AND TREATMENT OF COVID-19

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Application No. 63/107,641 filed on October 30, 2020, the disclosure of which is incorporated herein by reference.

SUMMARY

[0002] Embodiments herein are directed to a SARS-CoV-2 vaccine comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence

TCATCATTTTGTCATTTTGTCATT (SEQ ID NO.l).

[0003] In some embodiments, the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow-release delivery vehicle. Some embodiments further comprise a pharmaceutically acceptable carrier. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS- CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg. In some embodiments, the at least one SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.

[0004] Some embodiments are directed to a pharmaceutical composition comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence

TCATCATTTTGTCATTTTGTCATT (SEQ ID NO.l) and a pharmaceutically acceptable carrier. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.

[0005] Some embodiments are directed to a method of vaccination of a subject comprising administering to a subject an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence

TCATCATTTTGTCATTTTGTCATT (SEQ ID NO.l).

In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered to the subject by intramuscular, subcutaneous, or intradermal injection at the same site. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered by the oral, intranasal, anal, vaginal, transdermal, or mucosal route. In some embodiments, the subject is a human. In some embodiments, the subject is a human greater than 18 years of age. In some embodiments, the subject is a human less than 18 years of age. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow- release delivery vehicle. In some embodiments, the effective amount is effective for treating, preventing, or ameliorating COVID-19 in the subject. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered contemporaneously or simultaneously. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the least one recombinant SARS-CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, at least one SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.

BRIEF DESCRIPTION OF THE FIGURES

[0006] FIG.1 depicts a schematic representation of the mechanism of action of IMT504.

[0007] FIG. 2 shows that IMT504 generates rapid and robust immune responses in other vaccines.

[0008] FIG 3. depicts structural insights for SARS-CoV-2 vaccine design.

[0009] FIG. 4 depicts virus neutralizing titers (VNT) with NidoVax Vaccine Constructs. (A) There were no significant VNTs when rats were immunized with the antigens without adjuvant (60 micrograms (mcg)). (B) Rats immunized with RBD2, S1+S2 and SI antigens (15 mcg) with IMT504 adjuvant resulted in significant neutralizing antibody responses. RBD219N (SARS-CoV) and S2 did not result in significant neutralizing antibody responses. Geometric Mean Titers: RBD2=1810.2, Sl+S2=4305.4, Sl=1076.3 (C) Rats immunized with RBD2, S1+S2 and SI antigens (60 mcg) with IMT504 adjuvant resulted in significant neutralizing antibody responses. RBD219N and S2 did not result in significant VNTs. Geometric Mean Titers: RBD2=320, Sl+S2=7240.8, Sl=1076.3. Log transformed (Log2) VNTs were expressed on the y-axis, with vaccine groups on the x-axis. Tukey’s multiple comparison test was performed to compute the variance among the groups (***:p<.001; ****: p< 0001).

[0010] FIG. 5 depicts comparison of 15 mcg and 60 mcg doses of NidoVax vaccines. There were no significant differences (t-test) in VNTs between the 15 mcg and 60 mcg doses, for RBD2, S1+S2 and SI antigens, when immunized with IMT504 adjuvant. This suggests that a lower dose of 15 mcg is sufficient to induce the necessary neutralizing antibody responses. Log transformed (Log2) virus neutralization titers were expressed on the y-axis, with the vaccine groups on the x-axis.

SEQUENCE LISTING

The nucleotide sequences listed in the accompanying sequence listing are shown using standard one letter code for nucleotides, as defined in 37 C.F.R. 1.822. The Sequence Listing is submitted as an ASCII text file created on October 28, 2021, which is incorporated by reference herein.

DETAILED DESCRIPTION

[0011] Some embodiments herein are directed to a ready-to-use, rapid-response coronavirus vaccine for single dose protection and antigen sparing. Some embodiments make use of IMT504, an immunomodulatory adjuvant. In some embodiments, IMT504 engenders rapid immune protection after one dose, allows for antigen (dose) sparing, has an excellent safety profile, rapidly induces a robust antibody response in elder animals, and can be made in a cost-effective manner. Given the urgent need for an effective and safe vaccine to combat COVID-19, the properties exhibited by IMT504 are ideal for vaccines targeting SARS-CoV-2.

[0012] Some embodiments are directed to safe COVID- 19 vaccine formulations that offer single dose, rapid response protection and significant dose sparing. In some embodiments, vaccines are built on an adjuvant system that is an immunomodulatory oligonucleotide (IMT504). In some embodiments, the adjuvant that directly activates B cells to increase cytokine production and antibody production, maturation, and diversity, as well as increase B cells’ antigen-presenting abilities. In some embodiments, IMT504 also has additional effects on the immune system, including activating CD4+ and CD8+ T cells and natural killer cells.

[0013] In some embodiments, direct protective antibodies are produced within 21 days following a single dose. In some embodiments, subjects receiving IMT504-based vaccination have higher antibody titers when compared to subjects receiving unadj uv anted vaccine. In some embodiments, IMT504 allows for significant antigen (dose) sparing (reducing cost/dose), while also affording protective antibody levels. In some embodiments, IMT504 is relatively easy to produce under GMP conditions using a rapid automatic process that is economically scalable, and large quantities can be produced at a reasonable cost. In some embodiments, IMT504 is stable with a shelf-life of at least 24 months. [0014] In some embodiments, the vaccine targets SARS-CoV-2. In some embodiments, the vaccine antigen is the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), or a combination thereof. In some embodiments the vaccine antigen is selected from RBD2, S1+S2 and SI antigens.

[0015] Some embodiments are directed to methods of preventing COVID-19 via vaccination comprising administering to a subject a recombinant SARS-CoV-2 antigen and IMT504. In some embodiments, the combination of recombinant SARS-CoV-2 antigen and IMT504 is administered to the subject once. In yet other embodiments, the combination of recombinant SARS-CoV-2 antigen and IMT504 may be administered two or more times. In some embodiments, administering to a subject a recombinant SARS-CoV-2 antigen and IMT504 produces a potent, safe antibody response by combining a recombinant SARS- CoV- 2 antigen with IMT504 adjuvant. In some embodiments, IMT504 works by directly acting on B cells to stimulate an antibody response. In some embodiments, the methods described herein are antigen (dose) sparing. In some embodiment, the methods described herein do not result in toxicity in the subject. In some embodiments, the methods described herein rapidly induce robust antibody response in older adults who are at most risk in this pandemic. In some embodiments, the combination of SARS-CoV-2 antigen and IMT504 and can be made in a cost-effective manner.

[0016] In some embodiments, antigen dosing is between about 15 mcg and about 300 mcg. In some embodiments, the dose of IMT504 is about 1 mg. In some embodiments, the dose of IMT504 is between about 1 mcg and 1 g. In some embodiments, the dose of IMT504 is between about 1 mcg and about 1 mg. In some embodiments, the dose of IMT504 is between about 1 mg and 1 g. In some embodiments, the dose of IMT504 is between about 1 mg and lOOmg. In some embodiments, the dose of IMT504 is between about 1 mg and 10 mg.

[0017] In some embodiments, the subject is a human. In some embodiments, the subject is a human greater than 18 years of age. In some embodiments, the subject is a human less than 18 years of age.

[0018] In some embodiments, IMT504 safely and effectively stimulates the host immune system. IMT504 (5’-TCATCATTTTGTCATTTTGTCATT-3’(SEQ ID NO.l)) is a modified single-strand piece of DNA (oligonucleotide or oligodeoxynucleotide, ODN) that directly binds to B cells to stimulate the production of potent antibodies. Immunomodulatory ODNs fall into two classes - CpG ODNs and non-CpG PyNTTTTGT ODNs. The CpG and PyNTTTTGT ODNs differ in their active sites; CpG ODNs contain at least one active site with an unmethylated CpG in a given sequence, while the PyNTTTTGT ODNs have at least one active site with the sequence (C/T)(A/T/C/G)TTTTGT15. Both kinds of ODNs can act on B cells and plasmacytoid dendritic cells, but differ in effects. Unlike CpG ODNs, PyNTTTTGT ODNs do not induce interferon (IFN) a secretion but do induce IFNy and granulocyte macrophage-colony stimulating factor (GM-CSF) secretion in the presence of interleukin (IL) 2, and have the ability to stimulate mesenchymal stem cell (MSC) precursor expansion.

[0019] IMT504 is a PyNTTTTGT ODN with a novel mechanism of action (See FIG. 1). IMT504 has been shown to directly activate B cells to increase cytokine production and antibody production, maturation, and diversity, as well as increase B cells’ antigen-presenting abilities. IMT504 has additional effects on the immune system, including activating CD4+ and CD8+ T cells and natural killer (NK) cells. IMT504 also activates activation-induced cytidine deaminase (AID). Additionally, IMT504 is not a Toll-like Receptor (TLR) agonist, but, instead, works through an entirely different receptor system that bypasses the toxic issues often seen with TLR agonists. IMT504 has been studied in other indications, especially rabies and Pseudomonas aeruginosa infection, and has been studied in 11 different species, including humans. In every case, IMT504 has been well-tolerated and effective and there has never been any indication of cytokine storm. Importantly, IMT504 has been administered in compassionate usage cases for a few advanced human cancer patients (melanoma, ovarian cancer, lymphoma). No serious adverse events (SAEs) occurred, even with the administration of very large amounts of IMT504 (e.g., one patient’s total IMT504 exposure exceeded 700 mg) for durations ranging from months to years. IMT504 was also successfully used in human volunteers as a vaccine adjuvant with a rabies vaccine, again showing an excellent safety profile and robust immune response. Five volunteers received 3 doses of 1 mg IMT504 via intramuscular injection mixed with rabies vaccine (Montaner et al., 2012) resulting in a robust, well tolerated immune response. To date, in the small number of human patients studied, IMT504 has been well-tolerated, even at very high doses, much greater than that proposed for treating infectious diseases.

[0020] Some embodiments are directed to vaccine formulations. In some embodiments, vaccine formulations may consist of different concentrations of IMT504 and different dilutions of the recombinant proteins to optimize the response, compared to non-adjuvanted vaccine. In some embodiments, an optimized vaccine will mean one that is highly immunogenic and elicits antibodies that will neutralize virus in vitro, as well as provide protection against live SARS- CoV-2 challenge. In some embodiments the combination of a SARS-CoV-2 vaccine and IMT504 results in an augmented immune response to the SARS-CoV-2 vaccine compared with a SARS-CoV-2 vaccine alone and produces high levels of SARS-CoV-2 neutralizing antibodies compares with a SARS-CoV-2 vaccine alone.

Definitions

[0021] As used herein, the term “allergy” refers to acquired hypersensitivity to a substance

(allergen). Non-limiting examples of allergies include eczema, allergic rhinitis, asthma, and urticaria.

[0022] As used herein, the term “immune system deficiency” refers to a disease in which the immune system is not functioning in normal capacity.

[0023] As used herein, the term “oligonucleotide” or “oligo” shall mean multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). The term “oligonucleotide” as used herein refers to both oligoribonucleotides (ORNs) and oligodeoxyribonucleotides (ODNs). The term “oligonucleotide” shall also include oligonucleosides (i.e., an oligonucleotide minus the phosphate) and any other organic base containing polymer. Oligonucleotides can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by oligonucleotide chemical synthesis). Oligonucleotides can also be obtained from a plasmid or via recombinant technology. As used herein, the term “oligonucleotide” may also refer to multiple nucleotides linked by phosphodiester or phosphorothioate bonds.

[0024] As used herein, the term “immunostimulatory oligonucleotide” refers to an oligonucleotide which stimulates, (i.e., has a mitogenic effect on, or induces or increases cytokine expression by) a cell of the immune system (i.e., a lymphocyte, a macrophage).

[0025] As used herein, the term “CpG” refers to an unmethylated cytosine-guanine dinucleotide. [0026] As used herein, the term “CpG oligonucleotide” refers to an oligonucleotide which stimulates a cell of the immune system and its immunostimulatory activity critically depends on the presence of at least one CpG in its sequence.

[0027] As used herein, the term “non-CpG oligonucleotide” refers to an oligonucleotide which stimulates a cell of the immune system and its immunostimulatory activity does not critically depend on the presence of a CpG in its sequence.

[0028] As used herein, the term “subject” refers to an animal of the order Primate, including humans.

[0029] As used herein, the term “treating” refers to a process by which the symptoms of a disease, and more particularly infectious diseases such as COVID-19 are ameliorated or completely eliminated.

[0030] As used herein, the term “preventing” refers to a process by which a disease, and more particularly infectious diseases such as COVID-19 are obstructed or delayed.

The Immune System

[0031] The major function of the immune system is to protect the host of invading pathogens. A number of different cell types, both antigen-independent and antigen-specific, have evolved to detect and neutralize these invading pathogens. Among them, lymphocytes have an important characteristic, which is their ability to specifically recognize antigens, a feature not possessed by any other cell. This means that any lymphocyte function stimulated by an antigen is directed solely at that antigen.

[0032] Lymphocytes may be divided into two maj or populations: T and B. T-lymphocytes have a central role in regulating the immune response and for this they produce and secrete lymphokines (i.e., interleukins). B-lymphocytes are the only cells that produce antibodies, which are proteins — Immunoglobulins (IgG) — that recognize and bind antigens.

[0033] Some T-lymphocytes are known as helper (Th-lymphocytes) because they assist B cells to produce antibody. T-lymphocytes express a characteristic membrane molecule designated CD4. Other T-lymphocytes are known as cytotoxic (CTL) because they are capable of killing certain cells. They express a different characteristic membrane protein designated CD8. [0034] Th-lymphocytes, in mice, have been subdivided according to the lymphokines they produce in groups designated ThO, Thl and Th2. In general, Th 1 -lymphocytes produce lymphokines which stimulate macrophages and CTLS (IL2, IFNy, TNF-J3), Th2-lymphocytes produce lymphokines which stimulate B-lymphocytes to proliferate and produce antibody (IL 2, IL5, IL6, IL10, IL13), whilst ThO-lymphocytes produce a mixture of lymphokines and are thought to be an intermediate stage from which Thl- and Th2-lymphocytes are derived. In humans, Thl- and Th2-like lymphocytes have been demonstrated, although they do seem to show a less strict division with respect to their patterns of cytokine secretion.

[0035] A third population of lymphocytes, which lack the major makers of T and B cells include the natural killer cells (NK cells), the killer cells (K cells) and the lymphokine-activated killer cells (L A K cells). NK cells can kill certain tumor cells and some virally infected cells, but unlike cytotoxic T-lymphocytes they are not capable of recognizing a specific antigen. K cells are able to bind to cells, which have antibody to them via their antigen-binding regions and kill them. L A K cells do not specifically recognize an antigen but they are capable of destroying a wider range of targets than NK cells.

[0036] Macrophages and dendritic cells play a critical role in initiating immune responses, helping T cells to respond to antigens.

[0037] There are several antibody classes. The IgG class comprises most of the circulating antibodies and it has four subclasses designated IgGl, IgG2, IgG3 and IgG4.

[0038] The IgM class comprises about 10% of the circulating antibodies. These are the principal antibodies produce during the primary immunological response. The IgA class comprises most of the antibody secreted at mucous membranes and exerts its protective effect by blocking access of the antigen to the inner body. The IgD class comprises less than 1% of serum antibodies and its biological role is largely unknown. The IgE class comprises antibodies that are mainly bound to the surface of most cells and basophils. These antibodies are associated with reactions that occur in individuals who are undergoing allergic reactions.

Vaccines and Vaccines Adjuvants

[0039] Vaccines are preparations used to stimulate animals to mount an immune response against antigens included in the vaccine. [0040] In some embodiments, the vaccines described herein include adjuvants, which are substances that used in combination with specific antigen produce more immunity than the antigen used alone.

Nucleic Acids as Immunostimulatory Compounds

[0041] Several polynucleotides have been demonstrated to have immunostimulatory properties. For example, poly (I, C) is an inducer of interferon (IFN) production, macrophage activation and NK cell activation (Talmadge, J. E., Adams, J., Phillips, H., Collins, M., Lenz, B., Schneider, M., Schlick, E., Ruffmann, R., Wiltrout, R. H., Chirigos, M. A. 1985. Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly- L:-lysine and carboxymethylcellulose. Cancer Res. 45:1058; Wiltrout, R. H., Salup, R. R., Twilley, T. A., Talmage, J. E. 1985. mmunomodulation of natural killer activity by polyribonucleotides. J. Biol. Resp. Mod. 4:512), poly (dG, dC) is mitogenic for B cells (Messina, J. P., Gilkerson, G. S., Pisetsky, D. S. 1993. The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens. Cell. Immunol. 147:148) and induces IFN and NK activity (Tocunaga, T., Yamamoto, S., Namba, K.1988. A synthetic single-stranded DNA, poly(dG,dC), induces interferon-a/p and - y, augments natural killer activity, and suppresses tumor growth. Jpn.J. Cancer Res. 79:682).

[0042] Bacterial DNA has also been reported to have immunostimulatory properties. These properties include the induction of cytokines (interferon gamma (IFN y), alpha (IFN a), beta (IFN ); tumor necrosis factor alpha (TNF a), interleukin 6 (IL6), 12 (IL 12) and 18 (IL 18), as well as the direct stimulation of B cells (Yamamoto, S. et al. 1988. In vitro augmentation of natural killer cell activity of interferon a/p and y with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. (Gann) 79: 866-873; Yamamoto S. et al, 1992. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol. Immunol. 36: 983-997.; Klinman, D. M., Yi, A- K, Beaucage, S. L., Conover, J. and Krieg, A. M., 1996.

[0043] CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12 and interferon y. Proc. Natl. Acad. Sci. USA 93, 2879-2883. Halpern, M. D., et al. 1996. Bacterial DNA induces murine interferon-y production by stimulation of interleukin- 12 and tumor necrosis factor-a. Cell. Immunol. 167: 72-78. Sparwasser, T. et al, 1997. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-a-mediated shock. Eur. J. Immunol. 27: 1671-1679; Krieg, A. M. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 345-349.

[0044] In contrast, it has been reported that mammalian DNA has no significant immune effects (Pisetsky, D. S. 1996. The immunologic properties of DNA. J. Immunol. 156: 421-423; Messina et al. 1991. Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA. J. Immunol. 147: 1759).

[0045] Synthetic DNA has also been reported to be immunostimulatory if it contains unmethylated CpG motifs. (Yamamoto, S et al.; 1992. Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity. J. Immunol. 148: 4072-4076; Ballas, Z. K., et al.; 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157: 1840-1845; Hartmann, G., Krieg, A. M. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164:944; Hartmann, G., Weeratna, R. D., Ballas, Z. K., Payette, P., Blackwell, S., Suparto, I., Rasmussen, W. L., Waldschmidt, M., Sajuthi, D., Purcell, R. H., Davis, H. L., Krieg, A. M. 2000. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 164:1617; Verthelyi, D., Ishii, K. J., Gursel, M., Takeshita, F., Klinman, D. M. 2001. Human peripheric blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 166:2372). However, one oligonucleotide containing phosphorothioate bonds that lack CpG motifs has been found to have some immunostimulatory activity on human B cells (Liang, H., Nishioka, Y., Reich, C. F., Pisetsky, D. S., Lipsky, P. E. 1996. Activation of human B cells by phosphorothioate oligonucleotides. J. Clin. Invest. 98: 1119). This particular non-CpG oligonucleotide containing phosphorothioate bonds is a poly-T chain, 20 nucleotides long. Also, Vollmer et al (Vollmer J, Janosch A, Laucht M, Ballas Z K, Schetter C, Krieg A M. Highly immunostimulatory CpG-free oligodeoxynucleotides for activation of human leukocytes. Antisense Nucleic Acid Drug Dev. 12: 165-175, 2002) reported immunostimulation by phosphorothioate poly T ODNs. These authors pointed out that poly T ODNs are only active as phosphorothioate ODNs and have much lower activity than CpG ODNs.

[0046] It has now been discovered that non-CpG oligonucleotides containing the following non-palindromic sequence motif: X1X2X3X4X5X6X7X8,

[0047] wherein Xi is C,T,G or A (preferably T or C); X2 is C,T,G or A; X7 is C,T,G or A (preferably G); at least three, and preferably all, of X3, X4, X5, Xe and Xs are T; with the proviso that, in the motif, a C does not precede a G, have potent immunostimulatory activity. Therefore, these oligonucleotides can be administered to subjects to treat “immune system deficiencies” or in conjunction with a vaccine, as adjuvants, to boost the immune system in order to have a better response to the vaccine or administered to subjects to increase the responsiveness to tumors.

[0048] It has now been discovered that non-CpG oligonucleotides containing the following non-palindromic sequence motif:

X1X2X3X4X5X6X7X8,

[0049] wherein Xi, X2 and X7 are C,T,G or A; at least three of X3, X4, X5, Xe and Xs are T; with the proviso that, in the motif, a C does not precede a G, are useful as immunostimulants in animals of the order Primate, including humans.

[0050] In some embodiments, Xi consist of a C or a T and X7 consist of a G. More preferably X3,X4,X5,Xe X7 Xs of the immunostimulatory motif consist of TTTTGT. Even more advantageously X1X2X3X4X5X6X7X8 consist of CNTTTTGT or TNTTTTGT wherein N is C, T, G or A. Those of X3-X6 and Xs that are not T can be any nucleotide (e.g., C, T, G, A) or can be absent so that the nucleotide preceding links directly with the nucleotide following the position of the omitted nucleotide (S). The oligonucleotides of this invention are useful as adjuvants in a vaccine formulation comprising one or more antigens. In embodiments of this aspect, the vaccine formulation can be liquid or lyophilized in dosage form. Many dosage forms are known in the art and can be applied herein. In embodiments of this aspect, the oligonucleotides of this invention are present in the composition at a dose of from about 10 to 10,000 pg per dose. In these preparations, the oligonucleotides of this invention may be combined with other immunostimulant compounds. Examples of well-known immunostimulants are: a-interferon, [3-interferon, y-interferon, granulocyte macrophage colony stimulator factor (GM-CSF), interleukin 2 (IL2), interleukin 12 (IL 12) and CpG oligonucleotide. [0051] The nucleic acids and oligonucleotides described herein can be synthesized by a variety of synthetic chemistry methodologies that involve the chemical synthesis of relatively short fragments of nucleic acids with defined chemical structures. Common techniques include solid-phase synthesis using phosphoamidite and phosphorami dite building blocks derived from protected 2'-deoxynucleosides (dA, dC, dG, and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides. Other methods may include, but are not limited to, H- phosphonate and phosphate triester methods of oligonucleotide synthesis, phosphodiester synthesis, phosphotriester synthesis, phosphite tri ester synthesis or phosphorothioate synthesis. The synthetic chemistry methods described herein may optionally include post-synthetic processing methodologies.

[0052] In preferred embodiments the antigenic component of the vaccine is one or more, natural or recombinant, antigens of the SARS-CoV-2 virus.

[0053] Embodiments herein are directed to a SARS-CoV-2 vaccine comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and effective amount of an immunostimulatory oligonucleotide having about 15 to about 100 nucleotides. Embodiments herein are directed to a SARS-CoV-2 vaccine comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence

TCATCATTTTGTCATTTTGTCATT (SEQ ID NO. l).

[0054] In some embodiments, the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow-release delivery vehicle. Some embodiments further comprise a pharmaceutically acceptable carrier. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS- CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg. In some embodiments, the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof. An “effective amount” of a compound is a predetermined amount calculated to achieve the desired effect (e.g., prevent COVID-19).

[0055] Some embodiments are directed to a pharmaceutical composition comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having about 15 to about 100 nucleotides. Some embodiments are directed to a pharmaceutical composition comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence

TCATCATTTTGTCATTTTGTCATT (SEQ ID NO.l) and a pharmaceutically acceptable carrier. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg. In some embodiments, the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof. [0056] Some embodiments are directed to a method of vaccination of a subject comprising administering to a subject an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having about 15 to about 100 nucleotides. Some embodiments are directed to a method of vaccination of a subject comprising administering to a subject an effective amount of at least one recombinant SARS- CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence

TCATCATTTTGTCATTTTGTCATT (SEQ ID NO.l).

In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered to the subject by intramuscular, subcutaneous, or intradermal injection at the same site. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered by the oral, intranasal, anal, vaginal, transdermal, or mucosal route. In some embodiments, the subject is a human. In some embodiments, the subject is a human greater than 18 years of age. In some embodiments, the subject is a human less than 18 years of age. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow- release delivery vehicle. In some embodiments, the effective amount is effective for treating, preventing or ameliorating COVID- 19 in the subject. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered contemporaneously or simultaneously. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg. In some embodiments, the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.

[0057] In some embodiments, one or more of the oligonucleotides of this invention and the antigen are administered simultaneously locally (by oral, rectal, intranasal, or transdermal route) or by intradermic, subcutaneous, or intramuscular injection. An aspect of this invention is a method of vaccination of a person. The person can be vaccinated prophylactically or therapeutically.

[0058] A prophylactic vaccine is designed to elicit protection from a disease caused by an infectious agent through the induction of specific immunity.

[0059] A therapeutic vaccine is designed to induce remission of an illness (i.e., a tumor and metastasis or illness associated with, an infectious agent like the human immunodeficiency virus).

[0060] The method of vaccination includes administering one or more of the oligonucleotides of this invention and one or more antigens — that is, the vaccine can be designed against one disease target or a combination of disease targets.

[0061] In embodiments, one or more of the oligonucleotide of this invention is/are present in a pharmaceutical formulation that can be liquid or lyophilized in dosage form. Many dosage forms are known in the art and can be applied herein. In embodiments of this aspect one or more of the oligonucleotides of this invention is/are present in the composition at a dose of from about 10 to 10,000 pg per dose. In these preparations, one or more of the oligonucleotides of this invention may be combined with other immunostimulant compounds. Examples of well-known immunostimulants are: a-interferon, [3-interferon, y-interferon, granulocyte macrophage colony stimulator factor (GM-CSF), interleukin 2 (IL2), interleukin 12 (IL 12), CpG oligonucleotides and Mycobacterium bovis BCG cells. Also, one or more of the oligonucleotides of this invention may be combined with an anti-infective or anticancer drug, or a surgical procedure. In all these cases, the oligonucleotides of this invention may be administered before, after, or simultaneously with the alternative treatment. [0062] In some embodiments, the immunostimulatory oligonucleotides of the invention are advantageously modified into stabilized oligonucleotides. Such stabilized immunostimulatory oligonucleotide may be particularly useful to obtain a prolonged immunostimulation. As used herein, a “stabilized oligonucleotide” refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via an exo- or endonuclease). In some embodiments, stabilized oligonucleotides of the present invention comprise a phosphate backbone modification. In some embodiments, the phosphate backbone modification is a 5' inter-nucleotide linkage modification, for instance, at the first two nucleotides of the 5' end of the oligonucleotide of the invention. Furthermore, the phosphate backbone modification may be a 3' inter-nucleotide linkage modification. In such a case, the modification may occur, for instance, at the last two nucleotides of the 3' end of the oligonucleotide of the invention. In some embodiments, the immunostimulatory oligonucleotide of the invention may be stably modified so as to comprise a phosphorothioate-linked nucleotide (i.e., at least one of the phosphate oxygens is replaced by sulfur). In some embodiments, most if not all the nucleotides of the immunostimulatory oligonucleotides of the invention comprise a phosphorothioate- linked nucleotide.

[0063] Other stabilized oligonucleotides may alternatively include: nonionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.

[0064] The present invention provides methods to augment the immune response of animals of the order Primate, including humans, adding to vaccines one or more of the oligonucleotides of this invention or performing a treatment based in the administration of one or more of the oligonucleotides of this invention to a person with COVID- 19 or at risk of contracting COVID- 19 due to exposure to the SARS-CoV-2 virus with one or more of the oligonucleotides of this invention “ex vivo”, and readministering these activated white blood cells to the same person.

[0065] Vaccine compositions useful containing one or more of the oligonucleotides of this invention can present antigens directly (i.e., in the form of a defined protein or polysaccharide) or as a part of a complex biological entity (i.e., complete viruses; complete bacterial cells; bacterial membranes or artificial conjugates like polysaccharide-protein conjugates). These antigens can be combined in multiple vaccines.

[0066] A vaccine composition including at least one antigen is formulated to include one or more of the oligonucleotides of this invention.

[0067] One or more of the oligonucleotides of this invention may be formulated alone or together with one or more antigens in a pharmaceutical composition, which may also include carriers, thickeners, diluents, buffers, preservatives, surface active agents, anti-microbial agents, anti-inflammatory agents, anesthetics and the like. The formulation can be liquid or lyophilized. The pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be done topically, orally, by inhalation or parenterally. Formulation for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, tablets and the like. Thickeners, flavorings, diluents, emulsifiers and the like may be necessary or desirable. Formulations for parenteral administration include sterile aqueous solutions, which may also contain buffers, diluents and other additives. A vaccine containing one or more antigens and one or more of the oligonucleotides of this invention can be formulated and used for prophylactic or therapeutic purposes.

[0068] A further refinement of a vaccine formulation is to incorporate one or more of the oligonucleotides of this invention as adjuvant/s and the antigen/s into a delivery vehicle to provide for delayed release of the active compounds of the vaccine over time. This can be accomplished by various means known in the art. Examples of these means are encapsulation into Poly (lactide-coglycolide) micro particles (Kersten, G. F. A. and Gander, B. 1996. Biodegradable Micro Spheres as vehicles for antigens, in: S. H. E. Kaufmann, ed. Concepts in Vaccine Development. Walter de Gruyter. Berlin-N.Y.), liposomes (Gregoriadis, G. et al. 2000. Liposomes as Immunological Adjuvants and Vaccine Carriers, in: S. H. E. Kaufmann, ed. Concepts in Vaccine Development. Walter de Gruyter. Berlin-N.Y.) and poly (methyl methacrylate) nanoparticles (Kreuter, J. 2000. Poly (Methyl Methacrylate) nanoparticles as vaccine adjuvants, in: S. H. E. Kaufmann, ed. Concepts in Vaccine Development. Walter de Gruyter. Berlin-N.Y.). [0069] Another refinement of the vaccine formulation is to conjugate the antigen/s and one or more of the oligonucleotides of this invention, by chemical means (Mier W, Eritja R, Mohammed A, Haberkom U, Eisenhut M. 2000. Preparation and evaluation of tumor-targeting peptide-oligonucleotide conjugates. Bioconjug. Chem. 11:855).

[0070] Many vaccine formulations are known in the art and can be used by substituting one or more of the oligonucleotides of this invention for the adjuvant previously known or by simply adding one or more of the oligonucleotides of this invention to the original formulation.

[0071] The pharmaceutical composition for these treatments may include one or more of the oligonucleotides of this invention together with carriers, thickeners, diluents, buffers, preservatives, surface active agents, anti-microbial agents, anti-inflammatory agents, anesthetics and the like. The formulation can be liquid or lyophilized.

[0072] The pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be done topically, orally, by inhalation or parenterally. Formulation for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, tablets and the like. Thickeners, flavorings, diluents, emulsifiers and the like may be necessary or desirable. Formulations for parenteral administration include sterile aqueous solutions, which may also contain buffers, diluents and other additives. Alternatively, one or more of the oligonucleotides of this invention can be contacted with immunocompetent cells (i.e., B cells or plasmacy toid dendritic cells) obtained from a subj ect having a tumoral disease or an immune system deficiency “ex vzvo” and activated cells can then be reintroduced in the subject.

[0073] Whenever a numerical range with a lower limit and an upper limit is disclosed, any number and any included range falling within the range is specifically disclosed. In particular, every range of values (of the form, “from about a to about b,” or, equivalently, “from approximately a to b,” or, equivalently, “from approximately a-b”) disclosed herein is to be understood to set forth every number and range encompassed within the broader range of values. It must also be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As used herein, the term “about” means plus or minus 10% of the numerical value of the number with which it is being used. Therefore, about 50% means in the range of 45%-55%.

[0074] One or more illustrative embodiments are presented herein. Not all features of a physical implementation are described or shown in this application for the sake of clarity. It is understood that in the development of a physical embodiment of the present disclosure, numerous implementation-specific decisions must be made to achieve the developer's goals, such as compliance with system-related, business-related, government-related and other constraints, which vary by implementation and from time to time. While a developer's efforts might be time-consuming, such efforts would be, nevertheless, a routine undertaking for one of ordinary skill in the art and having benefit of this disclosure.

[0075] Therefore, the present disclosure is well adapted to attain the ends and advantages mentioned as well as those that are inherent therein. The particular embodiments disclosed above are illustrative only, as the present disclosure may be modified and practiced in different but equivalent manners apparent to one having ordinary skill in the art and having the benefit of the teachings herein. Furthermore, no limitations are intended to the details of construction or design herein shown, other than as described in the claims below. It is therefore evident that the particular illustrative embodiments disclosed above may be altered, combined, or modified and all such variations are considered within the scope and spirit of the present disclosure. The embodiments illustratively disclosed herein suitably may be practiced in the absence of any element that is not specifically disclosed herein and/or any optional element disclosed herein.

Example 1 - Non-clinical IMT504 safety and pharmacokinetic studies

[0076] IMT504 pharmacokinetic studies were carried out in male and female Sprague Dawley rats by intraperitoneal (i.p.) and subcutaneous (s.c.) administration routes; IMT504 showed good bioavailability by both routes. A mixture of IMT504 and ³² P -labeled IMT504 (tracer) yielded a specific activity of 7 pCi/mg. A total of 2 mg IMT504 was administered per animal (roughly 15 mg/kg). The maximum plasma concentration (Cmax) was reached 60 minutes after s.c. IMT504 injection. IMT504 primarily was associated with liver, spleen, thymus, intestine, kidney, and heart. IMT504 passage across the blood-brain border was negligible. IMT504 is primarily excreted in urine.

[0077] When assessing safety, IMT504 dosing route and regimen was determined based on intended clinical use. Single-dose toxicity studies were performed either by s.c. or intravenous (i.v.) route in male and female Sprague Dawley rats and by i.v. route in C. apella monkeys. In the single- dose studies, 50 mg/kg was tentatively defined as the “maximum tolerated dose” for s.c. administration in rats. Further studies indicated that 10 mg/kg is the “no observed adverse effect level” (NOAEL) dose for s.c. administration in rats. Rat and monkey studies indicate 3.5 mg/kg as the NOAEL dose for i.v. administration.

[0078] In repeated-dose studies, rats were i.v. injected daily with either 0.35 or 3.5 mg/kg/day IMT504 for 6 weeks. These doses were selected taking into account acute toxicity and PK studies. Statistical significance was evaluated with the Student-Gosset test with a = 0.05. No rats died, total body weight remained unchanged, and there were no laboratory abnormalities attributed to IMT504 (data not shown).

[0079] Table 1. Monkey multiple i.v. doses (3.5 mg/kg/day). Combined data from animals in control (3 males and 3 females) or treated (3 males and 3 females) groups. ALP, alkaline phosphatase. GT, glutamyl transferase; IG, immunoglobulin; KPTT, kaolin partial thromboplastin time; N/D, not determined; RBC, red blood cell; SGOT, serum glutamic oxaloacetic transaminase; SGPT, serum glutamic-pyruvic transaminase; TP, prothrombin time. *p<0.05.

Table 1

[0080] A second repeated-dose study was performed in monkeys; 3.5 mg/kg/day IMT504 was i.v. administered 3 times/week for 6 weeks. Minor changes in laboratory markers were observed (Table 2); there were statistically significant but transient increases (p<0.05) in immunoglobulin M (IgM) and gamma GT after 6-week treatment, a slight increase in leukocyte count at beginning of treatment and at day 90, and an increase in neutrophil and lymphocyte counts on day 42. No monkeys died during the study, the intragroup variation in weight was under 10%, and no behavioral changes or abnormal clinical signs were observed.

[0081] In addition to these safety studies, IMT504 was also assessed for genotoxic potential by three different assays: the Ames test, chromosomal aberrations assay, and the sister chromatid exchange assay. IMT504 is not mutagenic under any condition tested. Another study indicated that IMT504 does not alter embryonic development in rats, when administered s.c. in a 20 mg/kg single dose.

[0082] Based on these data, 10 mg/kg/day is the NOAEL dose of IMT504. This dose is hundreds of times higher than IMT504 doses used in efficacy studies (e.g., 1-25 pg used in influenza studies below). The high NOAEL dose suggests a dose range that will allow for safe IMT504 usage in humans.

Example 2 - IMT504 human safety [0083] IMT504 has been administered to human subjects outside the US. In one published study, IMT504 was administered as a vaccine adjuvant for rabies virus vaccine to healthy male Caucasian volunteers (ages 39-51) immunized with three doses of 1 mg/dose IMT504 injected at days 0, 30, and 60. Positive immune response was observed without any SAEs, including no indications of a cytokine storm. IMT504 has also been administered in an expanded access use setting for treating aggressive, terminal cancers in a select group of patients (unpublished data). Again, no SAEs occurred, even with the administration of very large amounts of IMT504 (e.g., one patient’s total exposure to IMT504 exceeded 700 mg). In the small number of human patients studied, IMT504 has been well-tolerated, even at very high doses, much greater than that proposed for use as a vaccine adjuvant. These data strongly support the safety profile of IMT504 that was demonstrated in the various preclinical safety studies.

Example 3 - Initial IMT504 efficacy studies

[0084] In a highly lethal intracerebral challenge with live rabies virus, we demonstrated 100% protection after a single dose. Additionally, protective levels of HAI titers in an influenza model, have been demonstrated after only a single dose. Surprisingly, elder rats have been found to have higher antibody titers with IMT504-based vaccination when compared to younger rats that had received unadjuvanted vaccine. Of note, in both rabies and influenza vaccine studies, IMT504 allowed for significant antigen (dose) sparing (reducing cost/dose), while also affording protective antibody levels. Other studies with HIV, HPV, and influenza vaccines show similar antibody results (functional antibodies and dose sparing).

Example 4 - Development of IMT504-based SARS-CoV-2 vaccine

[0085] A combination ofIMT504 with either recombinantly-expressed spike SI protein, the spike S2 protein, or the receptor binding domain (RBD) were tested to determine immunogenicity, in vitro virus neutralization at different timepoints. In addition, we will use an adaptive clinical trial design to expeditiously study 40 high risk exposure volunteers for both safety and efficacy. This will be expanded to at least 300 high risk exposure volunteers.

[0086] Experimental Designs

Table 2 - Study Design #1

Table 3 - Study Design #2

[0087] For Study Design #1, sera were collected at days 1, 7, 14, 21, and 42 for in vitro neutralization studies. For Study Design #2, sera were collected at days 3, 21, 43 and 91 for in vitro neutralization studies. The animals were maintained in BSL-2 animal labs during the duration of the study. Animals were intramuscularly injected with IMT504 and the vaccine candidates as indicated above. Animals were monitored during the entire period of study, with at least one check every 24 hours. Animals were monitored for general wellbeing including weight, external appearance including fur morphology, movement, responsiveness to stimuli, eating and drinking habits and social behavior. Animals displaying any signs of distress were monitored more closely (twice every 24 hours) and if the stress conditions did not improve, were euthanized. The data were recorded to support the decision-making process regarding dosing regimens.

[0088] In vitro Neutralization: For Study Design #1, sera was collected at days 1, 7, 14, 21, and 42 for in vitro neutralization studies. For Study Design #2, sera was collected at days 3, 21, 43 and 91 for in vitro neutralization studies. Deliverables: We conducted a plaque reduction neutralization assay for SARS-CoV-2 using immune sera obtained from vaccinated animals. The serum samples were incubated with the virus at varying dilutions to determine extent of neutralization as evidenced by reduction in plaque counts using Vero cells. UV- inactivated virus was used as a positive control in the absence of any commercial neutralizing antibody availability. Neutralization of >75% of the input virus was considered significant. Serum samples were also analyzed by multiplexed ELISA for circulating cytokines. Results from Study Design #1 are depicted in Fig. 4 and results from Study Design #2 are depicted in Fig. 5.

[0089] Vaccine and Adjuvant Production, Manufacturing, and Regulatory Affairs: A variety of cell-based production systems can be used for vaccine production. Our strategy is to express full-length S protein and separately, the spike protein SI, spike protein S2, and receptor binding domain (RBD). A number of in vivo protein production platforms exist including, but not limited to, Chinese hamster ovary (CHO) cells. CHO cells are one of the most prominent and safe cell lines for industrial protein production. The proven ability of CHO cells to produce complex recombinant proteins and to perform human like posttranslational modifications underlines the advantages connected with these host cells (Wurm, F. M. Production of recombinant protein therapeutics in cultivated mammalian cells. Nat Biotech 22, 1393-1398 (2004)). Moreover, the systematic elucidation of the CHO cell genome provides new opportunities for future development and optimization of this platform (Xu, X. et al. The genomic sequence of the Chinese hamster ovary (CHO)-Kl cell line. Nat Biotech 29, 735-741 (2011)).

[0090] IMT504 is a short single-stranded synthetic 24-mer DNA segment with a well- defined stable, simple formulation. As such, it is relatively easy to produce under GMP conditions using a rapid automatic process. This process is economically scalable, and large quantities can be produced at a reasonable cost. [0091] Vaccine formulations will consist of different concentrations of IMT504 and different dilutions of the recombinant proteins to optimize the response, compared to non- adjuvanted vaccine. An optimized vaccine will mean one that is highly immunogenic and elicits antibodies that will neutralize virus in vitro, as well as provide protection against live SARS-CoV-2 challenge. Immunogenicity studies and live challenge work will be done in Sprague-Dawley rats.

[0092] Adaptive Clinical Trial: We will initiate an adaptive clinical trial, open-label, dose ranging safety and efficacy trial in n=40 healthy male and non-pregnant female participants, aged 18 and above. Enrollment will occur at 1-3 domestic sites. Inclusion criteria also include body mass index 18-30 kg/m ² at time of screening; negative serological tests for SARS-CoV- 2, Hepatitis B surface antigen, Hepatitis C antibody, and HIV antibody at time of screening; use of medically effective contraception; and screening electrocardiogram deemed as having no clinically significant findings. Exclusion criteria include pregnancy or breastfeeding; participating in another clinical study in the last 30 days; or previous exposure to SARS-CoV- 2. Participants will receive an intramuscular injection of our vaccine formulations determined in prior studies (described above) and will be followed for 12 months. Primary outcomes measures include percentage of participants with adverse events, percentage of participants with injection site reactions, percentage of participants with adverse events of special interest, change from baseline in antigen-specific binding antibody titers, and change from baseline in antigen-specific IFNy cellular immune responses. The secondary outcome measure will be demonstration of serum neutralization.

[0093] Measuring Successful Outcomes: We define successful outcome of this study in four ways: (1) producing at least two vaccine constructs (SI + S2 proteins and RBD), (2) demonstrating immunogenicity in Sprague-Dawley rats, (3) showing in vitro virus neutralization and protection in live SARS-CoV-2 Sprague-Dawley rat challenge model, and (4) demonstrating safety and immunogenicity in an adaptive clinical trial. These metrics are aligned with developing rapid-response vaccines utilizing adjuvant systems that provide unique vaccine attributes. IMT504 has a strong track record of success in other vaccine settings, and we anticipate equally positive results with this proposed coronavirus vaccine strategy.

Example 4 - Comparison of recombinant SARS-CoV-2 antigen in combination with IMT504 with other SARS-CoV-2 vaccines [0094] Table 4 shows a comparison of the recombinant SARS-CoV-2 antigen in combination with IMT504 with other SARS-CoV-2 vaccines. Recombinant SARS-CoV-2 antigen in combination with IMT504 achieved peak neutralizing titers significantly higher than other SARS-CoV-2 vaccines in animal models. Neutralizing titers are a surrogate marker for vaccine efficacy. Studies have shown that higher titers lead to a more sustained and durable immune response.

Table 4

*Single vaccination; GMT = Geometric Mean Titer; GMR = Geometric Mean Response

Example 5 - Peak animal neutralizing titers for SARS-CoV-2 antigen in combination with

IMT504 in various SARS-CoV-2 variants

[0095] Table 5 displays peak animal neutralizing titers for SARS-CoV-2 antigen in combination with IMT504 in various SARS-CoV-2 variants

Table 5