IMPROVED ENZYMATIC MODIFICATION OF PHOSPHOLIPIDS IN FOOD

TECHNICAL FIELD

The present invention relates to phospholipases and their use in the manufacture of food. The present invention further relates to methods of making dough and baked products using phospholipases.

CROSS REFERENCE TO REPLATED APPLICATIONS

This application claims benefit to U.S. Provisional Application No. 63/368,530, filed July 15, 2022, which is hereby incorporated by reference in its entirety.

REFERENCE TO A SEQUENCE LISTING

The contents of the electronic submission of the text file Sequence Listing, named “NB42091WOPCT_SequenceListing.xml” was created on July 15, 2022, and is 151 KB in size, which is hereby incorporated by reference in its entirety.

BACKGROUND

The use of lipases in bread dough is well known. For example, in EP0585988 it is shown that the addition of lipase to dough provided an anti-staling effect in. W094/04035 teaches that an improved softness can be obtained by adding a lipase to dough. It has also been shown that exogenous lipases can modify bread volume.

While lipases, including phospholipases, have been described for their positive properties in the preparation of dough and baked products, prior art lipases sometimes have multiple activities that conflict with one another. Therefore, today, there is still a need in some food applications, in particular, in baking, for improved lipases with more specific activities.

Microorganisms such as filamentous fungi are widely employed as hosts for the production of heterologous proteins, including lipases. However, microorganisms invariably express endogenous proteases. For heterologous proteins which are susceptible to enzymatic proteolysis, endogenous proteases may degrade the heterologous protein. Depending on the sensitivity of the heterologous protein to proteolysis, there are work arounds to minimize degradation of the heterologous protein. The heterologous protein can be purified away from the endogenous proteases for example by chromatography. But proteolysis may occur too quickly, degrading a substantial amount of the heterologous protein before chromatography can be performed.

The host can also be genetically engineered to eliminate one or more proteases to reduce or eliminate proteolysis of the heterologous protein. However, typical hosts such as Trichoderma, have many endogenous proteases and reducing proteolysis requires knowledge of which protease(s) are responsible for degrading the particular heterologous protein. Moreover, there are limits to how many genes can be deleted and still maintain a healthy host cell.

There is a continuing need for technologies to overcome host cell proteolysis issues. Ideally, these improved technologies would result in higher yields of proteins.

The subject matter disclosed herein addresses these needs and provides additional benefits as well.

SUMMARY OF THE INVENTION

In accordance with an aspect of the present invention, an isolated polypeptide is presented having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

In another aspect of the present invention, a method is presented of making a dough, said method comprising admixing a dough component selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45. Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the method of making a dough has the further step of adding at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Optionally, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Optionally, the amylase is an exoamylase.

Optionally, the exoamylase is a maltogenic amylase.

Optionally, the exoamylase is a non-maltogenic amylase. Optionally, the non- maltogenic amylase hydrolyses starch by cleaving off one or more linear maltooligosaccharides, predominantly comprising from four to eight D-glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity.

Optionallyy, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

Optionally, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:123.

Optionally, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Optionally, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117. Optionally, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, a dough is presented having an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the dough has improved dough extensibility and/or stability.

In another aspect of the present invention, the dough has at least one additional enzyme useful for improving dough and/or a baked product made therefrom. Optionally, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Optionally, the amylase is an exoamylase.

Optionally, the exoamylase is a maltogenic amylase.

Optionally, the exoamylase is a non-maltogenic amylase. Optionally, the non- maltogenic amylase hydrolyses starch by cleaving off one or more linear maltooligosaccharides, predominantly comprising from four to eight D-glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

Optionally, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NQ:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

Optionally, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Optionally, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Optionally, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, a method is presented of preparing a baked product comprising baking a dough as set forth above.

In another aspect of the present invention, a baked product is presented obtainable by the method as described above. Preferably, the baked product has at least one improved property selected from the group consisting of improved crumb pore size, improved uniformity of gas bubbles, no separation between crust and crumb, increased volume, increased crust crispiness and improved oven spring.

Optionally, the improved property is crust crispiness.

In another aspect of the present invention, a pre-mix for baking is presented having flour and an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO:

40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:

41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the pre-mix has at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Optionally, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Optionally, the amylase is an exoamylase. Optionally, the exoamylase is a maltogenic amylase.

Optionally, the exoamylase is a non-maltogenic amylase. Optionally, the non- maltogenic amylase hydrolyses starch by cleaving off one or more linear maltooligosaccharides, predominantly comprising from four to eight D-glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

Optionally, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO: 123.

Optionally, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Optionally, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Optionally, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, a baking improver is provided having a granulate or agglomerated powder and an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27. Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the baking improver has at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Optionally, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Optionally, the amylase is an exoamylase.

Optionally, the exoamylase is a maltogenic amylase.

Optionally, the exoamylase is a non-maltogenic amylase. Optionally, the non- maltogenic amylase hydrolyses starch by cleaving off one or more linear maltooligosaccharides, predominantly comprising from four to eight D-glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

Optionally, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:123. Optionally, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Optionally, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Optionally, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, an isolated polynucleotide is presented having a nucleic acid sequence encoding an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45. Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

In another aspect of the present invention, a recombinant expression vector is presented having a polynucleotide as described above.

In another aspect of the present invention, a host cell is presented having the recombinant expression vector as described above.

In another aspect of the present invention, a method is presented of modification of a phospholipid emulsifier having the step of treating the emulsifier with an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45. Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the phospholipid emulsifier is lecithin or lysolecithin.

In another aspect of the present invention, a method of creating a lysophospholipid in a lipid containing food matrix is presented having the step of adding to the lipid containing food matrix an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ 1D NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27. Optionally, the lipid containing food matrix is selected from the group consisting of eggs and food products containing eggs, dough for sweet bakery goods, processed meat, milk based products, and vegetable oil.

In another aspect of the present invention, a recombinant cell is presented having a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) a heterologously expressed protein.

Optionally, the heterologously expressed protein is an aminopeptidase, alphaamylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, alpha-galactosidase, betagalactosidase, glucose oxidase (GOX), alphaglucosidase, beta-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase , proteolytic enzyme, ribonuclease, alpha- 1 ,6-transglucosidase, transglutaminase, urokinase, xylanase, or beta-xylosidase.

Optionally, the heterologously expressed protein is a phospholipase. Optionally, the phospholipase is an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or a mammalian cell.

Optionally, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthera.

Optionally, the recombinant cell is Trichoderma reesei.

In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila or Bacillus licheniformis.

Optionally, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.

In another aspect of the present invention, a fermentation broth is presented having a recombinant cell as described above.

In another aspect of the present invention, a method for decreasing proteolysis of a heterologously expressed protein is presented having the step of culturing a recombinant cell comprising a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) the heterologously expressed protein under suitable conditions for production of the heterologously expressed protein and the BASI polypeptide.

Optionally, the method includes the step of isolating the heterologous protein.

Optionally, the heterologously expressed protein is an aminopeptidase, alphaamylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, alpha-galactosidase, betagalactosidase, glucose oxidase (GOX), alphaglucosidase, beta-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase . mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase , proteolytic enzyme, ribonuclease, alpha- 1 ,6-transglucosidase, transglutaminase, urokinase, xylanase, or beta-xylosidase.

Optionally, the heterologously expressed protein is a phospholipase.

Optionally, the phospholipase is an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or a mammalian cell.

Optionally, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthera.

Optionally, the recombinant cell is Trichoderma reesei.

Optionally, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

Optionally, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila or Bacillus licheniformis.

Optionally, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.

In another aspect of the present invention, a method for decreasing proteolysis of a recombinantly expressed protein is presented having the step of isolating the recombinantly expressed protein in the presence of an exogenously added barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

Optionally, the method includes the step of isolating the heterologous protein.

Optionally, the heterologously expressed protein is an aminopeptidase, alphaamylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, alpha-galactosidase, betagalactosidase, glucose oxidase (GOX), alphaglucosidase, beta-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase . mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase , proteolytic enzyme, ribonuclease, alpha- 1 ,6-transglucosidase, transglutaminase, urokinase, xylanase, or beta-xylosidase.

Optionally, the heterologously expressed protein is a phospholipase.

Optionally, the phospholipase is an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or a mammalian cell.

Optionally, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthera.

Optionally, the recombinant cell is Trichoderma reesei.

Optionally, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

Optionally, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila or Bacillus licheniformis . Optionally, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.

BRIEF DESCRIPTION OF THE BIOLOGICAL SEQUENCES

SEQ ID NO: 1 - sets forth the full length amino acid sequence of the CRC08310 phospholipase variant from Trichoderma harzianum.

SEQ ID NO: 2 - sets forth the pro-protein sequence of the CRC08310 phospholipase variant from Trichoderma harzianum.

SEQ ID NO: 3 - sets forth the full length amino acid sequence of the CRC08316 phospholipase variant from Pestalotiopsis fici.

SEQ ID NO: 4 - sets forth the pro-protein amino acid sequence of the CRC08316 phospholipase variant from Pestalotiopsis fici.

SEQ ID NO: 5 - sets forth the full length amino acid sequence of the CRC08319 phospholipase variant from Metarhizium guizhouense (also known as Metarhizium anisopliae ).

SEQ ID NO: 6 - sets forth the pro-protein amino acid sequence of the CRC08319 phospholipase variant from Metarhizium guizhouense (also known as Metarhizium anisopliae).

SEQ ID NO: 7- sets forth the full length amino acid sequence of the CRC08405 phospholipase variant from Diaporthe ampelina.

SEQ ID NO: 8 - sets forth the pro-protein amino acid sequence of the CRC08405 phospholipase variant from Diaporthe ampelina.

SEQ ID NO: 9 - sets forth the full length amino acid sequence of the CRC08418 phospholipase variant from Magnaporthe oryzae.

SEQ ID NO: 10 - sets forth the pro-protein amino acid sequence of the CRC08418 phospholipase variant from Magnaporthe oryzae.

SEQ ID NO: 11- sets forth the full length amino acid sequence of the CRC08826 phospholipase variant from Neonectria ditissima.

SEQ ID NO: 12 sets forth the pro-protein amino acid sequence of the CRC08826 phospholipase variant from Neonectria ditissima.

SEQ ID NO: 13 - sets forth the full length amino acid sequence of the CRC08833 phospholipase variant from Trichoderma gamsii.

SEQ ID NO: 14 - sets forth the pro-protein amino acid sequence of the CRC08833 phospholipase variant from Trichoderma gamsii. SEQ ID NO: 15: - sets forth the full length amino acid sequence of the CRC08845 phospholipase variant from Metarhizium anisopliae.

SEQ ID NO: 16 sets forth the pro-protein amino acid sequence of the CRC08845 phospholipase variant from Metarhizium anisopliae.

SEQ ID NO: 17 - sets forth the amino acid sequence of a phospholipase Al used in the commercial product Powerbake 4080.

SEQ ID NO: 18 - sets forth the amino acid sequence of a phospholipase Al used in the commercial product Lipopan F.

SEQ ID NO: 19 - sets forth the codon-optimized synthetic nucleic acid sequence of full-length CRC08310.

SEQ ID NO: 20 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08316.

SEQ ID NO: 21 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08319.

SEQ ID NO: 22 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08405.

SEQ ID NO: 23 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08418.

SEQ ID NO: 24 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08826.

SEQ ID NO: 25 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08833.

SEQ ID NO: 26 - sets forth codon-optimized synthetic nucleic acid sequence of full- length CRC08845.

SEQ ID NO: 27 - sets forth CRC08319 mature Q28-K147.

SEQ ID NO: 28 - sets forth CRC08319 mature Q28-T146.

SEQ ID NO: 29 - sets forth CRC08319 mature Q28-T140.

SEQ ID NO: 30 - sets forth CRC08310 mature Q28-K150.

SEQ ID NO: 31 - sets forth CRC08310 mature Q28-G149.

SEQ ID NO: 32 - sets forth CRC08316 mature Q26-R150.

SEQ ID NO: 33 - sets forth CRC08316 mature Q26-K149.

SEQ ID NO: 34 - sets forth CRC08405 mature Q28-K147.

SEQ ID NO: 35 - sets forth CRC08405 mature Q28-T146.

SEQ ID NO: 36 - sets forth CRC08418 mature Q34-G150. SEQ ID NO: 37 - sets forth CRC08418 mature Q34-G157.

SEQ ID NO: 38 - sets forth CRC08826 mature A30-K152.

SEQ ID NO: 39 - sets forth CRC08826 mature A30-D146.

SEQ ID NO: 40 - sets forth CRC08826 mature A30-K151.

SEQ ID NO: 41 - sets forth CRC08833 mature Q28-R150.

SEQ ID NO: 42 - sets forth CRC08833 mature Q28-Q124.

SEQ ID NO: 43 - sets forth CRC08833 mature Q28-F141.

SEQ ID NO: 44 - sets forth CRC08833 mature Q28-D145.

SEQ ID NO: 45 - sets forth CRC08833 mature Q28-G149.

SEQ ID NO:46 - sets forth the cbh1 promoter sequence.

SEQ ID NO:47 - sets forth the pepl signal with glal intron.

SEQ ID NO:48 - sets forth the CRC08319 proenzyme DNA sequence.

SEQ ID NO:49 - sets for the cbh1 terminator DNA sequence.

SEQ ID NO:50 - sets forth the pyr2 DNA sequence.

SEQ ID NO:51 - sets forth the amds DNA sequence.

SEQ ID NO:52 - sets for the yhfN region DNA sequence.

SEQ ID NO:53 - sets for the engineered rrnl promoter DNA sequence.

SEQ ID NO:54 - sets forth the aprE signal peptide DNA sequence.

SEQ ID NO:55 - sets forth the codon optimized BASI for expression in Bacillus DNA sequence.

SEQ ID NO:56 - sets forth the BPN' terminator DNA sequence.

SEQ ID NO:57 - sets forth the alrA gene DNA sequence.

SEQ ID NO:58 - sets forth mature BASI.

SEQ ID NO:59 - sets forth CF 17-79.

SEQ ID NO:60 - sets forth CF 19-20.

SEQ ID NO:61 - sets forth CF 19-19.

SEQ ID NO:62 - sets forth CF 19-22.

SEQ ID NO:63 - sets forth CF 19-21.

SEQ ID NO:64 - sets forth CF 17-80.

SEQ ID NO:65 - sets forth sgRNA cpa5.

SEQ ID NO:66 - sets forth sgRNA cpa5.

SEQ ID NO:67 - sets forth locus A upstream homology region (UHR).

SEQ ID NO:68 - sets forth locus A downstream homology region (DHR).

SEQ ID NO:69 - sets forth the cbh2 promoter. SEQ ID NO:70 - sets froth the cbh1 catalytic core (E229Q) and linker.

SEQ ID NO:71 - sets forth the kexin site.

SEQ ID NO:72 - sets forth the trpC terminator.

SEQ ID NO:73 - sets forth sgRNA locus A.

SEQ ID NO:74 - sets forth the cpa5 right flank.

SEQ ID NO:75 - sets forth the sdil marker.

SEQ ID NO:76 - sets forth the cpa5 left flank.

SEQ ID NO:77 - sets forth RPG2641.

SEQ ID NO:78 - sets forth RPG2594.

SEQ ID NO:79 - sets forth RPG2642.

SEQ ID NO:80 - sets forth RPG2537.

SEQ ID NO:81 - sets forth the als marker.

SEQ ID NO: 82 - sets forth TR0004946_slp6.

SEQ ID NO:83 - sets forth TR0004988_slp6.

SEQ ID NO:84 - sets forth TR0491140_ampl.

SEQ ID NO:85 - sets forth TR0491227_ampl.

SEQ ID NO:86 - sets forth TR0839906_Tr22210.

SEQ ID NO:87 - sets forth TR0839982_Tr22210.

SEQ ID NO:88 - sets forth TR2093782_slp3.

SEQ ID NO: 89 - sets forth TR2093819_slp3.

SEQ ID NO:90 - sets forth RPG2732.

SEQ ID NO:91 - sets forth RPG2733.

SEQ ID NO:92 - sets forth RPG2736.

SEQ ID NO:93 - sets forth RPG2737.

SEQ ID NO:94 - sets forth RPG2738.

SEQ ID NO:95 - sets forth RPG2739.

SEQ ID NO:96 - sets forth RPG2740.

SEQ ID NO:97 - sets forth RPG2741.

SEQ ID NO:98 - sets forth sucA marker.

SEQ ID NO:99 - sets forth gSK96_pep2.

SEQ ID NO: 100 - sets forth gSK97_pep2.

SEQ ID NO: 101 - sets forth TR1266711_sed2.

SEQ ID NO: 102 - sets froth TR1266752_sed2.

SEQ ID NO: 103 - sets forth TR3505404_cpa5. SEQ ID NO: 104 - sets forth TR3505523_cpa5.

SEQ ID NO: 105 - sets forth the cbh1 catalytic core and linker

SEQ ID NO: 106 - sets forth the sdil marker.

SEQ ID NO: 107 - sets forth TR3881664_gefl.

SEQ ID NO: 108 - sets forth TR3882135_gefl.

SEQ ID NO: 109 - sets forth RPG2752.

SEQ ID NO: 110 - sets forth RPG2618.

SEQ ID NO: 111 - sets forth RPG2734.

SEQ ID NO: 112 - sets forth RPG2735.

SEQ ID NO: 113 - sets forth RPG2742.

SEQ ID NO: 114 - sets forth RPG2743.

SEQ ID NO: 115 - sets forth HOX full length.

SEQ ID NO: 116 - sets forth HOX mature.

SEQ ID NO: 117 - sets forth GOX mature.

SEQ ID NO: 118 - sets forth BS3 mature.

SEQ ID NO: 119 - sets forth WAAA249 mature.

SEQ ID NO: 120 - sets forth NBA mature.

SEQ ID NO: 121 - sets forth SAS3 mature.

SEQ ID NO: 122 - sets forth Maltogenic amylase variant VERON MAXIMA mature.

SEQ ID NO: 123 - sets forth WAAA245 mature.

SEQ ID NO: 124 - sets forth BASI codon optimized DNA.

DESCRIPTION OF FIGURES

Figure 1A depicts crusty roll specific volume (ccm/g) presented as a function of optimal dosage of Lipopan F (relative dosing based on mg protein/kg flour).

Figure IB depicts crusty roll specific volume (ccm/g) presented as a function of dosage of CRC08319.

Figure 2A depicts dough lipid profiling using Lipopan F.

Figure 2B depicts dough lipid profiling using CRC08319.

Figure 3 depicts sponge & dough relative specific volume as effect of ‘CRC08319 + Powerbake 4080 with and without presence of SOLEC F.

Figures 4A and 4B shows schematic diagrams of two phospholipase CRC08319 expression cassettes for Trichoderma expression. The cassettes begin with a region corresponding to the promoter sequence of Trichoderma cbh1 (SEQ ID NO:46). This is followed by the Trichoderma pepl signal sequence interrupted by a Trichoderma glal intron (SEQ ID NO:47), which is then fused in-frame to the coding sequence for the phospholipase CRC08319 pro-enzyme (SEQ ID NO:48). This is followed by the Trichoderma cbh1 terminator (SEQ ID NO:49). At the far right end is the selection marker, either the Trichoderma pyr2 gene (A, SEQ ID NO:50) or the Aspergillus amdS gene (B, SEQ ID NO:51). Numbering above the diagrams correspond to base pair numbers.

Figure 5 shows a bar graph of Residual Activities of the phospholipase expressed from Trichoderma strain AWG09 in ten independent 14L fermentations (y axis). Broth supernatants were incubated for about one day at 33 °C and residual activity was calculated relative to incubation at 4°C (x axis). The dotted line indicates the average.

Figure 6 shows a schematic diagram of the B ASI expression cassette for targeted integration at yhƒN locus and expression in Bacillus. The cassette begins with a region homologous to the yhƒN locus in Bacillus subtilis (SEQ ID NO:52). This is followed by an engineered rrnI promoter (SEQ ID NO:53) to drive expression of an aprE signal sequence (SEQ ID NO:54) fused in-frame to the codon optimized coding sequence of BASI (SEQ ID: 55). This is followed by BPN’ terminator sequence (SEQ ID NO:56) and the air A selection marker (SEQ ID NO:57). Numbering above the diagrams correspond to base pair numbers. The position of the primers used for PCR and circularization of the cassette (CF 17-79 and CF 17-80) are also diagrammed.

Figure 7 shows a box plot of Residual Activities of the phospholipase expressed from Trichoderma strain AWG09 in 14L fermentors with and without the addition of Bacillus expressed BASI. Broth supernatants were incubated for 18 hours at 33 °C and residual activity was calculated relative to incubation at 4°C. Statistics are present in the table below the box plot. The Comparison Circles on the right show that sample population with BASI addition are statistically different from those without BASI addition at an alpha level of 0.1.

Figure 8 shows a schematic diagram of the BASI expression cassette for targeted integration at locus A and Trichoderma expression. The cassette begins and ends with homology regions for targeting the cassette to locus A (upstream homology region, SEQ ID NO:67 and downstream homology region, SEQ ID NO:68). Between the homology regions is the BASI expression cassette and amdS selection marker (“amdS gene”, SEQ ID NO:51). The portion for BASI expression is composed of a cbh2 promoter (SEQ ID NO: 69), the coding sequence of cbh1 catalytic core and linker (“cbh1_core”, SEQ ID NO:70), a kexin cleavage promoting sequence (“Kex”, SEQ ID NO: 71), a codon optimized coding sequence for mature BASI (SEQ ID: 23) and an Aspergillus trpC terminator (SEQ ID: 72). Numbering above the diagrams correspond to base pair numbers.

Figure 9 shows SDS-PAGE analysis of filtrates from microtiter plate fermentations of Trichoderma strains expressing phospholipase, BASI and control strains. More particularly, as shown in Figure 9, lane 5 is Invitrogen SeeBlue Plus 2 molecular weight marker with approximate molecular weights on the far right of the figure. Lane 1 is from strain AZP79pp which shows the background proteins still expressed in this Trichoderma host. Lane 2 is from strain BBS89, which additionally expresses phospholipase CRC08319. Lanes 3 and 4 are from transformants of BBS89 additionally expressing BASI and its Cbh1_core fusion partner. Approximate migration of Cbh1_core, BASI and CRC08319 proteins is labeled on the far left of the figure.

Figure 10 shows a box plot of Residual Activities of the phospholipase expressed from parent BBS89 or two sets of transformants derived thereof with the BASI expression cassette (BASI1 and BASI2) after incubation for 3 days at 33C relative to incubation at 4C. Statistics are given in a table below the box plot. The Comparison Circles on the right show that the BASI expressing transformant populations are statistically different from the parental BBS89 at an alpha level of 0.05.

Figure 11 shows a box plot of Residual Activities of the phospholipase expressed from parent BBX71 or two sets of transformants derived thereof after incubation for 3 days at 33C relative to incubation at 4C. One set of transformants had a BASI expression cassette inserted at the geƒ1 locus (BASI), and the other set had only the selection marker integrated at the geƒ1 locus (marker only). Statistics are given in a table below the box plot. The Comparison Circles on the right show that the populations are statistically different from each other at an alpha level of 0.1.

Figure 12 depicts crusty Roll specific volume (ccm/g) presented as function of dosage of Phospholipase 8319 mature, active fragment dosage, where lowest dosage tested is represented as 1 and additional dosages are represented by fold (x) relative to lowest dosage.

Figure 13 shows volume response of xylanase Bs3 in combination with CRC08319 mature, active fragment and POWERBake 4080 in crusty roll application measuring specific volume.

Figure 14 shows volume response of xylanase Bs3 in combination with CRC08319 mature, active fragment and POWERBake 4080 in Tweedy white toast application measuring specific volume unshocked and shocked. Figure 15 shows volume response of Glucose oxidase GOX (listed as SEQ ID NO: 117 and used as product Grindamyl® S 860) in combination with CRC08319 mature, active fragment and POWERBake 4080 in Tweedy white toast application measuring specific volume unshocked and shocked.

Figure 16 shows volume response of Hexose oxidase HOX (listed as SEQ ID NO: 116 and used as product Grindamyl® SUREBake 800) in combination with CRC08319 mature, active fragment and POWERBake 4080 in Tweedy white toast application measuring specific volume unshocked and shocked.

Figure 17 demonstrates pasting temperature of RVA samples containing CRC08319 in combination with different amylases. CRC08319 on its own provides a higher pasting temperature compared to control dough. Surprisingly, when CRC08319 is present in combination with amylases an even higher pasting temperature is observed.

DETAILED DESCRIPTION

Abbreviations

NAPE - N-acyl phosphatidylethanolamine

NALPE - N-acyl lysophosphatidylethanolamine

NAGPE - N-acyl glycerophosphoethanolamine

DGDG - digalactosyldiglyceride

DGMG - digalactosylmonoglyceride

MGDG - monogalactosyldiglyceride

MGMG - monogalactosylmonoglyceride

PC - phosphatidylcholine

LPC - lysophosphatidylcholine

PLA - phospholipase A

DATEM - diacetyl tartaric acid ester of mono- and diglycerides

Definitions

The term “amino acid sequence” is synonymous with the terms “polypeptide,” “protein,” and “peptide,” and are used interchangeably. Where such amino acid sequences exhibit activity, they may be referred to as an “enzyme.” The conventional one-letter or three- letter codes for amino acid residues are used, with amino acid sequences being presented in the standard amino-to-carboxy terminal orientation (i.e., N→C). The term “nucleic acid” encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding a polypeptide. Nucleic acids may be single stranded or double stranded. The terms “nucleic acid” and “polynucleotide” are used interchangeably. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present compositions and methods encompass nucleotide sequences that encode a particular amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in 5'-to-3' orientation.

A “vector” refers to a polynucleotide sequence designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.

An “expression vector” refers to a DNA construct comprising a DNA sequence encoding a polypeptide of interest, which coding sequence is operably linked to a suitable control sequence capable of effecting expression of the DNA in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites on the mRNA, enhancers and sequences which control termination of transcription and translation.

The term “barley a-amylase/subtilisin inhibitor” or “BASI” is an inhibitor of a-amylase from barley and of serine proteases of the subtilisin family. In some embodiments, BASI comprises the amino acid sequence of SEQ ID NO:58. In other embodiments, BASI may have at least about 50% sequence identity to SEQ ID NO:58 or it may comprise a sequence having at least about 50% sequence identity to residues 67-96 of SEQ ID NO: 58. The identity may particularly be at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 98% identical to residues 67-96 of SEQ ID NO:58.

In addition to the specific amino acid sequences and polynucleotides mentioned herein, the present invention encompasses variants, homologues, derivatives and fragments thereof. The term "variant" is used to mean a nucleotide sequence or amino acid sequence which differs from a wild-type sequence.

For example, a variant may include substitutions, insertions, deletions, truncations, transversions and/or inversions at one or more position(s) relative to a wild-type sequence. Variants can be made using methods known in the art for example site scanning mutagenesis, insertional mutagenesis, random mutagenesis, site-directed mutagenesis and directed- evolution as well as using recombinant methods well known in the art. Polynucleotide sequences encoding variant amino acid sequences may readily be synthesized using methods known in the art.

In some aspects, the variant is a naturally occurring nucleotide sequence or amino acid sequence which differs from a wild-type sequence. For example, the variant may be a natural genetic variant.

In some aspects, the variant is an engineered variant. For example, the variant may be engineered by recombinant methods.

The protein sequences of the instant invention may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other as set forth in Table 3.

Table 3.

The present invention also encompasses homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) that may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Non-homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements may also be made by synthetic amino acids (e.g. unnatural amino acids) include; alpha* and alpha-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-Cl-phenylalanine*, p- Br-phenylalanine*, p-l-phenylalanine*, L-allyl-glycine*, B-alanine*, L-a-amino butyric acid*, L-g-amino butyric acid*, L-a-amino isobutyric acid*, L-e-amino caproic acid ^# , 7-amino heptanoic acid*, L- methionine sulfone ^# *, L-norleucine*, L-norvaline*, p-nitro-L- phenylalanine*, L-hydroxyproline ^# , L-thioproline*, methyl derivatives of phenylalanine (Phe) such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino) ^# , L-Tyr (methyl)*, L-Phe (4- isopropyl)*, L-Tic (l,2,3,4-tetrahydroisoquinoline-3-carboxyl acid)*, L-diaminopropionic acid ^# and L-Phe (4-benzyl)*.

The notation * has been utilised for the purpose of the discussion above (relating to homologous or non-homologous substitution), to indicate the hydrophobic nature of the derivative whereas # has been utilised to indicate the hydrophilic nature of the derivative, #* indicates amphipathic characteristics.

Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or b-alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, “the peptoid form” is used to refer to variant amino acid residues wherein the a-carbon substituent group is on the residue’s nitrogen atom rather than the a-carbon. Processes for preparing peptides in the peptoid form are known in the art, for example Simon RJ et al., PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

The nucleotide sequences for use in the present invention may include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of nucleotide sequences of the present invention. The present invention also encompasses the use of nucleotide sequences that are complementary to the sequences presented herein.

Other variants of the sequences described herein may be obtained for example by probing DNA libraries made from a range of individuals, for example individuals from different populations. In addition, other homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein. Such sequences may be obtained by probing cDNA libraries or genomic DNA libraries made from other animal species and probing such libraries with probes comprising all or part of any one of the sequences in the attached sequence listings under conditions of medium to high stringency. Similar considerations apply to obtaining species homologues and allelic variants of the polypeptide or nucleotide sequences of the invention.

Variants and strain/species homologues may also be obtained using degenerate PCR which will use primers designed to target sequences within the variants and homologues encoding conserved amino acid sequences within the sequences of the present invention. Conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants/homologues. Sequence alignments can be performed using computer software known in the art. For example the GCG Wisconsin PileUp program is widely used.

The primers used in degenerate PCR will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.

Alternatively, such polynucleotides may be obtained by site directed mutagenesis of characterised sequences. This may be useful where for example silent codon sequence changes are required to optimise codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.

The present invention employs, unless otherwise indicated, conventional techniques of biochemistry, molecular biology, microbiology and recombinant DNA, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N. Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; and, D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is herein incorporated by reference.

As used herein, “percent (%) sequence identity” means that a particular sequence has at least a certain percentage of amino acid residues identical to those in a specified reference sequence, when aligned using the CLUSTAL W algorithm with default parameters. See Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680. Default parameters for the CLUSTAL W algorithm are: Gap opening penalty: 10.0

Gap extension penalty: 0.05

Protein weight matrix: BLOSUM series DNA weight matrix: IUB

Delay divergent sequences %: 40 Gap separation distance: 8

DNA transitions weight: 0.50

List hydrophilic residues: GPSNDQEKR

Use negative matrix: OFF

Toggle Residue specific penalties: ON Toggle hydrophilic penalties: ON Toggle end gap separation penalty: OFF

Deletions are counted as non-identical residues, compared to a reference sequence. Deletions occurring at either terminus are included. For example, a variant with five amino acid deletions of the C-terminus of the mature 617 residue polypeptide would have a percent sequence identity of 99% (612 I 617 identical residues x 100, rounded to the nearest whole number) relative to the mature polypeptide. Such a variant would be encompassed by a variant having “at least 99% sequence identity” to a mature polypeptide.

As used herein, the term “lipase” refers to triacylglycerol lipases as defined by enzyme entry EC 3.1.1.3. Lipases catalyse the hydrolysis of triacylglycerols to give free fatty acids (saturated or unsaturated), diacylglyerols, monoacylglycerols and glycerol.

As used herein, the term “phospholipase” refers to an enzyme that hydrolyses phospholipids into fatty acids (saturated or unsaturated), lysophospholipids, diacylgycerols, choline phosphate and phophatidates, depending on the site of hydrolysis. Phospholipases are further classified into types A, B, C and D.

In accordance with the instant invention, proteins, including enzymes, of the present invention exist in multiple forms. Proteins of the instant invention may be clipped or trimmed (i.e., removing amino acids) from the N-terminus and/or the C-terminus, resulting in a shorter protein. Proteins of the instant invention can also have internal deletions. Shorter proteins as described herein can have higher activity or lower activity than longer counterparts. Without being bound by theory, as used herein the term “pre-pro-protein” is a protein, including an enzyme, which has an N-terminal signal peptide that targets the protein for secretion. A pre- pro-protein is sometimes referred to herein as “full length” or “full length protein”. The N- terminal signal peptide is cleaved off in the endoplasmic reticulum to yield a “pro-protein”. A pro-protein, as used herein, is shorter in length than the full length protein (it is missing the signal peptide) but longer than the mature protein. In general, a pro-protein is inactive or less active than the mature protein. A pro-protein can be activated or converted to a more active mature form by post-translational modification such as N- or C- terminal clipping. A proprotein which is an enzyme may be called a “proenzyme” or a “zymogen.” The clipped active protein (derived from the pro-protein) is also referred to herein as the mature protein. It is to be noted that the above terms are used for convenience and are not meant to override or determine the activities of a protein of the instant invention. It is also to be noted that any particular protein of the instant invention can have more than one variant described by the same term.

As used herein, the term “phospholipase A” refers to enzymes that catalyse the hydrolysis of the ester bond of the fatty acid components of phospholipids. There are two different types of phospholipase A activity that can be distinguished. Phospholipase Al, as defined in enzyme entry EC 3.1.1.32, and phospholipase A2, as defined in enzyme entry EC 3.1.1.4, catalyse the deacylation of one fatty acyl group in the sn1 and sn2 positions, respectively, from a diacylglycerophospholipid to produce lysophospholipid.

Phospholipase Al and A2 catalyze the deacylation of one fatty acid group in the sn1 and sn2 positions, respectively. Hence, phospholipase Al (also sometimes referred to herein as PLA1) hydrolyzes the 1-acyl group of a phospholipid, hydrolyzing the bond between the fatty acid and the glycerin residue at the one position. Phospholipase A2 (also sometimes referred to herein as PLA2) catalyzes hydrolysis of the 2-acyl group.

Hydrolysis of a phospholipid by a phospholipase produces a compound termed a lysophospholipid. Thus, selective hydrolysis of a phospholipid with a phospholipase Al produces a 2-acyl lysophospholipid. Hydrolysis of a phospholipid with a phospholipase A2 produces a 1-acyl lysophospholipid. Another phospholipase is a “lysophospholipase” which catalyzes the hydrolysis of the remaining fatty acyl group in the lysophospholipid.

A used herein, the phrase “an sn1/sn2 specificity ratio” is defined here as the relative PLA1 activity divided by the relative PLA2 activity as set forth more fully below.

As used herein, the phrase “a lysophospholipase/phospholipase activity ratio” means (LPC-U/mg protein) / (PC-U/mg protein) as set forth more fully below.

As used herein, the phrase “a NALPE/NAPE activity ratio” means (NALPE-U/mg protein) / (NAPE-U/mg protein) as set forth more fully below.

All references cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings of all references herein specifically referred to are incorporated by reference.

Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the present invention.

Other definitions are set forth below.

Production of enzymes

The enzymes of the present invention can be produced in host cells, for example, by secretion or intracellular expression. A cultured cell material (e.g., a whole-cell broth) having an enzyme can be obtained following secretion of the enzyme into the cell medium. Optionally, the enzyme can be isolated from the host cells, or even isolated from the cell broth, depending on the desired purity of the final enzyme. Suitable host cells include bacterial, fungal (including yeast and filamentous fungi), and plant cells (including algae). Particularly useful host cells include Aspergillus niger, Aspergillus oryzae or Trichoderma reesei. Other host cells include bacterial cells, e.g., Bacillus subtilis or B. licheniformis , as well as Streptomyces, E. coli.

Vectors

A DNA construct comprising a nucleic acid encoding an enzyme can be constructed to be expressed in a host cell. Because of the well-known degeneracy in the genetic code, variant polynucleotides that encode an identical amino acid sequence can be designed and made with routine skill. It is also well-known in the art to optimize codon use for a particular host cell. Nucleic acids encoding phospholipase can be incorporated into a vector. Vectors can be transferred to a host cell using well-known transformation techniques, such as those disclosed below.

The vector may be any vector that can be transformed into and replicated within a host cell. For example, a vector comprising a nucleic acid encoding an enzyme can be transformed and replicated in a bacterial host cell as a means of propagating and amplifying the vector. The vector also may be transformed into an expression host, so that the encoding nucleic acids can be expressed as a functional phospholipase. Host cells that serve as expression hosts can include filamentous fungi, for example. The Fungal Genetics Stock Center (FGSC) Catalogue of Strains lists suitable vectors for expression in fungal host cells. See FGSC, Catalogue of Strains, University of Missouri, at www.fgsc.net (last modified January 17, 2007). A representative vector is pJG153, a promoterless Cre expression vector that can be replicated in a bacterial host. See Harrison et al. (June 2011) Applied Environ. Microbiol. 77: 3916-22. pJG153can be modified with routine skill to comprise and express a nucleic acid encoding a phospholipase.

A nucleic acid encoding an enzyme can be operably linked to a suitable promoter, which allows transcription in the host cell. The promoter may be any DNA sequence that shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Exemplary promoters for directing the transcription of the DNA sequence encoding a phospholipase, especially in a bacterial host, are the promoter of the lac operon of E. coli, the Streptomyces coelicolor agarase gene dagA or celA promoters, the promoters of the Bacillus licheniformis a-amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus amyloliquefaciens a-amylase (amyQ), the promoters of the Bacillus subtilis xylA and xylB genes etc. For transcription in a fungal host, examples of useful promoters are those derived from the gene encoding Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral a-amylase, A. niger acid stable a-amylase, A. niger glucoamylase, Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase, or A. nidulans acetamidase. When a gene encoding an enzyme is expressed in a bacterial species such as E. coli, a suitable promoter can be selected, for example, from a bacteriophage promoter including a T7 promoter and a phage lambda promoter. Examples of suitable promoters for the expression in a yeast species include but are not limited to the Gal 1 and Gal 10 promoters of

Saccharomyces cerevisiae and the Pichia pastoris A0X1 or A0X2 promoters, cbh1 is an endogenous, inducible promoter from Trichoderma reesei. See Liu et al. (2008) “Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1 ) promoter optimization,” Acta Biochim. Biophys. Sin (Shanghai) 40(2): 158-65.

The coding sequence can be operably linked to a signal sequence. The DNA encoding the signal sequence may be the DNA sequence naturally associated with the phospholipase gene to be expressed or from a different Genus or species. A signal sequence and a promoter sequence comprising a DNA construct or vector can be introduced into a fungal host cell and can be derived from the same source. For example, the signal sequence is the cbh1 signal sequence that is operably linked to a cbh1 promoter.

An expression vector may also comprise a suitable transcription terminator and, in eukaryotes, polyadenylation sequences operably linked to the DNA sequence encoding a variant phospholipase. Termination and polyadenylation sequences may suitably be derived from the same sources as the promoter.

The vector may further comprise a DNA sequence enabling the vector to replicate in the host cell. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUBllO, pE194, pAMBl, and pIJ702.

The vector may also comprise a selectable marker, e.g., a gene the product of which complements a defect in the isolated host cell, such as the dal genes from B. subtilis or B. licheniformis, or a gene that confers antibiotic resistance such as, e.g., ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Furthermore, the vector may comprise Aspergillus selection markers such as amdS, argB, niaD and xx.s C, a marker giving rise to hygromycin resistance, or the selection may be accomplished by co-transformation, such as known in the art. See e.g., International PCT Application WO 91/17243.

Intracellular expression may be advantageous in some respects, e.g., when using certain bacteria or fungi as host cells to produce large amounts of phospholipase for subsequent enrichment or purification. Extracellular secretion of phospholipase into the culture medium can also be used to make a cultured cell material comprising the isolated phospholipase.

The expression vector typically includes the components of a cloning vector, such as, for example, an element that permits autonomous replication of the vector in the selected host organism and one or more phenotypically detectable markers for selection purposes. The expression vector normally comprises control nucleotide sequences such as a promoter, operator, ribosome binding site, translation initiation signal and optionally, a repressor gene or one or more activator genes. Additionally, the expression vector may comprise a sequence coding for an amino acid sequence capable of targeting the phospholipase to a host cell organelle such as a peroxisome, or to a particular host cell compartment. Such a targeting sequence includes but is not limited to the sequence, SKL. For expression under the direction of control sequences, the nucleic acid sequence of the phospholipase is operably linked to the control sequences in proper manner with respect to expression.

The procedures used to ligate the DNA construct encoding a phospholipase, the promoter, terminator and other elements, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (see, e.g., Sambrook et al. , MOLECULAR CLONING: A LABORATORY MANUAL, 2 ^nd ed., Cold Spring Harbor, 1989, and 3 ^rd ed., 2001).

Transformation and Culture of Host Cells

An isolated cell, either comprising a DNA construct or an expression vector, is advantageously used as a host cell in the recombinant production of an enzyme according to the instant invention. The cell may be transformed with the DNA construct encoding the enzyme, conveniently by integrating the DNA construct (in one or more copies) in the host chromosome. This integration is generally considered to be an advantage, as the DNA sequence is more likely to be stably maintained in the cell. Integration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g., by homologous or heterologous recombination. Alternatively, the cell may be transformed with an expression vector as described above in connection with the different types of host cells.

Examples of suitable bacterial host organisms are Gram positive bacterial species such as Bacillaceae including Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Geobacillus (formerly Bacillus) stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus lautus, Bacillus megaterium, and Bacillus thuringiensis; Streptomyces species such as Streptomyces murinus; lactic acid bacterial species including Lactococcus sp. such as Lactococcus lactis; Lactobacillus sp. including Lactobacillus reuteri; Leuconostoc sp.; Pediococcus sp.; and Streptococcus sp. Alternatively, strains of a Gram negative bacterial species belonging to Enterobacteriaceae including E. coli, or to Pseudomonadaceae can be selected as the host organism.

A suitable yeast host organism can be selected from the biotechnologically relevant yeasts species such as but not limited to yeast species such as Pichia sp., Hansenula sp., or Kluyveromyces, Yarrowinia, Schizosaccharomyces species or a species of Saccharomyces, including Saccharomyces cerevisiae or a species belonging to Schizosaccharomyces such as, for example, .S'. pombe species. A strain of the methylotrophic yeast species, Pichia pastoris, can be used as the host organism. Alternatively, the host organism can be a Hansenula species. Suitable host organisms among filamentous fungi include species of Aspergillus, e.g., Aspergillus niger, Aspergillus oryzae, Aspergillus tubigensis, Aspergillus awamori, or Aspergillus nidulans. Alternatively, strains of a Fusarium species, e.g., Fusarium oxysporum or of a Rhizomucor species such as Rhizomucor miehei can be used as the host organism. Other suitable strains include Thermomyces and Mucor species. In addition, Trichoderma sp. can be used as a host. A suitable procedure for transformation of Aspergillus host cells includes, for example, that described in EP 238023. An enzyme expressed by a fungal host cell can be glycosylated, i.e., will comprise a glycosyl moiety. The glycosylation pattern can be the same or different as present in the wild-type phospholipase. The type and/or degree of glycosylation may impart changes in enzymatic and/or biochemical properties.

It may be advantageous to delete genes from expression hosts, where the gene deficiency can be cured by the transformed expression vector. Known methods may be used to obtain a fungal host cell having one or more inactivated genes. Gene inactivation may be accomplished by complete or partial deletion, by insertional inactivation or by any other means that renders a gene nonfunctional for its intended purpose, such that the gene is prevented from expression of a functional protein. Any gene from a Trichoderma sp. or other filamentous fungal host that has been cloned can be deleted, for example, cbh1, cbh2, egll, and egl2 genes. Gene deletion may be accomplished by inserting a form of the desired gene to be inactivated into a plasmid by methods known in the art.

Introduction of a DNA construct or vector into a host cell includes techniques such as transformation; electroporation; nuclear microinjection; transduction; transfection, e.g., lipofection mediated and DEAE-Dextrin mediated transfection; incubation with calcium phosphate DNA precipitate; high velocity bombardment with DNA-coated microprojectiles; and protoplast fusion. General transformation techniques are known in the art. See, e.g. , Sambrook et al. (2001), supra. The expression of heterologous protein in Trichoderma is described, for example, in U.S. Patent No. 6,022,725. Reference is also made to Cao et al. (2000) Science 9:991-1001 for transformation of Aspergillus strains. Genetically stable transformants can be constructed with vector systems whereby the nucleic acid encoding an enzyme is stably integrated into a host cell chromosome. Transformants are then selected and purified by known techniques.

The preparation of Trichoderma sp. for transformation, for example, may involve the preparation of protoplasts from fungal mycelia. See Campbell et al. (1989) Curr. Genet. 16: 53-56. The mycelia can be obtained from germinated vegetative spores. The mycelia are treated with an enzyme that digests the cell wall, resulting in protoplasts. The protoplasts are protected by the presence of an osmotic stabilizer in the suspending medium. These stabilizers include sorbitol, mannitol, potassium chloride, magnesium sulfate, and the like. Usually, the concentration of these stabilizers varies between 0.8 M and 1.2 M, e.g., a 1.2 M solution of sorbitol can be used in the suspension medium.

Uptake of DNA into the host Trichoderma sp. strain depends upon the calcium ion concentration. Generally, between about 10-50 mM CaCl ₂ is used in an uptake solution. Additional suitable compounds include a buffering system, such as TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA) or 10 mM MOPS, pH 6.0 and polyethylene glycol. The polyethylene glycol is believed to fuse the cell membranes, thus permitting the contents of the medium to be delivered into the cytoplasm of the Trichoderma sp. strain. This fusion frequently leaves multiple copies of the plasmid DNA integrated into the host chromosome.

Usually, transformation of Trichoderma sp. uses protoplasts or cells that have been subjected to a permeability treatment, typically at a density of 10 ⁵ to 10 ⁷ /mL, particularly 2xlO ⁶ /mL. A volume of 100 μL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl ₂ ) may be mixed with the desired DNA. Generally, a high concentration of PEG is added to the uptake solution. From 0.1 to 1 volume of 25% PEG 4000 can be added to the protoplast suspension; however, it is useful to add about 0.25 volumes to the protoplast suspension. Additives, such as dimethyl sulfoxide, heparin, spermidine, potassium chloride and the like, may also be added to the uptake solution to facilitate transformation. Similar procedures are available for other fungal host cells. See, e.g., U.S. Patent No. 6,022,725.

As used herein, Protein Identification (“JGI PID”) numbers for native Trichoderma genes reference Version 2 of the Trichoderma reesei QM6a genome sequence assembly generated by the Department of Energy Joint Genome Institute (JGI). (The Genome Portal of the Department of Energy Joint Genome Institute, Grigoriev et al., Nucleic Acids Res 2012 Jan;40(Database issue):D26-32. doi: 10.1093/nar/gkr947). The JGI assembled Scaffold sequences and annotated genes have also been deposited in GeneBank (The National Center for Biotechnology) under the nucleotide accession numbers GL985056.1 through GL985132.1.

Expression

A method of producing an enzyme of the instant invention may comprise cultivating a host cell as described above under conditions conducive to the production of the enzyme and recovering the enzyme from the cells and/or culture medium. The medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in question and obtaining expression of a phospholipase. Suitable media and media components are available from commercial suppliers or may be prepared according to published recipes (e.g., as described in catalogues of the American Type Culture Collection).

An enzyme secreted from the host cells can be used in a whole broth preparation. In the present methods, the preparation of a spent whole fermentation broth of a recombinant microorganism can be achieved using any cultivation method known in the art resulting in the expression of a phospholipase. Fermentation may, therefore, be understood as comprising shake flask cultivation, small- or large-scale fermentation (including continuous, batch, fed- batch, or solid-state fermentations) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing the phospholipase to be expressed or isolated. The term “spent whole fermentation broth” is defined herein as unfractionated contents of fermentation material that includes culture medium, extracellular proteins (e.g., enzymes), and cellular biomass. It is understood that the term “spent whole fermentation broth” also encompasses cellular biomass that has been lysed or permeabilized using methods well known in the art.

An enzyme secreted from the host cells may conveniently be recovered from the culture medium by well-known procedures, including separating the cells from the medium by centrifugation or filtration, and precipitating proteinaceous components of the medium by means of a salt such as ammonium sulfate, followed by the use of chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like. The polynucleotide encoding an enzyme in a vector can be operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators. The control sequences may in particular comprise promoters.

Host cells may be cultured under suitable conditions that allow expression of a phospholipase. Expression of the enzymes may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression. In the case of inducible expression, protein production can be initiated when required by, for example, addition of an inducer substance to the culture medium, for example dexamethasone or IPTG or Sophorose. Polypeptides can also be produced recombinantly in an in vitro cell-free system, such as the TNT™ (Promega) rabbit reticulocyte system.

An expression host also can be cultured in the appropriate medium for the host, under aerobic conditions. Shaking or a combination of agitation and aeration can be provided, with production occurring at the appropriate temperature for that host, e.g., from about 25°C to about 75°C e.g., 30°C to 45°C), depending on the needs of the host and production of the desired phospholipase. Culturing can occur from about 12 to about 100 hours or greater (and any hour value there between, e.g., from 24 to 72 hours). Typically, the culture broth is at a pH of about 4.0 to about 8.0, again depending on the culture conditions needed for the host relative to production of a phospholipase.

Methods for Enriching and Purifying enzymes

Fermentation, separation, and concentration techniques are well known in the art and conventional methods can be used in order to prepare an enzyme polypeptide-containing solution.

After fermentation, a fermentation broth is obtained, the microbial cells and various suspended solids, including residual raw fermentation materials, are removed by conventional separation techniques in order to obtain an enzyme solution. Filtration, centrifugation, microfiltration, rotary vacuum drum filtration, ultrafiltration, centrifugation followed by ultra-filtration, extraction, or chromatography, or the like, are generally used.

It is desirable to concentrate an enzyme polypeptide-containing solution in order to optimize recovery. Use of unconcentrated solutions requires increased incubation time in order to collect the enriched or purified enzyme precipitate.

The enzyme containing solution is concentrated using conventional concentration techniques until the desired enzyme level is obtained. Concentration of the enzyme containing solution may be achieved by any of the techniques discussed herein. Exemplary methods of enrichment and purification include but are not limited to rotary vacuum filtration and/or ultrafiltration.

The enzyme solution is concentrated into a concentrated enzyme solution until the enzyme activity of the concentrated phospholipase polypeptide-containing solution is at a desired level.

Concentration may be performed using, e.g., a precipitation agent, such as a metal halide precipitation agent. Metal halide precipitation agents include but are not limited to alkali metal chlorides, alkali metal bromides and blends of two or more of these metal halides. Exemplary metal halides include sodium chloride, potassium chloride, sodium bromide, potassium bromide and blends of two or more of these metal halides. The metal halide precipitation agent, sodium chloride, can also be used as a preservative.

The metal halide precipitation agent is used in an amount effective to precipitate a phospholipase. The selection of at least an effective amount and an optimum amount of metal halide effective to cause precipitation of the enzyme, as well as the conditions of the precipitation for maximum recovery including incubation time, pH, temperature and concentration of enzyme, will be readily apparent to one of ordinary skill in the art, after routine testing.

Generally, at least about 5% w/v (weight/volume) to about 25% w/v of metal halide is added to the concentrated enzyme solution, and usually at least 8% w/v. Generally, no more than about 25% w/v of metal halide is added to the concentrated enzyme solution and usually no more than about 20% w/v. The optimal concentration of the metal halide precipitation agent will depend, among others, on the nature of the specific phospholipase polypeptide and on its concentration in the concentrated enzyme solution.

Another alternative way to precipitate the enzyme is to use organic compounds. Exemplary organic compound precipitating agents include: 4-hydroxy benzoic acid, alkali metal salts of 4-hydroxybenzoic acid, alkyl esters of 4-hydroxybenzoic acid, and blends of two or more of these organic compounds. The addition of the organic compound precipitation agents can take place prior to, simultaneously with or subsequent to the addition of the metal halide precipitation agent, and the addition of both precipitation agents, organic compound and metal halide, may be carried out sequentially or simultaneously.

Generally, the organic precipitation agents are selected from the group consisting of alkali metal salts of 4-hydroxybenzoic acid, such as sodium or potassium salts, and linear or branched alkyl esters of 4-hydroxybenzoic acid, wherein the alkyl group contains from 1 to 12 carbon atoms, and blends of two or more of these organic compounds. The organic compound precipitation agents can be, for example, linear or branched alkyl esters of 4- hydroxy benzoic acid, wherein the alkyl group contains from 1 to 10 carbon atoms, and blends of two or more of these organic compounds. Exemplary organic compounds are linear alkyl esters of 4-hydroxybenzoic acid, wherein the alkyl group contains from 1 to 6 carbon atoms, and blends of two or more of these organic compounds. Methyl esters of 4-hydroxybenzoic acid, propyl esters of 4-hydroxybenzoic acid, butyl ester of 4-hydroxybenzoic acid, ethyl ester of 4-hydroxybenzoic acid and blends of two or more of these organic compounds can also be used. Additional organic compounds also include but are not limited to 4- hydroxybenzoic acid methyl ester (named methyl PARABEN), 4-hydroxybenzoic acid propyl ester (named propyl PARABEN), which also are both preservative agents. For further descriptions, see, e.g., U.S. Patent No. 5,281,526.

Addition of the organic compound precipitation agent provides the advantage of high flexibility of the precipitation conditions with respect to pH, temperature, phospholipase concentration, precipitation agent concentration, and time of incubation.

The organic compound precipitation agent is used in an amount effective to improve precipitation of the enzyme by means of the metal halide precipitation agent. The selection of at least an effective amount and an optimum amount of organic compound precipitation agent, as well as the conditions of the precipitation for maximum recovery including incubation time, pH, temperature and concentration of enzyme, will be readily apparent to one of ordinary skill in the art, in light of the present disclosure, after routine testing.

Generally, at least about 0.01% w/v of organic compound precipitation agent is added to the concentrated enzyme solution and usually at least about 0.02% w/v. Generally, no more than about 0.3% w/v of organic compound precipitation agent is added to the concentrated enzyme solution and usually no more than about 0.2% w/v.

The concentrated polypeptide solution, containing the metal halide precipitation agent, and the organic compound precipitation agent, can be adjusted to a pH, which will, of necessity, depend on the enzyme to be enriched or purified. Generally, the pH is adjusted at a level near the isoelectric point of the phospholipase. The pH can be adjusted at a pH in a range from about 2.5 pH units below the isoelectric point (pl) up to about 2.5 pH units above the isoelectric point.

The incubation time necessary to obtain an enriched or purified enzyme precipitate depends on the nature of the specific enzyme, the concentration of enzyme, and the specific precipitation agent(s) and its (their) concentration. Generally, the time effective to precipitate the enzyme is between about 1 to about 30 hours; usually it does not exceed about 25 hours. In the presence of the organic compound precipitation agent, the time of incubation can still be reduced to less about 10 hours and in most cases even about 6 hours.

Generally, the temperature during incubation is between about 4°C and about 50°C. Usually, the method is carried out at a temperature between about 10°C and about 45°C e.g., between about 20 °C and about 40 °C). The optimal temperature for inducing precipitation varies according to the solution conditions and the enzyme or precipitation agent(s) used.

The overall recovery of enriched or purified enzyme precipitate, and the efficiency with which the process is conducted, is improved by agitating the solution comprising the enzyme, the added metal halide and the added organic compound. The agitation step is done both during addition of the metal halide and the organic compound, and during the subsequent incubation period. Suitable agitation methods include mechanical stirring or shaking, vigorous aeration, or any similar technique.

After the incubation period, the enriched or purified enzyme is then separated from the dissociated pigment and other impurities and collected by conventional separation techniques, such as filtration, centrifugation, microfiltration, rotary vacuum filtration, ultrafiltration, press filtration, cross membrane microfiltration, cross flow membrane microfiltration, or the like. Further enrichment or purification of the enzyme precipitate can be obtained by washing the precipitate with water. For example, the enriched or purified enzyme precipitate is washed with water containing the metal halide precipitation agent, or with water containing the metal halide and the organic compound precipitation agents.

During fermentation, an enzyme polypeptide accumulates in the culture broth. For the isolation, enrichment, or purification of the desired phospholipase, the culture broth is centrifuged or filtered to eliminate cells, and the resulting cell-free liquid is used for enzyme enrichment or purification. In one embodiment, the cell-free broth is subjected to salting out using ammonium sulfate at about 70% saturation; the 70% saturation-precipitation fraction is then dissolved in a buffer and applied to a column such as a Sephadex G-100 column and eluted to recover the enzyme-active fraction. For further enrichment or purification, a conventional procedure such as ion exchange chromatography may be used.

Enriched or purified enzymes can be made into a final product that is either liquid (solution, slurry) or solid (granular, powder).

Description of the Preferred Embodiments

In accordance with an aspect of the present invention, an isolated polypeptide is presented having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

In another aspect of the present invention, a method is presented of making a dough, said method comprising admixing a dough component selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45. More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the method of making a dough has the further step of adding at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Preferably, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Preferably, the amylase is an exoamylase.

Preferably, the exoamylase is a maltogenic amylase.

In other preferred embodiments of the invention, the exoamylase is a non- maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyses starch by cleaving off one or more linear malto-oligosaccharides, predominantly comprising from four to eight D- glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity.

Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18. In other preferred embodiments, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.

Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Preferably, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, a dough is presented having an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the dough has improved dough extensibility and/or stability.

In another aspect of the present invention, the dough has at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Preferably, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Preferably, the amylase is an exoamylase.

Preferably, the exoamylase is a maltogenic amylase.

In other preferred embodiments of the invention, the exoamylase is a non- maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyses starch by cleaving off one or more linear malto-oligosaccharides, predominantly comprising from four to eight D- glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

In other preferred embodiments, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.

Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Preferably, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, a method is presented of preparing a baked product comprising baking a dough as set forth above.

In another aspect of the present invention, a baked product is presented obtainable by the method as described above. Preferably, the baked product has at least one improved property selected from the group consisting of improved crumb pore size, improved uniformity of gas bubbles, no separation between crust and crumb, increased volume, increased crust crispiness and improved oven spring.

Preferably, the improved property is crust crispiness.

In another aspect of the present invention, a pre-mix for baking is presented having flour and an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the pre-mix has at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Preferably, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Preferably, the amylase is an exoamylase.

Preferably, the exoamylase is a maltogenic amylase.

In other preferred embodiments of the invention, the exoamylase is a non- maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyses starch by cleaving off one or more linear malto-oligosaccharides, predominantly comprising from four to eight D- glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin.

In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

In other preferred embodiments, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.

Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Preferably, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, a baking improver is provided having a granulate or agglomerated powder and an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27. Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the baking improver has at least one additional enzyme useful for improving dough and/or a baked product made therefrom.

Preferably, the additional enzyme is one or more of an amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, phospholipase which is different than said phospholipase Al, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.

Preferably, the amylase is an exoamylase.

Preferably, the exoamylase is a maltogenic amylase.

In other preferred embodiments of the invention, the exoamylase is a non- maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyses starch by cleaving off one or more linear malto-oligosaccharides, predominantly comprising from four to eight D- glucopyranosyl units, from the non-reducing ends of the side chains of amylopectin. In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or a 100% sequence identity to SEQ ID NO: 17 and/or SEQ ID NO: 18.

In other preferred embodiments, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.

Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 118.

Preferably, the glucose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 117.

Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity to SEQ ID NO: 116.

In another aspect of the present invention, an isolated polynucleotide is presented having a nucleic acid sequence encoding an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45. More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

In another aspect of the present invention, a recombinant expression vector is presented having a polynucleotide as described above.

In another aspect of the present invention, a host cell is presented having the recombinant expression vector as described above.

In another aspect of the present invention, a method is presented of modification of a phospholipid emulsifier having the step of treating the emulsifier with an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45. More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the phospholipid emulsifier is lecithin or lysolecithin.

In another aspect of the present invention, a method of creating a lysophospholipid in a lipid containing food matrix is presented having the step of adding to the lipid containing food matrix an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27. Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the lipid containing food matrix is selected from the group consisting of eggs and food products containing eggs, dough for sweet bakery goods, processed meat, milk based products, and vegetable oil.

In another aspect of the present invention, a recombinant cell is presented having a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) a heterologously expressed protein.

Preferably, the heterologously expressed protein is an aminopeptidase, alpha-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, alpha-galactosidase, betagalactosidase, glucose oxidase (GOX), alphaglucosidase, beta-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase . mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, alpha- 1 ,6-transglucosidase, transglutaminase, urokinase, xylanase, or beta-xylosidase. More preferably, the heterologously expressed protein is a phospholipase.

Still more preferably, the phospholipase is an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or a mammalian cell.

Preferably, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthera.

More preferably, the recombinant cell is Trichoderma reesei.

In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus ory ae.

In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila or Bacillus licheniformis.

Preferably, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.

In another aspect of the present invention, a fermentation broth is presented having a recombinant cell as described above.

In another aspect of the present invention, a method for decreasing proteolysis of a heterologously expressed protein is presented having the step of culturing a recombinant cell comprising a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) the heterologously expressed protein under suitable conditions for production of the heterologously expressed protein and the BASI polypeptide.

Preferably, the method includes the step of isolating the heterologous protein.

Preferably, the heterologously expressed protein is an aminopeptidase, alpha-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, alpha-galactosidase, betagalactosidase, glucose oxidase (GOX), alphaglucosidase, beta-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase . mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase , proteolytic enzyme, ribonuclease, alpha- 1 ,6-transglucosidase, transglutaminase, urokinase, xylanase, or beta-xylosidase.

More preferably, the heterologously expressed protein is a phospholipase. Still more preferably, the phospholipase is an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.

Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or a mammalian cell.

Preferably, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthera.

More preferably, the recombinant cell is Trichoderma reesei.

In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila or Bacillus licheniformis.

Preferably, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.

In another aspect of the present invention, a method for decreasing proteolysis of a recombinantly expressed protein is presented having the step of isolating the recombinantly expressed protein in the presence of an exogenously added barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

Preferably, the method includes the step of isolating the heterologous protein.

Preferably, the heterologously expressed protein is an aminopeptidase, alpha-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, alpha-galactosidase, betagalactosidase, glucose oxidase (GOX), alphaglucosidase, beta-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase . mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase , proteolytic enzyme, ribonuclease, alpha- 1 ,6-transglucosidase, transglutaminase, urokinase, xylanase, or beta-xylosidase.

More preferably, the heterologously expressed protein is a phospholipase. Still more preferably, the phospholipase is an isolated polypeptide having phospholipase Al activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with at least 95% sequence identity to SEQ ID NO: 27.

Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

More preferably, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27. Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or a mammalian cell.

Preferably, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthera.

More preferably, the recombinant cell is Trichoderma reesei.

In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila or Bacillus licheniformis.

Preferably, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.

ASSAYS and METHODS

Enzyme characterization assays - Activity assays and Assay for the Determination of phospholipase position specificity

PC-P assay:

Phospholipase activity (PC-U) may be determined using the following assay:

Substrate: 1.71% L-a-phosphatidylcholine Soy (95%) (Avanti 441601G, Avanti Polare Lipids, USA), 6.25% TRITON™-X 100 (Sigma X-100), and 5 mM CaCl ₂ were dissolved in 0.05 M HEPES buffer pH 7.

Assay procedure:

Samples, calibration sample, and control sample were diluted in 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analysis was carried out using 96 well microtiter plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30°C. 200 μL substrate was thermostated for 180 seconds at 30°C, before 50 μL of enzyme sample was added. Enzymation lasted 600 sec. The amount of free fatty acid liberated during enzymation was measured using the NEFA kit obtained from WakoChemicals GmbH, Germany).

This assay kit is composed of two reagents

NEFA-HR(1):

50 mM Phosphate buffer pH 7.0 containing

0.53 U/mL Acyl-CoA Synthase (ACS)

0.31 mM coenzyme A (Co A)

4.3 mM adenosine 5 -triphosphate disodium salt (ATP) 1.5 mM 4-amino-antipyrine (4-AA)

2.6 U/mL Ascorbate oxidase (AOD)

0.062 % Sodium azide

NEFA-HR(2) :

2.4 mM 3-Methyl-N-Ethyl-N-(E-Hydroxyethyl)-Aniline (MEHA)

12 U/mL Acyl-CoA oxidase (ACOD)

14 U/mL Peroxidase (POD)

After incubation 10 μl enzymation mixture was transferred to a new micro titer plate containing 150 μL NEFA-HR(l) and incubated for 240 sec at 30°C. Afterwards 75 μL NEFA-HR(2) was added and the mixture was incubated for 240 sec at 30°C. OD 540 nm was then measured.

Enzyme activity (pmol FFA/(min mL)) was calculated based on a calibration curve made form oleic acid. Enzyme activity PC-U was calculated as micromole fatty acid produced per milliliter volume of enzyme sample per minute under assay conditions.

Enzyme activity (pmol/(min-mL)) = OD* 250 μl * D

S * 50 μl* 10 min

OD = OD of sample withdrawn OD of blind sample

250 μl = total volume of substrate and enzyme

50 μl = Volume of enzyme solution

D = dilution of sample

S = the slope of the calibration curve (OD/(pmol/mL))

10 = reaction time of enzymation (min)

LC-MC:

The samples were analyzed as intact proteins by CapLC-MS. The only sample preparation was a lOx dilution in 6 M Guanidinium hydrochloride, 50 mM Ammonium bicarbonate pH 7.0.

Masses corresponding to the major components, were extracted from deconvoluted (Calculated mass of a protein molecule, using the full envelope of a protein, detected at several charge states. The Xtract function in Thermo Xcalibur Qual Browser is used for deconvolution) MS spectra, and used for calculating the relative ratio between major components.

CapLC-ESI-MS instruments:

• Agilent CapLC system: H2O 99.9% / Formic acid 1‰ • Solvent B: ACN 99.9% / Formic acid 1‰ • Column: 10 cm, ID 75 µm – 3 µm C18-A2 • MS-instrument: LTQ Orbitrap, high-resolution mass spectrometer (Thermo Finnigan) Chromatographic conditions, CapLC S ^ystem Agilent 1100 CapLC system (Agilent Technologies) Column Waters; XBridge Protein L x D: 150 mm, 2.1 Å MS conditions MS method Setting Description Capillary temperature 330°C 60 LPC-P assay:

Lyso-Phospholipase activity (LPC-U) may be determined using the following assay:

Substrate: 1.18% l-oleoyl-2-hydroxy-sn-glycero-3-phosphocholine (Avanti 845875P, Avanti Polar lipid, USA), 6.25% TRITON™-X 100 (Sigma X-100), and 5 mM CaCl ₂ were dissolved in 0.05 M HEPES buffer pH 7.

Assay procedure:

Samples, calibration sample, and control sample were diluted in 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analysis was carried out using 96 well micro titer plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30°C. 200 μL substrate was thermostated for 180 seconds at 30°C, before 50 μL of enzyme sample was added. Enzymation lasted 600 sec. The amount of free fatty acid liberated during enzymation was measured using the NEFA kit obtained from WakoChemicals GmbH, Germany).

This assay kit is composed of two reagents

NEFA-HR(l) :

50 mM Phosphate buffer pH 7.0 containing

0.53 U/mL Acyl-CoA Synthase (ACS)

0.31 mM coenzyme A (Co A)

4.3 mM adenosine 5 -triphosphate disodium salt (ATP)

1.5 mM 4-amino-antipyrine (4-AA)

2.6 U/mL Ascorbate oxidase (AOD)

0.062 % Sodium azide

NEFA-HR(2) :

2.4 mM 3-Methyl-N-Ethyl-N-(E-Hydroxyethyl)-Aniline (MEHA)

12 U/mL Acyl-CoA oxidase (ACOD)

14 U/mL Peroxidase (POD)

After incubation 10 μl enzymation mixture was transferred to a new micro titer plate containing 150 μL NEFA-HR(l) and incubated for 240 sec at 30°C. Afterwards 75 μL NEFA-HR(2) was added and the mixture was incubated for 240 sec at 30°C. OD 540 iim was then measured.

Enzyme activity (pmol FFA/(min-mL)) was calculated based on a calibration curve made form oleic acid. Enzyme activity LPC-U was calculated as micromole fatty acid produced per milliliter volume of enzyme sample per minute under assay conditions. Enzyme activity (pmol/(min-mL)) = OD* 250 ul * D

S * 50 μl* 10 min

OD = OD of sample withdrawn OD of blind sample 250 μl = total volume of substrate and enzyme 50 μl = Volume of enzyme solution

D = dilution of sample

S = the slope of the calibration curve (OD/(pmol/mL))

10 = reaction time of enzy mation (min)

NAPE-P assay:

NAPE Phospholipase activity (NAPE-U) may be determined using the following assay: Substrate: 2.25% Palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine-N-lin oleoyl (16:0-18:2 PE-N18:2) (Avanti 792003, Avanti Polar lipid, USA), 6.25% TRITON™-X 100 (Sigma X-100), and 5 mM CaCl ₂ were dissolved in 0.05 M HEPES buffer pH 7.

Assay procedure:

Samples, calibration sample, and control sample were diluted in 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analysis was carried out using 96 well micro titer plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30°C. 200 μL substrate was thermostated for 180 seconds at 30°C, before 50 μL of enzy1e sample was added. Enzymation lasted 600 sec. The amount of free fatty acid liberated during enzymation was measured using the NEFA kit obtained from WakoChemicals GmbH, Germany).

This assay kit is composed of two reagents

NEFA-HR(1) :

50 m Phosphate buffer pH 7.0 containing

0.53 U/mL Acyl-CoA Synthase (ACS)

0.31 mM coenzyme A (Co A)

4.3 mM adenosine 5 -triphosphate disodium salt (ATP)

1.5 mM 4-amino-antipyrine (4-AA)

2.6 U/mL Ascorbate oxidase (AOD)

0.062 % Sodium azide

NEFA-HR(2) :

2.4 mM 3-Methyl-N-Ethyl-N-(E-Hydroxyethyl)-Aniline (MEHA)

12 U/mL Acyl-CoA oxidase (ACOD) 14 U/mL Peroxidase (POD)

After incubation 10 μl enzymation mixture was transferred to a new micro titer plate containing 150 μL NEFA-HR(l) and incubated for 240 sec at 30°C. Afterwards 75 μL NEFA-HR(2) was added and the mixture was incubated for 240 sec at 30°C. OD 540 nm was then measured.

Enzyme activity (pmol FFA/min-mL) was calculated based on a calibration curve made form oleic acid. Enzyme activity NAPE-U pH 7 was calculated as micromole fatty acid produced per minute under assay conditions.

Enzyme activity (pmol FFA/(min-mL)) was calculated based on a calibration curve made form oleic acid. Enzyme activity NAPE-U was calculated as micromole fatty acid produced per milliliter volume of enzyme sample per minute under assay conditions.

Enzyme activity (μmol/(min mL)) = OD * 250 μl * D

S * 50 μl* 10 min

OD = OD of sample withdrawn OD of blind sample 250 μl = total volume of substrate and enzyme 50 μl = Volume of enzyme solution

D = dilution of sample

S = the slope of the calibration curve (OD/(μmol/mL))

10 = reaction time of enzymation (min)

NALPE-P assay:

NALPE Phospholipase activity (NALPE-U) may be determined using the following assay: Substrate: 1.68% 1-palmitoyl-sn-glycero-3-phosphoethanolamine-N-linoleoyl (16:0- NALPE- N18:2), (Avanti 791759, Avanti Polar Lipids, USA), 6.25% TRITON™-X 100 (SigmaX-100), and 5 mM CaCl ₂ were dissolved in 0.05 M HEPES buffer pH 7.

Assay procedure:

Samples, calibration sample, and control sample were diluted in 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analysis was carried out using 96 well micro titer plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30°C. 200 μL substrate was thermostated for 180 seconds at 30°C, before 50 μL of enzyme sample was added. Enzymation lasted 600 sec. The amount of free fatty acid liberated during enzymation was measured using the NEFA kit obtained from WakoChemicals GmbH, Germany).

This assay kit is composed of two reagents

NEFA-HR(l) :

50 mM Phosphate buffer pH 7.0 containing

0.53 U/mL Acyl-CoA Synthase (ACS)

0.31 mM coenzyme A (Co A)

4.3 mM adenosine 5 -triphosphate disodium salt (ATP)

1.5 mM 4-amino-antipyrine (4-AA)

2.6 U/mL Ascorbate oxidase (AOD)

0.062 % Sodium azide

NEFA-HR12) :

2.4 mM 3-Methyl-N-Ethyl-N-(E-Hydroxyethyl)-Aniline (MEHA)

12 U/mL Acyl-CoA oxidase (ACOD)

14 U/mL Peroxidase (POD)

After incubation 10 μl enzymation mixture was transferred to a new micro titer plate containing 150 μL NEFA-HR(l) and incubated for 240 sec at 30°C. Afterwards 75 μL NEFA-HR(2) was added and the mixture was incubated for 240 sec at 30°C. OD 540 nm was then measured.

Enzyme activity (pmol FFA/(min-mL)) was calculated based on a calibration curve made form oleic acid. Enzyme activity NALPE-U was calculated as micromole fatty acid produced per milliliter volume of enzyme sample per minute under assay conditions.

Enzyme activity (pmol/(min-mL)) = OD* 250 ul * D

S * 50 μl* 10 min

OD = OD of sample withdrawn OD of blind sample

250 μl = total volume of substrate and enzyme

50 μl = Volume of enzyme solution

D = dilution of sample

S = the slope of the calibration curve (OD/(pmol/mL))

10 = reaction time of enzymation (min)

Assay for the Determination of phospholipase activity and sn1 and sn2 position specificity on PC (phosphatidylcholine) Substrate: 0.6% 16:0-18:1 PC, l-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (Avanti 850457, Avanti Polar Lipids, USA), 0.4% TRITON™-X 100 (Sigma, X-100), and 5 mM CaCl ₂ were dissolved in 0.05 M HEPES buffer pH 7.

Assay procedure:

2 mL substrate was incubated at 30°C and added 0.1 ml of an enzyme dilution corresponding to 2-10% substrate consumed after 10 minutes reaction in 0.05 M HEPES buffer (magnetic stirring).

40 μL 4 M HC1 was added to stop the reaction and to protonate the free fatty acids. 1 mL 99% ethanol was added and mixed on a Vortex mixer. 5 mL MTBE (methyl tert-butyl ether) containing 0.5 mg C17:0 fatty acid (margaric acid) was added. The sample was mixed again on a Vortex mixer for 5 sec and extracted for 30 minutes on a rotamixer (Stuart Rotartor SB2) at 25 rpm. The sample was centrifuged at 1520 g for 10 minutes.

One 500 mg amine (NH2) - Bond Elut SPE column (Agilent) was placed on a Bond Elut Vacuum System. The column was conditioned with 8 mL Petroleum-ether. The MTBE phase from the extraction was applied onto the column and eluted with:

1. fraction 8 mL Solvent A: MTBE:2-propanol (2:1)

2. fraction 8 mL Solvent B: Acetone: Formic acid (100:2)

The solvents were eluted with approx. 0.25 mL/min.

The collected fatty acid fraction (fract. 2) was evaporated to dryness and fatty acids were analyzed by GLC. Based on the internal standard Fatty Acid C 17:0 the amount of Cl 6:0 and Cl 8: 1 fatty acid was determined.

Enzyme activity was calculated as pmol fatty acid produced per minutes under assay conditions.

Enzyme activity = 2 x A x 1000000 x D

100 x MW x 10 x 0.1

Where

A = % C16:0 fatty acid + % C18:l fatty acids

2 = mL substrate

1000000 = mol conversion to pmol

D = Enzyme dilution factor

MW = average molecular weight of C16:0 and C18:l fatty acids produced

10 = minutes reaction time

0.1 = mL enzyme added to assay The relative PLA1 enzyme activity was calculated as:

Relative PLA1 activity = % 06:0 x 100

% 06:0+% 08:1

The relative PLA2 enzyme activity was calculated as:

Relative PLA2 activity = % 08:1 x 100

% 06:0+% 08:1

The sn1/sn2 specificity ratio is presented as:

Snl/sn2 specificity ratio = Relative PLA1 activity / Relative PLA2 activity

Assay for the Determination of phospholipase activity and sn1 and sn2 position specificity on NAPE (N-acyl phosphatidylethanolamine)

Substrate: 0.79% 16:0-18:2 (PE-N18:2) NAPE Palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine-N-linoleoyl (Avanti 792003, Avanti Polar lipid, USA), 0.4% TRfTON™-X 100 (Sigma, X-100), and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.

Assay procedure:

2 mL substrate was incubated at 30°C and added 0.1 ml of an enzyme dilution corresponding to 2-10% substrate consumed after 10 minutes reaction in 0.05 M HEPES buffer (magnetic stirring).

40 μL 4 M HC1 was added to stop the reaction and to protonate the free fatty acids. 1 mL 99% ethanol was added and mixed on a Vortex mixer. 5 mL MTBE (methyl tert-butyl ether) containing 0.5 mg C17:0 fatty acid (margaric acid) was added. The sample was mixed again on a Vortex mixer for 5 sec and extracted for 30 minutes on a rotamixer (Stuart Rotartor SB2) at 25 rpm. The sample was centrifuged at 1520 g for 10 minutes.

One 500 mg amine (NH2) - Bond Elut SPE column (Agilent) was placed on a Bond Elut Vacuum System. The column was conditioned with 8 mL Petroleum-ether. The MTBE phase from the extraction was applied onto the column and eluted with:

1. fraction 8 mL Solvent A: MTBE:2-propanol (2:1)

2. fraction 8 mL Solvent B: Acetone: Formic acid (100:2)

The solvents were eluted with approx. 0.25 mL/min.

The collected fatty acid fraction (fract. 2) was evaporated to dryness and fatty acids were analyzed by GLC. Based on the internal standard Fatty Acid C17:0 the amount of C16:0 and Cl 8:2 fatty acid was determined.

Enzyme activity was calculated as pmol fatty acid produced per minutes under assay conditions.

Enzyme activity = 2 x A x 1000000 x D

100 x MW x 10 x 0.1

Where

A = % C16:0 fatty acid + % C18:2 fatty acids

2 = mL substrate

1000000 = mol conversion to pmol

D = Enzyme dilution factor

MW = average molecular weight of C16:0 and C18:l fatty acids produced

10 = minutes reaction time

0.1 = mL enzyme added to assay

The relative PLA1 enzyme activity was calculated as:

Relative PLA1 activity = % 06:0 x 100

% 06:0+% 08:2

The relative PLA2 enzyme activity was calculated as:

Relative PLA2 activity = % C18:2 x 100

% 06:0+% 08:2

The sn1/sn2 specificity ratio is presented as:

Snl/sn2 specificity ratio = Relative PLA1 activity / Relative PLA2 activity

Gaschromatography (GLC):

Free fatty acid was analyzed by GLC as trimethyl silyl derivatives (TMS).

Apparatus

• Perkin Elmer Clarus 600 Capillary Gas Chromatograph equipped with WCOT fused silica column 12.5 m x 0.25mm ID x 0.1μ film thickness 5% phenyl-methyl-silicone (CP Sil 8 CB from Chrompack).

• Carrier gas: Helium.

• Injector: PSSI cold split injection (initial temp 90°C heated to 395 °C), volume l.Opl

• Detector FID: 395 °C

Oven program: 1 2 3 4

Oven temperature, °C 80 200 240 360

Isothermal, time, min 2 0 0 10 Temperature rate, °C/min 20 10 12

Sample preparation:

Evaporated sample is dissolved in 1.5 ml Heptane:Pyridine, 2: 1. 500 μl sample solution is transferred to a crimp vial, 100 μl MSTFA (N-Methyl-N-trimethylsilyl-trifluoraceamid) is added and reacted for 15 minutes at 60°C.

Baking applications

Crusty Roll baking setup

Recipe Bakers %

Wheat flour (Reform) 100

Compressed yeast (Malteserkors) 4.5

Salt 1.6

Sugar 1.6

Water (400 BU-2%) 57

Fungal alpha amylase (16.2 FAU/g blend) 0.46

Other Enzymes variable

Kneading on a Diosna spiral mixer. Water uptake for flour according to analysis: 400 BU -2% Procedure

Mix all ingredients in a bowl, 1 minute slow speed - add water and knead 2 minutes slow and 6.5 minutes fast speed. Dough temperature must be approximate 26°C. 1350 g dough is scaled and molded round by hand. The dough is rested in a heating cabinet for 10 minutes at 30°C.

The dough is molded into 30 dough balls on a “GLIMIK™ rounder” - settings according to table on machine.

The dough is proofed for 45 minutes at 34°C, 85% RH and baked for 13 minutes at 200°C / 2 1 steam + 5 minutes damper open (MIWE oven prog. 1). After baking the rolls are cooled for 25 minutes at ambient temperature before weighing and measuring of volume.

Dough and bread characteristics are evaluated by a skilled person

Sponge & Dough baking setup

Recipe Bakers %

SPONGE

Polar Bear flour 70

Compressed yeast (Malteserkors) 2.25

Water 65 % of total Water amount (400 BU) Sponge total 112.55 %

DOUGH

Polar Bear flour 30

Salt 1.5

Compressed yeast (Malteserkors) 0.67

Ascorbic acid 60 ppm

Sugar 8

Rapeseed Oil 2

Water 35 % of total Water amount (400 BU)

SUREBake 800 (IFF) 50 ppm

Other Enzymes variable, for example one or more of alphaamylase, hexose oxidase and xylanase

Kneading on a Hobart mixer.

Procedure

Sponge: Mix all ingredients in a bowl 1 minute at 1st speed - 3 minutes at 2nd speed. Sponge temperature must be approximate 25.5°C. Ferment sponge for 3 hours at 30°C, 85% RH in an unlidded bowl.

Dough: Mix sponge and all remaining ingredients except salt for 2 minutes at low speed, then 3 minutes at medium speed (use ice water). Add salt and mix 3 minutes at medium speed. Scale 450 g dough pieces and mould (underscaled - normal scale 550 g dough). Rest dough for 10 minutes at ambient temperature. Mould on Benier MS 500 with setting:

Preform -16

Drum press 3

Pressureboard front 4.0 (3.5 for shock)

Pressureboard back 3.5 (3.1 for shock)

Width front 330, back 290

Put dough into greased tins and proof 70 minutes (prolonged proofing - normal proofing 60 min) at 43 °C, 95% RH. Shock half of the loaves by dropping the dough containing tin on a table twice from a height of 6.5 cm. Bake for 26 minutes at 200°C (MIWE oven prog. 4). Take breads out of tins and cool for 70 minutes before weighing and measuring of volume. Dough and bread characteristics are evaluated by a skilled person. Extraction of dough lipids.

Sample of fully proofed dough was frozen and freeze dried. The dry dough was the grounded and sieved. 1.5 g grounded, sifted sample was mixed with 1.5 g carrier (Diatomaceous earth, Thermo Scientific, P/N: 60-033854) and transferred into an ASE 10 ml sample tube. Extraction was carried out using Dionex ASE350 (Thermo Scientific) at 40°C with water saturated butanol as solvent and a static run time of 10 minutes. After extraction, the solvent was evaporated using Scan Speed 40 (Scanvac, Labogene APS) at 60°C and 1000 rpm. The dried lipid was dissolved in 3.75 ml Heptane: Isopropanol (3:2).

HPLC analysis of phospholipids extracted from dough:

The dough lipid samples were analyzed by liquid chromatography using a Charged Aerosol Detector. The column was a normal phase column (DIOL), and the mobile phase was a gradient of A: acetone/methanol 96/4 with addition of 1 mM ammonium formate and B: acetone/methanol/H2O 60/34/6 with addition of 1 mM ammonium formate.

NALPE was used as standard for quantification.

Instrumental:

Dionex Ultimate 3000 UHPLC, Thermo Scientific

VANQOISH Detector, Thermo Scientific

Column: Fortis HILIC Diol, 1.7 pm, 50 x 2.1 mm

Chromatographic:

Column temperature was 30°C and injection volume was 4 μL.

Sample preparation:

Lipid was extracted from dough as described in ‘Extraction of dough lipids’ and filtered through 0.45 μM filter before being injected.

Calculation:

Cromeleon software was used to integrate the chromatograms and molar concentration of NAPE, NALPE and NAGPE was calculated based on a NALPE standard curve. Presentation of results:

Respective lipid levels of NAPE, NALPE and NAGPE were obtained by initially normalizing the respective molar level of each component to the ‘Average Total molar lipid (NAPE + NALPE + NAGPE)’ across all doughs. Following, respective lipid levels are presented relative to NAPE level in the Negative control (no enzyme added). Thus, NAPE starts (Negative control) at 1. NALPE and NAGPE are presented as levels generated relative to NAPE start level.

RVA analyses

To perform RVA analyses, samples were prepared using Brabender Farinograph AACC Method No.54-2 and Reform wheat flour. The water content was adjusted to 400 BU in the control sample. Same water content as in control sample was used for all samples containing enzymes. Dough sample was developed and frozen in liquid nitrogen. For RVA analysis dough was thawed and homogenized in distilled water using an Ultra-Turex T25Basic, IKA Labortechnik. RVA analysis was conducted using Rapid Visco analyzer RVA-2 Stand Alone from Newport Scientific from Calibre control International ltd., Appleton, Warrington, UK. RVA analysis profile was run from 40°C to 95°C over 28 min. Data was analyzed using Thermocline software program.

White Toast baking setup

Recipe Bakers %

Wheat flour (Falcon) 100.0

Compressed yeast (Malteserkors) 3.0

Salt 1.8

Ascorbic acid 0.01

Water (400 BU-4%) 57.5

Fungal alpha amylase (16.2 FAU/g blend) 0.014

Other Enzymes variable

Mix on a Tweedy K5 mixer. Water uptake for flour according to analysis: 400 BU -4% Procedure

Add all dry ingredients to the mixer, then add water, and start mixing (Mixing energy 11.5 Watt hours/kg at 400rpm, -0.6 bar). Dough temperature must be approximate 29°C. Rest dough for 5 minutes at ambient temperature under cloth. Scale 700g dough pieces and mold round by hand. Rest dough for 5 minutes at ambient temperature under cloth. Then, mold dough on Benier MS500 at following settings: Preform: -18, Drum Press:3, Pressureboard: 4.5 cm front, 4.0 cm Back, With: 370mm front, 340 mm back. Add molded doughs into 10x10x30cm tins and proof for 70 minutes at 40°C, 70% RH. Shock half of the loaves by dropping the dough containing tin on a table twice from a height of 6.5 cm. Bake at 205°C for 30 minutes. Cool breads for 70 minutes at ambient temperature before measuring weight and volume. Dough and bread characteristics are evaluated by a skilled person.

CHEMICAL STRUCTURES In below structures Rl, R2 and R3 are C12-C24 hydrocarbons. The C12-24 hydrocarbons are either saturated or unsaturated. Rl, R2 and R3 may be identical or different hydrocarbons.

PC

LPC or

NAPE NALPE or

It should be kept in mind that the following described embodiment(s) is only presented by way of example and should not be construed as limiting the inventive concept to any particular enzyme.

EXAMPLES EXAMPLE 1 - CRC08310 - ThaPla1

Cloning of Trichoderma harzianum phospholipase ThaPla1 (CRC08310)

A putative phospholipase gene, designated as CRC08310, was identified in Trichoderma harzianum, and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: KKO98756.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-110, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08310 is provided in SEQ ID NO: 19. The corresponding protein encoded by the full-length CRC08310 gene is shown in SEQ ID NO:1. At the N-terminus, the protein has a signal peptide with a length of 16 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785- 786). The presence of a signal sequence suggests that CRC08310 is a secreted enzyme. The pro-protein sequence of CRC08310 is set forth in SEQ ID NO: 2.

EXAMPLE 2 - Expression of CRC08310

The codon-optimized synthetic DNA sequence encoding the full-length CRC08310 protein (SEQ ID NO: 19) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08310. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08310 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08310 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media. EXAMPLE 3 - CRC08316 - PfiPla1

Cloning of Pestalotiopsis fici W106-1 phospholipase PfiPla1 (CRC08316)

A putative phospholipase gene, designated as CRC08316, was identified in Pestalotiopsis fici W106-1 and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: ETS81250.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08316 is provided in SEQ ID NO: 20. The corresponding protein encoded by the full-length CRC08316 gene is shown in SEQ ID NOG. At the N-terminus, the protein has a signal peptide with a length of 18 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785- 786). The presence of a signal sequence suggests that CRC08316 is a secreted enzyme. The pro-protein sequence of CRC08316 is set forth in SEQ ID NO: 4.

EXAMPLE 4 - Expression of CRC08316

The codon-optimized synthetic DNA sequence encoding the full-length CRC08316 protein (SEQ ID NO: 20) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08316. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08316 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest. The pGXT-CRC08316 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtering, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with the loading buffer containing 20 mM sodium acetate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium acetate (pH 5.0) and a gradient of 0.5 - 0.3 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a HiLoad Q_HP Sepharose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted from the column with 20 mM Tris buffer (pH 8.0) and a NaCl gradient of 0-0.4 M. The fractions containing the active target protein were then pooled and concentrated via the 10K Amicon Ultra devices and stored in 20 mM Tris buffer (pH 8.0) and 40% glycerol at -20 °C until usage.

EXAMPLE 5 - CRC08319 - MguPla1

Cloning of Metarhizium guizhouense ARSEF 977 phospholipase MguPla1 (CRC08319)

A putative phospholipase gene, designated as CRC08319, was identified in Metarhizium guizhouense ARSEF 977 and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: KID92477.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403—410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08319 is provided in SEQ ID NO: 21. The corresponding protein encoded by the full-length CRC08319 gene is shown in SEQ ID NO: 5. At the N-terminus, the protein has a signal peptide with a length of 16 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of a signal sequence suggests that CRC08319 is a secreted enzyme. The pro-protein sequence of CRC08319 is set forth in SEQ ID NO: 6. EXAMPLE 6 - Expression of CRC08319 The codon-optimized synthetic DNA sequence encoding the full-length CRC08319 protein (SEQ ID NO: 21) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08319. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08319 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08319 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtering, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with the loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0) and 0.25 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a Superdex 75 gel filtration column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0) supplemented with additional 0.15 M NaCl and 10% glycerol. The fractions containing the active target protein were then pooled and concentrated via the 10K Amicon Ultra devices and stored in 20 mM sodium phosphate buffer (pH 7.0) supplemented with 0.15 M NaCl and 40% glycerol at -20 °C until usage.

EXAMPLE 7 - CRC08405 - DamPla1

Cloning of Diaporthe ampelina phospholipase DamPla1 (CRC08405)

A putative phospholipase gene, designated as CRC08405, was identified in Diaporthe ampelina and encodes a protein with 100% identity to a sequence available from the NCB1 database (NCBI accession No.: KKY36548.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-110, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08405 is provided in SEQ ID NO: 22. The corresponding protein encoded by the full-length CRC08405 gene is shown in SEQ ID NO: 7. At the N-terminus, the protein has a signal peptide with a length of 18 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of a signal sequence suggests that CRC08405 is a secreted enzyme. The pro-protein sequence of CRC08405 is set forth in SEQ ID NO: 8.

EXAMPLE 8 - Expression of CRC08405

The codon-optimized synthetic DNA sequence encoding the full-length CRC08405 protein (SEQ ID NO: 22) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08405. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08405 contains the Trichoderma reesei cbh1 -derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08405 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtering, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with the loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0). The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a HiPrep Q-XL Sepharose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with 20 mM Tris buffer (pH 8.0) and a NaCl gradient of 0 - 0.5 M. The fractions containing the active target protein were then pooled and concentrated via the 10K Amicon Ultra devices and stored in 20 mM Tris buffer (pH 8.0) supplemented with 0.15 M NaCl and 40% glycerol at - 20 °C until usage.

EXAMPLE 9 - CRC08418 - MorPla3

Cloning of Magnaporthe oryzae Y34 phospholipase MorPla3 (CRC08418)

A putative phospholipase gene, designated as CRC08418, was identified in Magnaporthe oryzae Y34 and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: ELQ41978.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08418 is provided in SEQ ID NO: 23. The corresponding protein encoded by the full-length CRC08418 gene is shown in SEQ ID NO: 9. At the N-terminus, the protein has a signal peptide with a length of 25 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785- 786). The presence of a signal sequence suggests that CRC08418 is a secreted enzyme. The pro-protein sequence of CRC08418 is set forth in SEQ ID NO: 10. EXAMPLE 10 - Expression of CRC08418

The codon-optimized synthetic DNA sequence encoding the full-length CRC08418 protein (SEQ ID NO: 23) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC0418. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08418 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08418 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 0.8 M. After filtering, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with the loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0). The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a Superdex 75 gel filtration column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0) with 0.15 M NaCl (pH 7.0). The fractions containing the active target protein were then pooled and concentrated via the 10K Amicon Ultra devices and stored in 20 mM sodium phosphate buffer (pH 7.0) with 0.15 M NaCl (pH 7.0) and 40% glycerol at -20 °C until usage.

EXAMPLE 11 - CRC08826 - NdiPla1

Cloning of Neonectria ditissima phospholipase NdiPla1 (CRC08826)

A putative phospholipase gene, designated as CRC08826, was identified in Neonectria ditissima and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: KPM45012.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08826 is provided in SEQ ID NO: 24. The corresponding protein encoded by the full-length CRC08826 gene is shown in SEQ ID NO: 11. At the N-terminus, the protein has a signal peptide with a length of 16 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of a signal sequence suggests that CRC08826 is a secreted enzyme. The pro-protein sequence of CRC08826 is set forth in SEQ ID NO: 12.

EXAMPLE 12 - Expression of CRC08826

The codon-optimized synthetic DNA sequence encoding the full-length CRC08826 protein (SEQ ID NO: 24) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08826. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08826 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08826 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtering, the resulting soluble fraction was applied to a HiPrep Phenyl FF 16/10 column pre-equilibrated with the loading buffer containing 20 mM sodium phosphate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 5.0) and a gradient of 0.5 - 0 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a HiPrep Q FF 16/10 column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0). The target protein was eluted with 20 mM sodium phosphate buffer (pH 7.0) and a NaCl gradient of 0 - 0.5 M. The fractions containing the active target protein were then pooled, concentrated and subsequently loaded onto a HiLoad 26/60 Superdex 75 Prep column pre-equilibrated with 20 mM sodium acetate (pH 5.0) and 150 mM NaCl. The fractions containing the active target protein were pooled, concentrated and loaded onto a HiPrep Phenyl HP 16/10 column pre-equilibrated with the loading buffer containing 20 mM sodium phosphate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted with 20 mM sodium phosphate (pH 5.0) and a gradient of 0.75 - 0 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated via the 10K Amicon Ultra devices, and stored in 20 mM sodium phosphate (pH 5.0) and 40% glycerol at -20 °C until usage.

EXAMPLE 13 - CRC08833 - TgaPla1

Cloning of Trichoderma gamsii phospholipase TgaPla1 (CRC08833)

A putative phospholipase gene, designated as CRC08833, was identified in Trichoderma gamsii, and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: KUF04745.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08833 is provided in SEQ ID NO: 25. The corresponding protein encoded by the full-length CRC08833 gene is shown in SEQ ID NO: 13. At the N-terminus, the protein has a signal peptide with a length of 16 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of a signal sequence suggests that CRC08833 is a secreted enzyme. The pro-protein sequence of CRC08826 is set forth in SEQ ID NO: 14.

EXAMPLE 14 - Expression of CRC08833

The codon-optimized synthetic DNA sequence encoding the full-length CRC08833 protein (SEQ ID NO: 25) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08833. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08833 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08833 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99). Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtering, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with the loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0) and 0.5 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a HiLoad Q_XL Sepharose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with 20 m Tris buffer (pH 8.0) and a NaCl gradient of 0 - 0.5 M. The fractions containing the active target protein were then pooled and concentrated via the 10K Amicon Ultra devices and stored in 20 mM Tris buffer (pH 8.0) and 40% glycerol at -20 °C until usage.

EXAMPLE 15 - CRC08845 - ManPla1

Cloning of Metarhizium anisopliae BRIP 53293 phospholipase ManPla1 (CRC08845)

A putative phospholipase gene, designated as CRC08845, was identified in Metarhizium anisopliae BRIP 53293 and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession No.: KJK84204.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215: 403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08845 is provided in SEQ ID NO: 26. The corresponding protein encoded by the full-length CRC08845 gene is shown in SEQ ID NO: 15. At the N-terminus, the protein has a signal peptide with a length of 17 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785- 786). The presence of a signal sequence suggests that CRC08845 is a secreted enzyme. The pro-protein sequence of CRC08845 is set forth in SEQ ID NO: 16.

EXAMPLE 16 - Expression of CRC08845

The codon-optimized synthetic DNA sequence encoding the full-length CRC08845 protein (SEQ ID NO: 26) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTTpyr2 vector described in published PCT Application WO2015/017256, incorporated by reference herein), resulting in plasmid pGXT- CRC08845. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of transformants on acetamide as a sole nitrogen source, and the Trichoderma reesei telomere regions allow for non-chromosomal plasmid maintenance in a fungal cell. pGXT-CRC08845 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator regions allowing for a strong inducible expression of the gene of interest.

The pGXT-CRC08845 plasmid was then transformed into a suitable Trichoderma reesei strain (method described in published PCT application WO 05/001036) using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99).

Transformants were selected on a solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g/L; cesium chloride 1.68 g/L; glucose 20 g/L; potassium dihydrogen phosphate 15 g/L; magnesium sulfate heptahydrate 0.6 g/L; calcium chloride dihydrate 0.6 g/L; iron (II) sulfate 5 mg/L; zinc sulfate 1.4 mg/L; cobalt (II) chloride 1 mg/L; manganese (II) sulfate 1.6 mg/L; agar 20 g/L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, transformants were picked and transferred individually to acetamide agar plates. After 5 days of growth on acetamide plates, transformants displaying stable morphology were inoculated in 200 μL glucose/sophorose defined media in 96- well microtiter plates. The microtiter plate was incubated in an oxygen growth chamber at 28 °C for 5 days. Supernatants from these cultures were used to confirm the protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250-mL shake flask with Glucose/Sophorose defined media.

The crude broth was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtering, the resulting soluble fraction was applied to a Butyl FF column pre-equilibrated with the loading buffer containing 20 mM sodium acetate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium acetate (pH 5.0) and a gradient of 0.3 - 0 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated and subsequently loaded onto a Q HP column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0). The target protein was eluted with 20 mM sodium phosphate buffer (pH 7.0) and a NaCl gradient of 0 - 0.5 M. The fractions containing the active target protein were then pooled, concentrated and subsequently loaded onto a Q HP column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with 20 mM Tris buffer (pH 8.0) and a NaCl gradient of 0 - 0.5 M. The fractions containing the active target protein were then pooled, concentrated via the 10K Amicon Ultra devices, and stored in 20 mM Tris buffer (pH 8.0), 0.15 M NaCl and 40% glycerol at -20 °C until usage.

Example 17. Characterization of phospholipases of the present invention relative to Powerbake 4080 and Lipopan F

Enzyme characterization is done by determination of specific activity using different lipid substrates as per activity methods presented in ‘Assays and Methods’. Powerbake 4080 is a commercial product of IFF. Powerbake 4080 acts on a polar lipid at the sn1 position. The active enzyme component of Powerbake 4080 is set forth as SEQ ID NO: 6 from US Patent No. 8,012,732 hereby incorporated by reference (also set forth herein as SEQ ID NO: 17). This enzyme is known to have both galactolipase and phospholipase activity. Lipopan F is a commercial product of Novozymes. The active enzyme in Lipopan F acts on polar lipid at the sn1 position and is in SEQ ID NO: 2 of EP0869167B hereby incorporated by reference (also set forth herein as SEQ ID NO: 18). This enzyme is also known to have galactolipase activity.

Specific activities are determined using phosphatidylcholine substrate (PC-P assay), lyso-phosphatidylcholine substrate (LPC-P assay), N-acyl phosphatidylethanolamine substrate (NAPE-P assay) and lyso-N-acyl phosphatidylethanolcholine substrate (NALPE-P assay). Activities are presented relative to protein concentration, presenting the specific activity of the various enzymes using different substrates - see Table 1. Table 1. Specific activities of enzyme (activity unit/mg enzyme protein)

As can be seen from Table 1 all enzymes (except Powerbake 4080 and Lipopan F) show very low specific activity for LPC and NALPE substrate. The ratio of LPC to PC as well as ratio of NALPE to NAPE activity is presented in Table 2.

Table 2. Ratio of specific activity for LPC to PC (LPC-U/PC-U) and NALPE to NAPE (NALPE-U/NAPE-U). More specifically LPC-U/PC-U = (LPC-U/mg protein) / (PC-U/mg protein) and NALPE-U/NAPE-U = (NALPE-U/mg protein) / (NAPE-U/mg protein).

It is clear from Table 2, that the candidates tested show significantly lower activity towards the lysophospholipid substrate relative to phospholipid substrates than the existing marketed enzyme products such as Powerbake 4080 and Lipopan F.

The candidates evaluated surprisingly represent a new group of phospholipases - ‘No-lyso- phospholipases’ - which are characterized by having No or extremely low lyso-phospholipase activity.

Current marketed products show LPC-U/PC-U or NALPE-U/NAPE-U ratios above respectively 0.014 and 0.13, whereas in contrast the ‘No-lyso-phospholipases’ show ratios below respectively, 0.002 and 0.0016. Thus, the ratios of the ‘No-lyso-phospholipases’ are lower than the current marketed products by a factor of 7 and 90, respectively.

This characteristic of ‘No-lyso-phospholipase’ activity provides the opportunity for a more robust system generating emulsifying components in lipid containing food matrices. The ‘No-lyso-phospholipases’ provide more robust systems by elimination of the risk of over dosage as is seen with current marketed enzymes. The ‘No-lyso-phospholipases’ enable the generation of emulsifying components without risking the degradation of the generated emulsifying components (lyso-phospholipid like i.e., LPC or NALPE). Thus, the ‘roll-over effect’ observed with current marketed enzymes, where the lyso-phospholipid components are not only generated but also further hydrolyzed/degraded, is eliminated providing potential for overall higher levels of emulsifying components.

Example 18. Characterization of phospholipase position specificity.

Enzyme position specificity was characterized by determination of free fatty acid (FFA) liberation from specific designed PC and NAPE substrate. FFA determination was done by GLC analysis as presented in ‘Gaschromatography (GLC)’ after the Assay for the Determination of phospholipase activity and sn1 and sn2 position specificity on PC (phosphatidylcholine)’ and ‘Assay for the Determination of phospholipase activity and sn1 and sn2 position specificity on NAPE (N-acyl phosphatidylethanolamine)’ under ‘Assays and Methods’.

The specificity was determined by assaying the release of free fatty acids (FFA) by GLC analysis. Based on the internal standard (Fatty Acid C17:0) the amount respectively C16:0 and C18: 1 fatty acid with the PC assay and C16:0 and C18:2 fatty acid with the NAPE assay was determined. Position specificity is presented as % relative PLA1 and % relative PLA2 activity. Please refer to Table 3 (A and B) for specificity identification of the different candidates using respectively the PC and the NAPE position specificity assay.

Table 3A. Position specificity of Phospholipases as determined by ‘Assay for the Determination of phospholipase activity and sn1 and sn2 position specificity on PC (phosphatidylcholine)’ and presentation of ratio sn1/sn2.

Table 3B. Position specificity of Phospholipases as determined by ‘Assay for the Determination of phospholipase activity and sn1 and sn2 position specificity on NAPE (N- acyl-phosphatidylethanolamine)’ and presentation of ratio sn1/sn2.

Example 19. Baking experiments testing application effect and dough lipid profiling of ‘No-lyso-phospholipases’ vs marketed phospholipase Lipopan F

In this experiment, the current marketed phospholipase product Lipopan F was tested in a Crusty Roll experimental setup to show application performance by increasing dosages and the correlating lipid profiling of the dough matrix. Additionally, the application performance and dough lipid profiling of the ‘No-lyso-phospholipase’ CRC08319 was tested in comparison.

The Crusty Roll baking was done according to ‘Crusty Roll’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trials and the results from the baking evaluation as well as dough lipid profiling is presented in respectively Table 4 (A and B), Figure 1 (A and B) and Figure 2 (A and B).

Table 4A and B. Experimental setup of enzyme dose-response test in Crusty Roll baking.

All dosages are presented as dosage relative to the optimal dosage of Lipopan F (relative based on mg protein/kg flour). The optimal dosage of Lipopan F is defined as the dosage giving the highest specific volume in the presented baking setup. The optimal Lipopan F dosage is presented by ‘1’, Negative controls is presented by ‘O’.

For example, Lipopan F dose-response Trial 2 (Table 4A): A Lipopan F dosage of 0.10 reflects that Lipopan F dosage in this trial was ‘0.10 x Optimal dosage of Lipopan F’ - or in other words, that Lipopan F dosage in this trial was 10 % of the dosages used in the trial showing the optimal dosage of Lipopan F (the trial showing the highest specific volume (Trial 4)).

Table 4A: Crusty roll bake - Lipopan F dose-response

Table 4B: Crusty roll bake - CRC08319 dose-response

Figure 1A depicts crusty Roll specific volume (ccm/g) presented as function of optimal dosage of Lipopan F.

Optimal dosage of Lipopan F is defined as Lipopan F dosage giving the highest specific volume in the presented baking setup - and optimal Lipopan F dosage is presented by ‘1’ . All other dosages presented are relative to the optimal Lipopan dosage (based on mg protein/kg flour). 0 represents Negative control. Dose response of Lipopan F. 0 represents Negative control (No enzyme added) and ‘1’ represents optimal Lipopan F dosage (= highest specific volume).

Figure 1B depicts dose response of ‘CRC08319 - No-lyso-phospholipase’ . 0 represents Negative control (No enzyme added) and CRC08319 dosages are presented relative to optimal Lipopan F dosage (relative dosage based on mg protein/kg flour).

Lipopan F show optimal dosage represented by ‘1 x Optimal dosing’. With increasing dosage Lipopan F show overdosing presented by a decrease in specific volume. In contrast, increasing dosage of CRC08319 show continued increase or levelling out in specific volume.

Fully fermented doughs were frozen, freeze dried and lipids in the dry dough were extracted with water saturated butanol and analyzed by HPLC according to procedure described in Assays and Methods. Results are shown in Figure 2.

Application effects on specific volume are supported by lipid profile. Current marketed product - Lipopan F - show hydrolysis of NAPE to NALPE, and at higher dosages further hydrolysis of NALPE to NAGPE aligning to a decrease in specific volumes. With 80 % hydrolysis of NAPE (NAPE reduced to 20 % of start level (Start level = 0 x Optimal dosing (Negative Ctrl)) Lipopan F show NALPE generation of around 60 %. This 80 % hydrolysis of NAPE and 60 % generation of NALPE correlates with optimal dosage (highest specific volume = 1 x Optimal dosage) of Lipopan F. Lipopan F shows alignment between specific volume and peak in NALPE levels. For Lipopan F it is evident that the peak in NALPE levels around 60 % is followed by reduction in NALPE at the higher dosages tested (dosages above optimal dosage (1)) aligning with formation of NAGPE. The highest levels of NAGPE are observed at the highest dosage Lipopan F.

In contrast, the ‘No-lyso-phospholipase’ - CRC08319 - show full conversion of NAPE to NALPE. At 80 % hydrolysis of NAPE (NAPE reduced to 20 % of start level), NALPE levels are at 80 %. With further hydrolysis of NAPE the ‘No-lyso-phospholipase’ show a continued increase or levelling out in NALPE levels which is also aligned with specific volume.

With full hydrolysis of NAPE (>90-95 % hydrolyzed) reaction equilibrium starts to show with continued increase or levelling out of the NALPE levels.

Even when the ‘No-lyso-phospholipase’ is dosed 20 x optimal dosage of Lipopan F corresponding to 4-6 fold the dosage of ‘No-lyso-phospholipase’ resulting in complete NAPE hydrolysis (~ 10 % residual NAPE) NAGPE levels are still below 5 %.

Example 20. Application of No-lyso-phospholipascs to Lipid Containing Food Matrix

No-lyso phospholipase can for example be used in egg yolk and whole eggs, in processed meats, in degumming of vegetable oils, in milk products like cheese, and in bakery products such as bread and in bakery products such as sweet bakery goods, including cakes and cookies.

Egg yolk containing products

Egg yolk is well known for use in the food industry due to its emulsifying properties. Approximately 30% of the lipid in egg yolk is phospholipid, which contributes to egg yolks emulsification properties. In many foods including mayonnaise, sauces, dressings, and cakes the emulsifying properties of egg yolk are exploited. For some food applications, however, the emulsification properties of egg yolk are not sufficient to obtain a homogenous product without separation. In mayonnaise, for example, pasteurization of the product at high temperatures cause the product to separate. No-lyso phospholipase may be used to modify phospholipid to lyso-phospholipid in egg yolk (and food products containing egg yolk). Product separation at high temperature pasteurization can be avoided using enzyme modified egg yolk.

Processed meat products

No-lyso phospholipase may be used in processed meat products. No-lyso phospholipase will contribute to improve the emulsification of processed meat products and contribute to better consistency and reduced cooking loss. No-lyso phospholipase added to processed meat will convert meat phospholipids to lysophospholipids. Because of the emulsifying properties of lysophospholipids, this component contributes to improved consistency and less cooking induced loss by improved emulsification of the fat in the meat. Vegetable oil

Crude vegetable oils like soya bean oil contain 1-2% phospholipids. Phospholipds are removed from the oil during the refining process, to improve the quality of the oil and prevent sedimentation in the oil. The removal of phospholipids is conducted by a so-called degumming process during the oil reefing process. The degumming can be conducted by chemical or enzymatic means. In the degumming process ‘No-lyso phospholipase’ may be used to convert phospholipids to lysophospholipids which are more water-soluble and can be removed from the oil by washing with water. Enzymatic hydrolysis of phospholipids is a gentler process compared with the chemical degumming which requires harsh alkaline or acidic conditions. Degumming with No-lyso phospholipase will cause fewer effluents. Milk products

No-lyso phospholipase may be used in milk products. No-lyso phospholipase will contribute to increased yield during cheese production. No-lyso phospholipase added to milk will convert milk phospholipids to lysophospholipids. Because of the emulsification properties of lysophospholipids, this will contribute to increased cheese yield by entrapping more lipid in the cheese curd.

Sweet Bakery Goods

Eggs are a substantial part of most cake products. No-lyso phospholipase may be used to modify the phospholipids in egg by production of lyso-phospholipids, which contribute to improved emulsification during cake mixing and gives a softer and more tender crumb. No-lyso phospholipase may also be used directly in the cake dough to modify the phospholipids of the flour.

EXAMPLE 21. Baking effect of ‘No-lyso-phospholipase’ in presence of supplement substrate - Lecithin (SOLEC F)

In this example, the combination of the ‘No-lyso-phospholipase’ CRC08319 and Powerbake 4080 was tested with and without the presence of supplement substrate in the form of SOLEC F. SOLEC F is a commercial product of IFF. SOELC F is an easy to handle, deoiled soy lecithin. The ‘No-lyso-phospholipase’ CRC08319 and Powerbake 4080 show marked improvement in both shocked and unshocked volume in the presence of supplement substrate. The effect of supplement substrate without presence of CRC08319 and Powerbake 4080 is very limited and in the case of shock stability potentially even negative. The Sponge & Dough baking trail was done according to ‘Sponge & Dough’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trial and the results from the baking evaluation is presented in respectively Table 6 and Figure 3.

Dosages of CRC08319 is presented as dosage relative to the optimal dosage of Lipopan F (relative based on mg protein/kg flour) as presented in Example 19. The optimal dosage of Lipopan F is defined as the dosage giving the highest specific volume in the Crusty Roll baking setup presented in Example 19. The optimal Lipopan F dosage is presented by ‘1 ’, Negative controls are shown as ‘0’.

For example, CRC08319 dosage of 5x in this trial was ‘5x Optimal dosage of Lipopan F’ (based on mg protein/kg flour) as presented in Crusty Roll application test in Example 19. Table 6. Experimental setup of Sponge & Dough testing of CRC08319 + Powerbake 4080’ with and without presence of supplement substrate (SOLEC F). Figure 3 shows Sponge & Dough relative specific volume as effect of ‘CRC08319 + Powerbake 4080’ with and without presence of SOLEC F. Figure 3 presents relative specific volumes (relative to negative control unshocked) of shocked and unshocked loafs. The Sponge & Dough trial show a clear increase in specific volume – Unshocked and Shocked – of ‘CRC08319+Powerbake 4080’ vs. Negative Control (Neg Ctrl) without the presence of SOLEC F. The effect of ‘CRC08319+Powerbake 4080’ in the presence of SOLEC F provide a further increase in specific volume vs. ‘CRC08319+Powerbake 4080’ without the presence of supplement SOLEC F. EXAMPLE 22. Proteolysis of phospholipase CRC08319 when expressed recombinantly in Trichoderma reesei 1. Overview A Trichoderma strain was developed that expresses phospholipase CRC08319. The secreted CRC08319 phospholipase was found to lose activity in the fermentation broth. Activity loss was found to correlate with loss of amino acids of the CRC08319 lipase at the C-terminal end presumably through proteolysis. 2. Trichoderma strain for the recombinant expression of phospholipase CRC08319 Two expression cassettes for phospholipase CRC08319 were developed to place the pro-enzyme encoding sequence for the phospholipase under the control of the cbh1 promotor and terminator sequences and with a signal sequence from Trichoderma pep1 containing an intron from Trichoderma gla1, using methods known to one skilled in the art. The two cassettes differed in the selection marker that was placed at one end of the cassette to facilitate isolation of Trichoderma transformants carrying the expression cassette, one having the Trichoderma pyr2 gene and the other having the Aspergillus amdS gene. A schematic map of the expression cassettes is given in FIG. 4A and FIG. 4B showing the relative position and orientation of the DNA parts in the cassettes. Pertinent biological parts of the cassette are listed in Table 7 in their order found in the cassette along with corresponding SEQ IDs. These cassettes could be constructed and/or commercially synthesized (e.g., GeneArt, IDT) by one skilled in the art from the disclosed information.

Table 7: Parts of the CRC08319 phospholipase expression cassettes First the pyr2-linked expression cassette was used to co-transform a Trichoderma strain along with restriction enzyme SwaI. Approximately fifteen (15) pg of purified expression cassette were used to transform protoplasts of strain AZP79, a pyr2 mutant Trichoderma reesei strain wherein the four native cellulase genes, cbh1, cbh2, egll and egl2 had been deleted. The transformation was performed using a standard polyethylene glycol (PEG) mediated protoplast transformation protocol. The transformants were grown on Vogel’s minimal medium agar plates to select for uridine prototrophy acquired by the pyr2 marker. Transformants were then isolated and outgrown on Vogel’s minimal agar plates before screening for phospholipase expression as generally described in Section 3 of this Example. A strain, ASQ29, expressing phospholipase was selected for transformation with the amdS-linked expression cassette.

Secondly, the amdS-linked expression cassette was used to co-transform a Trichoderma strain along with restriction enzyme Noll. Approximately fifteen (15) pg of purified expression cassette DNA was used to transform protoplasts of strain ASQ29 using PEG mediated transformation as described above except transformants were selected on minimal media containing acetamide as the sole nitrogen source. Transformants were then isolated and outgrown on minimal agar plates with acetamide as the sole nitrogen source before screening for phospholipase expression as generally described in Section 3 of this Example. A strain, AWG09, was selected for fermentation and characterization of CRC08319 phospholipase.

3. Fermentation and transformant evaluation in microtiter plates

Methods for microtiter plate fermentation of transformants and fermentation broth analysis by SDS-PAGE and PC-P assay are as set forth below.

Media composition:

400x T. reesei trace elements: citric Acid (anhydrous), 175 g/L; FeSO4.7 H2O, 200 g/L, ZnSO4.7 H2O, 16 g/L, CuSO4.5 H2O, 3.2 g/L; MnSO4.H2O, 1.4 g/L; H3BO3, 0.8 g/L. Citrate minimal medium 5 g/L (NH4)2S04, 4.5 g/L KH2PO4, 1 g/L MgS04.7 H20, and 14.4 g/L citric acid, adjusted to pH 5.5 with 5% NaOH. After autoclaving for 30 minutes, sterile 50% glucose was added to a final concentration of 0.5 %, along with 2.5 mL/L of 400x trace element solution.

Liquid defined (LD) culture medium contained the following components. Casamino acids, 12 g/L; (NH4)2SO4, 5 g/L; MgSO4.7H2O, 1 g/L; KH2PO4, 4.5 g/L; CaCl2.2H2O, 1 g/L; PIPPS, 33 g/L; 400x T. reesei trace elements, 2.5 ml/L; pH adjusted to 6.9 with NaOH. After sterilization, lactose or a glucose/sophorose mixture was added to a final concentration of 1.5% w/v.

Fermentation:

Transformants were grown in citrate minimal media for 36-48 hours at 32C in 96 well plates with shaking. After incubation, 0.11 mL of seed culture were added to 0.99 ml of LD medium per well of a 24-well 20% Lactose slow release micro-titer plate (srMTP). srMTPs have been described in US patent US10030221B2. These production cultures were then fermented for 4 to 5 days at 25°C and 250 RPM. Following fermentation, secreted proteins were separated from the cell mass by filtration through a filter-bottom 96- well plate into a 96- well non-binding assay plate. Phosphatidylcholine assay: To assess phospholipase activity (PC-U), filtrates were assayed for activity on phosphatidylcholine using the PC-P assay as described in Assay and Methods above. SDS-PAGE analysis: To observe the proteins secreted by Trichoderma into the fermentation broth, one (1) to five (5) microliters of filtrate was diluted in 4x LDS loading buffer (Invitrogen), denatured, and run on NuPAGE 4-12% Bis-Tris SDS-PAGE gels (Invitrogen) along with the See Blue Plus 2 molecular weight standard (Invitrogen) in 1X NuPAGE MES buffer (Invitrogen). Gels were then staining with Simply Blue Safe Stain (Invitrogen) and destaining in water using standard molecular biology procedures. 4. Fermentation of AWG09 in 14L fermentors To generate fermentation broths more representative of commercial scale fermentation, Trichoderma strains engineered to express CRC08319 phospholipase were fermented in 14L fermentors. Briefly, spores of a strain were added to 500 mL of medium in a 3 L flask with both side and bottom baffles. The cultures were grown in a minimal medium for 48 hours at 34°C in a shaking incubator. After 48 hours, the contents of each flask were added separately to 14 L fermentors containing 9.5 L of medium containing 4.7 g/L KHPO, 1.0 g/L MgSO7HO, 4.3 g/L (NH)SO and 2.5 mL/L of 400X T. reesei trace elements solution (citric Acid (anhydrous), 175 g/L; FeSO ₄ · 7 H ₂ O, 200 g/L, ZnSO ₄ · 7 H ₂ O, 16 g/L, CuSO ₄ · 5 H ₂ O, 3.2 g/L; MnSO ₄ H ₂ O, 1.4 g/L; H ₃ BO ₃ , 0.8 g/L; soy flour, 15 g/L). These components were heat sterilized together at 121°C for 30 minutes. A solution of 60% glucose and 0.48% CaCl ₂ · 2 H ₂ O was separately autoclaved, cooled, and added to the fermentor to a final concentration of 75 g/L glucose and 0.6 g/L CaCl ₂ · 2 H ₂ O. The medium was adjusted to pH 3.5 with 28% NH and the temperature was maintained at 34°C during the growth period. Once glucose was exhausted, the temperature was dropped to 28°C, and the cultures were fed glucose- sophorose. Broth pH was controlled at around 7 with an ammonia feed. The dry cell weight (DCW), total protein concentrations and other parameters were measured, and specific total protein production rates and yield on fed sugars were calculated. 5. Stability of CRC08319 It was found that CRC08319 phospholipase activity (PC-U) was not consistently stable in Trichoderma broth supernatants. Approximately 1 ml of fresh fermentation broth from 14L fermentations of AWG09 were transferred to 1.5ml microcentrifuge tubes. These were spun at 21,000 xg in a benchtop 98 microcentrifuge for 3 minutes then the supernatants were aliquoted to 200 ul PCR tubes and stored at -20°C. Forty microliters (40 ul) of thawed supernatants from 10 independent Trichoderma AWG09 14L fermentation broth were aliquoted to two sets of 200 ul PCR tubes. One set of tubes was stored at 4°C and the other at 33 °C for one day then phospholipase activities were measured for both by the PC-P assay. Residual activity was calculated as a ratio of the broth activity after incubation at 33 °C relative to broth activity after incubation at 4°C.

As shown in FIG. 5, all samples lost CRC08319 phospholipase activity upon incubation at 33 °C ranging from nearly all activity lost to about half.

6. Analysis of recombinant CRC08319 protein species produced by Trichoderma Recombinant CRC08319 protein species as produced by Trichoderma and present in the fermentation broth were analyzed. It was found that the CRC08319 protein was a mixture of three prominent species differing in their C-terminal processing, two mature active species and a truncated, inactive species. The CRC08319 protein of >90% purity from both high and low activity fermentation broths were analyzed to better understand the activity loss. Samples were assayed for phosphatidylcholine activity (PC-U), CRC08319 protein was quantified and the sequence of the CRC08319 species was deduced by LC-MS.

Phosphatidylcholine activity (PC-U) of the fractions was measured by the Phosphatidylcholine PC-P Assay.

Protein was quantified by SDS-PAGE gel and densitometry using GelDoc™ Go Imaging system (Bio-Rad). Reagents used in the assay: Concentrated (2x) Laemmli Sample Buffer (Bio-Rad, Catalogue #1610737); 26-well TGX Any kDa Gel (Bio-Rad, Catalogue #5678125); protein markers “Precision Plus Protein™ Unstained Protein Standards” (BioRad, Catalogue #161-0363); protein standard (protein concentration assigned by Total Amino Acid Analysis, Eurofins Scientific). The analysis was carried out as follow: In a 96 well- PCR plate 50μL diluted enzyme sample were mixed with 50 μL sample buffer containing 2.7 mg DTT. The plate was sealed by Microseal ‘B ’ Film from Bio- Rad and placed into PCR machine and heated at 70°C for 10 minutes. Next the chamber was filled with running buffer, gel cassette was set. Then 10 μL of each sample and standard (~ 0.1-1.00 mg/mL protein standard) was loaded on the gel and 10 μL of the markers were loaded. After that the electrophoresis was run at 200 V for 34 min. Following electrophoresis, the gel was transferred to the GelDoc Go Imager. Image Lab software was used for calculation of intensity of each band. By knowing the protein amount of the sample used as standard a calibration curve was created. The amount of target protein in the sample was determined by the band intensity and the calibration curve. The samples were analyzed as intact proteins by CapLC-MS. The only sample preparation was a 10x dilution in 6 M Guanidinium hydrochloride, 50 mM Ammonium bicarbonate pH 7.0. Masses corresponding to the major components, were extracted from deconvoluted (Calculated mass of a protein molecule, using the full envelope of a protein, detected at several charge states. The Xtract function in Thermo Xcalibur Qual Browser is used for deconvolution) MS spectra, and used for calculating the relative ratio between major components. CapLC-ESI-MS instruments: Agilent CapLC system: Solvent A: H2O 99.9% / Formic acid 1‰ Solvent B: ACN 99.9% / Formic acid 1‰ Column: 10 cm, ID 75 µm – 3 µm C18-A2 MS-instrument: LTQ Orbitrap, high-resolution mass spectrometer (Thermo Finnigan) Chromatographic conditions, CapLC System Agilent 1100 CapLC system (Agilent Technologies) 100

MS conditions

This revealed variation in the processing of the C-terminal end of the CRC08319 protein in the Trichoderma broth (Table 8). Two species were identified: SEQ ID NO. 27 and SEQ ID NO: 28, which had high specific activity on phosphatidylcholine, herein collectively referred to as the mature CRC08319. The third prominent species was 6 or 7 amino acids shorter than the mature CRC08319 and had almost 40x lower specific activity, herein referred to as truncated CRC08319 (SEQ ID NO: 29).

Table 8: Specific activity of (PC-U/mg protein) CRC08319 processed forms in Trichoderma broth

Example 23: Stabilization of CRC08319 in Trichoderma clarified broth by supplementation with exogenously produced BASI

1. Overview

Clarified broths from Trichoderma strain AWG09 fermented in 14L fermentors were incubated at warm temperatures with and without the addition of Bacillus produced BASI were analyzed. Inclusion of the BASI protein in the fermentate results in a 2.4x increase in CRC08319 incubation stability.

2. A strain of Bacillus subtilis for the recombinant expression of BASI

An expression cassette was developed for integration of a barley amylase subtilisin inhibitor (BASI) expression cassette at the yhƒN locus with the alrA selection marker in Bacillus subtilis. A schematic map of the expression cassette is given in FIG. 6 showing the relative position and orientation of the DNA parts in the cassette. Pertinent biological parts of the cassette are listed in Table 9 in their order found in the cassette along with corresponding SEQ IDs. This cassette could be constructed as described below and/or commercially synthesized (e.g., GeneArt, IDT) by one skilled in the art from the disclosed information.

Table 9: Parts of the BASI expression cassette for Bacillus expression

The yhƒN region and rrnl (engineered) promoter from B. subtilis and the aprE signal sequence from B. subtilis were amplified from a B. subtilis expression strain with primers CF 17-79 and CF 19-20 (Table 10). The primer CF 17-79 also contains an overhang from the end of the alrA cassette which will allow for assembly. A 20 bp overhang from the end of the aprE signal sequence, a gene encoding the barley amylase subtilisin inhibitor (BASI) protein (SEQ ID NO: 58) (codon optimized by the software Geneious) plus 20 base pairs of the start of the BPN’ terminator from B. amyliquefaciens were synthesized by an outside vendor (Eurofins Genomics). This synthetic DNA fragment was amplified with primers CF 19-19 and CF 19-22 (Table 1). Using techniques known in the art, the two fragments were fused together using PCR with primers CF 17-79 and CF 19-22 (Table 10) to form PCR fusion 1.

A DNA fragment containing the BPN’ terminator and the alrA expression cassette was amplified with primers CF 19-21 and CF 17-80 (Table 10) (CF 17-80 has an overhang into the yhƒN upstream region for future Gibson assembly) from a B. subtilis expression strain. Using techniques known in the art, this PCR fragment and PCR fusion 1 were assembled using Gibson Assembly (New England Biolabs) to create a circular DNA cassette.

The assembly underwent a rolling circle amplification (Evomics), which was used to transform 200ul of competent cells of a suitable B. subtilis strain. The transformed cells were incubated at 37°C for 1 hour while shaking at 250 rpm. This method is based on the observation that the alrA gene, which codes for alanine racemase, is essential in B. subtilis (Ferrari et al., Bio/Technol., 3:1003-1007, 1987), and thus can be used as a selectable marker. The alanine racemase converts the natural L-alanine into D-alanine that is needed for cell wall synthesis. An alanine racemase inhibitor, b-chloro-D-alanine (CDA), can be used for selection/amplification of the alrA gene (Heaton et al., Biochem. Biophys. Res. Comm., 149:576-579, 1987). The alrA gene cassette is integrated with the BASI cassette into a host that has been deleted for the native alrA gene and selection is performed on plates that are not supplemented with D-alanine. Cells from the transformation mixture were plated onto agar plates. Single colonies were selected to be grown in Luria broth with b-chloro-D- alanine (CD A) to optical density of 1.0 at 600nm. The strain sample was then frozen at -80°C with 20% glycerol.

Table 10. PCR primers of Bacillus BASI-aZrA cassette

3. Fermentation of Bacillus subtilis expressing BASI at 14L scale in liquid culture

The inoculum was grown in a seed flask containing LB medium and is shown in Table 11. The production medium used to produce the BASI protein contained minerals, one or more carbon sources, and a complex nitrogen source shown in Table 12 and Table 13. The BASI protein accumulated in the broth/cells.

Growth in 14 L fermentors consisted of 2 steps: generating the seed culture and generating the production culture while producing protein. Seed cultures were started by inoculating 30 mL of LB media into a 350 mL flask. The seed cultures were incubated at 180 rpm and 37°C for roughly 2h - until it was turbid. A volume of 30 mL of the seed culture was inoculated into each tank to bring the final volume to 7 kg of appropriate production medium. The production culture had 1 -sided pH control (base addition only) during the experiment and was controlled at pH 7.1 with NH ₄ OH for base addition. The feed was triggered when the OUR reach 25 mmol/L/h and ramped from 0.28 g/min to 1.65 g/min over 10 hours.

Various parameters were monitored during the run and include, but are not limited to: CER (carbon dioxide evolution rate), OUR (oxygen uptake rate), pH, DO (dissolved oxygen), OD (optical density), etc. To generate Bacillus produced BASI UFC, Fermentation broth obtained was diluted with 2 parts of process water. Cationic polymer C581 at 1% was added to flocculate the cells. Flocculated cells were removed by depth filtration, using a Buchner filter fitted with HR900 filter pad precoated with diatomaceous earth FW12. Clarified filtrate was concentrated using 10K PES MWCO ultrafilter membrane. 4. Stabilization of Trichoderma produced CRC08319 with Bacillus produced BASI Approximately 1 ml of fresh fermentation broth from 14L fermentations of AWG09 were transferred to 1.5ml microcentrifuge tubes. These were spun at 21,000 xg in a benchtop microcentrifuge for 3 minutes then the supernatants were aliquoted to 200 ul PCR tubes and stored at -20°C. Forty microliters (40 ul) of thawed supernatants from 6 independent Trichoderma AWG09 14L fermentation broth were aliquoted to four sets of 200 ul PCR tubes (“test sets” A-D), see Table 14.

Table 14: Experiment conditions for BASI addition to AWG09 broth supernatants

To the supernatants of test sets B and D, 1 ul of Bacillus produced BASI UFC at approximately 20 g/L was added to each of the tubes, briefly mixed then pulse spun. Immediately following this, test sets A and B were transferred to a 4°C refrigerator and test sets C and D were transferred to a 33°C incubator. Following 18 hours of incubation, all test set samples were diluted and assayed using the PC-P assay generally as described in “Assay and Methods”. To calculate “residual activities”, the activity values for each supernatant test set at 33 °C were divided by the activity values of the supernatant test set stored at 4°C, i.e., set °C values divided by set A values and set D values divided by set B values.

Results

As shown in Figure 7, clarified 14L supernatant broths from CRC08319 expressing strain AWG09 lost on average 65% of their activity when stored at 33C for 18 hours. However, these same supernatants only lost on average 25% of their activity when stored at 33C for 18hours when the Bacillus expressed BASI supernatant was added. This shows that BASI can stabilize CRC08319 in Trichoderma broth, most likely through the inhibition of co-expressed Trichoderma subtilisin-like proteases native to Trichoderma. Example 24: Recombinant co-expression of phospholipase CRC08319 and BASI by Trichoderma reesei

1. Overview

A Trichoderma strain was developed that expresses phospholipase CRC08319. When an expression cassette for BASI is added to this strain, BASI expression is evident by SDS- PAGE analysis and phospholipase stability is improved.

2. A Trichoderma strain for the recombinant expression of phospholipase CRC08319

A Trichoderma strain that expresses phospholipase CRC08319 was constructed by co-transformation of an expression cassette marked with the pyr2 selection marker and Cas9- RNPs targeting the carboxypeptidase (cpa5) locus.

The pyr2 -linked CRC08319 expression cassette as described in Example 22 was used to co-transform a Trichoderma strain along with assembled Cas9 nuclease with synthetic guide RNAs (sgRNAs, SEQ ID Nos. 65 and 66) that targeted a region within Trichoderma genome encoding a predicted carboxypeptidase (cpa5, JGI PID 120998). These Cas9- sgRNA complexes were assembled in vitro according the manufacturer’s protocol (Synthego) and used to transform Trichoderma as generally set forth in PCT Publication No. WG/2016/100568. Approximately fifteen (15) pg of purified fragment and the assembled Cas9-sgRNA complex were used to transform protoplasts of strain AZP79, a pyr2 mutant Trichoderma reesei strain wherein the four native cellulase genes, cbh1, cbh2, egll and egl2 had been deleted. The transformation was performed using a standard polyethylene glycol (PEG) mediated protoplast transformation. The transformants were grown on Vogel’s minimal medium agar plates to select for uridine prototrophy acquired by the pyr2 marker. Transformants were then isolated and outgrown on Vogel’ s minimal agar plates before screening for phospholipase expression as generally described in Example 22. A strain, BBS89, expressing phospholipase was selected to evaluate BASI co-expression.

3. Strains for the recombinant co-expression of BASI and CRC08319

Here, an expression cassette for a BASI fusion protein was developed and used to target integration at locus A in Trichoderma strain BBS89 which expresses phospholipase CRC08319.

An expression cassette for barley alpha-amylase subtilisin inhibitor (BASI) was developed to overexpress BASI in Trichoderma as a translational fusion with a catalytically inactive Cbh1_core with linker, using methods known to one skilled in the art. DNA encoding several amino acids intended to promote cleavage of the fusion protein and release of the BASI protein were placed at the end of the Cbh1 linker just before the start of the mature BASI sequence (kexin site). Expression of the fusion protein was placed under regulation of the Trichoderma cbh2 promoter and the Aspergillus nidulans trpC terminator. The Aspergillus nidulans amdS gene was placed at one end of the cassette to facilitate isolation of Trichoderma transformants carrying the expression cassette. The expression cassette was flanked by approximately Ikb upstream and downstream homology regions, to promote integration of the cassette at an intergenic region in the Trichoderma genome herein referred to as locus A. A schematic map of the expression cassette is given in Figure 8 showing the relative orientation of the DNA parts in the cassette. Pertinent biological parts of the cassette are listed in Table 15 in their order found in the cassette along with corresponding SEQ IDs. This cassette could be constructed and/or commercially synthesized (e.g., GeneArt, IDT) by one skilled in the art from the disclosed information.

Table 15: Parts of the BASI expression cassette

The cassette was used to co-transform strain BBS89, a Trichoderma strain generated from Section 2, along with assembled Cas9 nuclease with synthetic guide RNA (SEQ ID NO: 73) that targeted locus A, an intergenic region within Trichoderma genome. These Cas9-sgRNA complexes were assembled in vitro according the manufacturer’s protocol (Synthego) and used to transform Trichoderma as generally set forth in PCT Publication No.

WO/2016/100568. Approximately five (5) μg of purified fragment and the assembled Cas9- sgRNA complex were used to transform protoplasts of BBS89. The transformation was performed using the polyethylene glycol (PEG) mediated protoplast transformation protocol (Ouedraogo et al., 2015; Penttila et al., 1987). The transformants were grown on Trichoderma minimal medium agar plates with acetamide as the sole nitrogen source to select for acquisition of the amdS marker. Transformants were then isolated and outgrown on Trichoderma minimal agar plates with acetamide as the sole nitrogen source before testing transformants. 4. Fermentation in microtiter plates Transformants from two independent PEG transformations (BASI1 and BASI2), parental strain (BBS89), and a spontaneous prototrophic revertant of host strain AZP79 (AZP79pp) were fermented in srMTPs essentially as described in Example 22. Following fermentation, broth filtrates were analyzed by SDS-PAGE and phosphatidylcholine activity assays essentially as described in Example 22. Results: As shown in Figure 9, a new band of apparent molecular weight of around 12 kDa was seen in the filtrate of strain BBS89 containing the CRC08319 phospholipase cassette (lane 2) but not in that of AZP79pp (lane 1), a pyrimidine prototrophic derivative of the same parental strain. This is consistent with the calculated molecular weight of mature CRC08319 phospholipase species at 13 kDa. In pooled filtrates for BBS89 transformants with the BASI expression cassette (lanes 3 and 4), two additional bands were observed relative to BBS89 parent (lane 2). One band at approximately 60 kDa is consistent with expected migration of glycosylated Cbh1_core with linker. The other prominent band, found between 14 and 28 kDa, is consistent with the expected molecular weight of mature BASI at 20 kDa. 5. Stability of recombinant CRC08319 expressed by Trichoderma reesei with and without co-expression of recombinant BASI It was demonstrated that CRC08319 phospholipase was more stable in Trichoderma filtrate when co-expressed with BASI. To assess phospholipase stability in Trichoderma filtrate, aliquots of filtrate were transferred to non-binding MTPs, sealed, and incubated at 4C and 33C for three days. Activity was then measured using the Phosphatidylcholine Assay essentially as described in Example 22. Residual activity was calculated as a ratio of the broth activity after incubation at 33C relative to broth activity after incubation at 4C. Results: As shown in Figure 10, phospholipase produced by the BBS89 parent strain retained only 48% of activity following incubation at 33C relative to incubation at 4C. However, in 109 both sets of transformants (BASI1 and BASI2) derived from BBS89 using the BASI expression cassette, the phospholipase retained 55% of activity. This represents a 14% increase in phospholipase stability.

Example 25: Co-expression of BASI and phospholipase CRC08319 in Trichoderma with protease deletions

1. Overview

Here proteases were knocked-out (inactivated) by cas9-mediated mutation of their genes in the genome of CRC08319 phospholipase expressing Trichoderma strain AWG09 (Example 22) through 3 consecutive rounds of transformation with selection markers. In the final round, a BASI expression cassette is introduced at the geƒ1 locus. Transformants expressing BASI on average had 6% improved CRC08319 incubation stability.

2. Knockout of carboxypeptidase cpa5

Here an expression cassette for CRC08319 was targeted to replace a portion of and inactivate a predicted carboxypeptidase (cpa5, JGI PID 120998).

This cpa5 -targeting cassette included a DNA sequence having a 1.0 Kb region homologous to the DNA sequence spanning a contiguous portion of exons 1 and 2 and intron 1 of cpa5 (Left Flank). Also included within the plasmid was a DNA sequence having a 1.0 Kb region homologous to the DNA sequence spanning part of exon 2 of the cpa5 gene and contiguous downstream sequences (Right Flank). These sequences were designed to target the cpa5 gene and replace the regions of the genome between the Left and Right Flanks with the intervening cassette sequences. These intervening sequences included an expression cassette for phospholipase CRC08319 pro-enzyme encoding sequence for the phospholipase under the control of the cbh1 promotor and terminator sequences and with a signal sequence from Trichoderma pepl containing an intron from Trichoderma glal and an engineered Trichoderma sdi1 selection marker which can confer resistance to fungicide carboxin, using methods known to one skilled in the art.

The expression cassettes design is essentially the same as diagramed in Figure 8, except for two alterations: 1) using the upstream and downstream homology regions for the cpa5 locus in place of the regions for locus A and 2) using the sdi1 marker in place of the amdS marker. Pertinent biological parts are listed in Table 16 along with corresponding SEQ IDs. This cassette could be constructed and/or commercially synthesized (e.g., GeneArt, IDT) by one skilled in the art from the disclosed information. Table 16: Parts of the cpa5-targeting cassette with CRC08319 phospholipase expression cassette

The cpa5- targeting cassette was used to co-transform strain AWG09, a Trichoderma strain generated in Example 22, along with assembled Cas9 nuclease with synthetic guide RNAs (sgRNAs, SEQ ID Nos: 65 and 66) that targeted the cpa5 locus. These Cas9-sgRNA complexes were assembled in vitro according the manufacturer’s protocol (Synthego) and used to transform Trichoderma as generally set forth in PCT Publication No. WO/2016/100568. Approximately ten (10) μg of purified cpa5 -targeting cassette DNA and the assembled Cas9-sgRNA complex were used to transform protoplasts of strain AWG09. The transformation was performed using a standard polyethylene glycol (PEG) mediated protoplast transformation protocol. The transformants were grown on Vogel’s minimal medium agar plates with 150 ug/ml carboxin to select for acquisition of the sdi1 marker. Stable transformants were isolated, propagated then screened by PCR for the targeted integration at the cpa5 locus by homologous recombination. Homologous integration of the cpa5 disruption cassette at the cpa5 locus was verified by amplifying DNA fragments of the expected sizes using two primer pairs. Primer pair RPG2641 and RPG2594 amplified a DNA fragment starting outside the 5 ' end of the disruption cassette region and ending within the selection marker.

RPG2641 cgtccctcaaggagtcgtttggc (SEQ ID NO:77) RPG2594 gagcctgtaccgctgcctcaccattctcaactgcacgcgg (SEQ ID NO:78)

Primer pair RPG2642 and RPG2537 amplified a DNA fragment starting within the selection marker of the disruption cassette and ending outside the 3' end of the disruption cassette region.

RPG2642 cgcgtagagccgatagcgaagaat (SEQ ID NO: 79)

RPG2537 cgggaatgagtgcctgctactgc (SEQ ID O: 80)

The generated strain with confirmed homologous integration of the cpa5 disruption cassette was named BAH83.

3. Knockout of proteases ampl, slp3, slp6, and Tr22210

Here cpa5 deleted strain BAH83 is co-transformed with the als selection marker and Cas9-sgRNA complexes targeting four protease loci.

A DNA fragment containing the als marker (SEQ ID NO:81) was used to cotransform strain BAH83, along with assembled Cas9 nuclease with synthetic guide RNAs (SEQ ID NOs: 82-89) that targeted the ampl (JGI PID 81070), slp3 (JGI PID 123234), slp6 (JGI PID 121495) and Tr22210 (JGI PID 22210) loci. These Cas9-sgRNA complexes were assembled in vitro according the manufacturer’s protocol (Synthego) and used to transform Trichoderma as generally set forth in PCT Publication No. WO/2016/100568. Approximately ten (10) pg of purified als marker DNA and the assembled Cas9-sgRNA complex were used to transform protoplasts of strain BAH83. The transformation was performed using a standard polyethylene glycol (PEG) mediated protoplast transformation protocol.

Transformants were selected for resistance to herbicide chlorimuron ethyl. Transformants were then screened by PCR for mutational events at the targeted loci by PCR amplification of amplicons spanning the paired cas9-RNP target sites. Table 17 lists the primers used to screen transformants. A selected transformant, named BBR87, that showed mutational events by PCR and whole genome sequencing analysis at all four loci was selected for additional protease deletion.

Table 17: Primers for screening BAH83 transformants

4. Knockout of proteases pep2 and sed2

Here 5-protease knockout strain BBR87 is co-transformed with the sucA selection marker and Cas9-sgRNA complexes targeting two additional proteases, pep2 and sed2 as well as the cpa5 locus to remove the CRC08319 expression cassette and sdi1 selection marker.

A DNA fragment containing a sucA marker (SEQ ID NO:98) was used to co-transform strain BBR87, along with assembled Cas9 nuclease with synthetic guide RNAs (SEQ ID NOs:99 to 104) that targeted the pep2 (JGI PID 53961), sed2 (JGI PID 70962) and cpa5 loci. These Cas9-sgRNA complexes were assembled in vitro according the manufacturer’s protocol (Synthego) and used to transform Trichoderma. Approximately ten (10) pg of purified sdi1 marker DNA and the assembled Cas9-sgRNA complex were used to transform protoplasts of strain BBR87. The transformation was performed using a standard polyethylene glycol (PEG) mediated protoplast transformation protocol.

Transformants were selected on Vogel’s minimal media with sucrose as the sole carbon source. Transformants were then screened by PCR for mutational events at the targeted loci by PCR amplification of amplicons spanning the paired cas9-RNP target sites. Table 18 lists the primers used to screen transformants. A selected transformant, named BBX71, that showed mutational events by PCR and whole genome sequencing analysis at all three loci was selected for additional protease deletion.

Table 18: Primers for analysing BBR87 transformants

5. Integration of BASI expression cassette at geƒ1 locus

Here 7-protease knockout strain BBX71 was co-transformed with an expression cassette for BASI containing an sdi1 selection marker and Cas9-sgRNA complexes targeting the geƒ1 (JGI PID 120482) locus.

An expression cassette for barley alpha-amylase subtilisin inhibitor (BASI) was developed to overexpress BASI in Trichoderma nearly identical to the cassette in Example 24, except replacement of the catalytically inactive Cbh1_core with linker (SEQ ID NO:70) with an active one (SEQ ID NO:105) and selection marker (SEQ ID NO:51) was replaced with an sdi1 marker (SEQ ID NO:106). Additionally, homology regions (SEQ ID NOs:67 and 68) were excluded. Pertinent biological parts of the cassette are listed in Table 19 in their order found in the cassette along with corresponding SEQ IDs. This cassette could be constructed and/or commercially synthesized (e.g., GeneArt, IDT) by one skilled in the art from the disclosed information.

Table 19: Parts of the BASI expression cassette

This BASI expression cassette and just the sdi1 marker alone was used to co-transform strain BBX71, along with assembled Cas9 nuclease with synthetic guide RNAs (SEQ ID NOs:107 and 108) that targeted the geƒ1 locus. These Cas9-sgRNA complexes were assembled in vitro according the manufacturer’s protocol (Synthego) and used to transform Trichoderma as generally set forth in PCT Publication No. WO/2016/100568. Approximately ten (10) pg of purified BASI expression cassette DNA and the assembled Cas9-sgRNA complex were used to transform protoplasts of strain BBX71. In a separate transformation, approximately five (5) pg of purified sdi1 selection marker DNA (SEQ ID NO: 106) and the assembled Cas9-sgRNA complex were used to transform protoplasts of strain BBX71.The transformations were performed using a standard polyethylene glycol (PEG) mediated protoplast transformation protocol.

The transformants were selected on Vogel’s minimal medium agar plates with 150 ug/ml agricultural fungicide carboxin to select for acquisition of the sdi1 marker. Transformants were isolated onto selective media then screened in microtiter plates for phospholipase, Cbh1_core and BASI expression by SDS-PAGE analysis essentially as described in Example 22. Four independent transformants showing expression of phospholipase, Cbh1_core and BASI were selected for evaluation of CRC08319 stability. Four random isolates targeting only an sdi1 selection marker to geƒ1 locus were analyzed in parallel to control for the effect of geƒ1 disruption.

6. Stability of recombinant CRC08319 expressed by Trichoderma reesei protease knockout strains with and without co-expression of recombinant BASI

The following strains were evaluated in srMTP fermentations: BBX71, a phospholipase negative control strain, 4 independent BBX71 transformants with only an sdi1 selection marker at the geƒ1 locus, and 4 independent BBX71 transformants where the BASI expression cassette and an sdi1 selection marker were targeted for integration at the geƒ1 locus. srMTP fermentation and subsequent phosphatidylcholine activity assays were performed essentially as described in Example 22 herein.

Results

As shown in Figure 11, transformants expressing BASI (“BASI”) had on average 6% higher residual phospholipase activity after incubation at 33C for two days compared to transformants with only the sdi1 marker (“marker only”) integrated at the geƒ1 locus (0.56 vs. 0.53 residual activity). Surprisingly, integration of the marker alone at the geƒ1 locus, increased phospholipase residual activity 26% under the same conditions compared to the BBX71 parent (“BBX71”, 0.53 vs. 0.42 residual activity).

Example 26: Mature forms of phospholipases In accordance with an aspect of the present invention, active fragments of other phospholipases were also observed as set forth in Table 20.

Table 20. Mature forms of phospholipases

EXAMPLE 27. Baking experiment testing application effect of Phospholipase CRC08319 Mature, active fragment.

In this experiment, the mature, active fragment of CRC083I9 phospholipase was tested in increasing dosages in a Crusty Roll experimental setup to show application performance. The Crusty Roll baking was done according to ‘Crusty Roll’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trials and the results from the baking evaluation is presented in respectively Table 21 and Figure 12. Table 21. Experimental setup of enzyme dose-response test in Crusty Roll baking.

Crusty roll bake including Phospholipase CRC08319 Mature, active fragment dose-response in a constant Crusty roll matrix.

Figure 12 shows a dose-response study of CRC08319 mature, active fragment in crusty roll application measuring specific volume after both 45 and 60 min proofing time. Phospholipase CRC08319 Mature, active fragment is tested in a constant Crusty roll matrix where the lowest dose is given as 1 and the other dosages are fold increases relative to lowest dose tested. Increasing dosage of Phospholipase CRC08319 Mature, active fragment shows continued increase in specific volume.

Example 28. Experimental setup of Xylanase response test in combination with CRC08319+POWERBake 4080 in Crusty rolls

In this experiment Xylanase Bs3 (listed as SEQ ID NO: 118 and sold as POWERBake® 950, Dupont Nutrition Bioscience, Denmark) was tested in a Crusty Roll experimental setup to show supplement volume response in combination with the ‘No-lyso- phospholipase’ CRC08319 and POWERBake 4080.

The Crusty Roll baking was done according to ‘Crusty Roll’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trials and the results from the baking evaluation are presented in respectively Table 22 and Figure 13.

Table 22. Experimental setup of Xylanase response test in Crusty Roll baking.

Crusty roll bake including Phospholipase CRC08319 Mature, active fragment and POWERBake 4080 with and without Xylanase Bs3 (listed as SEQ ID NO: 118 and sold as product POWERBake® 950).

Figure 13 shows volume response of xylanase Bs3 in combination with CRC08319 mature, active fragment and POWERBake 4080 in crusty roll application measuring specific volume.

Phospholipase CRC08319 Mature, active fragment, is used in combination with POWERBake 4080. The dosage of Phospholipase CRC08319 Mature, active fragment, used is x5.4 relative to the dosage representation provided in Example 19, Figure 1.

The combination of xylanase with CRC08319+POWERBake 4080 is observed to have a supplement positive effect as seen by the increased specific volume of Xylanse Bs3 on top of CRC08319+POWERBake 4080 in Crusty rolls.

Example 29. Experimental setup of Xylanase response test in combination with CRC08319+POWERBake 4080 in Tweedy white toast application

In this experiment Xylanase Bs3 (listed as SEQ ID NO: 118 and sold as product POWERBake® 950, Dupont Nutrition Bioscience, Denmark) was tested in a Tweedy white toast experimental setup to show supplement volume response in combination with the ‘No- lyso-phospholipase’ CRC08319 and POWERBake 4080.

The Tweedy white toast baking was done according to ‘Tweedy white toast’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trials and the results from the baking evaluation are presented in respectively Table 23 and Figure 14.

Tabic 23. Experimental setup of Xylanase response test in White toast baking.

Tweedy white toast bake including Phospholipase CRC08319 Mature, active fragment and POWERBake 4080 with and without Xylanase Bs3 (listed as SEQ ID NO: 118 and sold as product POWERBake® 950).

Figure 14 shows volume response of xylanase Bs3 in combination with CRC08319 mature, active fragment and POWERBake 4080 in Tweedy white toast application measuring specific volume unshocked and shocked.

Phospholipase CRC08319 Mature, active fragment, is used in combination with POWERBake 4080. The dosage of Phospholipase CRC08319 Mature, active fragment, used is x5.9 relative to the dosage representation provided in Example 19, Figure 1.

The combination of xylanase with CRC08319+POWERBake 4080 is observed to have a supplement positive effect as seen by the increased specific volume - shocked and unshocked - of Xylanse Bs3 on top of CRC08319+POWERBake 4080 in Tweedy white toast.

Example 30. Experimental setup of Glucose oxidase response test in combination with CRC08319+POWERBake 4080 in Tweedy white toast application

In this experiment Glucose oxidase GOX (listed as SEQ ID NO: 117 and sold as Grindamyl® S 860, Dupont Nutrition Bioscience, Denmark) was tested in a Tweedy white toast experimental setup to show supplement volume response in combination with the ‘No- lyso-phospholipase’ CRC08319 and POWERBake 4080.

The Tweedy white toast baking was done according to ‘Tweedy white toast’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trials and the results from the baking evaluation are presented in respectively Table 24 and Figure 15.

Table 24. Experimental setup of Glucose oxidase response test in White toast baking.

Tweedy white toast bake including Phospholipase CRC08319 Mature, active fragment and POWERBake 4080 with and without Glucose oxidase GOX (listed as SEQ ID NO: 117 and sold as product Grindamyl® S 860).

Figure 15 shows volume response of Glucose oxidase GOX (listed as SEQ ID NO: 117 and sold as product Grindamyl® S 860) in combination with CRC08319 mature, active fragment and POWERBake 4080 in Tweedy white toast application measuring specific volume unshocked and shocked.

Phospholipase CRC08319 Mature, active fragment, is used in combination with POWERBake 4080. The dosage of Phospholipase CRC08319 Mature, active fragment, used is x5.9 relative to the dosage representation provided in Example 19, Figure 1.

The combination of Glucose oxidase with CRC08319+POWERBake 4080 is observed to have a supplement positive effect as seen by the increased specific volume - shocked and unshocked - of Glucose oxidase GOX on top of CRC08319+POWERBake 4080 in Tweedy white toast.

Example 31. Experimental setup of Hexose oxidase response test in combination with CRC08319+POWERBake 4080 in Tweedy white toast application

In this experiment Hexose oxidase HOX (listed as SEQ ID NO: 116 and sold as product Grindamyl® SUREBake 800, Dupont Nutrition Bioscience, Denmark) was tested in a Tweedy white toast experimental setup to show supplement volume response in combination with the ‘No-lyso-phospholipase’ CRC08319 and POWERBake 4080.

The Tweedy white toast baking was done according to ‘Tweedy white toast’ description presented in the ‘Assay and Methods’ section above.

The experimental setup of the application trials and the results from the baking evaluation are presented in respectively Table 25 and Figure 16.

Table 25. Experimental setup of Hexose oxidase response test in Tweedy white toast baking.

Tweedy white toast bake including Phospholipase CRC08319 Mature, active fragment and POWERBake 4080 with and without Hexose oxidase HOX (listed as SEQ ID NO: 116 and sold as product Grindamyl® SUREBake 800).

Figure 16 shows volume response of Hexose oxidase HOX (listed as SEQ ID NO: 116 and sold as product Grindamyl® SUREBake 800) in combination with CRC08319 mature, active fragment and POWERBake 4080 in Tweedy white toast application measuring specific volume unshocked and shocked.

Phospholipase CRC08319 Mature, active fragment, is used in combination with POWERBake 4080. The dosage of Phospholipase CRC08319 Mature, active fragment, used is x5.9 relative to the dosage representation provided in Example 19, Figure 1.

The combination of Hexose oxidase with CRC083f9+POWERBake 4080 is observed to have a supplement positive effect as seen by the increased specific volume - shocked and unshocked - of Hexose oxidase HOX on top of CRC08319+POWERBake 4080 in Tweedy white toast.

Example 32. Experimental analyses of CRC08319 and amylase impact on pasting temperature using RVA analyses

RVA analyses including CRC08319 with and without different amylases (NBA, VERON MAXIMA, WAAA245, WAAA249, and SAS3) were conducted according to RVA analyses in Assay and Methods section.

Table 26. Experimental setup of Amylase response test in RVA analyses.

RVA (Rapid Visco Analyser) analyses including Phospholipase CRC08319 Mature, active fragment without and with different amylases - NBA (listed as SEQ ID NO: 120 and used as product POWERFresh® Bread 8100, Dupont Nutrition Bioscience, Denmark), VERON MAXIMA (listed as SEQ ID NO: 122 and sold as product VERON® MAXIMA, AB Enzymes), WAAA245 (listed as SEQ ID NO:123), WAAA249 (listed as SEQ ID NO:119), or SAS3 (listed as SEQ ID NO: 121 and sold as product GRINDAMYL® CAPTIVE TS-E 1514, Dupont Nutrition Bioscience, Denmark). The dosage of Phospholipase CRC08319 Mature, active fragment, used is x7.9 relative to the dosage representation provided in Example 19, Figure 1.

Dosages of WAAA245 and WAAA249 are presented as dosage relative to dosage of POWERFresh® Bread 8100. The dosage relatedness is based on activity units/kg flour, where enzyme activity is measured using Blocked p-Nitrophenyl-a-D-Maltoheptoside (Megazyme, a-Amylase Reagent (Ceralpha), Product code: R-CAAR4) - Substrate preparation according to manufactures instruction. Activity assay run at pH 5.6 (Malate buffer), 30 degC, 5 min.

The activity of POWERFresh® Bread 8100, 250 ppm is defined as 1, and the dosages of WAAA245 and WAAA249 are presented relative to this.

^# Dosage represented as relative dosage based on activity measured using Blocked p-Nitrophenyl-a-D- Maltoheptoside (Megazyme, a-Amylase Reagent (Ceralpha), Product code: R-CAAR4) - Substrate preparation according to manufactures instruction. Assay was run at pH 5.6 (Malate buffer), 30 degC, 5 min. The activity of POWERFresh® Bread 8100, 250 ppm is defined as 1, and the dosages of WAAA245 and WAAA249 are presented relative to this .

Figure 17 demonstrates pasting temperature of RVA samples containing CRC08319 in combination with different amylases. CRC08319 on its own provides a higher pasting temperature compared to control dough. Surprisingly, when CRC08319 is combined with amylases even higher pasting temperatures are observed.

Although the foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding, certain changes and modifications can be practiced within the scope of the appended claims. In addition, each reference provided herein is incorporated by reference in its entirety for all purposes to the same extent as if each reference was individually incorporated by reference. To the extent the content of any citation, including website or accession number may change with time, the version in effect at the filing date of this application is meant. Unless otherwise apparent from the context any step, element, aspect, feature of embodiment can be used in combination with any other.