimental animals to the subject polypeptides or formulations containing the subject polypeptides.
HTTER36 and soluble fragments thereof may be employed to stimulate the anchorage-independent growth of normal rat kidney fibroblasts.
HTTER36 and soluble fragment thereof may be employed aε a multi-functional regulator of cell growth and differentiation being capable of such diverse effectε of inhibiting the growth of several human cancer cell lines, and T and B lymphocytes
HTTER36 and soluble fragments thereof may also be employed to inhibit early hematopoietic progenitor cell proliferation, stimulates the induction of differentiation of rat muscle mesenchymal cells and stimulate production of cartilage-specific macro molecules, causing increased εynthesis and secretion of collagen.
HTTER36 and soluble fragments thereof may also be employed to stimulate bone formation.
This invention provides a method of screening compounds to identify antagonist compounds to the polypeptide of the present invention. As an example, a mammalian cell or membrane preparation expresεing a HTTER36 receptor is incubated with a potential compound and the ability of the compound to generate a εecond εignal from the receptor is measured to determine if it is an effective antagonist . Such second mesεenger syεtems include but
are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysiε. Effective antagoniεts are alεo determined by the method above wherein an antagonist compound is detected which binds to the receptor but does not elicit a second messenger response to thereby block the receptor from HTTER36.
Another assay for identifying potential antagonists specific to the receptors to the polypeptide of the present invention is a competition assay which comprises isolating plasma membranes which over-express a receptor to the polypeptide of the present invention, for example, human A431 carcinoma cells. Serially diluted test sample in a medium (volume is approximately 10 microliters) containing 10 nM 125 I-HTTER36 is added to five micrograms of the plasma membrane in the presence of the potential antagonist compound and incubated for 4 hours at 4°C. The reaction mixtures are diluted and immediately passed through a millipore filter. The filters are then rapidly washed and the bound radioactivity is measured in a gamma counter. The amount of bound HTTER36 is then measured. A control assay is also performed in the absence of the compound to determine if the antagonistε reduce the amount of bound HTTER36.
Potential antagonist compounds include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide. Alternatively, a potential antagonist may be a closely related protein which binds to the receptor which is an inactive forms of the polypeptide and thereby prevent the action of the polypeptide of the present invention.
Another antagonist compound is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methodε are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing transcription and the production of the
polypeptide of the present invention. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptide of the present invention (Antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)) . The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptide of the present invention.
Antagonist compounds include a small molecule which binds to the polypeptide of the present invention and blocks its action at the receptor such that normal biological activity is prevented. The small molecules may alεo bind the receptor to the polypeptide to prevent binding. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.
The antagonists may be employed to treat neoplasia, for example, cancers and tumors, in cells whose growth are stimulated by the polypeptide of the present invention.
The antagonists may also be employed to prevent the stimulation of formation of extracellular matrix molecules in the liver and lung.
The polypeptides of the present invention or antagonist compounds may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of adminiεtration.
The invention alεo provideε a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides or compounds of the present invention may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
The polypeptides, and antagonists which are polypeptides, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art and are apparent from the teachings herein. For example, cells may be engineered by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. For example, a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention.
Retroviruseε from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis viruε, retroviruεeε such aε Rouε Sarcoma virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunode iciency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
The vector includes one or more promoterε. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al. , Biotechniσues, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and /3-actin promoters) . Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoterε, εuch as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ; the β-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.
The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, -2 , ψ-AM, PA12, T19-14X, VT-19-17- H2, CRE , RIP , GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomeε, and CaP0 4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated
into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptideε. Such retroviral vector particleε then may be employed, to tranεduce eukaryotic cells, either in vi tro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
This invention is also related to the use of the gene of the present invention as a diagnostic. Detection of a mutated form of the gene of the preεent invention will allow a diagnoεis of a disease or a susceptibility to a disease which results from underexpression of the polypeptide of the present invention, for example, improper wound healing and improper neurological functioning.
Individuals carrying mutations in the human gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding a polypeptide of the present invention can be used to identify and analyze mutations thereof. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digeεtion or by differences in melting temperatures.
Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985)) .
Sequence changes at specific locations may also be revealed by nuclease protection asεays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985) ) .
Thuε, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes,
(e.g., Reεtriction Fragment Length Polymorphisms (RFLP)) and
Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in si tu analysis.
The present invention also relates to diagnostic assays for detecting altered levels of the polypeptide of the present invention in various tissues since an over-expression of the proteins compared to normal control tiεsue sampleε can detect the presence of certain diseaεe conditions such as neoplaεia, skin disorders, ocular disorders and inflammation. Assays used to detect levels of the polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art and include radioi munoassays, competitive-binding aεεays, Western Blot analysis and preferably an ELISA assay. An ELISA assay initially comprises preparing an antibody specific to an
antigen of the polypeptide of the present invention, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradiεh peroxidaεe enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides of the present invention attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase iε now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to polypeptides of the present invention. Unattached reporter antibody is then washed out. Peroxidaεe substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of protein present in a given volume of patient sample when compared against a standard curve.
A competition assay may also be employed to determine levels of the polypeptide of the present invention in a sample derived from the hosts. Such an assay comprises isolating plasma membranes which over-express the receptor for the polypeptide of the present invention. A test sample containing the polypeptides of the present invention which have been labeled, are then added to the plasma membranes and then incubated for a set period of time. Also added to the reaction mixture is a sample derived from a host which is suspected of containing the polypeptide of the present invention. The reaction mixtures are then passed through a filter which is rapidly washed and the bound radioactivity is then measured to determine the amount of competition for the receptors and therefore the amount of the polypeptides of the present invention in the sample.
Antibodies specific to HTTER36 may be used for cancer diagnosis and therapy, since many types of cancer cells up-regulate various members of this super family during the process of neoplasia or hyperplasia. These antibodies bind to and inactivate
HTTER36. Monoclonal antibodies against HTTER36 (and/or its family members) are in clinical use for both the diagnosis and therapy of certain disorders including (but not limited to) hyperplastic and neoplastic growth abnormalities. Upregulation of growth factor expression by neoplastic tissues forms the basis for a variety of serum asεayε which detect increaεeε in growth factor in the blood of affected patientε. These aεεayε are typically applied not only in diagnoεtic settings, but are applied in prognostic settings as well (to detect the preεence of occult tumor cells following surgery, chemotherapy, etc) .
In addition, malignant cells expressing the HTTER36 receptor may be detected by using labeled HTTER36 in a receptor binding assay, or by the use of antibodies to the HTTER36 receptor itself. Cells may be distinguiεhed in accordance with the presence and density of receptors for HTTER36, thereby providing a means for predicting the susceptibility of such cells to the biological activities of HTTER36.
The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating thoεe sequences with genes associated with disease.
Briefly, sequenceε can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysiε of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification procesε. Theεe primers are then used for PCR screening of somatic cell hybrids containing individual human chromoεomeε. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from specific chromosomeε or pools of large genomic clones in an analogouε manner. Other mapping strategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as εhort as 50 or 60 bases. For a review of this technique, see Verma et al. , Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes) .
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region asεociated with the disease could be one of between 50 and 500 potential causative genes. (This asεumeε l megabase mapping reεolution and one gene per 20 kb) .
The polypeptideε, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includeε chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptideε to an animal, preferably a nonhuman. The antibody εo obtained will then bind the polypeptideε itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodieε can then be uεed to iεolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al. , 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to expresε humanized antibodieε to immunogenic polypeptide productε of thiε invention.
The present invention will be further described with reference to the following examples,- however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmidε to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposeε, typically l μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plaεmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980) .
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T. , et al. , Id., p. 146) . Unlesε otherwise provided, ligation may be accomplished using known buffers and conditionε with 10 unitε of T4 DNA ligaεe ("ligaεe") per 0.5 μg of approximately equimolar amounts of the DNA fragmentε to be ligated.
Unless otherwise εtated, tranεformation waε performed as described in the method of Graham, F. and Van der Eb, A. , Virology, 52:456-457 (1973) .
Example 1 Bacterial Expresεion and Purification of mature HTTER36
The DNA sequence encoding HTTER36, ATCC # 97349, was initially amplified using PCR oligonucleotide primers corresponding to the 5' sequences of the processed HTTER36 protein and the vector sequences 3' to the HTTER36 gene. Additional nucleotides
corresponding to HTTER36 were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' GAAAGGATCCGCAGCCATCCCTGTCCCCAAAL rrC rGT 3' (SEQ ID NO:3) contains a BamHI restriction enzyme site (in bold) followed by 18 nucleotides of HTTER36 coding sequence starting from nucleotide 791 of Figure 1 (SEQ ID N0:1) . The 3' sequence 5' TCCTTCTATTCAAGCTTCTG ACATCCTACCCACACCCACA 3' (SEQ ID NO:4) contains complementary sequences to a Hind III site and is followed by 15 nucleotides of HTTER36 beginning at nucleotide 1121, and a stop codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA, 91311) . pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6-His tag and restriction enzyme sites. pQE-9 was then digested with BamHI and Hind III. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform E. coli strain DH5 alpha (Gibco BRL) the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) . Transformants were identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture was used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expresεion. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized HTTER36 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al. , J. Chromatography 411:177-184 (1984)) . HTTER36 (85 % pure) was eluted from the
column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 molar glutathione (reduced) and 2 molar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 molar sodium phosphate.
Example 2 Cloning and expresεion HTTER36 using the baculovirus expression system
The DNA sequence encoding the HTTER36 protein, ATCC # 97349, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
The primers used are:
5' CIAGGGATCCGCCIATCATGCTTCGTTTCTTGCCAGA 3' (SEQ ID NO:5) contains the underlined Bam HI site an efficient signal for the initiation of translation in eukaryotic cells, a start codon (bold) and 17 bps of HTTER36 coding sequence. The 3' primer has the sequence 5' CTTCGGTACCC-ATTTCTGACATCCTACCCACAC 3' (SEQ ID NO:6) contains the underlined Asp7l8 site, and 23 nucleotides complementary to the 3' end of the HTTER36 sequence beginning at nucleotide 1126.
The amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) . The fragment is then digested with the endonucleases BamHI and Asp718 and then purified again on a 1% agarose gel. This fragment iε deεignated F2.
The vector pA2 is uεed (modification of pVL941 vector, diεcuεεed below) for the expression of the HTTER36 protein using the baculovirus expreεsion εystem (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) . This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis viruε (AcMNPV) followed by the recognition sites for the restriction endonucleaεeε. The polyadenylation εite of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidaεe gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin
gene. The polyhedrin sequenceε are flanked at both εides by viral εequences for the cell-mediated homologous recombination of co¬ transfected wild-type viral DNA. Many other baculovirus vectors could be used such as pAc373, pRGl, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39) .
The plasmid is digested with the restriction enzymes BamHI and Asp718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBacHTTER36) with the HTTER36 gene using the restriction enzymes BamHI and Aεp7l8. The sequence of the cloned fragment is confirmed by DNA sequencing.
5 μg of the plasmid pBacHTTER36 is co-transfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417
(1987)) . lμg of BaculoGold™ virus DNA and 5 μg of the plasmid pBacHTTER36 are mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwards 10 μl Lipofectin plus 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27°C. After 5 hours the transfection solution is removed from the plate and l ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation continued at 27°C for four days.
After four dayε the εupernatant is collected and a plaque assay performed similar aε deεcribed by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc. , Gaithersburg, page 9-10) .
Four days after the serial dilution, the virus is added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuεpended in an Eppendorf tube containing 200 μl of Grace'ε medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supematants of these culture dishes are harvested and then stored at 4°C.
Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-HTTER36 at a multiplicity of infection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg) . 42 hours later 5 μCi of 35 S-methionine and 5 μCi 3S S cysteine (Amersham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
Example 3 Expression of recomb ant HTTER36 n CHO cells
The vector pCl is used for the expression of the HTTER36 protein. Plasmid pCl s a derivative of the plasmid pSV2-dhfr
[ATCC Accession No. 371461 Both plasmids contain the mouse dhfr gene under control of the SV40 early promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Lift Technologies) supplemented with the chemotherapeutic agent methotrexate. The amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F.W., Kellems,
R.M., Bert o, J.R., and Schimke, R.T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M.J. and Sydenham, M.A. 1991,
Biotechnology Vol. 9:64-68). Cells grown in increasing concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of amplification of the DHFR gene. If a second gene is linked to the dhfr gene it is usually co-amplified and over-expreεεed. It is state of the art to develop cell lines carrying more than 1,000 copies of the genes. Subsequently, when the methotrexate is withdrawn, cell lines contain the amplified gene integrated into the chromosome (s) .
Plasmid pN346 contains for the expression of the gene of interest a strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology, March 1985, 438-447) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530, 1985) . Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI, Pvull, and Nrul . Behind these cloning sites the plasmid contains translational stop codons in all three reading frames followed by the 3 ' intron and the polyadenylation site of the rat preproinsulin gene. Other high efficient promoters can also be used for the expression, e.g., the human β-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g. , HIV and HTLVI. For the polyadenylation of the mRNA other signals, e.g., from the human growth hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated into the chromosome can also be selected upon co-transfection with a selectable marker such as gpt , G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g. G418 plus methotrexate.
The plasmid pN346 waε digested with the restriction enzyme BamHI and then dephosphorylated uεing calf intestinal phosphatase by procedures known in the art . The vector was then isolated from a 1% agarose gel.
The DNA sequence encoding HTTER36, ATCC # 97349 was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
The 5 ' primer has the sequence 5 ' ACAGCGGATCCAGCCACC ATCCTTCGTTTCTTGCCA 3' (SEQ ID NO: 7) and contains a BamHI restriction enzyme site (in bold) followed by an efficient signal for translation (Kozak, M., supra) plus the first 18 nucleotides
of the gene (the initiation codon for translation "ATG" is underlined) .
The 3' primer has the sequence 5' TCCTTCGGATCCCATTTCT GACATCCTACCCACACCCACA 3' (SEQ ID NO:8) and contains the cleavage site for the restriction endonuclease BamHI and 29 nucleotides complementary to the 3' translated and non-translated sequence of the gene.
The amplified fragments were isolated from a 1% agarose gel as described above and then digested with the endonuclease Bglll and then purified again on a 1% agarose gel.
The isolated fragment and the dephosphorylated vector were then ligated with T4 DNA ligase. E.coli HB101 cells were then tranεformed and bacteria identified that contained the plasmid pN346 inserted in the correct orientation using the restriction enzyme BamHI. The sequence of the inserted gene was confirmed by DNA sequencing.
Transfection of CHO-dhfr-cells
Chinese hamster ovary cells lacking an active DHFR enzyme were used for transfection. 5 μg of the expression plasmid N346 were cotransfected with 0.5 μg of the plasmid pSVneo using the lipofectin method (Feigner et al., supra) . The plasmid pSV2-neo contains a dominant selectable marker, the gene neo from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418. The cells were seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells were tryps ized and seeded in hybridoma cloning plates (Greiner, Germany) and cultivated from 10-14 days. After this period, single clones were trypsmized and then seeded in 6-well petri dishes using different concentrations of methotrexate (25, 50 nm, 100 nm, 200 nm, 400 nm) . Clones growing at the highest concentrations of methotrexate were then transferred to new 6-well plates containing even higher concentrations of methotrexate (500 nM, 1 μM, 2 μM, 5 μM) . The same procedure was repeated until cloneε grew at a concentration of 100 μM.
The expression of the desired gene product was analyzed by Western blot analysis and SDS-PAGE.
Example 4
Expression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tisεue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks. pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, iε digested with EcoRI and Hindlll and εubsequently treated with calf inteεtinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer containing an EcoRI site and the 3' primer further includes a Hindlll site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectiouε viral particleε
containing the gene (the packaging cellε are now referred to as producer cells) .
Fresh media is added to the transduced producer cells, and subsequently, the media iε harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media iε then uεed to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblastε and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that haε a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variationε of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: SOPPET, DANIEL (ii) TITLE OF INVENTION: GROWTH FACTOR HTTER36 (iii) NUMBER OF SEQUENCES: 9
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI,
STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068-1739
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US
(B) FILING DATE:
(C) CLASSIFICATION:
(vii..) ATTORNEY/AGENT INFORMATION.
(A) NAME: Ferraro, Gregory D
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-513
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO: 1 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1212 base pairs
(B) TYPE nucleic acid
(C) STRANDEDNESS single
(D) TOPOLOGY linear
(ii) MOLECULE TYPE DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY- CDS
(B) LOCATION: 41 1132
(xi) SEQUENCE DESCRIPTION. SEQ ID NO:1 :
AATTCGGCAC GAGCCCGGTC TGACAGCCAC TCCAGAGGCC ATG CTT CGT TTC TTG 55
Met Leu Arg Phe Leu 1 5
CCA GAT TTG GCT TTC AGC TTC CTG TTA ATT CTG GCT TTG GGC CAG GCA 103 Pro Asp Leu Ala Phe Ser Phe Leu Leu Ile Leu Ala Leu Gly Gin Ala 10 15 20
GTC CAA TTT CAA GAA TAT GTC TTT CTC CAA TTT CTG GGC TTA GAT AAG 151 Val Gin Phe Gin Glu Tyr Val Phe Leu Gin Phe Leu Gly Leu Asp Lys 25 30 35
GCG CCT TCA CCC CAG AAG TTC CAA CCT GTG CCT TAT ATC TTG AAG AAA 199 Ala Pro Ser Pro Gin Lys Phe Gin Pro Val Pro Tyr Ile Leu Lys Lys 40 45 50
ATT TTC CAG GAT CGC GAG GCA GCA GCG ACC ACT GGG GTC TCC CGA GAC 247 Ile Phe Gin Asp Arg Glu Ala Ala Ala Thr Thr Gly Val Ser Arg Asp 55 60 65
TTA TGC TAC GTA AAG GAG CTG GGC GTC CGC GGG AAT GTA CTT CGC TTT 295 Leu Cys Tyr Val Lys Glu Leu Gly Val Arg Gly Asn Val Leu Arg Phe 70 75 80 85
CTC CCA GAC CAA GGT TTC TTT CTT TAC CCA AAG AAA ATT TCC CAA GCT 343 Leu Pro Asp Gin Gly Phe Phe Leu Tyr Pro Lys Lys Ile Ser Gin Ala 90 95 100
TCC TCC TGC CTG CAG AAG CTC CTC TAC TTT AAC CTG TCT GCC ATC AAA 391 Ser Ser Cys Leu Gin Lys Leu Leu Tyr Phe Asn Leu Ser Ala Ile Lys 105 110 115
GAA AGG GAA CAG TTG ACA TTG GCC CAG CTG GGC CTG GAC TTG GGG CCC 439 Glu Arg Glu Gin Leu Thr Leu Ala Gin Leu Gly Leu Asp Leu Gly Pro 120 125 130
AAT TCT TAC TAT AAC CTG GGA CCA GAG CTG GAA CTG GCT CTG TTC CTG 487 Asn Ser Tyr Tyr Asn Leu Gly Pro Glu Leu Glu Leu Ala Leu Phe Leu 135 140 145
GTT CAG GAG CCT CAT GTG TGG GGC CAG ACC ACC CCT AAG CCA GGT AAA 535 Val Gin Glu Pro His Val Trp Gly Gin Thr Thr Pro Lys Pro Gly Lys 150 155 160 165
ATG TTT GTG TTG CGG TCA GTC CCA TGG CCA CAA GGT GCT GTT CAC TTC 583 Met Phe Val Leu Arg Ser Val Pro Trp Pro Gin Gly Ala Val His Phe 170 175 180
AAC CTG CTG GAT GTA GCT AAG GAT TGG AAT GAC AAC CCC CGG AAA AAT 631 Asn Leu Leu Asp Val Ala Lys Asp Trp Asn Asp Asn Pro Arg Lys Asn 185 190 195
TTC GGG TTA TTC CTG GAG ATA CTG GTC AAA GAA GAT AGA GAC TCA GGG 679 Phe Gly Leu Phe Leu Glu Ile Leu Val Lys Glu Asp Arg Asp Ser Gly 200 205 210
GTG AAT TTT CAG CCT GAA GAC ACC TGT GCC AGA CTA AGA TGC TCC CTT 727 Val Asn Phe Gin Pro Glu Asp Thr Cys Ala Arg Leu Arg Cys Ser Leu 215 220 225
CAT GCT TCC CTG CTG GTG GTG ACT CTC AAC CCT GAT CAG TGC CAC CCT 775 His Ala Ser Leu Leu Val Val Thr Leu Asn Pro Asp Gin Cys His Pro 230 235 240 245
TCT CGG AAA AGG AGA GCA GCC ATC CCT GTC CCC AAG CTT TCT TGT AAG 823 Ser Arg Lys Arg Arg Ala Ala lie Pro Val Pro Lys Leu Ser Cys Lys 250 255 260
AAC CTC TGC CAC CGT CAC CAG CTA TTC ATT AAC TTC CGG GAC CTG GGT 871 Asn Leu Cys His Arg His Gin Leu Phe Ile Asn Phe Arg Asp Leu Gly 265 270 275
TGG CAC AAG TGG ATC ATT GCC CCC AAG GGG TTC ATG GCA AAT TAC TGC 919 Trp His Lys Trp Ile Ile Ala Pro Lys Gly Phe Met Ala Asn Tyr Cys 280 285 290
CAT GGA GAG TGT CCC TTC TCA CTG ACC ATC TCT CTC AAC AGG TCC AAT 967 His Gly Glu Cys Pro Phe Ser Leu Thr Ile Ser Leu Asn Arg Ser Asn 295 300 305
TAT GCT TTC ATG CAA GCC CTG ATG CAT GCC GTT GAC CCA GAG ATC CCC 1015 Tyr Ala Phe Met Gin Ala Leu Met His Ala Val Asp Pro Glu Ile Pro
310 315 320 325
CAG GCT GTG TGT ATC CCC ACC AAG CTG TCT CCC ATT TCC ATG CTC TAC 1063 Gin Ala Val Cys Ile Pro Thr Lys Leu Ser Pro Ile Ser Met Leu Tyr 330 335 340
CAG GAC AAT AAT GAC AAT GTC ATT CTA CGA CAT TAT GAA GAC ATG GTA 1111 Gin Asp Asn Asn Asp Asn Val Ile Leu Arg His Tyr Glu Asp Met Val 345 350 355
GTC GAT GAA TGT GGG TGT GGG TAGGATGTCA GAAATGGGAA TAGAAGGAGT 1162
Val Asp Glu Cys Gly Cys Gly 360
GTTCTTAGGG TAAACTTTTA ATAAAACTAC CTAGCTGGTT TATGCCCAAA 1212
(2) INFORMATION FOR SEQ ID NO:2 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 364 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Leu Arg Phe Leu Pro Asp Leu Ala Phe Ser Phe Leu Leu Ile Leu 1 5 10 15
Ala Leu Gly Gin Ala Val Gin Phe Gin Glu Tyr Val Phe Leu Gin Phe 20 25 30
Leu Gly Leu Asp Lys Ala Pro Ser Pro Gin Lys Phe Gin Pro Val Pro 35 40 45
Tyr Ile Leu Lys Lys Ile Phe Gin Asp Arg Glu Ala Ala Ala Thr Thr 50 55 60
Gly Val Ser Arg Asp Leu Cys Tyr Val Lys Glu Leu Gly Val Arg Gly 65 70 75 80
Asn Val Leu Arg Phe Leu Pro Asp Gin Gly Phe Phe Leu Tyr Pro Lys 85 90 95
Lys Ile Ser Gin Ala Ser Ser Cys Leu Gin Lys Leu Leu Tyr Phe Asn 100 105 110
Leu Ser Ala Ile Lys Glu Arg Glu Gin Leu Thr Leu Ala Gin Leu Gly 115 120 125
Leu Asp Leu Gly Pro Asn Ser Tyr Tyr Asn Leu Gly Pro Glu Leu Glu 130 135 140
Leu Ala Leu Phe Leu Val Gin Glu Pro His Val Trp Gly Gin Thr Thr 145 150 155 160
Pro Lys Pro Gly Lys Met Phe Val Leu Arg Ser Val Pro Trp Pro Gin 165 170 175
Gly Ala Val His Phe Asn Leu Leu Asp Val Ala Lys Asp Trp Asn Asp 180 185 190
Asn Pro Arg Lys Asn Phe Gly Leu Phe Leu Glu Ile Leu Val Lys Glu 195 200 205
Asp Arg Asp Ser Gly Val Asn Phe Gin Pro Glu Asp Thr Cys Ala Arg 210 215 220
Leu Arg Cys Ser Leu His Ala Ser Leu Leu Val Val Thr Leu Asn Pro 225 230 235 240
Asp Gin Cys His Pro Ser Arg Lys Arg Arg Ala Ala Ile Pro Val Pro 245 250 255
Lys Leu Ser Cys Lys Asn Leu Cys His Arg His Gin Leu Phe Ile Asn 260 265 270
Phe Arg Asp Leu Gly Trp His Lys Trp Ile Ile Ala Pro Lys Gly Phe 275 280 285
Met Ala Asn Tyr Cys His Gly Glu Cys Pro Phe Ser Leu Thr Ile Ser 290 295 300
Leu Asn Arg Ser Asn Tyr Ala Phe Met Gin Ala Leu Met His Ala Val 305 310 315 320
Asp Pro Glu Ile Pro Gin Ala Val Cys Ile Pro Thr Lys Leu Ser Pro 325 330 335
Ile Ser Met Leu Tyr Gin Asp Asn Asn Asp Asn Val Ile Leu Arg His 340 345 350
Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys Gly 355 360
(2) INFORMATION FOR SEQ ID NO-.3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GAAAGGATCC GCAGCCATCC CTGTCCCCAA ACTTTCTTGT 40
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS :
(A) LENGTH- 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: TCCTTCTATT CAAGCTTCTG ACATCCTACC CACACCCACA 40
(2) INFORMATION FOR SEQ ID NO:5 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5 : CAGGGATCCG CCATCATGCT TCGTTTCTTG CCAGA 35
(2) INFORMATION FOR SEQ ID NO:6 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6 : CTTCGGTACC CATTTCTGAC ATCCTACCCA CAC 33
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7 : ACAGCGGATC CAGCCACCAT GCTTCGTTTC TTGCCA 36
(2) INFORMATION FOR SEQ ID NO:8 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION- SEQ ID NO:8 : TCCTTCGGAT CCCATTTCTG ACATCCTACC CACACCCACA 40
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 366 ammo acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 :
Met Gin Pro Tyr Gin Arg Leu Leu Ala Leu Gly Phe Leu Leu Leu Thr 1 5 10 15
Leu Pro Trp Gly Gin Thr Ser Glu Phe Gin Asp Ser Asp Leu Leu Gin 20 25 30
Phe Leu Gly Leu Glu Lys Ala Pro Ser Pro His Arg Phe Gin Pro Val 35 40 45
Pro Arg Val Leu Arg Lys Ile Ile Arg Ala Arg Glu Ala Ala Ala Ala 50 55 60
Ser Gly Ala Ser Gin Asp Leu Cys Tyr Val Lys Glu Leu Gly Val Arg 65 70 75 80
Gly Asn Leu Leu Gin Leu Leu Pro Asp Gin Gly Phe Phe Leu Asn Thr 85 90 95
Gin Lys Pro Phe Gin Asp Gly Ser Cys Leu Gin Lys Val Leu Tyr Phe 100 105 110
Asn Leu Ser Ala Ile Lys Glu Lys Ala Lys Leu Thr Met Ala Gin Leu 115 120 125
Thr Leu Asp Leu Gly Pro Arg Ser Tyr Tyr Asn Leu Arg Pro Glu Leu 130 135 140
Val Val Ala Leu Ser Val Val Gin Asp Arg Gly Val Trp Gly Arg Ser 145 150 155 160
His Pro Lys Val Gly Arg Leu Leu Phe Leu Arg Ser Val Pro Gly Pro 165 170 175
Gin Gly Gin Leu Gin Phe Asn Leu Gin Gly Ala Leu Lys Asp Trp Ser 180 185 190
Ser Asn Arg Leu Lys Asn Leu Asp Leu His Leu Glu Ile Leu Val Lys 195 200 205
Glu Asp Arg Tyr Ser Arg Val Thr Val Gin Pro Glu Asn Pro Cys Asp 210 215 220
Pro Leu Leu Arg Ser Leu His Ala Ser Leu Leu Val Val Thr Leu Asn 225 230 235 240
Pro Lys His Cys His Pro Ser Ser Arg Lys Arg Arg Ala Ala Ile Ser 245 250 255
Val Pro Lys Gly Phe Cys Arg Asn Phe Cys His Arg His Gin Leu Phe 260 265 270
Ile Asn Phe Gin Asp Leu Gly Trp His Lys Trp Val Ile Ala Pro Lys 275 280 285
Gly Phe Met Ala Asn Tyr Cys His Gly Glu Cys Pro Phe Ser Met Thr 290 295 300
Thr Tyr Leu Asn Ser Ser Asn Tyr Ala Phe Met Gin Ala Leu Met His 305 310 315 320
Met Ala Asp Pro Lys Val Pro Lys Ala Val Cys Val Pro Thr Lys Leu 325 330 335
Ser Pro Ile Ser Met Leu Tyr Gin Asp Ser Asp Lys Asn Val Ile Leu 340 345 350
Arg His Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys Gly 355 360 365
Next Patent: DETECTING BLADDER CANCER BY TELOMERASE ACTIVITY