HUTCHINSON JOHN H (US)
SHAW ANTHONY W (US)
GRAHAM SAMUEL L (US)
CICCARONE TERRENCE M (US)
DESOLMS S JANE (US)
HUTCHINSON JOHN H (US)
SHAW ANTHONY W (US)
GRAHAM SAMUEL L (US)
CICCARONE TERRENCE M (US)
US4690942A | 1987-09-01 | |||
US5559141A | 1996-09-24 | |||
US5780492A | 1998-07-14 |
MERCK & CO., INC. (NJ, US)
1. | A compound of formula A : wherein : Rla, Rlb and R1C are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R8O, R9S (O) qCN NO2, R8C (O), R8OC (O), R8 (C1C6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) C1C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3ClO cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=CH, k) R8C=C, and 1) OR8 ; R3, R4 and R5 are independently selected from : H,CN, N02, halogen, unsubstituted or substituted C 1C6 alkyl, N3, R9S (O) q, HC#C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30, CF3CH20, C3C10 cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl, (C1C6 alkyl) OR8, (C1C6 alkyl) C (O) R8,CH=CHR8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1C6 alkyl, unsubstituted or substituted, h) R80, i) N3, j) R9S (O) q, k)HC=CH2, 1) C#CH, m) CF3 n) R80 (C=O), and o) R8 (O=C) O ; R8 is independently selected from hydrogen, unsubstituted or substituted ClC6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (C1C6 alkyl) OR8,(C1C6 alkyl) OC (O) (ClC6 alkyl), (ClC6 alkyl) N (R8) 2, and(C1C6 alkyl) NHC (O) (C1C6 alkyl) R8 ; A1, A2 and A3 are independently selected from : a) a bond, b)HC=CH, c)C=C, d) O, e) (C=O), f) O(C=O), g) (C=O)O, h)NR8, i)C (O) N (R8), j)N (R8) C (O), k)NHC (O) NH, l) S(O)q, m)S (O) qNH, and n) NHS(O)q; A4 is selected from a bond, C (O), C=CH2, or spiro C3C6 cycloalkyl ; W is selected from : a) hydrogen, b) heterocycle, and c) aryl ; X is selected from : a) aryl, b) cycloalkyl, c) heterocycle, and d) a bond ; Y is selected from : a) aryl, unsubstituted or substituted b) heterocycle, unsubstituted or substituted, and c) cycloalkyl ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; qis 0, 1 or 2 ; r is 0, 1, 2 or 3 ; s is 0, 1, 2, 3 or 4 ; and ; t is 0, 1, 2 or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
2. | The compound of Claim 1, illustrated by formula A : wherein : Rla, Rlb and R1C are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3C10 cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R80C (O), R8 (C1C6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) ClC6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3ClO cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=C, k) R8CC, and 1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1C6 alkyl, N3, R9S (O) q,C=CH, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30, CF3CH20, C3C1o cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl, (C1C6 alkyl) OR8, (C1C6 alkyl) C (O) R8,CH=CHR8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1C6 alkyl, unsubstituted or substituted, h) R80, unsubstituted or substituted, i) N3, j) R9S (O) q, k)HC=CH2, 1)C=CH, m) CF3 n) R80 (C=O), and o) R8 (O=C) O; R8 is independently selected from hydrogen, unsubstituted or substituted C1C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (C1C6 alkyl) OR8,(C1C6 alkyl) OC (O) (ClC6 alkyl), (ClC6 alkyl) N (R8) 2, and(C1C6 alkyl) NHC (O) (C1C6 alkyl) R8 ; A1, A2 and A3 are independently selected from : a) a bond, b)HC=CH, c) C#C, d) O, e) (C=O), f)O (C=O), g) (C=O)O, h)NR8, i)C (O) N (R8), j)N (R8) C (O), k)NHC (O) NH, l) S(O)q, m)S (O) qNH, and n) NHS(O)q; A4 is selected from a bond, C (O), C=CH2, or spiro C3C6 cycloalkyl ; W is selected from : a) heterocycle, and b) aryl ; X is selected from : a) aryl, b) cycloalkyl, c) heterocycle, and d) a bond ; Y is selected from : a) aryl, b) heterocycle, and c) cycloalkyl ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; r is 1 or 2 ; sis 0, 1, 2, 3 or 4 ; and tis 0, 1, 2 or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
3. | The compound of Claim 1, illustrated by formula B : wherein : R1a, R1b and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3ClO cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R80C (O), R8 (C1C6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) C1C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C(O)0, R8OC(O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=CH, k) R8C=C, and 1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted ClCg alkyl, N3, R9S (O) q, HC#C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30, CF3CH20, C3C10 cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl, (C1C6 alkyl) OR8, (ClCe alkyl) C (O) R8,CH=CHR8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1C6 alkyl, unsubstituted or substituted, h) R80, i) N3, j) R9S (O) q, k)HC=CH2, l) C#CH, m) CF3 n) R80 (C=O), and o) R8 (O=C) O ; R8 is independently selected from hydrogen, unsubstituted or substituted ClC6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted ClC6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (C1C6 alkyl) OR8,(C1C6 alkyl) OC (O) (ClC6 alkyl), (C1C6 alkyl) N (R8) 2, and (C1C6 alkyl) NHC (O) (C1C6 alkyl) R8 ; A1, A2 and A3 are independently selected from : a) a bond, b)HC=CH, <BR> <BR> c)C=C,<BR> <BR> <BR> <BR> d)O,<BR> <BR> <BR> <BR> e) (C=O), f) O(C=O), g) (C=O)O, h)NR8, i)C (O) N (R8), j)N (R8) C (O), k)NHC (O) NH, 1)S (O) q, m)S (O) qNH, and n) NHS(O)q; A4 is selected from a bond, C (O), C=CH2, or spiro C3C6 cycloalkyl ; W is selected from : a) heterocycle, and b) aryl ; X is selected from : a) aryl, b) cycloalkyl, c) heterocycle, and d) a bond ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; p is 0, 1, 2, 3 or 4 ; qis 0, 1 or 2 ; sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2, or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
4. | The compound of Claim 3, illustrated by formula B : wherein : R1a, R1b and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3C10 cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R80C (O), R8 (ClC6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) C1C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=CH, k) R8C=C, and 1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1C6 alkyl, N3, R9S (O) q, HC#C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30, CF3CH20, C3C1o cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl,(C1C6 alkyl) OR8, (C1C6 alkyl) C (O) R8,CH=CHR8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1C6 alkyl, unsubstituted or substituted, h) R80, <BR> <BR> i) N3,<BR> <BR> <BR> <BR> j) R9S (O) q, k)HC=CH2, l) C#CH, m) CF3 n) R80 (C=O), and o) R8 (O=C) O ; R8 is independently selected from hydrogen, unsubstituted or substituted C1C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted ClC6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, ('ClC6 alkyl) OR8, (ClC6 alkyl) OC (O) (ClC6 alkyl), (ClC6 alkyl) N (R8) 2, and (ClC6 alkyl) NHC (O) (C1C6 alkyl) R8 ; A1 is selected from : a) a bond, b) O, c) (C=O), d)NR8, e)C (O) N (R8), and f)S (O) q ; A2 and A3 are independently selected from : a) a bond, b)HC=CH, <BR> <BR> <BR> c)C=C,<BR> <BR> <BR> <BR> <BR> d)O,<BR> <BR> <BR> <BR> <BR> e) (C=O), f)O (C=O), g) (C=O)O, h)NR8, i)C (O) N (R8), j)N (R8) C (O), k)NHC (O) NH, 1)S (O) q, m)S (O) qNH, and n) NHS(O)q; A4 is selected from a bond, C (O), C=CH2, or spiro C3C6 cycloalkyl ; W is a heterocycle, X is selected from : a) aryl, b) heterocycle, and c) a bond ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2 or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
5. | The compound of Claim 1, illustrated by formula C : wherein : R1a, R1b and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R80C (O), R8 (C1C6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) C1C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, ClCl cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) qCNj R8C (O), R8OC (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) ClC6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1C6 alkyl, N3, R9S (O) q, HC#C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF3O, CF3CH2O, C3C1o cycloalkyl, OR8, N (R8) 2,C (O) R8,O (ClC6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl, (C1C6 alkyl) OR8, (C1C6 alkyl) C (O) R8,CH=CHR8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) ClC6 alkyl, unsubstituted or substituted, h) R80, i) N3, j) R9S (O) q, k) CF3 1) R80 (C=O), and m) R8 (O=C) O ; R8 is independently selected from hydrogen, unsubstituted or substituted ClC6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (ClC6 alkyl) OR8, (C1C6 alkyl) OC (O) (ClC6 alkyl), (C1C6 alkyl) N (R8) 2, and (C1C6 alkyl) NHC (O) (C1C6 alkyl) R8 ; A2 is selected from : a) a bond, b)HC=CH, c)C=C, d) O, e) (C=O), f)O (C=O), <BR> <BR> <BR> g) (C=0) 0,<BR> <BR> <BR> <BR> <BR> h)NR8, i)C (O) N (R8), j)N (R8) C (O), k)NHC (O) NH, l) S(O)q, m)S (O) qNH, and n) NHS(O)q; A3 is selected from : a) a bond, b)O, c)S (O) q, d)S (O) qNH, e)NR8, f) (C=O), g) (C=0) 0, h)O (C=O), i)C (O) N (R8), j)N (R8) C (O), and k)NHC (O) NH ; A4 is selected from a bond, C (O), C=CH2, or spiro C3C6 cycloalkyl ; X is selected from : a) aryl, b) heterocycle, and c) a bond ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; s is 0, 1, 2, 3 or 4 ; and t is 0, 1, 2 or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
6. | The compound of Claim 1, illustrated by formula D : wherein : R1a, R1b and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, ClCl cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R80C (O), R8 (C1C6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) ClC6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3Cl0 cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1C6 alkyl, N3, R9S (O) q, HC C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF3O, CF3CH2O, C3Clo cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl,(C1C6 alkyl) OR8, (C1C6 alkyl) C (O) R8,CH=CHR8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1C6 alkyl, unsubstituted or substituted, h) R80, i) N3, j) R9S (O) q, k) CF3 1) R80 (C=O), and m) R8 (O=C)O; R8 is independently selected from hydrogen, unsubstituted or substituted ClC6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted ClC6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (ClCe alkyl) OR8, (C1C6 alkyl) OC (O) (ClC6 alkyl), (C1C6 alkyl) N (R8) 2, and (C1C6 alkyl) NHC (O) (C1C6 alkyl) R8 ; A2 is selected from : a) a bond, b)HC=CH, c)C=C, d) O, e) (C=O), f)O (C=O), g) (C=0) 0, h)NR8, i)C (O) N (R8), j)N (R8) C (O), k)NHC (O) NH, l) S(O)q, m)S (O) qNH, and n) NHS(O)q; A3 is selected from : a) a bond, b)O, c) S(O)q, d)S (O) qNH, e)NR8, f) (C=O), g) (C=0) 0, h)O (C=O), i)C (O) N (R8), j)N (R8) C (O), and k)NHC (O) NH ; A4 is selected from a bond, C (O), C=CH2, or spiro C3C6 cycloalkyl ; X is selected from : a) aryl, b) heterocycle, and c) a bond ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; and sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2, or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
7. | The compound of Claim 1, illustrated by formula E : wherein : Rla and Rlc are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R8OC (O), R8(C1C6 alkyl)O, N3, N(R8)2 or OC(O)Oheteroaralkyl; c) C1C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3ClO cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1C6 alkyl, N3, R9S (O) q, HC#C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30, CF3CH20, C3C1o cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl,(C1C6 alkyl) OR8, (ClCe alkyl) C (O) R8,CH=CHR8 and R8 is independently selected from hydrogen, unsubstituted or substituted C1C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted ClC6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (ClCe alkyl) OR8,(C1C6 alkyl) OC (O) (C1C6 alkyl),(Clc6 alkyl) N (R8) 2, and(C1C6 alkyl) NHC (O) (C1C6 alkyl) R8 ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; and s is 0, 1, 2, a or 4 ; or the pharmaceutically acceptable salts thereof. |
8. | The compound of Claim 1, illustrated by formula F : wherein : Rla and R1C are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R8O, R9S (O) q, CN, N02, R8C (O), R8OC (O), R8 (C1C6 alkyl) O, N3, N (R8) 2 orOC (O) Oheteroaralkyl ; c) C1C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3ClO cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R8OC (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted ClC6 alkyl, N3, R9S (O) q, HC#C, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30, CF3CH20, C3C10 cycloalkyl, OR8, N (R8) 2,C (O) R8,O (C1C6 alkyl) OR8, NHC (O) R8, aralkyl, heteroaralkyl,(C1C6 alkyl) OR8, (ClCe alkyl) C (O) R8,CH=CHR8 and R8 is independently selected from hydrogen, unsubstituted or substituted C1C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, (ClC6 alkyl) OR8, (ClC6 alkyl) OC (O) (ClC6 alkyl), (ClC6 alkyl) N (R8) 2, and (ClC6 alkyl) NHC (O) (C1C6 alkyl) R8 ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; and sis 0, 1, 2, 3 or 4 ; or the pharmaceutically acceptable salts thereof. |
9. | A compound of formula I : wherein : Rla, Rlb and Ric are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl ; unsubstituted or substituted heterocycle ; unsubstituted or substituted heteroaryl ; C3C1o cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, N02, R8C (O), R8OC (O), or N3 ; c) ClC6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3C1O cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C(O)O; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, f) heteroaryl, g) ClCe alkyl, h) C1C6 alkoxy, i) N3, j) R9S (O) q, k) R8C=C, and 1) R8CC ; R3, R4 and R5 are independently selected from : a) H, b) CN, c) N02, d) halogen, e) C1C6 alkyl, f) ClC6 alkoxy, g) N3, h) R9S (O) q, i)HC=CH2, j)CCH, k) aryl, unsubstituted or substituted, 1) heterocycle, unsubstituted or substituted, m) CF30, n) CF3CH20, o) C3C1o cycloalkyl, and p) CF3 ; R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) ClC6 alkyl, unsubstituted or substituted, h) R80, i) N3, j) R9S (O) q, k)HC=CH2, l) C#CH, m) CF3 n) R80 (C=O), and o) R8 (O=C) O ; R8 is independently selected from hydrogen, C1C6 alkyl, benzyl and aryl ; R9 is independently selected from ClC6 alkyl, benzyl and aryl ; A1 and A2 are independently selected from : a) a bond, b)HC=CH, c)CC, d) O, e) S (O) q, f) O (C=O), g) (O=C), and h) (C=O) O ; W is selected from : a) hydrogen, b) heterocycle, unsubstituted or substituted, and c) aryl, unsubstituted or substituted ; X is selected from : a) aryl, b) heteroaryl, c) cycloalkyl, d) heterocycle, and e) a bond ; Y is selected from : a) aryl, unsubstituted or substituted, b) heterocycle, unsubstituted or substituted, and c) heteroaryl, unsubstituted or substituted ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; and q is 0, 1 or 2 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
10. | The compound of Claim 9, illustrated by formula Ia : wherein : R1a is selected from : hydrogen or C1C6 alkyl ; R1b is independently selected from : a) hydrogen, b) aryl, heterocycle, C3Clo cycloalkyl, R8O or C2C6 alkenyl, c) ClC6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, or R80 ; R3 and R4 are independently selected from hydrogen, F, Cl, Br, N3, CN, C1C6 alkyl, substituted or unsubstituted aryl and substituted or unsubstituted heterocycle ; R5 is selected from : a) hydrogen, and b) ClC6 alkyl substituted with hydrogen or a group selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocyclic, unsubstituted or substituted C3 Clo cycloalkyl, CF3, N02, R8O, R9S (O) q, R8C (O), R80C (O), N3, and CN ; R6 is independently selected from : a) hydrogen, b) C1C6 alkyl, C1C6 perfluoroalkyl, F, Cl, CN, N02, and c) C1C6 alkyl substituted by C1C6 perfluoroalkyl, R8O, R8C (O), or R80C (O); R8 is independently selected from hydrogen, C1C6 alkyl, benzyl and aryl ; R9 is independently selected from C1C6 alkyl, benzyl and aryl ; A1 and A2 are independently selected from : a bond,HC=CH,C=C, O, S (O) q, O (C=O), and (O=C) O ; X is selected from : a) aryl, b) heteroaryl, c) cycloalkyl, d) heterocycle, and e) a bond ; Y is selected from : a) aryl, b) substituted aryl, c) heterocycle, and d) substituted heterocycle ; n is 0, 1, 2, 3 or 4 ; pis0, 1, 2, 3 or 4 ; and q is 0, 1, or 2 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. |
11. | The compound of Claim 9, illustrated by formula Ib : wherein : Rla is selected from : a) hydrogen, b) unsubstituted or substituted aryl ; unsubstituted or substituted heterocycle ; unsubstituted or substituted heteroaryl ; C3Clo cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R8O, R9S (O) q, CN, N02, R8C (O), R80C (O), or N3 ; c) ClC6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3C1o cycloalkyl, C2C6 alkenyl, C2C6 alkynyl, R80, R9S (O) q, CN, R8C (O), R80C (O), N3, or R8C (O) 0 ; Ric is independently selected from : H, unsubstituted or substituted Cl C6 alkyl, unsubstituted or substituted aryl, and unsubstituted or substituted heteroaryl ; R3 is selected from hydrogen, F, Cl, Br, N3, CN, ClC6 alkyl, substituted or unsubstituted aryl and substituted or unsubstituted heterocycle ; R4 and R5 are independently selected from : a) H, b) halogen, c) aryl, unsubstituted or substituted, d) heteroaryl, unsubstituted or substituted, and e) ClC6 alkyl ; R8 is independently selected from hydrogen, C1C6 alkyl, benzyl and aryl ; R9 is independently selected from C1C6 alkyl, benzyl and aryl ; n is independently selected from : 0, 1, 2, 3 or 4 ; and q is 0, 1 or 2 ; or the pharmaceutically acceptable salts thereof. |
12. | A compound which inhibits a prenylprotein transferase, selected from the group consisting of : 3 (biphenyl4ylmethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 3 (biphenyl4yl2ethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 3 (biphenyl3ylmethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (biphenyl4ylmethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (biphenyl4yl2ethoxy)4imidazol1ylmethylbenzonitrile 1tertbutoxycarbonyl4 (3chlorophenyl)2 (S) [2 (2cyano5imidazoll ylmethylphenoxy) ethyl] piperazine <BR> <BR> 2 (3chlorophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (4chlorophenyl2ethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3chlorophenyl2ethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (2chlorophenyl2ethoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (phenyl2ethoxy)4imidazol1ylmethylbenzonitrile 2 (3chlorobenzyloxy)4imidazol1ylmethylbenzonitrile 2(4chlorobenzyloxy)4imidazol1ylmethylbenzonitrile 2 (2, 4dichlorobenzyloxy)4imidazol1ylmethylbenzonitrile 2(benzyloxy)4imidazol1ylmethylbenzonitrile 2(biphenyl2ylmethoxy)4imidazol1ylmethylbenzonitrile 2(phenyl4butoxy)4imidazol1ylmethylbenzonitrile 2(phenyl3propoxy)4imidazol1ylmethylbenzonitrile 2 (biphenyl4yl2ethoxy)4 (1, 2, 4triazol1yl) methylbenzonitrile 2 (biphenyl4yl2ethoxy)4 (2methylimidazol1yl) methylbenzonitrile 2 (biphenyl4yl2ethoxy)4benzimidazol1yl) methylbenzonitrile <BR> <BR> 4imidazol1ylmethyl2 (naphthalen2yloxy)benzonitrile<BR> <BR> 2 (3cyanophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3bromophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (biphen3yloxy)4imidazol1ylmethylbenzonitrile 2(biphen4yloxy)4imidazol1ylmethylbenzonitrile 2 (3acetylphenoxy)4imidazol1ylmethylbenzonitrile 2(2acetylphenoxy)4imidazol1ylmethylbenzonitrile <BR> <BR> 2 (3trifluoromethylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3methylphenoxy)4imidazol1ylmethylbenzonitrile 2(2methylphenoxy)4imidazol1ylmethylbenzonitrile <BR> <BR> 2 (4methylphenoxy)4imidazollylmethylbenzonitrile<BR> <BR> 2 (3methoxyphenoxy)4imidazol1ylmethylbenzonitrile 2(2=methoxyphenoxy)4imidazol1ylmethylbenzonitrile 2 (4methoxyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3, 5dimethylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3, 4dimethylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3, 5dimethoxyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (1naphthyloxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (2, 4dichlorophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3fluorophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3tbutylphenoxy)4imidazol1ylmethylbenzonitrile 2 [3 (N, Ndiethylamino) phenoxy]4imidazol1ylmethylbenzonitrile 2 (3npropylphenoxy)4imidazol1ylmethylbenzonitrile 2(2,3dimethoxyphenoxy)4imidazol1ylmethylbenzonitrile 2(2,3dimethylphenoxy)4imidazol1ylmethylbenzonitrile <BR> <BR> 2 (3, 4dimethoxyphenoxy)4imidazollylmethylbenzonitrile<BR> <BR> 2 (2, 5dimeth6xyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3, 4dichlorophenoxy)4imidazol1ylmethylbenzonitrile 2(2,4dimethylphenoxy)4imidazol1ylmethylbenzonitrile 2 (4chloro2methylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (5chloro2methylphenoxy)4imidazol1ylmethylbenzonitrile 2 (2chloro4, 5dimethylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (5hydroxymethyl2methoxyphenoxy)4imidazol1ylmethyl benzonitrile 4imidazol1ylmethyl2 (3phenylaminophenoxy)benzonitrile 4imidazol1ylmethyl2[3(2methylphenylamino)phenoxy]benzonitrile <BR> <BR> 4imidazol1ylmethyl2 (3phenoxyphenoxy)benzonitrile<BR> <BR> 2 (2benzoylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 1 (5chloro2methoxyphenyl)3 [3 (2cyano5imidazol1ylmethyl<BR> phenoxy)phenyl]urea 1 (2, 5dimethoxyphenyl)3 [3(2cyano5imidazol1ylmethylphenoxy) phenyl]urea<BR> <BR> 2 (3benzyloxyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (4benzyloxyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (2benzylphenoxy)4imidazol1ylmethylbenzonitrile 2(3ethynylphenoxy)4imidazol1ylmethylbenzonitrile <BR> <BR> 2 (4acetyl3methylphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 4imidazol1ylmethyl2 (lHindazol6yloxy)benzonitrile 4imidazol1ylmethyl2 (5, 6, 7, 8tetrahydronaphthalen1yloxy) benzonitrile 4imidazol1ylmethyl2(8oxo5, 6, 7, 8tetrahydronaphthalen1yloxy) benzonitrile <BR> <BR> <BR> <BR> <BR> <BR> 4imidazol1ylmethyl2 (lHindol7yloxy)benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 4imidazol1ylmethyl2 (3oxoindan4yloxy)benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 4imidazol1ylmethyl2 (lHindol4yloxy)benzonitrile 2[3(2hydroxyethoxy)phenoxy]4imidazol1ylmethylbenzonitrile <BR> <BR> <BR> <BR> <BR> <BR> 4imidazol1ylmethyl2 (4imidazol1ylphenoxy)benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 4' (2cyano5imidazol1ylmethylphenoxy)biphenyl4carbonitrile N[3(2cyano5imidazol1ylmethylphenoxy)phenyl]acetamide <BR> <BR> <BR> <BR> <BR> <BR> 4imidazol1ylmethyl2 (9oxo9Hfluoren4yloxy)benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 3 (2cyano5imidazol1ylmethylphenoxy)Nphenylbenzamide 3(2cyano5imidazl1ylmethylphenoxy)NethylNphenylbenzamide 3 (2cyano5imidazol1ylmethylphenoxy)NcyclopropylmethylN phenylbenzamide 2(5chloropyuridin3yloxy)4imidazol1ylmethylbenzonitrile N[3(2cyano5imidazol1ylmethylphenoxy)phenyl] benzenesulfonamide <BR> <BR> <BR> 4imidazol1ylmethyl2 (indan5yloxy)benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 3 (9Hcarbazol2yloxy)4imidazol1ylmethylbenzonitrile 4imidazol1ylmethyl2(5, 6, 7, 8tetrahydronaphthalen2yloxy) benzonitrile <BR> <BR> 4imidazol1ylmethyl2 (2methoxy4propenylphenoxy)benzonitrile<BR> <BR> 4imidazol1ylmethyl2 [4 (3oxobutyl)phenoxy]benzonitrile<BR> <BR> 2 (3chlorophenoxy)5imidazol1ylmethylbenzonitrile<BR> <BR> 2 (4chlorophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3, 5dichlorophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (pyridin3yloxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (2chlorophenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (3chlorophenoxy)5 (4phenylimidazollylmethyl)benzonitrile<BR> <BR> 2 (biphen2yloxy)4imidazol1ylmethylbenzonitrile 2 (phenoxy)4imidazollylmethylbenzonitrile <BR> <BR> 2 (2chloro4methoxyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (2chlorophenylsulfanyl)4imidazol1ylmethylbenzonitrile 4imidazol1ylmethyl2(naphthalen2ylsulfanyl)benzonitrile 2(2,4dichlorophenylsulfanyl)4imidazol1ylmethylbenzonitrile 2(2,4dichlorobenzenesulfinyl)4imidazol1ylmethylbenzonitrile 2(2,4dichlorobenzenesulfinyl)4imidazol1ylmethylbenzonitrile 2 (2methylpyridin3yloxy)4imidazol1ylmethylbenzonitrile 2 (2, 4dimethylpyridin3yloxy)4imidazollylmethylbenzonitrile <BR> <BR> 2 (4chloro2methoxyphenoxy)4imidazol1ylmethylbenzonitrile<BR> <BR> 2 (2chlorophenoxy)4 (5methylimidazol1ylmethyl)benzonitrile<BR> <BR> 2 (2chlorophenoxy)4 (4methylimidazol1ylmethyl)benzonitrile<BR> <BR> 2 (3chloro5trifluoromethylpyridin2yloxy)4imidazol1ylmethyl benzonitrile <BR> <BR> 2 (2, 4dichlorophenoxy)4 (2methylimidazol1ylmethyl)benzonitrile N[3(2cyano5imidazol1ylmethylphenoxy)phenyl]benzamide 2[3(2cyano5imidazol1ylmethylphenoxy)phenyl]Nphenyl acetamide 4imidazol1ylmethyl2 (quinolin6yloxy)benzonitrile 4imidazol1ylmethyl2 (2oxo1, 2dihydroquinolin6yloxy)benzonitrile N [3(2cyano5imidazol1ylmethylphenoxy)phenyl]2phenyl acetamide <BR> <BR> 5 (2cyano5imidazol1ylmethylphenoxy)Ncyclohexylnicotinamide<BR> <BR> N (3chlorophenyl)5 (2cyano5imidazol1ylmethylphenoxy) nicotinamide 2 (2, 3dimethoxyphenoxy)4 (2, 4dimethylimidazol1ylmethyl) benzonitrile 4 (2methylimidazol1ylmethyl)2 (naphthalen2yloxy)benzonitrile<BR> <BR> 4(1imidazol1yl1methylethyl)2(naphthalen2yloxy)benzonitrile 1 [4iodo3(naphthalen2yloxy)benzyl]lHimidazole acetic acid 3 [3 (2chlorophenoxy)4cyanobenzyl]3Himidazol4 ylmethylester<BR> <BR> 2 (2chlorophenoxy)4 (5hydroxymethylimidazol1ylmethyl) benzonitrile 4 (5aminomethylimidazol1ylmethyl)2 (2chlorophenoxy) benzonitrile <BR> <BR> N {3 [4cyano3 (2, 3dimethoxyphenoxy)benzyl]3Himidazol4<BR> ylmethyl}2cyclohexylacetamide 2(3chlorophenoxy)4[(4chlorophenyl)imidazol1ylmethyl] benzonitrile <BR> <BR> 2 (3chlorophenoxy)4 [1 (4chlorophenyl)2hydroxy1imidazol1yl ethyl]benzonitrile <BR> <BR> 2 (3chlorophenoxy)4 [ (4chlorophenyl)hydroxy (3Himidazol4yl) methyl]benzonitrile <BR> <BR> 2 (2, 4dichlorophenylsulfanyl)4 [5 (2morpholin4ylethyl)imidazoll<BR> ylmethyl]benzonitrile 2 (2, 4dichlorophenoxy)4 [5 (2morpholin4ylethyl)imidazoll ylmethyl]benzonitrile 4 [hydroxy (3methyl3Himidazol4yl)methyl]2 (naphthalen2yloxy) benzonitrile 4 [amino (3methyl3Himidazol4yl)methyl]2 (naphthalen2yloxy) benzonitrile 4 [1hydroxy1 (3m ethyl3Him idazol4yl)ethyl]2 (naphthalen2yloxy) benzonitrile 4 [1am ino1 (3m ethyl3Him idazol4yl)ethyl]2 (naphthalen2yloxy) benzonitrile hydrochloride <BR> <BR> <BR> <BR> <BR> <BR> 3{2cyano5 [1amino1(3methyl3Himidazol4yl)ethyl]phenoxy}N ethylNphenylbenzamide <BR> <BR> <BR> <BR> <BR> <BR> 3{2cyano5 [1hydroxy1(3methyl3Himidazol4yl)ethyl]phenoxy}N ethylNphenylbenzamide 4 [1hydroxy1 (3methyl3Himidazol4yl)ethyl]2 (3phenylamino phenoxy)benzonitrile 4 [1hydroxy1 (3methyl3Himidazol4yl)ethyl]2 (3phenoxyphenoxy) benzonitrile <BR> <BR> <BR> <BR> <BR> <BR> 2 (3benzoylphenoxy)4 [1hydroxy1 (3methyl3Himidazol4yl)ethyl] benzonitrile 2(3tertbutylphenoxy)4[1hydroxy1(3methyl3Himidazol4yl) ethyl]benzonitrile <BR> <BR> <BR> <BR> <BR> <BR> 2 (3diethylaminophenoxy)4 [lhydroxyl (3methyl3Himidazol4yl) ethyl]benzonitrile 2 (5chloro2oxo2H [1, 2'] bipyridinyl5'ylmethoxy)4imidazol1 ylmethylbenzonitrile 4Imidazol1ylmethyl2 [2(2oxo2Hpyridin1yl)phenoxy]benzonitrile 4Imidazol1ylmethyl2 [3(2oxo2Hpyridin1yl)phenoxy]benzonitrile <BR> <BR> 4Imidazol1ylmethyl2 [4 (2oxo2H pyridin1yl)phenoxy]benzonitrile or the pharmaceutically acceptable salts thereof. |
13. | The compound according to Claim 12 which is : 2 (2, 3Dimethoxyphenoxy)4imidazol1ylmethylbenzonitrile or a pharmaceutically acceptable salt thereof. |
14. | The compound according to Claim 12 which is : 4Imidazol1ylmethyl2 (naphthalen2yloxy)benzonitrile or a pharmaceutically acceptable salt thereof. |
15. | The compound according to Claim 12 which is : 2 (2, 4Dichlorophenylsulfanyl)4imidazol1ylmethylbenzonitrile or a pharmaceutically acceptable salt thereof. |
16. | The compound according to Claim 12 which is : 3(2Cyano5imidazol1ylmethylphenoxy)NethylNphenylbenzamide or a pharmaceutically acceptable salt thereof. |
17. | The compound according to Claim 12 which is : 2 (2, 4dichlorophenylsulfanyl)4 [5 (2morpholin4ylethyl)imidazoll ylmethyl]benzonitrile or a pharmaceutically acceptable salt thereof. |
18. | A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 1. |
19. | A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 5. |
20. | A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 12. |
21. | A method for inhibiting a prenylprotein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
22. | A method for inhibiting a prenylprotein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 19. |
23. | A method for inhibiting a prenylprotein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 20. |
24. | A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
25. | A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 19. |
26. | A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 20. |
27. | A method for treating neurofibromen benign proliferative disorder which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
28. | A method for treating blindness related to retinal vascularization which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
29. | A method for treating infections from hepatitis delta and related viruses which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
30. | A method for preventing restenosis which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
31. | A method for treating polycystic kidney disease which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 18. |
32. | A pharmaceutical composition made by combining the compound of Claim 1 and a pharmaceutically acceptable carrier. |
33. | A process for making a pharmaceutical composition comprising combining a compound of Claim 1 and a pharmaceutically acceptable carrier. |
BACKGROUND OF THE INVENTION The Ras proteins (Ha-Ras, Ki4a-Ras, Ki4b-Ras and N-Ras) are part of a signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein. In the inactive state, Ras is bound to GDP. Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change. The GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D. R. Lowy and D. M. Willumsen, Ann. Rev. Biochem. 62 : 851-891 (1993)). Mutated ras genes (Ha-ras, Ki4a- ras, Ki4b-ras and N-ras) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras. The Ras C-terminus contains a sequence motif termed a"CAAX"or"Cys-Aaal-Aaa2-Xaa" box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al., Nature 310 : 583-586 (1984)). Depending on the specific sequence, this motif serves as a signal sequence for the enzymes farnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C15 or C20 isoprenoid, respectively. Such enzymes may be generally termed prenyl-protein transferase. (S. Clarke., Ann.
Rev. Biochem. 61 : 355-386 (1992) ; W. R. Schafer and J. Rine, Ann. Reu.
Genetics 30 : 209-237 (1992)). The Ras protein is one of several proteins that are known to undergo post-translational farnesylation. Other farnesylated proteins include the Ras-related GTP-binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also farnesylated. James, et al., have also suggested that there are farnesylated proteins of unknown structure and function in addition to those listed above.
Inhibition of farnesyl-protein transferase has been shown to block the growth of Ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype. It has also been demonstrated that certain inhibitors of farnesyl-protein transferase selectively block the processing of the Ras oncoprotein intracellularly (N. E. Kohl et al., Science, 260 : 1934-1937 (1993) and G. L. James et al., Science, 260 : 1937-1942 (1993). Recently, it has been shown that an inhibitor of farnesyl-protein transferase blocks the growth of ras- dependent tumors in nude mice (N. E. Kohl et al., Proc. Natl. Acad. Sci U. S. A., 91 : 9141-9145 (1994) and induces regression of mammary and salivary carcinomas in ras transgenic mice (N. E. Kohl et al., Nature Medicine, 1 : 792-797 (1995).
Indirect inhibition of farnesyl-protein transferase in vivo has been demonstrated with lovastatin (Merck & Co., Rahway, NJ) and compactin (Hancock et al., ibid ; Casey et al., ibid ; Schafer et al., Science 245 : 379 (1989)). These drugs inhibit HMG-CoA reductase, the rate limiting enzyme for the production of polyisoprenoids including farnesyl pyrophosphate. Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al., Cell, 62 : 81-88 (1990) ; Schaber et al., J. Biol. Chem., 265 : 14701-14704 (1990) ; Schafer et al., Science, 249 : 1133-1139 (1990) ; Manne et al., Proc. Natl. Acad. Sci USA, 87 : 7541- 7545 (1990)). Inhibition of farnesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells. However, direct inhibition of farnesyl-protein transferase
would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
Inhibitors of farnesyl-protein transferase (FPTase) have been described in two general classes. The first are analogs of farnesyl diphosphate (FPP), while the second class of inhibitors is related to the protein substrates (e. g., Ras) for the enzyme. The peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation. (Schaber et al., ibid ; Reiss et. al., ibid ; Reiss et al., PNAS, 88 : 732-736 (1991)). Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl- protein transferase enzyme, or may be purely competitive inhibitors (U. S. Patent 5, 141, 851, University of Texas ; N. E. Kohl et al., Science, 260 : 1934-1937 (1993) ; Graham, et al., J. Med. Chem., 37, 725 (1994)). In general, deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound. However, the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
It has recently been reported that farnesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7-112930).
It has recently been disclosed that certain tricyclic compounds which optionally incorporate a piperidine moiety are inhibitors of FPTase (WO 95/10514, WO 95/10515 and WO 95/10516).
Imidazole-containing inhibitors of farnesyl protein transferase have also been disclosed (WO 95/09001 and EP 0 675 112 Al).
It is, therefore, an object of this invention to develop compounds that inhibit prenyl-protein transferase and thus, the post- translational isoprenylation of proteins. It is a further object of this invention to develop chemotherapeutic compositions containing the
compounds of this invention and methods for producing the compounds of this invention.
SUMMARY OF THE INVENTION The present invention comprises small molecule phenyl- containing compounds which inhibit a prenyl-protein transferase.
Further contained in this invention are chemotherapeutic compositions containing these prenyl transferase inhibitors and methods for their production.
The compounds of this invention are illustrated by the formula A :
DETAILED DESCRIPTION OF THE INVENTION The compounds of this invention are useful in the inhibition of prenyl-protein transferase and the prenylation of the oncogene protein Ras. In a first embodiment of this invention, the inhibitors of prenyl- protein transferase are illustrated by the formula A : wherein : R1a, R1b and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-Clo cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteroaralkyl ; c) Cl-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or R8C (O) 0- ; R2 is selected from : a) hydrogen, b) CN, C)'N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) Cl-C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=CH-,
k) R8C=-C-, and 1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1-C6 alkyl, N3, R9S (O) q, HC=C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-C10 cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl, -(C1-C6 alkyl) OR8, -(C1-C6 alkyl) C (O) R8,-CH=CH-R8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1-C6 alkyl, unsubstituted or substituted, h) R80-, i) N3, j) R9S (O) q-, k)-HC=CH2, <BR> <BR> <BR> <BR> 1) -C#CH,<BR> <BR> <BR> <BR> <BR> m) CF3 n) R80 (C=O)-, and o) R8 (O=C) O-; R8 is independently selected from hydrogen, unsubstituted or substituted Cl-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from
H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1-c6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl) OR8, -(C1-C6 alkyl) OC (O) (Cl-C6 alkyl), -(C1-C6 alkyl) N (R8) 2, and -(C1-C6 alkyl) NHC (O) (C1-C6 alkyl) R8 ; A1, A2 and A3 are independently selected from : a) a bond, b)-HC=CH-, c)-C=C-, d) -O-, e)- (C=O)-, f)-O (C=O)-, g)- (C=0) 0-, h)-NR8-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, k)-NHC (O) NH-, 1) -S(O)q-, m)-S (O) qNH-, and n) -NHS(O)q-; A4 is selected from a bond, C (O), C=CH2, or spiro C3-C6 cycloalkyl ; W is selected from : a) hydrogen, b) heterocycle, and c) aryl ; X is selected from : a) aryl,
b) cycloalkyl, c) heterocycle, and d) a bond ; Y is selected from : a) aryl, unsubstituted or substituted b) heterocycle, unsubstituted or substituted, and c) cycloalkyl ; m is 0, 1, 2, 3 or 4 ; n is 0, l, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; qis 0, 1 or 2 ; r is 0, 1, 2 or 3 ; sis 0, 1, 2, 3 or 4 ; and ; t is 0, 1, 2 or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof. tn a further embodiment of this invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula A : wherein : Rla, Rlb and Rlc are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-ClO cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteroaralkyl ; c) C1-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-Clo cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b) CN, c) ifs02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1-C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=C-,
k) R8C=C-, and 1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1-C6 alkyl, N3, R9S (O) q,-C=CH, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-C1o cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl, -(C1-C6 alkyl) OR8, -(C1-C6 alkyl) C (O) R8,-CH=CH-R8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1-C6 alkyl, unsubstituted or substituted, h) R80-, unsubstituted or substituted, i) N3, j) R9S (O) q-, k)-HC=CH2, 1)-C=CH, m) CF3 n) R80 (C=O)-, and o) R8 (O=C) O-; R8 is independently selected from hydrogen, unsubstituted or substituted C1-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from
H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl) OR8,-(C1-C6 alkyl) OC (O) (Cl-C6 alkyl), -(C1-C6 alkyl) N (R8) 2, and -(C1-C6 alkyl) NHC (O) (C1-C6 alkyl) R8 ; A1, A2 and A3 are independently selected from : a) a bond, b)-HC=CH-, <BR> <BR> <BR> c)-C=C-,<BR> <BR> <BR> <BR> <BR> d)-O-,<BR> <BR> <BR> <BR> <BR> e)- (C=O)-, f)-O (C=O)-, g)- (C=0) 0-, h)-NR8-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, k)-NHC (O) NH-, 1) -S(O)q-, m)-S (O) qNH-, and n) -NHS(O)q-; A4 is selected from a bond, C (O), C=CH2, or spiro C3-C6 cycloalkyl ; W is selected from : a) heterocycle, and b) aryl ; X is selected from : a) aryl, b) cycloalkyl,
c) heterocycle, and d) a bond ; Y is selected from : a) aryl, b) heterocycle, and c) cycloalkyl ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; p is 0, 1, 2, 3 or 4 ; qis 0, 1 or 2 ; r is 1 or 2 ; sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2 or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof.
In another embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by formula B : wherein : Rla, R, lb and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-Clo cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteroaralkyl ; c) Cl-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-ClO cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R8O-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1-C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=CH-, k) R8C#C-, and
1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted Cl-C6 alkyl, N3, R9S (O) q, HC=-C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-C1o cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl, -(C1-C6 alkyl) OR8, -(C1-C6 alkyl) C (O) R8,-CH=CH-R8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1-C6 alkyl, unsubstituted or substituted, h) R80-, <BR> <BR> <BR> i) N3,<BR> <BR> <BR> <BR> <BR> <BR> j) R9S (O) q, k)-HC=CH2, 1) -C#CH, m) CF3 n) R8O(C=O)-, and o) R8 (O=C) O-; R8 is independently selected from hydrogen, unsubstituted or substituted C1-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from
H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl) OR8,-(C1-C6 alkyl) OC (O) (Cl-C6 alkyl), -(C1-C6 alkyl) N (R8) 2, and-(C1-C6 alkyl) NHC (O) (C1-C6 alkyl) R8; A1, A2 and A3 are independently selected from : a) a bond, b)-HC=CH-, c)-C=C-, d) -O-, e)- (C=O)-, f)-O (C=O)-, <BR> <BR> <BR> <BR> g)- (C=0) 0-,<BR> <BR> <BR> <BR> <BR> <BR> <BR> h)-NR8-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, k)-NHC (O) NH-, 1)-S (O) q-, m)-S (O) qNH-, and n) -NHS(O)q- ; A4 is selected from a bond, C (O), C=CH2, or spiro C3-C6 cycloalkyl ; W is selected from : a) heterocycle, and b) aryl ; X is selected from : a) aryl, b) cycloalkyl,
c) heterocycle, and d) a bond ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2, or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof.
In further embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by formula B : wherein : R1a, R1b and R1c are independently selected from :
a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteraralkyl ; c) Cl-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, Cs-Cio cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C(O)-, R8OC(O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) Cl-C6 alkyl, unsubstituted or substituted h) N3, i) R9S (O) q, j) R8HC=CH-, k) R8C=C, and 1) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1-C6 alkyl, N3, R9S (O) q, HC#C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-C1o cycloalkyl, OR8, N (R8) 2,-C (O) R8, -O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl,-(C1-C6 alkyl) OR8, -(C1-C6 alkyl) C (O) R8,-CH=CH-R8 and R6 is independently selected from :
a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) Cl-C6 alkyl, unsubstituted or substituted, h) R80-, i) N3, j) R9S (O) q-, k)-HC=CH2, 1) -C#CH, m) CF3 n) R80 (C=O)-, and o) R8 (O=C) O- ; R8 is independently selected from hydrogen, unsubstituted or substituted C1-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl) OR8,-(C1-C6 alkyl) OC (O) (Cl-C6 alkyl), -(C1-C6 alkyl) N (R8) 2, and -(C1-C6 alkyl) NHC (O) (Cl-C6 alkyl) R8 ; A1 is selected from : a) a bond, b) -O-, <BR> <BR> <BR> c)- (C=O)-,<BR> <BR> <BR> <BR> d)-NR8-,
e)-C (O) N (R8)-, and f) -S(O)q-; A2 and A3 are independently selected from : a) a bond, b)-HC=CH-, <BR> <BR> <BR> c)-C=C-,<BR> <BR> <BR> <BR> <BR> d)-O-,<BR> <BR> <BR> <BR> e)- (C=O)-, f)-O (C=O)-, g) -(C=O)O-, h)-NR8-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, k)-NHC (O) NH-, 1)-S (O) q-, m)-S (O) qNH-, and n) -NHS(O)q-; A4 is selected from a bond, C (O), C=CH2, or spiro C3-C6 cycloalkyl ; W is a heterocycle, X is selected from : a) aryl, b) heterocycle, and c) a bond; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; p is 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; s is 0, 1, 2, 3 or 4 ; and t is 0, 1, 2 or 3 ; provided that
is not a bond ; or the pharmaceutically acceptable salts thereof.
In another embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula C :
wherein : Rla, Rlb and R1C are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-C1o cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteroaralkyl ;
c) Cl-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C(O)-, R8OC (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b)-CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1-C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1-C6 alkyl, N3, R9S (O) q, HC-C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-ClO cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl, -(C1-C6 alkyl) OR8, -(C1-C6 alkyl) C (O) R8,-CH=CH-R8 and R6 is indepenXdently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) C1-C6 alkyl, unsubstituted or substituted, h) R80-,
i) N3, j) R9S (O) q-, k) CF3 1) R8O (C=O)-, and m) R8 (O=C) O- ; R8 is independently selected from hydrogen, unsubstituted or substituted Cl-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl)OR8, -(C1-C6 alkyl) OC (O) (Cl-C6 alkyl),- (Cl-C6 alkyl) N (R8) 2, and- (Cl-C6 alkyl) NHC (O) (C1-C6 alkyl) R8 ; A2 is selected from : a) a bond, b)-HC=CH-, c)-C=C-, d) -O-, <BR> <BR> <BR> e)- (C=O)-,<BR> <BR> <BR> <BR> <BR> f) O (C=O)-, g) -(C=O)O-, h)-NR8-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, k)-NHC (O) NH-, 1) -S(O)q-, m)-S (O) qNH-, and
n)-NHS (O) q ; A3 is selected from : a) a bond, b)-O-, c)-S (O) q-, d)-S (O) qNH-, e)-NR8-, f) -(C=O)-, g)-(C=O) O-, h)-O (C=O)-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, and k)-NHC (O) NH- ; A4 is selected from a bond, C (O), C=CH2, or spiro C3-C6 cycloalkyl ; X is selected from : a) aryl, b) heterocycle, and c) a bond ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2 or 3 ; provided that
is not a bond ; or the pharmaceutically acceptable salts thereof.
In another embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula D : wherein : R1a, R1b and R1c are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-ClO cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R8O-, R9S(O)q-, CN, NO2, R8C(O)-, R8OC(O)-, R8(C1-C6 alkyl)O-, N3, N(R8)2 or -OC(O)O-heteroaralkyl; c) C1-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-Clo cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R8O-, R9S (O) q-CN, R8C (O)-, R80C (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen,
b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1-C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from : H, CN, N02, halogen, unsubstituted or substituted C1-C6 alkyl, N3, R9S (O) q, HC#C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-Clo cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl,-(C1-C6 alkyl) OR8, - (Ci-Ce alkyl) C (O) R8,-CH=CH-R8 and R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) Cl-C6 alkyl, unsubstituted or substituted, h) R80-, i) N3, j) R9S (O) q-, k) CF3 1) R80 (C=O)-, and m) R8 (O=C) O-; R8 is independently selected from
hydrogen, unsubstituted or substituted C1-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, - (Cl-Ce alkyl) OR8,-(C1-C6 alkyl) OC (O) (Cl-C6 alkyl),- (Cl-C6 alkyl) N (R8) 2, and-(C1-C6 alkyl) NHC (O) (C1-C6 alkyl) R8 ; A2 is selected from : a) a bond, b)-HC=CH-, c)-C=C-, d) -O-, e) -(C=O)-, f)-O (C=O)-, g) -(C=O)O-, h)-NR8-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, k)-NHC (O) NH-, 1)-S (O) q-, m)-S (O) qNH-, and n) -NHS(O)q-; A3 is selected from : a) a bond, b) -O-, c) -S(O)q-, d)-S (O) qNH-,
e)-NR8-,<BR> <BR> <BR> <BR> <BR> <BR> <BR> - (C=O)-, g)- (C=0) 0-, h)-O (C=O)-, i)-C (O) N (R8)-, j)-N (R8) C (O)-, and k)-NHC (O) NH- ; A4 is selected from a bond, C (O), C=CH2, or spiro C3-C6 cycloalkyl ; X is selected from : a) aryl, b) heterocycle, and c) a bond ; m is 0, 1, 2, 3 or 4 ; nis 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; and sis 0, 1, 2, 3 or 4 ; and t is 0, 1, 2, or 3 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof.
In another embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula E : wherein : Rla and R1C are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-C1o cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R8O-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteroaralkyl ; c) C1-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R8O-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1-C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from :
H, CN, N02, halogen, unsubstituted or substituted Cl-Cg alkyl, N3, R9S (O) q, HC#C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-Clo cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (Cl-Ce alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl, -(C1-C6 alkyl) OR8, -(C1-C6 alkyl) C (O) R8,-CH=CH-R8 and R8 is independently selected from hydrogen, unsubstituted or substituted C1-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted C1-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted Cl-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl) OR8,-(C1-C6 alkyl) OC (O) (Cl-C6 alkyl),-(C1-C6 alkyl) N (R8) 2, and -(C1-C6 alkyl) NHC (O) (C1-C6 alkyl) R8 ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; and s is 0, 1, 2F 3 or 4 ; or the pharmaceutically acceptable salts thereof.
In another embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula F : wherein : R1a and R1C are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C3-Clo cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, R8 (C1-C6 alkyl) O-, N3, N (R8) 2 or-OC (O) O-heteroaralkyl ; c) Cl-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-Clo cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted f) heteroaryl, unsubstituted or substituted g) C1-C6 alkyl, unsubstituted or substituted h) R9S (O) q, and i) OR8 ; R3, R4 and R5 are independently selected from :
H, CN, N02, halogen, unsubstituted or substituted Cl-C6 alkyl, N3, R9S (O) q, HC--C-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, CF3, CF30-, CF3CH20-, C3-C1o cycloalkyl, OR8, N (R8) 2,-C (O) R8,-O (C1-C6 alkyl) OR8, -NHC (O) R8, aralkyl, heteroaralkyl,-(C1-C6 alkyl) OR8, - (Cl-Ce alkyl) C (O) R8,-CH=CH-R8 and R8 is independently selected from hydrogen, unsubstituted or substituted Cl-C6 alkyl, cycloalkyl, benzyl and unsubstituted or substituted aryl ; R9 is independently selected from H, unsubstituted or substituted Cl-C6 alkyl, benzyl and unsubstituted or substituted aryl ; R13 is independently selected from H, unsubstituted or substituted Cl-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -(C1-C6 alkyl)OR8, -(C1-C6 alkyl)OC(O)(C1-C6 alkyl), -(C1-C6 alkyl) N (R8) 2, and- (Cl-C6 alkyl) NHC (O) (Cl-C6 alkyl) R8 ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ; q is 0, 1 or 2 ; and s is 0, 1, 2, 3 or 4 ; or the pharmaceutically acceptable salts thereof.
In second embodiment of the instant invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula I : wherein : Rla, Rlb and Rlc are independently selected from : a) hydrogen, b) unsubstituted or substituted aryl ; unsubstituted or substituted heterocycle ; unsubstituted or substituted heteroaryl ; C3-ClO cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, or N3 ; c) C1-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or R8C(O)O-; R2 is selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, f) heteroaryl, g) C1-C6 alkyl, h) C1-C6 alkoxy, i) N3, j) R9S (O) q, k) R8C=C, and 1) R8C=C ; R3, R4 and R5 are independently selected from :
a) H, b) CN, c) N02, d) halogen, e) Cl-Ce alkyl, f) C1-C6 alkoxy, g) N3, h) R9S (O) q, i)-HC=CH2, j)-C-CH, k) aryl, unsubstituted or substituted, 1) heterocycle, unsubstituted or substituted, m) CF30-, n) CF3CH20-, o) C3-ClO cycloalkyl, and p) CF3 ; R6 is independently selected from : a) hydrogen, b) CN, c) N02, d) halogen, e) aryl, unsubstituted or substituted, f) heteroaryl, unsubstituted or substituted, g) Cl-C6 alkyl, unsubstituted or substituted, h) R80, i) N3, j) R9S (O) q, k)-HC=CH2, 1) -C#CH, m) CF3 n) R80 (C=O), and o) R8 (O=C) O ;
R8 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl ; R9 is independently selected from C1-C6 alkyl, benzyl and aryl ; A1 and A2 are independently selected from : a) a bond, b)-HC=CH-, c)-C=C-, d) O, e) S (O) q, f) O (C=O), g) (O=C), and h) (C=O) O ; W is selected from : a) hydrogen, b) heterocycle, unsubstituted or substituted, and c) aryl, unsubstituted or substituted ; X is selected from : a) aryl, b) heteroaryl, c) cycloalkyl, d) heterocycle, and e) a bond ; Y is selected from : a) aryl, unsubstituted or substituted, b) heterocycle, unsubstituted or substituted, and c) heteroaryl, unsubstituted or substituted ; m is 0, 1, 2, 3 or 4 ; n is 0, 1, 2, 3 or 4 ;
pis 0, 1, 2, 3 or 4 ; and q is 0, 1 or 2 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof.
A preferred embodiment of the compounds of this invention are illustrated by the formula Ia : wherein : Rla is selected from : hydrogen or C1-C6 alkyl ; Rlb is independently selected from : a) hydrogen, b) aryl, heterocycle, C3-ClO cycloalkyl, R80-or C2-C6 alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, or R80- ; R3 and R4 are independently selected from hydrogen, F, Cl, Br, N3, CN, C1-C6 alkyl, substituted or unsubstituted aryl and substituted or unsubstituted heterocycle ; R5 is selected from : a) hydrogen, and b) Cl-C6 alkyl substituted with hydrogen or a group selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocyclic, unsubstituted or substituted C3- Clo cycloalkyl, CF3, N02, R80-, R9S (O) q-, R8C (O)-, R80C (O)-, N3, and CN ; R6 is independently selected from : a) hydrogen, b) C1-C6 alkyl, C1-C6 perfluoroalkyl, F, Cl, CN, N02, and c) C1-C6 alkyl substituted by Cl-Ce perfluoroalkyl, R80-, R8C (O)-, or R80C (O)- ; R8 is independently selected from hydrogen, Cl-C6 alkyl, benzyl and aryl ; R9 is independently selected from Cl-C6 alkyl, benzyl and aryl ; A1 and A2 are independently selected from : a bond, -HC=CH-, -C#C-, O, S (O) q, O (C=O), and (O=C) O ; X is selected from : a) aryl, b) heteroaryl, c) cycloalkyl, d) heterocycle, and e) a bond ;
Y is selected from : a) aryl, b) substituted aryl, c) heterocycle, and d) substituted heterocycle ; nis 0, 1, 2, 3 or 4 ; pis 0, 1, 2, 3 or 4 ; and q is 0, 1, or 2 ; provided that is not a bond ; or the pharmaceutically acceptable salts thereof.
A further embodiment of the compounds of the instant invention is illustrated by Formula Ib : wherein : Rla is selected from :
a) hydrogen, b) unsubstituted or substituted aryl ; unsubstituted or substituted heterocycle ; unsubstituted or substituted heteroaryl ; C3-ClO cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, N02, R8C (O)-, R80C (O)-, or N3 ; c) Cl-C6 alkyl, unsubstituted or substituted by aryl, heterocyclic, C3-ClO cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R80-, R9S (O) q-, CN, R8C (O)-, R80C (O)-, N3, or- R8C (O) 0- ; Ric is independently selected from : H, unsubstituted or substituted Cl- C6 alkyl, unsubstituted or substituted aryl, and unsubstituted or substituted heteroaryl ; R3 is selected from hydrogen, F, Cl, Br, N3, CN, Cl-C6 alkyl, substituted or unsubstituted aryl and substituted or unsubstituted heterocycle ; R4 and R5 are independently selected from : a) H, b) halogen, c) aryl, unsubstituted or substituted, d) heteroaryl, unsubstituted or substituted, and e) Cl-C6 alkyl ; R8 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl ; R9 is independently selected from C1-C6 alkyl, benzyl and aryl ; n is independently selected from : 0, 1, 2, 3 or 4 ; and q is 0, 1 or 2 ; or the pharmaceutically acceptable salts thereof.
Specific examples of the compounds of the invention are : 3-(biphenyl-4-ylmethoxy)-4-imidazol-1-ylmethyl-benzontitrile 3- (biphenyl-4-yl-2-ethoxy)-4-imidazol-1-ylmethylbenzonitrile 3-(biphenyl-3-ylmethoxy)-4-imidazol-1-ylmethyl-benzontitrile <BR> <BR> 2- (biphenyl-4-ylmethoxy)-4-imidazol-1-ylmethyl-benzonitrile< ;BR> <BR> 2- (biphenyl-4-yl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile 1-tert-butoxycarbonyl-4- (3-chlorophenyl)-2 (S)- [2- (2-cyano-5-imidazol-l- ylmethyl-phenoxy) ethyl] piperazine <BR> <BR> 2- (3-chlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (4-chlorophenyl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile <BR> <BR> 2- (3-chlorophenyl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile <BR> <BR> 2- (2-chlorophenyl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile <BR> <BR> 2- (phenyl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (3-chlorobenzyloxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 2- (4-chlorobenzyloxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 2- (2, 4-dichlorobenzyloxy)-4-imidazol-1-ylmethyl-benzonitrile<B R> <BR> 2- (benzyloxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(biphenyl-2-ylmethoxy)-4-imidazol-1-ylmethyl-benzontitrile
2- (phenyl-4-butoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (phenyl-3-propoxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(biphenyl-4-yl-2-ethoxy)-4-(1, 2, 4-triazol-1-yl) methyl-benzonitrile 2- (biphenyl-4-yl-2-ethoxy)-4- (2-methyl-imidazol-1-yl) methyl-benzonitrile 2- (biphenyl-4-yl-2-ethoxy)-4-benzimidazol-1-yl) methyl-benzonitrile <BR> <BR> 4-imidazol-1-ylmethyl-2- (naphthalen-2-yloxy)-benzonitrile<BR> <BR> 2- (3-cyanophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR> ; <BR> 2- (3-bromophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR> ; <BR> 2- (biphen-3-yloxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(biphen-4-yloxy)-4-imidazol-1-ylmethyl-benzonitrile 2- (3-acetylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(2-acetylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2- (3-trifluoromethylphenoxy)-4-imidazol-1-ylmethyl-benzonitril e 2-(3-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(2-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile <BR> <BR> 2- (4-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (3-methoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(2-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile
2- (4-methoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (3, 5-dimethylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (3, 4-dimethylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (3, 5-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 2- (1-naphthyloxy)-4-imidazol-1-ylmethyl-benzonitrile<BR> <BR> 2- (2, 4-dichlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (3-fluorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (3-t-butylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2- [3- (N, N-diethylamino) phenoxy]-4-imidazol-1-ylmethyl-benzonitrile <BR> <BR> 2- (3-n-propylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 2- (2, 3-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 2- (2, 3-dimethylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(3,4-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2-(2,5-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2- (3, 4-dichlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile 2- (2, 4-dimethylphenoxy)-4-imidazol-l-ylmethyl-benzonitrile 2- (4-chloro-2-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitril e
2- (5-chloro-2-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitril e<BR> <BR> 2- (2-chloro-4, 5-dimethylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (5-hydroxymethyl-2-methoxyphenoxy)-4-imidazol-1-ylmethyl- benzonitrile 4-imidazol-1-ylmethyl-2- (3-phenylamino-phenoxy)-benzonitrile 4-imidazol-1-ylmethyl-2-[3-(2-methylphenylamino)-phenoxy]-be nzonitrile <BR> <BR> 4-imidazol-1-ylmethyl-2- (3-phenoxy-phenoxy)-benzonitrile<BR> <BR> 2- (2-benzoyl-phenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 1- (5-chloro-2-methoxy-phenyl)-3- [3- (2-cyano-5-imidazol-1-<BR> ylmethyl-phenoxy)-phenyl]-urea<BR> <BR> 1- (2, 5-dimethoxy-phenyl)-3- [3- (2-cyano-5-imidazol-l-<BR> ylmethyl-phenoxy)-phenyl]-urea<BR> <BR> 2- (3-benzyloxy-phenoxy)-4-imidazol-1-ylmethyl-benzonitrile< BR> <BR> 2- (4-benzyloxy-phenoxy)-4-imidazol-1-ylmethyl-benzonitrile< BR> <BR> 2- (2-benzyl-phenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (3-ethynyl-phenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR > <BR> 2- (4-acetyl-3-methyl-phenoxy)-4-imidazol-1-ylmethyl-benzonitri le 4-imidazol-1-ylmethyl-2-(1H-indazol-6-yloxy)-benzonitrile 4-imidazol-1-ylmethyl-2-(5, 6, 7, 8-tetrahydro-naphthalen-1-yloxy)- benzonitrile
4-imidazol-1-ylmethyl-2- (8-oxo-5, 6, 7, 8-tetrahydro-naphthalen-1-yloxy)- benzonitrile 4-imidazol-1-ylmethyl-2-(1H-indol-7-yloxy)-benzonitrile <BR> <BR> 4-imidazol-1-ylmethyl-2- (3-oxo-indan-4-yloxy)-benzonitrile<BR> <BR> 4-imidazol-1-ylmethyl-2- (lH-indol-4-yloxy)-benzonitrile 2- [3-(2-hydroxy-ethoxy)-phenoxy]-4-imidazol-1-ylmethyl-benzoni trile <BR> <BR> 4-imidazol-1-ylmethyl-2- (4-imidazol-1-yl-phenoxy)-benzonitrile<BR> <BR> 4'- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-biphenyl-4-carbonitr ile N-[3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-acetami de <BR> <BR> 4-imidazol-1-ylmethyl-2- (9-oxo-9H-fluoren-4-yloxy)-benzonitrile<BR> <BR> 3- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-Nphenyl-benzamide< ;BR> <BR> 3- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-ethyl-N-phenyl-ben zamide<BR> <BR> 3- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-cyclopropylmethyl- N- phenyl-benzamide 2- (5-chloro-pyridin-3-yloxy)-4-imidazol-1-ylmethyl-benzonitril e N-[3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]- benzenesulfonamide 4-imidazol-1-ylmethyl-2- (indan-5-yloxy)-benzonitrile<BR> <BR> 3- (9H-carbazol-2-yloxy)-4-imidazol-1-ylmethyl-benzonitrile
4-imidazol-1-ylmethyl-2-(5, 6, 7, 8-tetrahydro-naphthalen-2-yloxy)- benzonitrile <BR> <BR> 4-imidazol-1-ylmethyl-2- (2-methoxy-4-propenyl-phenoxy)-benzonitrile 4-imidazol-1-ylmethyl-2- [4- (3-oxo-butyl)-phenoxy]-benzonitrile <BR> <BR> 2- (3-chlorophenoxy)-5-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (4-chlorophenoxy)-4-imidazol-l-ylmethyl-benzonitrile<BR&g t; <BR> 2- (3, 5-dichlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR& gt; <BR> 2- (pyridin-3-yloxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (2-chlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile<BR&g t; <BR> 2- (3-chlorophenoxy)-5- (4-phenyl-imidazol-l-ylmethyl)-benzonitrile<BR> <BR> 2- (biphen-2-yloxy)-4-imidazol-1-ylmethyl-benzonitrile 2- (phenoxy)-4-imidazol-l-ylmethyl-benzonitrile 2- (2-chloro-4-methoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitri le 2-(2-chlorophenylsulfanyl)-4-imidazol-1-ylmethyl-benzonitril e <BR> <BR> 4-imidazol-1-ylmethyl-2- (naphthalen-2-ylsulfanyl)-benzonitrile<BR> <BR> 2- (2, 4-dichlorophenylsulfanyl)-4-imidazol-1-ylmethyl-benzonitrile 2-(2,4-dichloro-benzenesulfinyl)-4-imidazol-1-ylmethyl-benzo nitrile 2-(2,4-dichloro-benzenesulfinyl)-4-imidazol-1-ylmethyl-benzo nitrile
2- (2-methyl-pyridin-3-yloxy)-4-imidazol-1-ylmethyl-benzonitril e<BR> <BR> 2- (2, 4-dimethyl-pyridin-3-yloxy)-4-imidazol-1-ylmethyl-benzonitri le<BR> <BR> 2- (4-chloro-2-methoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitri le<BR> <BR> 2- (2-chlorophenoxy)-4- (5-methyl-imidazol-1-ylmethyl)-benzonitrile<BR> <BR> 2- (2-chlorophenoxy)-4- (4-methyl-imidazol-1-ylmethyl)-benzonitrile<BR> <BR> 2- (3-chloro-5-trifluoromethyl-pyridin-2-yloxy)-4-imidazol-1-yl methyl- benzonitrile <BR> <BR> 2- (2, 4-dichlorophenoxy)-4- (2-methyl-imidazol-1-ylmethyl)-benzonitrile N-[3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-benzami de 2-[3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-N-pheny l- acetamide 4-imidazol-1-ylmethyl-2- (quinolin-6-yloxy)-benzonitrile 4-imidazol-1-ylmethyl-2-(2-oxo-1,2-dihydro-quinolin-6-yloxy) -benzonitrile N- [3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-2-phenyl- acetamide" 5-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-cyclohexyl-nicot inamide N- (3-chloro-phenyl)-5- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)- nicotinamide 2- (2, 3-dimethoxyphenoxy)-4- (2, 4-dimethyl-imidazol-1-ylmethyl)- benzonitrile
4- (2-methyl-imidazol-l-ylmethyl)-2- (naphthalen-2-yloxy)-benzonitrile 4-(1-imidazol-1-yl-1-methyl-ethyl)-2-(naphthalen-2-yloxy)-be nzonitrile 1- [4-iodo-3-(naphthalen-2-yloxy)-benzyl]-lH-imidazole acetic acid 3- [3- (2-chloro-phenoxy)-4-cyano-benzyl]-3H-imidazol-4- ylmethyl ester 2- (2-chloro-phenoxy)-4- (5-hydroxymethyl-imidazol-1-ylmethyl)- benzonitrile 4- (5-aminomethyl-imidazol-1-ylmethyl)-2- (2-chloro-phenoxy)- benzonitrile <BR> <BR> N- {3- [4-cyano-3- (2, 3-dimethoxy-phenoxy)-benzyl]-3H-imidazol-4-<BR> ylmethyl}-2-cyclohexyl-acetamide<BR> <BR> 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)-imidazol-1-yl-methyl]- benzonitrile <BR> <BR> 2- (3-chloro-phenoxy)-4- [1- (4-chloro-phenyl)-2-hydroxy-1-imidazol-1-yl- ethyl]-benzonitrile <BR> <BR> 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)-hydroxy- (3H-imidazol-4-yl)-<BR> methyl]-benz6nitrile 2- (2, 4-dichloro-phenylsulfanyl)-4- [5- (2-morpholin-4-yl-ethyl)-imidazol-l- ylmethyl]-benzonitrile 2- (2, 4-dichloro-phenoxy)-4- [5-(2-morpholin-4-yl-ethyl)-imidazol-1- ylmethyl]-benzonitrile
4- [hydroxy- (3-methyl-3H-imidazol-4-yl)-methyl]-2- (naphthalen-2-yloxy)- benzonitrile 4- [amino- (3-methyl-3H-imidazol-4-yl)-methyl]-2- (naphthalen-2-yloxy)- benzonitrile 4- [1-hydroxy-1- (3-m ethyl-3H-im idazol-4-yl)-ethyl]-2- (naphthalen-2-yloxy)- benzonitrile 4- [1-am ino-1- (3-m ethyl-3H-im idazol-4-yl)-ethyl]-2- (naphthalen-2-yloxy)- benzonitrile hydrochloride <BR> <BR> <BR> <BR> <BR> <BR> 3- {2-cyano-5- [1-amino-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-phenoxy}-N- ethyl-N-phenyl-benzamide <BR> <BR> <BR> <BR> <BR> <BR> 3-{2-cyano-5- [1-hydroxy-1-(3-methyl-3H-imidazol-4-yl)-ethyl]-phenoxy}-N- ethyl-N-phenyl-benzamide 4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-2- (3-phenylamino- phenoxy)-benzonitrile 4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-2- (3-phenoxy-phenoxy)- benzonitrile <BR> <BR> <BR> <BR> <BR> <BR> 2- (3-benzoyl-phenoxy)-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]- benzonitrile 2- (3-tert-butyl-phenoxy)-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)- ethyl]-benzonitrile <BR> <BR> <BR> <BR> <BR> <BR> 2- (3-diethylamino-phenoxy)-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)- ethyl]-benzonitrile
2- (5-chloro-2-oxo-2H- [1, 2'] bipyridinyl-5'-ylmethoxy)-4-imidazol-1- ylmethyl-benzonitrile 4-Imidazol-1-ylmethyl-2- [2-(2-oxo-2H-pyridin-1-yl)-phenoxy]-benzonitrile 4-Imidazol-1-ylmethyl-2-[3-(2-oxo-2H- pyridin-1-yl)-phenoxy]-benzonitrile <BR> <BR> <BR> 4-Imidazol-1-ylmethyl-2- [4- (2-oxo-2H- pyridin-1-yl)-phenoxy]-benzonitrile or the pharmaceutically acceptable salts thereof.
The preferred compounds of the instant invention are : 3- (Biphenyl-4-ylmethoxy)-4-imidazol-1-ylmethyl-benzonitrile 3- (Biphenyl-3-ylmethoxy)-4-imidazol-1-ylmethyl-benzonitrile 3- (Biphenyl-4-yl-2-ethoxy)-4-imidazol-1-ylmethylbenzonitrile.
5 2-(Biphenyl-4-ylmjethoxy)-4-imidazol-1-ylmethyl-benzonitrile 2- (3-Chlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile
4-Imidazol-1-ylmethyl-2- (naphthalen-2-yloxy)-benzonitrile 2-(2,4-Dichlorophenylsulfanyl)-4-imidazol-1-ylmethyl-benzoni trile
3- (2-Cyano-5-imidazol-1-ylmethyl-phenoxy)-N-ethyl-N-phenyl-ben zamide 2- (2, 4-dichloro-phenylsulfanyl)-4- [5- (2-morpholin-4-yl-ethyl)-imidazol-l- ylmethyl]-benzonitrile
2- (2, 4-dichloro-phenoxy)-4- [5-(2-morpholin-4-yl-ethyl)-imidazol-1-<BR> ylmethyl]-benzonitrile 4- [l-hydroxy-1- (3-m ethyl-3H-im idazol-4-yl)-ethyl]-2- (naphthalen-2-yloxy)- benzonitrile
4- [1-am ino-1- (3-m ethyl-3H-im idazol-4-yl)-ethyl]-2- (naphthalen-2-yloxy)- benzonitrile or a pharmaceutically acceptable salt thereof.
The compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention. When any variable, substituent or term (e. g. aryl, heterocycle, Rla, R2, n, p, etc.) occurs more than one time in a formula or generic structure, its definition at each occurrence is independent of the definition at every other occurrence. Also, combinations of substituents/or variables are permissible only if such combinations result in stable compounds.
As used herein,"alkyl"is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having 1 to 6 carbon atoms, unless otherwise specified ;"alkoxy" represents an alkyl group having 1 to 4 carbon atoms, unless otherwise indicated, attached through an oxygen bridge."Halogen"or"halo"as used herein means fluoro, chloro, bromo and iodo.
As used herein,"aryl"is intended to mean any stable monocyclic, bicyclic or tricyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic. Examples of such aryl
elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl, indanonyl, biphenyl, tetralinyl, tetralonyl, fluorenonyl, phenanthryl, anthryl or acenaphthyl.
As used herein,"aralkyl"is intended to mean an aryl moiety, as defined above, attached through a C1-C6 alkyl linker, where alkyl is defined above. Examples of aralkyls inlcude, but are not limited to, benzyl, naphthylmethyl and phenylpropyl.
As used herein,"heteroaralkyl"is intended to mean a heteroaryl moiety, as defined below, attached through a C1-C6 alkyl linker, where alkyl is defined above. Examples of heteroaralkyls include, but are not limited to, 2-pyridylmethyl, 2-imidazolylethyl, 2-quinolinylmethyl, 2-imidazolylmethyl and the like.
The term heterocycle or heterocyclic, as used herein, represents a stable 5-to 7-membered monocyclic or stable 8-to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring. The heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure. Examples of such heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, benzopyrazolyl, chromanyl, cinnolinyl, dibenzofuranyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, 2-oxopyridyl, 2-oxoquinolinyl, piperidyl, piperazinyl, pyridyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiamorpholinyl,
thiamorpholinyl sulfoxide, thiazolyl, thiazolinyl, thienofuryl, thienothienyl, thienyl and triazolyl.
As used herein,"heteroaryl"is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S. Examples of such heterocyclic elements include, but are not limited to, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl, thienothienyl, and thienyl.
As used herein, the terms"substituted C1-C6 alkyl"and "substituted C1-C6 alkoxy"are intended to include the branch or straight-chain alkyl group of the specified number of carbon atoms, wherein the carbon atoms may be substituted with F, Cl, Br, CF3, N3, N02, NH2, oxo,-OH,-O (C1-C6 alkyl), S (O) o-2, (C1-C6 alkyl) S (0) o-2- (C1-C6 alkyl) S (0) o-2 (Cl- Cg alkyl)-, C3-Clp cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl,-C (O) NH, (C1-C6 alkyl) C (O) NH-, H2N-C (NH)-, (C1-C6 alkyl) C (O)-,-O (C1-C6 alkyl) CF3, (C1-C6 alkyl) OC (O)-, (C1-C6 alkyl) O (Cl- C6 alkyl)-, (Cl-C6 alkyl) C (0) 2 (C1-C6 alkyl)-, (C1-C6 alkyl) OC (O) NH-, aryl, benzyl, heterocycle, aralkyl, heteroaralkyl, halo-aryl, halb-benzyl, halo-heterocycle, cyano-aryl, cyano-benzyl and cyano-heterocycle.
As used herein, the terms"substituted aryl", "substituted heteroaryl","substituted aralkyl"and"substituted heteroaralkyl"are intended to include the cyclic group containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound. Such substitutents are preferably selected from the group which includes but is not limited to F, Cl, Br, CF3, NH2, N (C1-C6 alkyl) 2, N02, CN, N3, C1-C2o alkyl, C1-C6 alkoxy,-
OH,-O (C1-C6 alkyl), S (0) 0-2, (Cl-C6 alkyl) S (0) o-2-, (C1-C6 alkyl) S (0) o-2 (Cl-C6 alkyl)-, (Cl-C6 alkyl) C (O) NH-, H2N-C (NH)-, (Cl- C6 alkyl) C (O)-, (Cl-Ce alkyl) OC (O)-, (Ci-Ce alkyl) O (C1-C6 alkyl)-, (C1- Ce alkyl) C (0) 2 (Cl-C6 alkyl)-, (Cl-C6 alkyl) OC (O) NH-, aryl, aralkyl, heteroaryl, heteroaralkyl, halo-aryl, halo-aralkyl, halo-heterocycle, halo-heteroaralkyl, cyano-aryl, cyano-aralkyl, cyano-heterocycle and cyano-heteroaralkyl.
Examples of"spiro Cl-C6 cycloalkyl"include : Lines drawn into the ring systems from substituents (such as from R2, R3, R4 etc.) indicate that the indicated bond may be attached to any of the substitutable ring carbon atoms or heteroatom.
Preferably, Ria and Rlb are independently selected from : hydrogen, unsubstituted or substituted aryl or unsubstituted or substituted Cl-C6 alkyl.
Preferably, Rlc is selected from hydrogen, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle,-OR8,-N (R8) 2 and unsubstituted or substituted Cl-C6 alkyl.
Preferably, R2 is H, CN or halo. Most preferably, R2 is CN.
Preferably, R3 is selected from hydrogen, halo, CN, N02, and unsubstituted or substituted Cl-C6 alkyl.
Preferably, R4 and R5 are independently selected from hydrogen, halo, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, N3, -C (O) R8,-O (C1-C6 alkyl) OR8, and-(C1-C6 alkyl) OR8.
Preferably, R6 is selected from : hydrogen, F, Cl, Br, CN, N02, R80C (O)-, N3, and C1-C6 alkyl.
Preferably, R13 is selected from hydrogen, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl,- (Cl-C6 alkyl) OR8,-(C1-C6 alkyl) OC (O) (C1-C6 alkyl),-(C1-C6 alkyl) N (R8) 2, and
- (Cl-Ce alkyl) NHC (O) (C1-C6 alkyl) R8. More preferably, R13 is substituted C1-C6 alkyl, unsubstituted or substituted aryl,- (Cl-C6 alkyl) OR8,- (Ci-Ce alkyl) OC (O) (C1-C6 alkyl),-(C1-C6 alkyl) N (R8) 2, and - (Ci-Ce alkyl) NHC (O) (Cl-C6 alkyl) R8.
Preferably, Al and A2 are independently selected from : a bond, O and S (O) q. More preferably, Al is a bond and A2 is selected from O and S (O) q.
Preferably, A3 is selected from a bond, O,-NR8, C (O), -S (O) q,-C (O) N (R8),-N (R8) C (O),-S (O) qNH,-NHS (O) q, or-NHC (O) NH.
Preferably A4 is selected from a bond, C=CH2, or spiro C3- C6 cycloalkyl. Most preferably, A4 is a bond.
Preferably, W is a heterocycle, selected from pyrrolidinyl, imidazolyl, imidazolinyl, pyridinyl, thiazolyl, pyridonyl, 2- oxopiperidinyl, oxazolyl, indolyl, quinolinyl, isoquinolinyl, triazolyl and thienyl. Most preferably, W is imidazolyl or pyridyl.
Preferably, X is selected from a bond, aryl and heterocycle.
Preferably, Y is selected from an unsubstituted or substituted aryl or an unsubstituted or substituted heterocycle. More preferably, Y is selected from phenyl, furyl, thienyl and pyridyl. Most preferably, Y is phenyl.
Preferably, m, n, p, q, r, s and t are independently 0, 1, or 2.
The pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e. g., from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like : and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2- acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
It is intended that the definition of any substituent or variable (e. g., Rla, R1bs R13, n, p, etc.), at a particular location in a molecule, be independent of its definitions elsewhere in that molecule.
Thus,-C (R1a) 2 represents-CH2,-CHCH3,-CHC2H5, etc. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
The pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods.
Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
These reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the Schemes.
Synopsis of Schemes Schemes 1 to 9 describe the synthesis of compounds of formulae A and I. The starting materials can be obtained from commercial sources or they can be obtained using standard transformations (e. g. esterification of the hydroxy acid) from commerciall available materials.
In Scheme 1, amino-hydroxybenzoates of type II can be converted to the corresponding iodide III by treatment with acidic aqueous NaN02 followed by the addition of KI. The phenol may then be alkylated by treatment with a base such as NaH or Cs2C03 in an organic solvent (for example DMF) followed by the addition of an electrophile to yield IV. Reduction of the ester of IV using, for example, LiBH4 in THF then yields the alcohol V which can in turn be treated with Zn (CN) 2 in DMF and a palladium catalyst to give VI. The alcohol of VI can be
converted into a leaving group of VII in a number of ways. One such procedure involves reaction of the alcohol with a sulfonyl chloride in the presence of an organic base (e. g. triethylamine) in an organic solvent such as dichloromethane. A second method requires the reaction of the alcohol with CBr4 and a phosphine such as triphenyl phosphine in an organic solvent such as dichloromethane. A third method involves reaction of the alcohol with N-bromosuccinimide and dimethyl sulfide in dichloromethane. The reaction of VII with imidazole in a polar solvent such as DMF then affords compounds of formula IA. In addition, VII upon reaction with 4-iodo-1-tritylimidazole in THF with 1, 2- dibromoethane, Zn and NiCl2 (PPh3) 2 and subsequent methanolysis may yield compounds of formula IB.
Scheme 2 shows an alternative route for the conversion of III into VI employing chemical transformations described above.
In Scheme 3, the phenol X can be converted to the corresponding triflate XI using trifluoromethane sulfonic anhydride in an organic solvent such as dichloromethane with an organic base such as triethylamine. The triflate may then be converted to the nitrile XII, the ester reduced to XIII and the alcohol transformed to a leaving group as shown in XIV using previously described reactions. Treatment of XIV as above would then produce compounds of formula IC or ID.
An alternative route for the synthesis of compounds of formula IA and IB is given in Scheme 4. Methyl-hydroxybenzoic acids of structure XV may be bis alkylated by treatment with a base such as NaH or Cs2C03 in an organic solvent (for example DMF) followed by the addition of an electrophile to yield XVI saponification using aqueous hydroxide then affords the acid XVII. Acid XVII is then converted to the primary amide XIX via the acid chloride XVIII (prepared with thionyl chloride in a solvent such as toluene then a reaction with ammonia in, for example, chloroform). Treatment of XIX with thionyl chloride in DMF results in the nitrile XX which can be brominated at the benzylic position using, for example, N-bromosuccinimide and benzoyl peroxide in carbon tetrachloride. Transformations, as before, then yield IA or IB.
An alternative route for the synthesis of compounds of formula IA and IB is shown in Scheme 5 which incorporates the reaction steps described above but alters the order of these transformations to give XXIV which is converted to IA by treatment with a halide or mesylate.
Two routes to compounds containing a diaryl ether linkage as illustrated in XXVII are described in Scheme 6. The bromo fluoride XXV is transformed to the fluoro nitrile with zinc cyanide, then converted to ID in a series of transformations described in previous schemes.
Scheme 7 illustrates yet another route for the synthesis of compounds of formula IA.
Schemes 8 and 9 describe routes for the preparation of compounds XXXIX and XXXX which contain a heteroatom at the benzylic position between W and the phenyl ring of IA.
SCHEME 1 C02R CO2R NaN02, aq. HCl THF, H20 Cs2CO3 R'OH R'-OH ><'thenK)" R"Br, DMF NH2 I II III OH . OH CO2R f LIBH Zn (CN) 2 LiBH4 i Pd (Ph P) TUF DMF ) VV I I IV V CBrFsP. OH Br I THF ; THF CN CN VII CN imidazole DMF irF \Zn, NiC12 (Ph3P) 2 s NF NTK THF DMF BrCHCH2Br THF NU NU ,, Tr N--\ N H Zizi CN CN IA IB SCHEME 2 SCHEME 3 02R 02R Zn (CN) 2 Tf20, Et3N Pd (Ph3p) 4 R R. ^, H OTf CH2C'2 DMF R"R" XI OH C02R 5-11 MeS02C' R J C N---- R J C N THF ' Et3N, THF Xi oil 'Y THF"\ EtgN, THF N XH XN) OS02 Me imidazole /DMF D n D \ Zn, NiC12 (Ph3P) 2 n XIV BrCH2CH2Br THF NN-Tr\ N = w N H R CN R" ID SCHEME 4 C02H C02R NaH, RI LiOH OH 0 R- DMF H20, MEOH Me Mu XV XVI CO2H 4 CI SOCI R TOR Rl-OR toluene, DMF Me CHCI3 Me me XVII XVIII 0 NH2 NC NC SOC12 NBS, AIBN DMF CC'4 OR DMF R J OR CCI Me Me XIX XX NC c. f. scheme 1 OR---IA or IB CH2Br XXI SCHEME 5 C02R C02R R'OH LiBH4 R' J OH---R \J OH CN Vill III VIII OHB. OH Br N Z /Ph3P/ R' ; OH----- R' ; OH \CN CBr4 \ \CN CN CN CN"CN NJ , NU N Nt N) R OH R'OR" J CN X= halo, OMs CN XXIV IA SCHEME 6 SCHEME 7 H3 ICO2H OH /Zn (CN) 2 R'- \ \ R,-. THF Pd cat. Br ber Br XXX XXXI 0 Hoet OH NBS q He) Br N,- Heu s NBS R R'R DOMS CN F F CN XIX XXXIV heu) CsC03 N--- or KF/alumina R'<1 OR OR ROH OR CN la SCHEME 8 T Tr OH pyr, s3 R ou RMgBr/Mn02/N I N OH R R) R F F EtMgBr CON CL F XXXI I I XXXV CON XXXVI Tr OH 0 Q R R"X N OH 1) R"X R"R R R'------' con con F F CN CN XXXVII XXXVIII CsCOs '//N CsC03 <N N 1) soc12 or N H 1) SOC'2 NH2 R"R 2) NHC KF/alumina CON CN \ OR"' CON XXXIX XXXX SCHEME 9 Tr Tr Tr I I I ou RMgBr /Mn02// N H N 0 N H F CN CN CN XXXVI Tr i ou R R R/I-----. R/ \ F 2) OH- CN CN XXXVII XXXVIII CSC03 N N 1) SOC12 or N H 1) SOC'2 NH2 R"R N R KF/alumi ha 2) NH40H R" R"'OH Or"' CN ! CN xxxix XXXX
In the above Schemes, it is understood that R independently represents Ric or its protected precursors thereof ; R'independently represents R3 or its protected precursors thereof ; R"independently represents R13 or its protected precursors thereof ; R"'independently represents the following moiety : In a preferred embodiment of the instant invention the compounds of this instant invention are selective inhibitors of farnesyl- protein transferase. A compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl- protein transferase inhibitory activity, as assessed by the assay described in Example 29, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 30. Preferably, a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
In another preferred embodiment of the instant invention the compounds of this instant invention are dual inhibitors of farnesyl- protein transferase and geranylgeranyl-protein transferase type I. Such
a dual inhibitor will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed.
In a SEAP assay, such as described in Example 33, it is preferred that the dual inhibitor compound has an in vitro inhibitory activity (IC5Q) that is less than about 12RM against K4B-Ras dependent activation of MAP kinases in cells. More preferably, the dual inhibitor compound has an in vitro inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases in cells which is more than about 5 times lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells. Also more preferably, in a SEAP assay, the dual inhibitor compound has an inhibitory activity (IC50) that is less than about 10 nM against H-Ras dependent activation of MAP kinases in cells.
In a GGTase plus anion assay, such as described in Example 30, it is preferred that the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 5 RM against transfer of a geranylgeranyl residue to a protein or peptide substrate comprising a CAAXG motif by geranylgeranyl-protein transferase type I in the presence of a modulating anion. More preferably, the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 1, uM against transfer of a geranylgeranyl residue to a protein or peptide substrate comprising a CAAXG motif by geranylgeranyl-protein transferase type I in the presence of a modulating anion. Preferably, the dual inhibitor compound has an in vitro inhibitory activity (ICgo) in the in vitro assay as described in Example 29 that is less than about 1, uM against transfer of a farnesyl residue to a protein or peptide substrate, comprising a CAAXF motif, by farnesyl-protein transferase. More preferably, the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 100nM against transfer of a farnesyl residue to a protein or peptide substrate, comprising a CAAXF motif, by farnesyl-protein transferase.
Also preferably, the dual inhibitor compound has an in vitro inhibitory activity (ICgo) in the in vitro assay as described in Example 32, that is less than about 100 nM against the anchorage independent growth of H-ras-transformed mammalian fibroblasts.
The protein or peptide substrate utilized in the instant assay may incorporate any CAAX motif that is geranylgeranylated by GGTase-I. The term"CAAX"will refer to such motifs that may be geranylgeranylated by GGTase-I. It is understood that some of the "CAAX"containing protein or peptide substrates may also be farnesylated by farnesyl-protein transferase. In particular such G "CAAX"motifs include (the corresponding human protein is in parentheses) : CVIM (K4B-Ras) (SEQ. ID. NO. : 1), CVLL (mutated H- Ras) (SEQ. ID. NO. : 2), CVVM (N-Ras) (SEQ. ID. NO. : 3), CIIM (K4A-Ras) (SEQ. ID. NO. : 4), CLLL (Rap-IA) (SEQ. ID. NO. : 5), CQLL (Rap-IB) (SEQ. ID. NO. : 6), CSIM (SEQ. ID. NO. : 7), CAIM (SEQ. ID. NO. : 8), CKVL (SEQ. ID. NO. : 9), and CLIM (PFX) (SEQ. ID. NO. : 10). Preferably, the CAAX motif is CVIM.
F As used herein, the term"CAAX"is used to designate a protein or peptide substrate that incorporates four amino acid C- terminus motif that is farnesylated by farnesyl-protein transferase. It is understood that certain of the"CAAX"containing protein or peptide substrates may also be geranylgeranylated by GGTase-I. In particular such"CAAX"motifs include (the corresponding human protein is in parentheses) : CVLS (H-ras) (SEQ. ID. NO. : 11), CVIM (K4B-Ras) and CWM (N-Ras).
The instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer. Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors.
Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i. e., neurofibromin (NF-1), neu, src, abl, Ick, fyn) or by other mechanisms.
The compounds of the instant invention inhibit a prenyl- protein transferase and, in particular, the farnesylation of the oncogene protein Ras. The instant compounds may also inhibit tumor
angiogenesis, thereby affecting the growth of tumors (J. Rak et al.
Cancer Research, 55 : 4575-4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
The compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i. e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment. For example, a component of NF-1 is a benign proliferative disorder.
The instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J. S. Glenn et al. Science, 256 : 1331-1333 (1992).
The compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1 : 541-545 (1995).
The instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D. L. Schaffner et al.
American Journal of Pathology, 142 : 1051-1060 (1993) and B. Cowley, Jr. et al. FASEB Journal, 2 : A3160 (1988)).
The instant compounds may also be useful for the treatment of fungal infections.
The instant compounds may also be useful as inhibitors of proliferation"of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies.
The compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular,
intraperitoneal, subcutaneous, rectal and topical routes of administration.
The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate ; granulating and disintegrating agents, for example, corn starch, or alginic acid ; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed.
Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl- cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and
gum acacia ; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
The pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy beans, lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation
products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavouring agents.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative and flavoring and coloring agents.
The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1, 3-butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono-or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
The injectable suspensions or solutions may be introduced into a patient's blood-stream by local bolus injection. Alternatively, it may be advantageous to administer the suspensions or solution in such a way as to maintain a constant circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a deviceis the Deltec CADD-PLUSTM model 5400 intravenous pump.
Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non- irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are cocoa butter and polyethylene glycols.
For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed.
(For purposes of this application, topical application shall include mouth washes and gargles.) The compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
As used herein, the term"composition"is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
When a compound according to this invention is administered into a human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms. in one exemplary application, a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0. 1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0. 5 mg/kg of body weight to about 40 mg/kg of body weight per day.
The compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is
being treated. For example, the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant prenyl-protein transferase inhibitors and an antineoplastic agent. It is also understood that such a combination of antineoplastic agent and inhibitor of a prenyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery.
Examples of an antineoplastic agent include, in general, microtubule-stabilizing agents (such as paclitaxel (also known as Taxol@), docetaxel (also known as Taxotere), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives) ; microtubule-disruptor agents ; alkylating agents, anti-metabolites ; epidophyllotoxin ; an antineoplastic enzyme ; a topoisomerase inhibitor ; procarbazine ; mitoxantrone ; platinum coordination complexes ; biological response modifiers and growth inhibitors ; hormonal/anti- hormonal therapeutic agents and haematopoietic growth factors.
Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drugs, diynenes and the podophyllotoxins. Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like. Other useful antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase,
camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins.
The preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel.
Radiation therapy, including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of a prenyl-protein transferase alone to treat cancer.
Additionally, compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incorporated by reference.
The instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Thus, the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity. The instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase. In particular, if the compound of the instant invention is a selective inhibitor of farnesyl- protein transferase, co-administered with a compound (s) that is a selective inhibitor of geranylgeranyl protein transferase may provide the therapeutic effect of administration of a dual inhibitor as described hereinabove, and thus offer certain advantages over administration of only the compound of the instant invention.
In particular, the compounds disclosed in the following patents and publications may be useful as farnesyl pyrophosphate- competitive inhibitor component of the instant composition : U. S. Ser.
Nos. 08/254, 228 and 08/435, 047. Those patents and publications are incorporated herein by reference.
In practicing methods of this invention, which comprise administering, simultaneously or sequentially or in any order, two or more of a protein substrate-competitive inhibitor and a farnesyl pyrophosphate-competitive inhibitor, such administration can be orally
or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously. When the protein substrate-competitive inhibitor and farnesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods.
The instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U. S. Ser. No. 09/055, 487, filed April 6, 1998, which is incorporated herein by reference.
As used herein the term an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin (s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells. In particular, the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the <BR> <BR> <BR> avp3 integrin, which selectively antagonize, inhibit or counteract<BR> <BR> <BR> <BR> <BR> <BR> <BR> binding of a physiological ligand to the avß5 integrin, which antagonize,<BR> <BR> <BR> <BR> <BR> <BR> <BR> inhibit or counteract binding of a physiological ligand to both the (xvp3<BR> <BR> <BR> <BR> <BR> <BR> <BR> integrin and the av ? 5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin (s) expressed on capillary endothelial cells. The term also refers to antagonists of the <BR> <BR> <BR> oclßl, a2ßl, a5ßl, a6ßl and a6ß4 integrins. The term also refers to<BR> <BR> <BR> <BR> <BR> <BR> <BR> antagonists of any combination of αvß3 integrin, avp5 integrin, α1ß1,<BR> <BR> <BR> <BR> <BR> <BR> <BR> a2j31, a5pl, a6pl and a6ß4 integrins. The instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
Similarly, the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections.
If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described below and the other pharmaceutically active agent (s) within its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent (s) when a multiple combination formulation is inappropriate.
For oral use of a chemotherapeutic compound according to this invention, the selected compound may be administered, for example, in the form of tablets or capsules, or as an aqueous solution or suspension. In the case of tablets for oral use, carriers which are commonly used include lactose and corn starch, and lubricating agents, such as magnesium stearate, are commonly added. For oral administration in capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring agents may be added. For intramuscular, intraperitoneal, subcutaneous and intravenous use, sterile solutions of the active ingredient are usually prepared, and the pH of the solutions should be suitably adjusted and buffered. For intravenous use, the total concentration of solutes should be controlled in order to render the preparation isotonic.
The compounds of the instant invention may also be co- administered with other well-known therapeutic agents that are selected for their particular usefulness against the condition that is being treated. For example, the instant compounds may be useful in combination with known anti-cancer and cytotoxic agents. Similarly, the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restinosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections.
If formulated as a fixed dose, such combination products employ the compounds of this invention within the dosage range described below and the other pharmaceutically active agent (s) within
its approved dosage range. Compounds of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent (s) when a combination formulation is inappropriate.
The present invention also encompasses a pharmaceutical composition useful in the treatment of cancer, comprising the administration of a therapeutically effective amount of the compounds of this invention, with or without pharmaceutically acceptable carriers or diluents. Suitable compositions of this invention include aqueous solutions comprising compounds of this invention and pharmacolo- gically acceptable carriers, e. g., saline, at a pH level, e. g., 7. 4. The solutions may be introduced into a patient's intramuscular blood-stream by local bolus injection.
The compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl-protein transferase (FPTase) in a composition.
Thus the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention. After the assay mixtures are incubated for an sufficient period of time, well known in the art, to allow the FPTase to farnesylate the substrate, the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques.
Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substratetn the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
It would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain farnesyl-protein transferase and quantitating the enzyme. Thus, potent inhibitor compounds of the instant invention may be used in an active site titration assay to
determine the quantity of enzyme in the sample. A series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl-protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention. The concentration of a sufficiently potent inhibitor (i. e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel) required to inhibit the enzymatic activity of the sample by 50% is approximately equal to half of the concentration of the enzyme in that particular sample.
EXAMPLES Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof.
EXAMPLE 1 Preparation of 3- (biphenyl-4-ylmethoxy)-4-imidazol-1-ylmethyl- benzonitrile Step A : Preparation of phenvl 2-hydroxv-4-iodobenzoate A solution of NaN02 (1. 33 g, 19. 3 mmol) in 10 mL water was added to a solution of phenyl-4-amino-2-hydroxybenzoate (4. 02 g, 17. 6 mmol) in 3N HCl (35 mL) and THF (10 mL) at 0°C. The resulting yellow solution was stirred for 30 minutes then KI (8. 74 g, 52. 7 mmol) in water (13 mL) was added. After 10 minutes, the dark brown/red slurry was poured into EtOAc, washed twice with water then with aqueous sodium bisulfite and brine. The dried (MgS04) solution was filtered and concentrated to give a dark oil. Column chromatography (silica gel ; hexane : EtOAc 15 : 1) gave the title compound as a white solid which
contained approximately 15% of an unidentified impurity. This material was used as such in the next step.
Step B : Preparation of phenyl 4-iodo-2- (biphenyl-4-ylmethoxy) benzoate To a solution of a phenol, as described in Step A, in 10 mL of dimethyl formamide (DMF) was added 4-phenylbenzyliodide (292 mg, 0. 99 mmol) and Cs2CO3 (442 mg, 1. 35 mmol) and the suspension was stirred for 16 hr. After this time, the reaction mixture was diluted with EtOAc, extracted with water (3X), washed with brine, dried (MgS04) and concentrated in vacuo. The residue was purified by flash chromatography (Si02 ; hexane : EtOAc 20 : 1) to provide an oil which crystallized from ether : hexane 1 : 10 to give the title compound as a white solid.
1H NMR (CDC13) d 5. 23 (2H, s), 7. 17 (2H, m), 7. 25 (1H, m), 7. 3-7. 6 (13H, m), 7. 75 (1H, d).
Step C : Preparation of 4-iodo-2- (biphenvl-4-vlmethoxy) benzylalcohol To a solution of an ester, as described in Step B, in 5 mL of THF was added lithium borohydride (28 mg, 1. 27 mmol) and heated at reflux for 30 minutes. After this time, the reaction mixture was poured into EtOAc and extracted with 1N HCl, then water, and then brine. The organic layer was separated, dried (MgS04) and evaporated in vacuo to afford the title compound as a white solid : 1H NMR (CDCl3) d 2. 17 (1H, t), 4. 70 (2H, d), 5. 12 (2H, s), 7. 07 (1H, d), 7. 3- 7. 7 (11H, m).
Step D : Preparation of 4-cyano-2- (biphenyl-4-ylmethoxy) benzvlalcohol A solution of an iodide, as described in Step C, and Zn (CN) 2 (49 mg, 0. 42 mmol) in DMF (5 mL) was degassed with argon for 15 minutes. Pd (Ph3P) 4 (35 mg, 0. 03 mmol) was added and the mixture heated to 80°C for 16 hr. The mixture was poured into water and extracted with EtOAc (2X). The organic layers were washed with 1N HCl, water and then brine. They were then dried (MgS04) and the
solvent removed. Chromatography of the residue (silica gel ; hexane : EtOAc 2 : 1) afforded the title compound as a white solid.
1H NMR (CDC13) d 2. 18 (1H, t), 4. 81 (2H, d), 5. 17 (2H, s), 7. 19 (1H, d), 7. 3- 7. 65 (11H, m) Step E : Preparation of methanesulfonic acid 2- (biphenyl-4- ylmethoxy)-4-cyanobenzyl ester A solution of an alcohol, as described in Step D, in dichloromethane (4 mL) at room temperature, was treated sequentially with Et3N (81 RL, 0. 59 mmol) and methanesulfonyl chloride (32 RL, 0. 41 mmol). After 1 hr, a further Et3N (81 iL, 0. 59 mmol) and methanesulfonyl chloride (32 p. L, 0. 41 mmol) was added and stirred for another hour. The solution was poured into water, extracted with EtOAc, washed with brine, dried (MgS04) and evaporated to give a solid.
Column chromatography (silica gel ; hexane : EtOAc 2 : 1) gave the title compound as a solid. Rf (silica) : 0. 37 (hexane : EtOAc 2 : 1).
1H NMR (CDC13) d 2. 95 (3H, s), 5. 18 (2H, s), 5. 35 (2H, s), 7. 2-7. 7 (12H, m).
Step F : Preparation of 3- (biphenyl-4-ylmethoxy)-4-imidazol-l- ylmethyl-benzonitrile A solution of a mesylate, as described in Step E and imidazole (45 mg, 0. 66 mmol) in DMF (1. 5 mL) was stirred at room temperature for 16 hr. The mixture was poured into a saturate NaHC03 solution, extracted with EtOAc, washed with water and then brine, dried (MgS04) and evaporated to give a solid. Column chromatography (silica gel ; 2% MeOH in CHC13) gave an oil which crystallized from ether to afford the title compound.
1H NMR (CDC13) d 5. 16 (2H, s), 5. 20 (2H, s), 6. 89 (1H, t), 7. 00 (1H, d), 7. 09 (1H, s), 7. 24 (2H, m), 7. 35-7. 5 (5H, m), 7. 53 (1H, s), 7. 6-7. 68 (4H, m).
Analysis calculated for C24Hl9N30 : C, 78. 88 ; H, 5. 24 ; N, 11. 50 ; Found : C, 78. 67 ; H, 5. 54 ; N, 11. 31.
EXAMPLE 2 Preparation of 3- (biphenyl-4-yl-2-ethoxy)-4-imidazol-l- ylmethylbenzonitrile hydrochloride Step A : Preparation of phenyl 4-cvano-2-hydroxybenzoate A solution of phenyl 2-hydroxy-4-iodobenzoate, as described in Example 1, Step A, (2. 38 g, 7. 0 mmol) and Zn (CN) 2 (575 mg, 4. 9 mmol) in DMF was degassed with argon for 25 minutes. Pd (Ph3P) 4 (404 mg, 0. 35 mmol) was added and the mixture heated to 80°C for 16 hr. The mixture was poured into 1N HCl and extracted with EtOAc (2X), washed with water then brine, dried (MgS04) and the solvent removed.
Chromatography of the residue (silica gel ; hexane : EtOAc 9 : 1) afforded the title compound as a white solid.
1H NMR (CDCl3) d 7. 18-7. 28 (3H, m), 7. 35 (2H, m), 7. 48 (2H, m), 8. 19 (1H, d), 10. 67 (1H, s).
Step B : Preparation of phenyl 4-cyano-2- (biphenyl-4-yl-2-ethoxy) benzoate To a solution of a phenol, as described in Step A, in 5 mL of dimethyl formamide (DMF) was added biphenyl-4-ylethyl iodide (170 mg, 0. 55 mmol) and Cs2C03 (246 mg, 0. 75 mmol). The suspension was stirred for 16 hr. After this time, the reaction mixture was diluted with EtOAc, extracted with water (3X), washed with brine, dried (MgS04) and concentrated in vacuo. The residue was purified by flash chromatography (Si02 ; hexane : EtOAc 9 : 1 then 4 : 1) to provide the title compound." Rf (silica) : 0. 22 (hexane : EtOAc 9 : 1).
Step C : Preparation of 4-cyano-2- (biphenyl-4-yl-2-ethoxy) benzyl alcohol To a solution of an ester, as described in Step B, in 3 mL of THF was added lithium borohydride (9. 6 mg, 0. 44 mmol) and heated at reflux for 1 hr. After this time, the reaction mixture was poured into EtOAc and extracted with 1N HCl, then water, then brine. The organic
layer was separated, dried (MgS04) and evaporated in vacuo to afford the title compound as an oil. The residue was purified by flash chromatography (Si02 ; hexane : EtOAc 2 : 1) to provide the title compound.
1H NMR (CDCl3) d 2. 16 (1H, t), 3. 17 (2H, t), 4. 25 (2H, t), 4. 65 (1H, d), 7. 06 (1H, d), 7. 24 (1H, dd), 7. 3-7. 45 (6H, m), 7. 55-7. 6 (4H, m).
Step D : Preparation of 3- (biphenyl-4-yl-2-ethoxy)-4-bromomethyl- benzonitrile A mixture of an alcohol, as described in Step C, carbon tetrabromide (68 mg, 0. 205 mmol) and PPh3 (54 mg, 0. 205 mmol) in THF (2 mL) was stirred for 16 hr. More carbon tetrabromide (68 mg, 0. 205 mmol) and PPh3 (54 mg, 0. 205 mmol) were added and stirring continued for 24 hr. The solution was diluted with ether, filtered and the solvent concentrated. Chromatography of the residue (silica gel ; hexane : EtOAc 9 : 1) afforded the title compound.
Rf (silica) : 0. 78 (hexane : EtOAc 2 : 1).
Step E : Preparation of 3-(biphenyl-4-yl-2-ethoxy)-4-imidazol-1- vlmethvl-benzonitrile hydrochloride A solution of a bromide, as described in Step D, and imidazole (26 mg, 0. 38 mmol) in DMF (2 mL) was stirred at room temperature for 16 hr. The mixture was poured into saturate NaHC03 solution, extracted with EtOAc, washed with water then brine, dried (MgS04) and evaporated to give a solid. Column chromatography (silica gel ; hexane : EtOAc 1 : 1 then 2% MeOH in CHC13) gave an oil which was treated with 0. 5 mL 1N HCl in ether to afford (after removal of the ether) the title compound as a solid.
1H NMR (CD30D) d 3. 18 (2H, t), 4. 44 (2H, t), 5. 38 (2H, s), 7. 2-7. 5 (10H, m), 7. 5-7. 7 (4H, m), 8. 62 (1H, s).
EXAMPLE 3 Preparation of 3-(biphenyl-3-ylmethoxy)-4-imidazol-1-ylmethyl- benzonitrile hydrochloride Following the procedure described in Example 2, Steps A to F, but using biphenyl-3-ylmethyl bromide, as described in Step B, as starting material, the title compound was obtained as a solid.
1H NMR (CD30D) d 5. 27 (2H, s), 5. 52 (2H, s), 7. 3-7. 7 (14H, m), 8. 85 (1H, s).
EXAMPLE 4 Preparation of 2-(biphenyl-4-ylmethoxy)-4-imidazol-1-ylmethyl- benzonitrile Step A : Preparation of methyl 4-amino-3-hvdroxvbenzoate HCl (g) was bubbled through a solution of 4-amino-3- hydroxybenzoic acid (7 g, 54. 8 mmol) in MeOH (450 mL) until saturated then the mixture was heated at 70°C for 16 hr. The mixture was concentrated in vacuo, the residue taken up in EtOAc, washed with saturated NaHC03 then brine and dried (MgS04). Removal of the solvent yielded the title compound as a brown solid.
1H NMR (CD30D) d 3. 80 (3H, s), 6. 66 (1H, d), 7. 32 (1H, dd), 7. 37 (1H, dd).
Step B : Preparation of methyl 3-hydroxy-4-iodobenzoate A solution of NaN02 (15. 89 g, 0. 092 mol) in water (30 mL) was added to a solution of methyl 4-amino-3-hydroxybenzoate (14. 00 g, 0. 084 mol) in ? t3N HCl (120 mL) and THF (20 mL) at 0°C. The resulting dark red solution was stirred for 30 minutes then KI (41. 68 g, 2. 51 mol) in water (30 mL) was added. After 10 minutes, the dark brown/red slurry was poured into EtOAc, washed twice with water then with aqueous sodium bisulfite and brine. The dried (MgS04) solution was filtered and concentrated to give a dark oil. Column chromatography (silica gel ; hexane : EtOAc 15 : 1) gave the title compound.
Step C : Preparation of methyvano-3-hvdroxvbenzoate A solution of methyl 3-hydroxy-4-iodobenzoate (2. 38 g, 7. 0 mmol) (as described in Step B) and Zn (CN) 2 (0. 575 g, 4. 9 mmol) in DMF was degassed with argon for 25 minutes. Pd (Ph3P) 4 (0. 404 g, 0. 35 mmol) was added and the mixture heated to 80°C for 16 hr. The mixture was poured into 1N HCl and extracted with EtOAc (2X), washed with water then brine, dried (MgS04) and the solvent removed.
Chromatography of the residue (silica gel ; hexane : EtOAc 9 : 1) afforded the title compound as a white solid.
1H NMR (CDCl3) d 3. 95 (3H, s), 6. 54 (1H, br s), 7. 60 (1H, d), 7. 65 (1H, d), 7. 570 (1H, s).
Step D : Preparation of 2-Hydrox-4vdroxvmethvlbenzonitrile Methyl 4-cyano-3-hydroxybenzoate (as described in Example 4, Step C) (0. 50 g, 2. 82 mmol) was dissolved in dry THF (30 mL), treated with LiBH4 (2. 0M solution in THF) (5. 64 mL, 11. 28 mmol) and heated at reflux overnight. The reaction mixture was concentrated, then partitioned between EtOAc (50 mL) and 1N HCl (50 mL), the aqueous layer extracted with additional EtOAc (2 x 50 mL), the organic layers combined, washed with brine, and dried (MgS04). Filtration and concentration to dryness gave the title compound. <BR> <BR> <P>1H NMR (CD30D) 8 7. 45 (1H, d, J = 8 Hz), 6. 98 (1H, d, J = 1 Hz), 6. 89 (1H, dd, J = 1, 8, Hz), 4. 58 (2H, s).
Step E : Preparation of 4-Bromometh.2-hydroxv-benzonitrile 2-Hydroxy-4-hydroxymethylbenzonitrile (0. 20 g, 1. 34 mmol) was dissolved in DMF (5 mL)-CH2Cl2 (5 mL) and treated with triphenylphosphine (0. 53 g, 2. 01 mmol) and carbon tetrabromide (0. 67 g, 2. 01 mmol) at ambient temperature with stirring. After 2 h the reaction mixture was partitioned between EtOAc (100 mL)-H2O (100 mL), the organic layer separated, dried (MgS04), and filtered to give the title compound after silica gel chromatography (15% EtOAc/hexane to 25% EtOAc/ hexane).
1H NMR (CD30D) 8 7. 45 (1H, d, J = 8 Hz), 6. 94 (1H, s), 6. 90 (1H, d, J =8, Hz), 4. 40 (2H, s).
Step F : Preparation of 2-Hydroxy-4-imidazol-1-ylmethyl- benzonitrile 4-Bromomethyl-2-hydroxy-benzonitrile (0. 22 g, 1. 05 mmol) and imidazole (0. 36 g, 5. 23 mmol) were dissolved in DMF (10 mL) with stirring at ambient temperature. After stirring for 18 h the reaction mixture was concentrated in vacuo and purified by silica gel chromatography eluting with 2% CH30H/CH2C12 to 5% CH30H/CH2Cl2 to give the title compound. <BR> <BR> <P>1H NMR (DMSO) 8 11. 11 (1H, s), 7. 74 (1H, s), 7. 58 (1H, d, J = 8 Hz), 7. 17 (1H, s), 6. 95 (1H, s), 6. 74 (1H, d, J =8, Hz), 6. 69 (1H, s), 5. 23 (2H, s).
Step G : Preparation of 2- (biphenyl-4-ylmethoxy)-4-imidazol-l- ylmethyl-benzonitrile Following the procedure described in Example 2, Step E but using 2-hydroxy-4-imidazol-1-ylmethyl-benzonitrile (as described in Step F) and biphenyl-4-ylmethyl iodide as starting materials, the title compound was obtained as a solid.
1H NMR (CD30D) d 4. 89 (2H, s), 5. 28 (2H, s), 6. 91 (1H, d), 7. 06 (3H, m), 7. 3-7. 55 (5H, m), 7. 6-7. 66 (5H, m), 7. 77 (1H, s).
Analysis calculated for C24Hl9N30 : C, 78. 88 ; H, 5. 24 ; N, 11. 50 ; Found : C, 78. 59 ; H, 5. 31 ; N, 11. 10.
EXAMPLE 5 Preparation of 2- (biphenyl-4-yl-2-ethoxy)-4-imidazol-1-ylmethyl- benzonitrile hydrochloride Following the procedure described in Example 4, Step A to D but using biphenyl-4-ylethyl iodide as the starting material in Step B, and treatment of the final product with 1N HCl in ether, the title compound was obtained as a solid.
1H NMR (CD30D) d 3. 13 (2H, t), 4. 28 (2H, t), 4. 90 (2H, s), 6. 83 (1H, dd), 6. 95 (1H, s), 7. 00 (1H, t), 7. 11 (1H, t), 7. 30 (1H, m), 7. 35-7. 45 (4H, m), 7. 5- 7. 6 (5H, m), 7. 76 (1H, s).
EXAMPLE 6 Preparation of 1-tert-butoxycarbonyl-4- (3-chlorophenyl)-2 (S)- [2- (2-cyano- 5-imidazol-1-vlmethvl-phenoxy) ethvll piperazine Step A : Preparation of L-N-tert-butox,ccnvl homoserine lactone To a solution of L-homoserine lactone hydrochloride (10 g, 72. 7 mmol) and (Boc) 20 (19. 0 g, 87. 2 mmol) in dichloromethane (200 mL) at 0°C was added Et3N (12. 2 mL, 87. 2 mmol) dropwise. The solution was warmed to room temperature and stirred for 16 hr. The mixture was poured into 10% citric acid solution, extracted with EtOAc, washed with saturated NaHC03 solution, then brine, dried (MgS04) and evaporated in vacuo. Column chromatography (silica gel ; hexane : EtOAc 1 : 1 then pure EtOAc) afforded the title compound as a white solid.
Rf (silica) : 0. 58 (hexane : EtOAc 1 : 1).
Step B : Preparation of L-N-tert-butoxvcarbonvl homoserine lactol To a solution of a lactone, as described in Step A, in THF (355 mL) at-78°C was added DIBAL-H (1. OM in THF ; 146 mL, 146 mmol) dropwise. The solution was stirred at-78°C for 1 hr then EtOAc and sodium potassium tartrate solution were added and the resulting mixture stirred vigorously for 30 minutes. After extracting with EtOAc (4X) the combined organic layers were washed with brine and dried over MgS04. Removal of the solvent yielded an oil which solidified on standing. Column chromatography (silica gel ; hexane : EtOAc 2 : 1 then 1 : 1) affordedffthe title compound as a white solid.
Step C : Preparation of 3 (S)- (N'-tert-butoxycarbonylamino)-4- (N 3-chlorophenvlamino)-butanol To a solution of a lactol, as described in Step B, and 3- chloroaniline (6. 25 mL, 59. 1 mmol) in dichloroethane (200 mL) at room temperature was added acetic acid (3. 07 mL, 53. 7 mmol) followed by Na (OAc) 3BH (17. 1 g, 80. 5 mmol) and the mixture stirred for 2 hr.
Saturated NaHC03 solution was added and the mixture extracted with
dichloromethane (3X), washed with brine, dried (MgS04) and concentrated in vacuo. Column chromatography (silica gel ; hexane : EtOAc 2 : 1 then 1 : 1 then pure EtOAc) afforded the title compound as a white solid.
1H NMR (CDCl3) d 1. 45 (9H, s), 1. 5 (1H, m), 1. 90 (1H, m), 2. 96 (1H, br s), 3. 11 (1H, m), 3. 24 (1H, m), 3. 73 (2H, m), 4. 05 (2H, m), 4. 75 (1H, d), 6. 48 (1H, dd), 6. 58 (1H, t), 6. 67 (1H, dd), 7. 07 (1H, t).
Step D : Preparation of 3 (S)- (N'-tert-butoxycarbonylamino)-4- (N-3- chlorophenvl-N-chloroacetvl) amino-butanol To a solution of an amine, as described in Step C, in EtOAc (120 mL) and saturated NaHC03 (120 mL) at 0°C was added chloroacetyl chloride (3. 08 mL, 38. 8 mL) dropwise. After 2 hr, the mixture was extracted with EtOAc (3X), washed with brine, dried (MgS04) and concentrated in vacuo to give the title product as a clear oil which was used as such.
Step E : Preparation of 1-tert-butoxycarbonyl-4- (3-chlorophenyl)- 2 (S)- (2-hydroxyethvl)-5-oxo-piperazine To a solution of a chloroacetamide, as described in Step D, in DMF (100 mL) at 0°C was added Cs2CO3 (27. 75 g, 85. 2 mmol) and the reaction was stirred for 6 hr. The solution was poured into EtOAc and saturated NH4C1. Extracted with EtOAc (3X), washed with brine, dried and evaporated to give a yellow oil. Column chromatography (silica gel ; hexane : EtOAc 2 : 1 then 1 : 1 then pure EtOAc) afforded the title compound as a clear oil.
Step F : Preparation of 1-tert-butoxycarbonyl-4- (3-chlorophenyl)- 2 (S)- [2- (2-cyano-5-methoxycarbonylphenoxy) ethyl]-5-oxo- piperazine To a solution of 250 mg of methyl 4-cyano-3-hydroxybenzoate (1. 42 mmol), as described in Example 4, Step C, and PPh3 (465 mg, 1. 77 mmol) in THF (10 mL) was added dropwise a solution of the alcohol from Step E above (503 mg, 1. 42 mmol) and DEAD (0. 28 mL, 1. 77 mmol) in
THF (5 mL). After stirring for 16 hr, the solution was concentrated in vacuo and the residue taken up in EtOAc. This was then washed with 10% citric acid solution, saturated NaHC03 solution, brine and dried over MgS04. Filtration and removal of the solvent afforded an oil.
Column chromatography (silica gel ; hexane : EtOAc 4 : 1) afforded the title compound as a clear oil.
Step G : Preparation of 1-tert-butoxycarbonyl-4- (3-chlorophenyl)- 2 (S)- [2- (2-cyano-5-hydroxymethylphenoxy) ethyl]- piperazine Following the procedure described in Example 1, Step C but using an ester, as described in Step F above, as the starting material, the title compound was obtained.
FAB mass spectrum m/z = 472. 21 (M+H requires 471. 19) Step H : Preparation of 1-tert-butoxycarbonyl-4- (3-chloro-phenyl)- 2 (S)-[2-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-ethyl]-5- oxo-piperazine Following the procedure described in Example 2, Steps D and E but using an alcohol, as described in Step G above, as the starting material, the title compound was obtained as a white solid.
FAB mass spectrum m/z = 522. 19 (M+H requires 522. 22).
Analysis calculated for C28H32N503Cl'0. 15CH2Cl2 : C, 63. 22 ; H, 6. 09 ; N, 13. 10 ; Found : suc, 63. 17 ; H, 5. 88 ; N, 12. 93.
EXAMPLE 7 Preparation of 2- (3-chlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride Step A : Preparation of 2- (3-chlorophenoxv)-4-methyl-benzonitrile
To a solution of 2-fluoro-4-methylbenzonitrile (356mg, 3. 96mmol) and 3-chlorophenol (439, uL, 4. 16mmol) in lOmL of DMSO was added Cs2CO3 (2. 58g, 7. 92 mmol). The solution was heated at 80°C for 4h. The solution was diluted with EtOAc and was washed with Sat.
NaHC03 solution, water, and brine. The organics were dried (MgS04), filtered, and concentrated in vacuo to give the title compound without further purification.
Step B : Preparation of 2- (3-chlorophenoxy)-4-bromo-ylmethyl- benzonitrile To a solution of 2- (3-chlorophenoxy)-4-methyl-benzonitrile (640 mg, 2. 63 mmol), as described in Step A, NBS (470 mg, 2. 63 mmol), and AIBN (13mg, 0. 07mmol) in 24mL of CCl4 was refluxed under Ar for 4h. The solution was filtered through a celite pad and the filtrate was concentrated in vacuo. The residue was purified by silica gel chromatography (0-6% EtOAc/hexane) to give the title compound.
Step C : Preparation of 2- (3-chlorophenoxy)-4-imidazol-1-ylmethyl- benzonitrile hydrochloride To a solution of 2- (3-chlorophenoxy)-4-bromo-ylmethyl- benzonitrile (lllmg, 0. 34mmol), as described in Step B, in lOmL of DMF was added imidazole (117mg, 1. 72mmol). The reaction was stirred for 18h at ambient temperature. The solvent was removed in vacuo, diluted with EtOAc and was washed with saturated NaHC03 solution, water, and brine. The organics were dried (MgS04), filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography (1% MeOH/CH2Cl2) and treated with 1N HCl in ether to give the title compound as a HCl salt.
'HNMR (CDC13, 400MHz) d 9. 04 (1H, s), 7. 84 (1H, d, J=8Hz), 7. 61 (2H, d, J=llHz), 7. 43 (1H, t, J=8Hz), 7. 27 (2H, t, J=7Hz), 7. 16 (1H, s), 7. 05-7. 07 (2H, m), 5. 50 (2H, s). FAB MS 310 (M+1) Anal. calculated for Cl7Hi2N30iCli 1. 0 HC 0. 85 H20 C, 56. 47 ; H, 4. 10 ; N, 11. 62 ; Found C, 56. 85 ; H, 4. 08 ; N, 11. 23.
EXAMPLE 8 Preparation of 2- (4-chlorophenyl-2-ethoxy)-4-imidazol-1-ylmethyl- benzonitrile hydrochloride Step A : Preparation of 2-h. y-4-h. Ydroxymethvlbenzonitrile Methyl 4-cyano-3-hydroxybenzoate, as described in Example 4, Step C, (0. 50 g, 2. 82 mmol) was dissolved in dry THF (30 mL), treated with LiBH4 (2. 0M solution in THF) (5. 64 mL, 11. 28 mmol) and heated at reflux overnight. The reaction mixture was concentrated, then partitioned between EtOAc (50 mL) and 1N HCl (50 mL). Next, the aqueous layer was extracted with additional EtOAc (2 x 50 mL), the organic layers were combined, washed with brine, and dried (MgS04).
The title compounds was obtained by filtering and concentrating to dryness.
1H NMR (CD30D) d 7. 45 (1H, d, J = 8 Hz), 6. 98 (1H, d, J = 1 Hz), 6. 89 (1H, dd, J = 1, 8, Hz), 4. 58 (2H, s).
Step B : Preparation of 4-bromomethyl-2-hydroxy-benzonitrile 2-hydroxy-4-hydroxymethylbenzonitrile (0. 20 g, 1. 34 mmol) was dissolved in DMF (5 mL) and CH2Cl2 (5 mL) and then treated with triphenylphosphine (0. 53 g, 2. 01 mmol) and carbon tetrabromide (0. 67 g, 2. 01 mmol) at ambient temperature with stirring. After 2 h, the reaction mixture was partitioned between EtOAc (100 mL) and H20 (100 mL), the organic layer were separated, dried (MgS04), and filtered to give the title compound after silica gel chromatography (15% EtOAc/hexane to 25% EtOAc/hexane).
1H NMR (CD30D) d 7. 45 (1H, d, J = 8 Hz), 6. 94 (1H, s), 6. 90 (1H, d, J =8, Hz), 4. 40 (2H, s).
Step C : Preparation of 2-hydroxy-4-imidazol-1-ylmethyl- benzonitrile 4-bromomethyl-2-hydroxy-benzonitrile (0. 22 g, 1. 05 mmol) and imidazole (0. 36 g, 5. 23 mmol) were dissolved in DMF (10 mL) with stirring at ambient temperature. After stirring for 18 h, the reaction
mixture was concentrated in vacuo and purified by silica gel chromatography eluting with 2% CH30H/CH2C12 to 5% CH30H/ CH2C12 to give the title compound.
1H NMR (DMSO) d 11. 11 (1H, s), 7. 74 (1H, s), 7. 58 (1H, d, J = 8 Hz), 7. 17 (1H, s), 6. 95 (1H, s), 6. 74 (1H, d, J =8, Hz), 6. 69 (1H, s), 5. 23 (2H, s).
Step D : Preparation of 2- (4-chlorophenyl-2-ethoxy)-4-imidazol-l- ylmethyl-benzonitrile hydrochloride 4-chlorophenethyl alcohol (0. 11 g, 0. 67 mmol) and triethylamine (0. 37 mL, 2. 68 mmol) were dissolved in CH2C12 (5 mL) at 0°C. Then it was treated with methanesulfonyl chloride (0. 207 mL, 2. 68 mmol), with stirring and warming to ambient temperature, until tlc indicated loss of starting material. The reaction mixture was concentrated in vacuo, then dissolved in DMF (1 mL) and added to a mixture of 2-hydroxy-4-imidazol-1-ylmethyl-benzonitrile (0. 10 g, 0. 50 mmol) and cesium carbonate (0. 33 g, 1. 0 mmol) in DMF (2 mL). The reaction mixture was heated at 30°C for 18 h, then partitioned between EtOAc and H20, the aqueous layer washed with EtOAc, the organic layers combined, washed with brine, and dried (Na2SO4). Filtration and concentration to dryness gave the title compound after silica gel chromatography (0. 1 to 0. 2% CH30H/NH40H in CH2C12) and conversion to the hydrochloride salt.
FAB mass spectrum (M+1) 338 Analysis calculated for ClgHl6N30C1 1. 3 HCl * 0. 75 H20 : C, 57. 23 ; H, 4. 75 ; N, 10. 54 ; Found : C, 57. 49 ; H, 4. 74 ; N, 10. 14.
Using the procedure described above, but substituting the appropriate heterocycle for imidazole in Step C and the appropriate mesylate or halide in Step D, the following compounds were prepared : 2- (3-chlorophenyl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 338 Analysis calculated for C1gHl6N3OCl 1. 2 HCl 0. 35 H20 :
C, 58. 83 ; H, 4. 65 ; N, 10. 83 ; Found : C, 58. 90 ; H, 4. 67 ; N, 10. 50.
2- (2-chlorophenyl-2-ethoxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 338 <BR> <BR> <BR> <BR> <BR> <BR> 2- (phenvl-2-ethoxy)-4-imidazol-1-vlmethvl-benzonitrile hydrochloride FAB mass spectrum (M+1) 304 Analysis calculated for C19H17N3O 1. 0 HCl # 0. 85 H20 : C, 64. 25 ; H, 5. 59 ; N, 11. 83 ; Found : C, 64. 55 ; H, 5. 77 ; N, 11. 44.
2-(3-chlorobenzyloxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 324 Analysis calculated for Cl8Hl4ClN3O * 1. 2 HCl * 0. 40 H2O : C, 57. 69 ; H, 4. 30 ; N, 11. 21 ; Found : C, 57. 66 ; H, 4. 31 ; N, 11. 02.
2-(4-chlorobenzyloxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 324 2-(2,4-dichlorobenzyloxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 358 Analysis calculated for C18H13Cl2N3O # 0.10 H2O : C, 60. 04 ; H, 3. 70 ; N, 11. 67 ; Found : ^C, 60. 02 ; H, 3. 84 ; N, 11. 78.
2-(benzyloxv)-4-imidazol-1-vlmethvl-benzonitrile Analysis calculated for ClaHl5N30 0. 45 H2O : C, 72. 68 ; H, 5. 39 ; N, 14. 13 ; Found : C, 73. 03 ; H, 5. 13 ; N, 13. 75.
2- (biphenyl-2-vlmethoxv)-4-imidazol-1-ylmethvl-benzonitrile FAB mass spectrum (M+1) 366
Analysis calculated for C24H19N3O # 1. 1 HCl * 0. 85 H20 : C, 68. 49 ; H, 5. 22 ; N, 9. 99 ; Found : C, 68. 46 ; H, 5. 24 ; N, 9. 64.
2- (phenvl-4-butoxv)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 332 Analysis calculated for C 21H 21N30 o 1. 4 HCI : C, 65. 94 ; H, 5. 90 ; N, 10. 99 ; Found : C, 65. 94 ; H, 5. 78 ; N, 10. 78.
2- (phenvl-3-propoxy)-4-imidazol-1-vlmethyl-benzonitrile hvdrochloride FAB mass spectrum (M+1) 318 Analysis calculated for C20HlgN3O 1. 1 HCI : C, 67. 19 ; H, 5. 67 ; N, 11. 75 ; Found : C, 67. 20 ; H, 5. 43 ; N, 11. 70.
2- (biphenyl-4-yl-2-ethoxy)-4- (1, 2, 4-triazol-1-yl) methyl-benzonitrile hydrochloride HR mass spectrum theoretical 381. 1710 ; measured 381. 1707.
2- (biphenyl-4-yl-2-ethoxy)-4- (2-methyl-imidazol-1-yl) methyl-benzonitrile hydrochloride HR mass spectrum theoretical 394. 1910 ; measured 394. 1914.
2- (biphenyl-4-yl-2-ethoxy)-4-benzimidazol-1-yl) methyl-benzonitrile hydrochloride HR mass spectrum theoretical 430. 1920 ; measured 430. 1914.
EXAMPLE 9 Preparation of 4-imidazol-1-ylmethyl- (2-naphthalen-2-yloxy)-benzonitrile hydrochloride Step A : Preparation of 4-bromo-3-fluorobenzoic acid
4-Bromo-3-fluorotoluene (40. 0 g, 0. 212 mol) was heated at 90° C in H20 (200 mL) and pyridine (200 mL) with mechanical stirring under Ar. Potassium permanganate (KMn04) (67 g, 0. 424 mol) was added portionwise over 3 h. After 4 h, an HPLC of a filtered sample indicated 50 % conversion to the acid. An additional 30 g of KMn04 was added and heating continued overnight. HPLC indicated 81% conversion. Further KMn04 was added portionwise with reaction monitoring by HPLC until > 95% conversion was obtained. The reaction mixture was filtered through Celite, the filter pad washed with H20, aq NaOH and EtOH. The filtrate was concentrated to a small volume, then partitioned between 3N NaOH solution and diethyl ether. The aqueous basic layer was separated, cooled in an ice-H20 bath and acidified slowly with 6N HC1 solution to precipitate the white solid product. This was collected by suction filtration and dried at 40 °C. in a vacuum oven overnight to give the title compound. mp 190-192°C.
1H NMR (CDC13) d 7. 83 (dd, 1H, J = 2, 9 Hz), 7. 78 (dd, 1H, J = 2, 8 Hz), 7. 67-7. 71 (m, 1H).
Step B : Preparation of 4-bromo-3-fluorobenzvl alcohol 4-Bromo-3-fluorobenzoic acid (40. 8 g, 0. 187 mol) was dissolved in THF (250 ml) with magnetic stirring under Ar in an ice- H20 bath. The cloudy solution was treated dropwise with borane-THF complex (1 M) (374 mL, 0. 374 mol) over a 1 h period maintaining the internal temperature at < 10°C. The reaction mixture was left to warm to ambient temperature overnight, then cooled in an ice H20 bath and treated dropwise with H20 (150 mL). The THF was removed on a rotary evaporator, and the residue partitioned between EtOAc and H20. The aqueous layer was extracted with EtOAc (3 x 100 mL), the organic layers combined, washed with brine, and dried (Na2SO4), filtered, and concentrated to give the title compound as an oil which solidified on standing.
1H NMR (CDC13) d 7. 52 (t, 1H, J = 8 Hz), 7. 16 (d, 1H, J = 9 Hz), 7. 02 (d, 1H, J = 8 Hz), 4. 67 (s, 2H), 1. 47 (br s, 1H).
Step C : Preparation of 2-fluoro-4-hydroxymethvlbenzonitrile 4-Bromo-3-fluorobenzyl alcohol (20 g, 0. 097 mol) was dissolved in DMF (100 mL) and then placed under high vacuum for 15 min. The solution was then purged with Ar for 15 min. While purging continued, zinc cyanide (8 g, 0. 068 mol) and the catalyst, Pd [(PPh3)] 4, (5. 63 g, 0. 0049 mol) were added. The reaction mixture was heated at 95°C under Ar for 18 h, then cooled to ambient temperature and added to H20. The mixture was extracted with EtOAc, then washed with 1M HCl, H20, brine, and dried (Na2SO4). Filtration and concentration to dryness gave the title compound as a white solid after chromatography (silica gel, hexane : EtOAc, 6. 5 : 3. 5.
1H NMR (CDC13) d 7. 61 (t, 1H, J = 8 Hz), 7. 23-7. 29 (m, 2H), 4. 80 (d, 2H, J = 6 Hz), 1. 93 (t, 1H, J = 6Hz).
Step D : Preparation of 4-bromomethvl-2-fluoro-benzonitrile N-Bromosuccinimide (6. 6 g, 0. 037 mol) was dissolved in CH2Cl2 (150 mL), cooled to 0°C and treated with dimethylsulfide (3. 27 mL, 0. 0446 mol). The solution was cooled to-20°C and then treated dropwise with a solution of 2-fluoro-4-hydroxymethylbenzonitrile (3. 74 g, 0. 0248 mol) in CH2Cl2 (30 mL). After the addition, the reaction mixture was stirred at 0°C for 2 h then left to warm to ambient temperature overnight. The reaction mixture was added to ice/H20, extracted with EtOAc, the organic layer separated, washed with brine and dried (MgS04). Filtration and concentration to dryness gave the title compound which was purified chromatography (silica gel, 5-10% EtOAc/hexane.
1H NMR (CDC13) d 7. 61 (dd, 1H, J = 8, 8 Hz), 7. 26-7. 30 (m, 2H), 4. 45 (s, 2H).
Step E : Preparation of 2-fluoro-4-imidazol-1-vlmethvl-benzonitrile 4-Bromomethyl-2-fluoro-benzonitrile (3. 44g, 16. 0 mmol) and imidazole (5. 47 g, 80. 3 mmol) were dissolved in DMF (40 mL) and stirred at ambient temperature for 2 h. The DMF was removed in vacuo and the residue was partitioned between EtOAc (300 mL) and aqueous saturated NaHC03 solution. The organic layer was separated, washed with
NaHC03 solution, H20, brine, and dried (MgS04). Filtration and concentration to dryness gave the title compound after chromatography (silica gel, 1-2% CH3OH/CH2Cl2).
1H NMR (CDCl3) d 7. 62 (dd, 1H, J = 8. 5, 9. 5 Hz), 7. 57 (s, 1H), 7. 16 (s, 1H), 7. 00 (d, 1H, J = 8. 5 Hz), 6. 94 (d, 1H, J = 9. 5 Hz), 6. 91 (s, 1H), 5. 21 (s, 2H).
Step F : Preparation of 2-(2-naphthyloxy)-4-imidazol-1-ylmethyl- benzonitrile hydrochloride 2-Fluoro-4-imidazol-1-ylmethyl-benzonitrile (0. 167 g, 0. 830 mmol), 2-naphthol (0. 143 g, 0. 996 mmol) and cesium carbonate (0. 54 g, 1. 66 mmol) were dissolved in DMF (15 mL) and heated at 55°C under Ar for 18 h. The reaction mixture was partitioned between EtOAc and 1N NaOH solution. The organic layer was separated, washed with 1N NaOH solution, H20, brine, and dried (MgS04). Filtration and concentration to dryness gave the title compound after chromatography (silica gel, 1% CH30H/CH2Cl2).
FAB mass spectrum (M+1) 326 Analysis calculated for C21H15N3O # 1. 0 HCl * 0. 75 H20 : C, 67. 19 ; H, 4. 70 ; N, 11. 20 ; Found : C, 67. 23 ; H, 4. 89 ; N, 11. 14.
Using the procedure described above, but substituting the appropriate heterocycle for imidazole in Step E and the appropriate phenol or thiol in Step F, the following compounds were prepared : 2- (3-cyanophenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 301 2- (3-bromophenoxy)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 353 2- (biphen-3-yv)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 352
2- (biphen-4-vloxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 352 2-(3-acetylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 318 2-(2-acetylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 318 <BR> <BR> 2- (3-trifluoromethylphenoxy)-4-imidazol-1 ylmethyl-benzonitrile FAB mass spectrum (M+1) 344 2-(3-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 290 2- (2-methvlphenox, y)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 290 2-(4-methylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 290 2- (3-methoxyphenoxv)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 306 2- (2-methoxyphenoxv)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 306 2- (4-methoxyphenoxv)-4-imidazol-1-vlmethvl-benzonitrile FAB mass spectrum (M+1) 306 2- (3. 5-dimethylphenoxv)-4-imidazol-l-ylmethyl-benzonitrile FAB mass spectrum (M+1) 304 2- (3, 4-dimethylphenoxv)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 304
2-(3,5-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 336 2-(1-naphthyloxv)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 326 2-(2,4-dichlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 343 2- (3-fluorophenoxv)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 294 2-(3-t-butylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 332 <BR> <BR> 2-f[3- (N, N-diethvlamino) phenoxyl-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 347 2-(3-N-propylphenoxy)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 318 2-(2,3-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 336 2- (2, 3-dimethylphenoxv)-4-imidazol-l-ylmethyl-benzonitrile FAB mass spectrum (M+1) 304 2-(3,4-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 336 2-(2,5-dimethoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 336 2-(3,4-dichlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile
FAB mass spectrum (M+1) 343 2- (2, 4-dimethYlphenoxy)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 304 2-(4-chlloro-2-methylphenoxy)-4-imidazol-1-ylmethyl-benzonit rile FAB mass spectrum (M+1) 324 2-(5-chloro-2-methvlphenoxv)-4-imidazol-l-ylmethyl-benzonitr ile FAB mass spectrum (M+1) 324 2- (2-chloro-4, 5-dimethylphenoxv)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 338 2- (5-hydroxymethyl-2-methoxyphenoxy)-4-imidazol-1-ylmethyl- benzonitrile FAB mass spectrum (M+1) 336 4-omidazol-1-ylmethyl-2-(3-phenylamino-phenoxy)-benzonitrile FAB mass spectrum (M+1) 367 <BR> <BR> 4-imidazol-1-vlmethyl-2-f[3- (2-methylphenvlamino)-phenoxyl-benzonitrile FAB mass spectrum (M+1) 81 4-imidazol-1-ylmethyl-2-(3-phenylamino-phenoxy)-benzonitrile FAB mass spectrum (M+1) 368 2-(2-benzoyl-phenoxy)-4-imidazol-1-ylmethYl-benzonitrile FAB mass spectrum (M+1) 380 <BR> <BR> 1- (5-chloro-2-methoxy-phenyl)-3- [3- (2-cyano-5-imidazol-1-<BR> ylmethyl-phenoxy)-phenyll-urea FAB mass spectrum (M+1) 474
1- (2, 5-dimethoxy-phenyl)-3- [3- (2-cyano-5-imidazol-l- vlmethvl-phenoxy)-phenyll-urea FAB mass spectrum (M+1) 470 2-(3-benzyloxy-phenoxv)-4-imidazol-1-vlmethvl-benzonitrile FAB mass spectrum (M+1) 382 2-(4-benzyloxy-phenoxy)-4-imidazol-1-ylmethyl-benzonitrile FAB mass spectrum (M+1) 382 2- (2-benzvl-phenox)-4-imidazol-l-vlmethyl-benzonitrile FAB mass spectrum (M+1) 366 2-(3-ethvnsl-phenoxv)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 300 2-(4-acetyl-3-methyl-phenoxy)-4-imidazol-1-ylmethyl-benzonit rile FAB mass spectrum (M+1) 332 4-imidazol-1-vlmethvl-2-(lH-indazol-6-vloxy)-benzonitrile FAB mass spectrum (M+1) 315 4-imidazol-1-ylmethyl-2- (5, 6, 7, 8-tetrahydro-naphthalen-1-yloxy)- benzonitrile FAB mass spectrum (M+1) 330 4-imidazol-l-ylmethyl-2- (8-oxo-5, 6, 7, 8-tetrahydro-naphthalen-1-yloxy)- benzonitrile FAB mass spectrum (M+1) 344 4-imidazol-1-ylmethyl-2-(1H-indol-7-yloxy)-benzonitrile FAB mass spectrum (M+1) 315 4-imidazol-1-ylmethyl-2-(3-oxo-indan-4-yloxy)-benzonitrile FAB mass spectrum (M+1) 330
4-imidazol-1-vlmethvl-2-(lH-indol-4-vloxv)-benzonitrile FAB mass spectrum (M+1) 315 2-[3-(2-hydroxy-ethoxy)-phenoxy]-4-imidazol-1-ylmethyl-benzo nitrile FAB mass spectrum (M+1) 336 4-imidazol-1-ylmethyl-2- (4-imidazol-1-vl-phenoxy)-benzonitrile FAB mass spectrum (M+1) 342 <BR> <BR> 4'- (2-cvano-5-imidazol-1-ylmethyl-phenoxy)-biphenvl-4-carbonitr ile FAB mass spectrum (M+1) 377 N-[3-(2-Cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-acetami de FAB mass spectrum (M+1) 333 4-imidazol-1-ylmethyl-2-(9-oxo-9H-fluoren-4-yloxy)-benzonitr ile FAB mass spectrum (M+1) 378 2- (5-cvano-2-imidazol-1 vlmethyl-phenoxv)-N-phenvl-benzamide FAB mass spectrum (M+1) 395 2-(5-chloro-pvridin-3-vloxv)-4-imidazol-1-vlmethyl-benzonitr ile FAB mass spectrum (M+1) 311 N-[3-(2-Cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]- benzenesulfoilamide FAB mass spectrum (M+1) 431 4-imidazol-1-ylmethyl-2-(indan-5-yloxy)benzonitrile FAB mass spectrum (M+1) 316 2- (9H-carbazol-2-yloxv)-4-imidazol-1-vlmethyl-benzonitrile FAB mass spectrum (M+1) 365
4-imidazol-1-ylmethyl-2- (5, 6, 7, 8-tetrahydro-naphthalen-2-yloxy)- benzonitrile FAB mass spectrum (M+1) 330 <BR> <BR> 4-imidazol-1-ylmethyl-2- (2-methoxpropenyl-phenoxv)-benzonitrile FAB mass spectrum (M+1) 346 4-imidazol-1-vlmethyl-2- [4-(3-oxo-butyl)-phenoxvl-benzonitrile FAB mass spectrum (M+1) 346 <BR> <BR> 2- (3-chlorophenoxv)-5-imidazol-l-vlmethvl-benzonitrile hvdrochloride FAB mass spectrum (M+1) 310 <BR> <BR> 2- (4-chlorophenoxv)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 310 2- (3, 5-dichlorophenoxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 344 2-(pyridin-3-yloxy)-4-imidazol-1-ylmethyl-benzonitrile dihydrochloride FAB mass spectrum (M+1) 277 <BR> <BR> 2- (2-chlorophenoxv)-4-imidazol-1-vlmethyl-benzonitrile hvdrochloride FAB mass spectrum (M+1) 310 2-(3-chlorophenoxy)-5-(4-phenyl-imidazol-1-ylmethyl)-benzoni trile hydrochloride FAB mass spectrum (M+1) 386 <BR> <BR> 2- (biphen-2-yloxv)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride Analysis calculated for C23H17N3O # 1. 0 HCl # 0. 75 H20 : C, 68. 82 ; H, 4. 90 ; N, 10. 47 ; Found : C, 68. 80 ; H, 4. 91 ; N, 10. 30.
2-(phenoxy)-4-imidazol-1-vlmethvl-benzonitrile hvdrochloride Analysis calculated for C17H13N30 # 1.0 HCl # 0. 35 H20 : C, 64. 19 ; H, 4. 66 ; N, 13. 21 ; Found : C, 64. 33 ; H, 4. 78 ; N, 12. 84.
EXAMPLE 10 Preparation of 2- (2-chloro-4-methoxyphenoxy)-4-imidazol-1-ylmethyl- benzonitrile hydrochloride Step A : Preparation of 2- (2-chloro-4-methoxyphenoxy)-4-imidazol-l- vlmethvl-benzonitrile hydrochloride 2-Fluoro-4-imidazol-1-ylmethyl-benzonitrile, as described in Example 9, Step E, (0. 118 g, 0. 586 mmol), 2-chloro-4-methoxyphenol (0. 112 g, 0. 703 mmol), KF on alumina (40% by weight) (0. 112 g, 0. 703 mmol) and 18-crown-6 (0. 11 g, 10% by weight of phenol) were dissolved in CH3CN (5 mL) and heated at reflux under Ar for 18 h. The reaction mixture was filtered, dissolved in CH30H and purified by RP HPLC on a Waters Prep Pak column eluting with a 0. 1% TFA/H2O : 0. 1% TFA/ CH3CN gradient (95 : 5 to 5 : 95) to give the title compound after conversion to the hydrochloride salt.
FAB mass spectrum (M+1) 340 Analysis calculated for Cl8Hl4ClN302 1. 0 HCl 0. 15 CH2Cl2 : C, 56. 04 ; H, 3. 96 ; N, 10. 80 ; Found : C, 56. 25 ; H, 3. 90 ; N, 10. 42.
Using the procedure described above, but substituting the appropriate heterocycle for imidazole (Example 9, Step E) and the appropriate phenol or thiol in Step A, the following compounds were prepared : 2- (2-chlorophenylsulfanyl)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 326
4-imidazol-1 ylmethvl-2- (naphthalen-2ylsulfanvl)-benzonitrile FAB mass spectrum (M+1) 342 2- (2, 4-dichlorophenylsulfanyl)-4-imidazol-l-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 360 Oxidation of this compound provided the sulfoxide : <BR> <BR> 2- (2. 4-dichloro-benzenesulfinyl)-4-imidazol-1-ylmethvl--benzonitr ile FAB mass spectrum (M+1) 376 and the sulfone : 2-(2,4-dichloro-benzenesulfonyl)-4-imidazol-1-ylmethyl-benzo nitrile FAB mass spectrum (M+1) 392 2- (2-methvl-pvridin-3-yloxy)-4-imidazol-1-ylmethvl-benzonitril e FAB mass spectrum (M+1) 291 2-(2,4-dimethyl-pyridin-3-yloxy)-4-imidazol-1-ylmethyl-benzo nitrile FAB mass spectrum (M+1) 305 <BR> <BR> 2- (4-chloro-2-methoxyphenoxy)-4-imidazol-1-ylmethyl-benzonitri le hydrochloride FAB mass spectrum (M+1) 340 <BR> <BR> 2- (2-chlorophenoxv)-4- (5-methvl-imidazol-1-vlmethvl)-benzonitrile FAB mass spectrum (M+1) 324 <BR> <BR> 2- (2-chlorophenoxy)-4- (4-methyl-imidazol-1-ylmethyl)-benzonitrile hydrochloride FAB mass spectrum (M+1) 324
2- (3-chloro-5-trifluoromethyl-pyridin-2-yloxy)-4-imidazol-1-yl methyl- benzonitrile FAB mass spectrum (M+1) 471 2- (2-acetylphenoxy)-4-imidazol-1-ylmethyl-benzonitrile hydrochloride FAB mass spectrum (M+1) 318 2- (2, 4-dichlorophenoxy)-4- (2-methyl-imidazol-1-ylmethyl)-benzonitrile hydrochloride FAB mass spectrum (M+1) 358 N-f[3- (2-cvano-5-imidazol-1-ylmethyl-phenoxv)-phenyll-benzamide Analysis calculated for C24Hl8N402 0. 1 EtOAc : C, 72. 67 ; H, 4. 70 ; N, 13. 90 ; Found : C, 72. 70 ; H, 4. 70 ; N, 13. 50.
2- [3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-N-phenyl- acetamide Analysis calculated for C25H20N402'0. 95 H20 : C, 70. 55 ; H, 5. 19 ; N, 13. 17 ; Found : C, 70. 52 ; H, 5. 03 ; N, 12. 92.
4-imidazol-1-ylmethyl-2-(quinolin-6-yloxy)-benzonitrile FAB mass spectrum (M+1) 327 <BR> <BR> 4-imidazol-1-ylmethvl-2- (2-oxo-1. 2-dihydro-quinolin-6-vloxv)-benzonitrile FAB mass spectrum (M+1) 343 N- [3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-phenyl]-2-phenyl- acetamide FAB mass spectrum (M+1) 409 5-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-cyclohexyl-nicot inamide FAB mass spectrum (M+1) 402
N- (3-chloro-phenyl)-5- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)- nicotinamide FAB mass spectrum (M+1) 430 <BR> <BR> <BR> <BR> <BR> 3- (2-cvano-5-imidazol-1-vlmethyl-phenoxy)-N-ethvl-N-phenyl-ben zamide FAB mass spectrum (M+1) 423 <BR> <BR> <BR> <BR> <BR> 3- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-cyclopropylmethyl- N-<BR> <BR> <BR> <BR> phenyl-benzamide FAB mass spectrum (M+1) 449 2- (2, 3-dimethoxyphenoxy)-4- (2, 4-dimethyl-imidazol-1-ylmethyl)- benzonitrile hydrochloride FAB mass spectrum (M+1) 364 4-(2-methyl-imidazol-1-ylmethyl)-2-(naphthalen-2-yloxy)-benz onitrile FAB mass spectrum (M+1) 340 EXAMPLE 11 Preparation of 3- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-ethyl-N- phenvl-benzamide trifluroacetate To a solution of 3-(2-cyano-5-imidazol-1-ylmethyl-phenoxy)- N-phenyl-benzamide (0. 075 g, 0. 19 mmol) in DMF (5. 0ml) was added NaH (0. 016 g, 60% disp., 0. 38 mmol). The solution was stirred for 10 min. and iodoethane (0. 060 mL, 0. 76 mmol) was added and the stirring continued for 18 hr. The DMF was removed in vacuo and the residue was partitioned with EtOAc and saturated NaHC03. The EtOAc layer was washed with H20, brine, and dried (MgS04). Filtration and concentration in vacuo gave the title compound after purification on preparative HPLC. FAB mass spectrum m/e 423 (M+1).
Analysis calculated for C26H22N402 * 1. 35 TFA * 0. 25 H20 : C, 59. 33 ; H, 4. 14 ; N, 9. 65 ; Found : C, 59. 33 ; H, 4. 11 ; N, 9. 73.
Using the procedure described above the following compound was prepared : <BR> <BR> <BR> 3- (2-cyano-5-imidazol-1-ylmethyl-phenoxy)-N-cyclopropylmethyl- N-<BR> <BR> <BR> <BR> <BR> <BR> phenyl-benzamide FAB mass spectrum m/e 449 (M+1).
EXAMPLE 12 Preparation of 4- (l-imidazol-1-yl-l-methyl-ethyl)-2- (naphthalen-2-yloxy)- benzonitrile hydrochloride Step A : Preparation of 4- (1-midazol-1-yl-1-methyl-ethyl)-2- (naphthalen-2-vloxv)-benzonitrile hydrochloride 4-Imidazol-1-ylmethyl-2- (naphthalen-2-yloxy)-benzonitrile hydrochloride (126 mg,. 348 mmol) was dissolved in dry THF (2 mL) and cooled to-78°C under argon. Lithium bis (trimethylsilyl) amide (1. 31 mL, 1. 31 mmol) was added dropwise over 5 min and stirred for 15 min.
Methyl iodide (. 086 mL, 1. 39 mmol) was added and the mixture stirred at -78°C for 4 h. The reaction was quenched with sat. NaHC03 solution (1 mL), warmed to RT, diluted with sat. NaHC03 solution and extracted with CH2Cl2 (3X). The combined organic layers were dried (Na2SO4), concentrated, and purified using SiO2 chromatography (0. 5-1. 0 % MeOH/CH2Cl2). The oil was dissolved in CH2Cl2 and treated with 1N HCl ethereal solution to give the title compound.
EXAMPLE 13 Preparation'of 1-f[4-iodo-3- (naphthalen-2-yloX-benzvll-1H-imidazole Step A : Preparation of 4-iodo-3- (naphthalen-2-yloxy)-benzoic acid methyl ester A mixture of 3-hydroxy-4-iodo-benzoic acid acid methyl ester (0. 505 g, 1. 82 mmol), cupric acetate (0. 330 g, 1. 82 mmol), 2- naphthylboronic acid (0. 625 g, 3. 63 mmol) and powdered 4A molecular sieves (0. 3 g) in CH2Cl2 (21 mL) was treated with triethylamine (1. 27 mL, 9. 08 mmol) and stirred at ambient temperature for 18 hr. The reaction
mixture was filtered through celite, concentrated to dryness and chromatographed (SiO2, 5-40% EtOAc : hexane) to give the title compound. FAB mass spectrum (M+1) 405.
Step B : Preparation of [4-iodo-3- (naphthalen-2-yloxy)-phenyl]- methanol 4-Iodo-3- (naphthalen-2-yloxy)-benzoic acid methyl ester (0. 10 g, 0. 25 mmol) dissolved in THF (2 mL) was treated with LiBH4 (2 M solution in THF) (0. 247 mL, 0. 495 mmol) and heated at reflux for 1. 5 hr.
The reaction mixture was cooled, added to H20 (50 mL)-concd HCl (4. 3 mL), and extracted with EtOAc (3x30 mL). The organics were combined, washed with H2O, aq saturated NaHC03 solution, brine, and dried (Na2SO4). Filtration and concentration to dryness gave the title compound which was used without purification.
Step C : Preparation of [4-iodo-3- (naphthalen-2-yloxy)-phenyl]- methyl bromide To a solution of [4-iodo-3- (naphthalen-2-yloxy)-phenyl]- methanol (0. 085 g, 0. 226 mmol) in CH2Cl2 (2 mL) at-15°C was added a cold (0°C) solution of N-bromosuccinimide (0. 120 g, 0. 68 mmol) in dimethyl sulfide (0. 060 mL, 0. 814 mmol) with stirring. The reaction mixture was allowed to warm to ambient temperature overnight, concentrated to dryness, and chromatographed (SiO2, 10% EtOAc : hexane) to give the title compound which was used without purification.
Step D : Preparation of 1- [4-Iodo-3- (naphthalen-2-yloxy)-benzyl]-1H- imidazole [4-Iodo-3- (naphthalen-2-yloxy)-phenyl]-methyl bromide (0. 226 mmol) and imidazole (0. 10 g) were dissolved in DMF (2 mL) and stirred at ambient temperature for 18 hr. The reaction mixture was purified by RP LC on a Vydac column eluting with a gradient of 0. 1% TFA/H20 : 0. 1% TFA/CH3CN (95/5 : 5/95) to give the title compound.
FAB mass spectrum (M+1) 427.
Analysis calculated for C20Hl5 IN2O 0. 35 Et20 0. 25 HCl :
C, 55. 71 ; H, 4. 10 ; N, 6. 07 ; Found : C, 55. 70 ; H, 4. 07 ; N, 5. 70.
EXAMPLE 14 Preparation of acetic acid 3- [3- (2-chloro-phenoxy)-4-cyano-benzyl]-3H- imidazol-4-ylmethyl ester hydrochloride Step A : Preparation of 1-triphenylmethyl-4- (hydroxymethyl)- imidazole To a solution of 4- (hydroxymethyl) imidazole hydrochloride (35. 0 g, 260 mmol) in 250 mL of dry DMF at room temperature was added triethylamine (90. 6 mL, 650 mmol). A white solid precipitated from the solution. Chlorotriphenylmethane (76. 1 g, 273 mmol) in 500 mL of DMF was added dropwise. The reaction mixture was stirred for 20 hours, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the title product as a white.
Step B : Preparation of 1-triphenylmethyl-4- (acetoxymethyl)- imidazole 1-Triphenylmethyl-4- (hydroxymethyl)-imidazole (260 mmol) was suspended in 500 mL of pyridine. Acetic anhydride (74 mL, 780 mmol) was added dropwise, and the reaction was stirred for 48 hours during which it became homogeneous. The solution was poured into 2 L of EtOAc, washed with water (3 x 1 L), 5% aq. HCl soln. (2 x 1 L), sat. aq.
NaHC03, and brine, then dried (Na2SO4), filtered, and concentrated in vacuo to provide the title product as a white powder which was sufficiently pure for use in the next reaction.
Step C : Preparation of 1- (4-cyano-3-fluorobenzyl)-5- (acetoxymethyl)- imidazole hydrobromide A solution of 1-triphenylmethyl-4- (acetoxymethyl) imidazole (36. 72 g, 96. 14 mmol) and 4-bromomethyl-2-fluoro-benzonitrile, as described in Example 9, Step D), (20. 67 g, 96. 14 mmol) in 250 mL of
EtOAc was stirred at 60 °C for 20 hours, during which a white precipitate formed. The reaction was cooled to room temperature and filtered to provide the solid imidazolium bromide salt. The filtrate was concentrated in vacuo to a volume of 100 mL, reheated at 60 °C for two hours, cooled to room temperature, and filtered again. The filtrate was concentrated in vacuo to a volume 40 mL, reheated at 60 °C for another two hours, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in 300 mL of methanol, and warmed to 60 °C. After two hours, the solution was reconcentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the title product hydrobromide as a white solid.
Step D : Preparation of acetic acid 3- [3- (2-chloro-phenoxy)-4-cyano- benzyll-3H-imidazol-4-ylmethyl ester hydrochloride To a solution of 1- (4-cyano-3-fluorobenzyl)-5- (acetoxymethyl)- imidazole hydrobromide (0. 29 g, 1. 06 mmol) in DMF (7. 0 mL) was added 2-chlorophenol (0. 132 mL, 1. 27 mmol) and cesium carbonate (0. 691 g, 2. 12 mmol). The mixture was heated to 55°C and stirred for 18 hr. The DMF was removed in vacuo and the residue was partitioned with EtOAc and saturated NaHC03 solution. The EtOAc layer was washed with H20, brine, and dried (MgS04). Filtration and concentration to dryness gave the title compound after chromatography (SiO2, CH2Cl2 : CH30H : NH40H/98 : 2 : 0. 2) and conversion to the hydrochloride salt.
FAB mass spectrum m/e 382 (M+1).
Analysis calculated for C20H16C1N303 * 1. 4 HCl : Found : C, 55. 50 ; H, 4. 05 ; N, 9. 71.
C, 55. 55 ; H, 4. 07 ; N, 9. 41.
EXAMPLE 15 Preparation of 2- (2-chloro-phenoxy)-4- (5-hydroxymethyl-imidazol-1- ylmethyl)-benzonitrile hydrochloride
To a solution of acetic acid 3- [3- (2-chloro-phenoxy)-4-cyano- benzyl]-3H-imidazol-4-ylmethyl ester hydrochloride (as described in Example 14) (0. 112 g, 0. 268 mmol) in THF (2. 0 mL) was added 1M NaOH (0. 536 mL). After 3. 5 hr. the reaction was partitioned between EtOAc and saturated NaHC03 solution. The EtOAc layer was washed with H20, brine, and dried (MgS04). Filtration and concentration in vacuo gave the title compound after conversion to the hydrochloride salt.
FAB mass spectrum m/e 340 (M+1).
Analysis calculated for Ci8Hi4ClN302'1. 0 HCl 0. 2 EtOAc : C, 57. 33 ; H, 4. 25 ; N, 10. 67.
Found : C, 57. 68 ; H, 3. 83 ; N, 10. 65.
EXAMPLE 16 Preparation of 4- (5-aminomethyl-imidazol-1-ylmethyl)-2- (2-chloro- phenoxv)-benzonitrile ditrifluroacetate Step A : Preparation of 4- (5-azidomethyl-imidazol-1-ylmethyl)-2- (2- chloro-phenoxy)-benzonitrile To a solution of 2- (2-chloro-phenoxy)-4- (5-hydroxymethyl- imidazol-1-ylmethyl)-benzonitrile hydrochloride, as described in Example 15, (0. 07 g, 0. 186 mmol) in CH2Cl2 (4. 0 mL), and triethylamine (0. 078 mL, 0. 558 mmol) at 0°C was added methanesulfonyl chloride (0. 016 mL, 0. 205 mmol). The cooling bath was removed and the mixture was stirred for lhr. To this solution was added sodium azide (0. 018 g, 0. 277 mmol) in DMF (1. 0 mL). After lhr. the reaction mixture was partitioned between EtOAc and saturated NaHC03 solution. The EtOAc layer was washed with H20, brine, and dried (MgS04). Filtration and concentration in vacuo gave the title product which was used in the next step without further purification.
Step B : Preparation of 4- (5-aminomethyl-imidazol-1-ylmethyl)-2- (2- chloro-phenoxv)-benzonitrile ditrifluroacetate To a solution of 4- (5-azidomethyl-imidazol-1-ylmethyl)-2- (2- chloro-phenoxy)-benzonitrile (0. 05 g, 0. 137 mmol) in CH30H (5. 0 mL)
under argon was added 10% Pd/C (0. 020 g). The mixture was placed under 1 atmosphere of hydrogen and stirred for 18 hr. The mixture was filtered and the CH30H was removed in vacuo to give the title compound after purification by preparative HPLC.
FAB mass spectrum m/e 339 (M+1).
Analysis calculated for Ci8Hi5ClN40'2. 2 HCl * 0. 1 H20 : C, 45. 49 ; H, 2. 97 ; N, 9. 47.
Found : C, 45. 43 ; H, 2. 92 ; N, 9. 50.
EXAMPLE 17 Preparation of N- {3- [4-cyano-3- (2, 3-dimethoxy-phenoxy)-benzyl]-3H- imidazol-4-ylmethyll-2-cyclohexyl-acetamide hydrochloride Step A : Preparation of 1- (4-cyano-3-fluorobenzyl)-5- (hydroxymethyl) imidazole To a solution of 1- (4-cyano-3-fluorobenzyl)-5- (acetoxymethyl)- imidazole hydrobromide (as described in Example 14, Step C) (31. 87 g, 89. 77 mmol) in 300 mL of 2 : 1 THF/water at 0 °C was added lithium hydroxide monohydrate (7. 53 g, 179 mmol). After two hours, the reaction was concentrated in vacuo to a 100 mL volume, stored at 0 °C for 30 minutes, then filtered and washed with 700 mL of cold water to provide a brown solid. This material was dried in vacuo over P205 to provide the titled product as a pale brown powder which was sufficiently pure for use in the next step without further purification.
Step B : Preparation of 4- (5-aminomethyl-imidazol-1-ylmethyl)-2- fluoro-benzonitrile dihydrochloride Following the procedures described in Example 16 but starting with 1- (4-cyano-3-fluorobenzyl)-5- (hydroxymethyl) imidazole (1. 1 g, 4. 85 mmol) the title compound was prepared.
Step C : Preparation of N- [3- (4-cyano-3-fluoro-benzyl)-3H-imidazol-- ylmethyll-2-cvclohexvl-acetamide
To a solution of 4- (5-aminomethyl-imidazol-1-ylmethyl)-2- fluoro-benzonitrile dihydrochloride (0. 17 g, 0. 651 mmol) in DMF (5. 0 mL) was added cyclohexylacetic acid (0. 11 g, 0. 782 mmol), BOP reagent (0. 433 g, 0. 977 mmol), and NMM (0. 28 mL, 2. 6 mmol). The mixture was stirred for 18 hr. The DMF was removed in vacuo and the residue was partitioned with EtOAc and saturated NaHC03 solution. The EtOAc layer was washed with H20, brine, and dried (MgS04). Filtration and concentration in vacuo gave the title compound after chromatography (silica gel, CH2Cl2 : CH30H : NH40H/ 97 : 3 : 0. 3).
Step D : Preparation of N- {3- [4-cyano-3- (2, 3-dimethoxy-phenoxy)- benzyl]-3H-imidazol-4-ylmethyl}-2-cyclohexyl-acetamide hydrochloride To a solution of N- [3- (4-cyano-3-fluoro-benzyl)-3H-imidazol- ylmethyl]-2-cyclohexyl-acetamide (0. 16 g, 0. 451 mmol) in acetonitrile (7. 0 mL) was added 2, 3-dimethoxyphenol (0. 065 mL, 0. 497 mmol), KF/A1203 (0. 2 g), and 18-crown-6 (0. 032 g). The mixture was refluxed for 20 hr.
The acetonitrile was removed in vacuo and the residue was partitioned with EtOAc and saturated NaHC03. The ethyl acetate layer was washed with H20, brine, and dried (MgS04). Removal of the ethyl acetate in vacuo gave the title compound after chromatography (silica gel, CH2Cl2 : CH30H : NH40H/98 : 2 : 0 and conversion to the hydrochloride salt.
FAB mass spectrum m/e 489 (M+1).
EXAMPLE 18 <BR> <BR> <BR> <BR> <BR> <BR> <BR> Preparation 6f2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)-imidazol-l-yl- methyll-benzonitrile trifluoroacetate Step A : Preparation of 4-Bromo-3-fluorobenzaldehvde To a well-stirred mixture of 4-bromo-3-fluorobenzyl alcohol (as described in Example 9, Step B) (10. 25 g, 0. 05 mol), TEMPO (0. 781 g, 0. 005 mol) and tetrabutylammonium fluoride (1. 39 g, 0. 005 mol) in CH2Cl2 (200 mL) and a solution of 0. 5M NaHCO3/0. 05M K2CO3 (200 mL) was added N-chlorosuccinimide (9. 35 g, 0. 07 mol). After 6 hrs, the
layers were separated, the aqueous layer back-washed with CH2Cl2 (2 x 50 mL), the organics combined and dried (Na2SO4). The solution was filtered, concentrated to half its volume, then chromatographed (silica gel, CH2Cl2) to give the title compound.
1H NMR (CDC13) 8 9. 96 (s, 1H), 7. 78 (dd, 1H, J = 2, 8 Hz), 7. 62 (dd, 1H, J = 2, 8 Hz), 7. 56 (dd, 1H, J = 2, 8 Hz).
Step B : Preparation of (4-bromo-3-fluoro-phenyl)- (4-chloro-phenyl)- methanol To a solution of 4-bromo-3-fluorobenzaldehyde (1. 6 g, 7. 88 mmol) in diethylether (20 mL) at 0°C was added 4-chlorophenyl- magnesiumbromide (lM/ether, 9. 46 mL, 9. 46 mmol) dropwise via syringe. The cooling bath was removed and after the mixture was stirred for 18 hr it was cooled to 0°C and saturated NH4C1 solution (20 mL) was added to quench the reaction. The reaction mixture was partitioned between EtOAc and saturated NaHCO3 solution. The EtOAc layer was washed with H20, brine, and dried (MgS04). Filtration and concentration in vacuo gave the title compound as a solid after chromatography (silica gel, hexane : EtOAc/ 85 : 15).
Step C : Preparation of (4-cyano-3-fluoro-phenyl)- (4-chloro-phenyl)- methanol Following the procedure described in Example 9, Step C, but starting with (4-bromo-3-fluoro-phenyl)- (4-chloro-phenyl)-methanol (2. 2 g, 6. 97 mmol), the title compound was obtained as a solid.
Step D : Preparation of 4- [ (4-chloro-phenyl)-imidazol-1-yl-methyl]-2- fluoro-benzonitrile To a solution of (4-cyano-3-fluoro-phenyl)- (4-chloro-phenyl)- methanol (2. 2 g, 8. 79 mmol) in acetonitrile (30 mL) was added CDI (4. 28 g, 8. 79 mmol) and imidazole hydrochloride (2. 75 g, 8. 79 mmol) and the mixture was heated at reflux for 3 hr. The acetonitrile was removed in vacuo and the residue was partitioned with EtOAc and saturated NaHC03 solution. The EtOAc layer was washed with H2O, brine, and
dried (MgS04). Filtration and concentration in vacuo gave the title compound.
Step E : Preparation of 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)- imidazol-l-.ethvll-benzonitrile trifluoroacetate Following the procedure described in Example 11, Step A, but starting with 4- [ (4-chloro-phenyl)-imidazol-1-yl-methyl]-2-fluoro- benzonitrile, as described in Step D, (0. 06 g, 0. 193 mmol) and 3- chlorophenol (0. 022 mL, 0. 212 mmol), the the title compound was obtained after purification by preparative HPLC.
FAB mass spectrum m/e 420 (M+1).
Analysis calculated for C23Hl5Cl2N30 1. 90 TFA * 0. 40 H20 : C, 49. 98 ; H, 2. 77 ; N, 6. 52.
Found : C, 49. 98 ; H, 2. 72 ; N, 6. 36.
EXAMPLE 19 Preparation of 2- (3-chloro-phenoxy)-4- [1- (4-chloro-phenyl)-2-hydroxy-1- imidazol1-yl-ethyl]-benzonitrile hydrochloride To a solution of 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)- imidazol-l-yl-methyl]-benzonitrile trifluoroacetate (0. 065 g, 0. 122 mmol) in acetonitrile (5 mL) was added 1M KOH (0. 5 mL) (pH = 9-10) and 37% aqueous formaldehyde (0. 14 mL) After stirring for 18hr the mixture was adjusted to pH = 3 with acetic acid, diluted with CH30H (3 mL) and purified on prep HPLC. The TFA salt was converted to the HC1 salt to obtain the title compound.
FAB mass spectrum m/e 450 (M+1).
Analysis calculated for C24Hl7Cl2N302* 0. 4 CH2C12 0. 3 H20 : C, 57. 13 ; H, 3. 75 ; N, 8. 06.
Found : C, 57. 13 ; H, 3. 82 ; N, 7. 67.
EXAMPLE 20 Preparation of 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)-hydroxy- (3H- imidazol-4-vl)-methyll-benzonitrile Step A : Preparation of (4-bromo-3-fluoro-phenyl)- (4-chlorophenyl)- methanol 4-Bromo-3-fluorobenzaldehyde (as described in Example 18, Step A) (3. 61 g, 17. 7 mmol) was dissolved in anhydrous diethyl ether (40 mL). To this solution was added a 1. OM solution of 4-chlorophenyl- magnesium bromide (21. 3 mL, 21. 3 mmol). After stirring at ambient temperature for 4hr the reaction was quenched with satd. NH4Cl and extracted with Et20. The organic layer was washed with satd NaHC03 solution, water, brine, dried (MgSO4), concentrated and purified by chromatography (SiO2, 10% EtOAc/hexane) to give the title compound.
Step B : Preparation of (4-bromo-3-fluoro-phenyl)- (4-chloro-phenyl)- methanone (4-Bromo-3-fluoro-phenyl)- (4-chloro-phenyl)-methanol (2. 26 g, 7. 16 mmol) and MnO2 (6. 22g, 70. 1 mmol) was stirred in CH2Cl2 (40 mL) for 40 hr. The solution was filtered through a celite pad and concentrated to give the title compound.
Step C : Preparation of (4-bromo-3-fluoro-phenyl)- (4-chloro-phenyl)- (1-trityl-lH-imidazol-4-yl)-methanol 4-Iodo-l-trityl-lH-imidazole (1. 39 g, 3. 18 mmol) was dissolved in'anhydrous CH2Cl2 (10 mL). To this solution was added a 3. 0M solution of ethylmagnesium bromide (1. 11 mL, 3. 34 mmol) and stirred under Ar. After 3hr, a solution of (4-bromo-3-fluoro-phenyl)- (4- chloro-phenyl)-methanone (1. OOg, 3. 18 mmol) dissolved in CH2Cl2 (5 mL) was added dropwise and the resulting solution was stirred overnight.
The reaction was quenched with satd. NH4Cl solution, diluted with satd.
NaHC03 solution to pH=8. 5, and extracted with CH2Cl2 (3X). The combined organic layers were dried (MgS04), concentrated and purified
using SiO2 chromatography (10-20% EtOAc/Hexane) to yield the title compound.
Step D : Preparation of 4- [ (4-chloro-phenyl)-hydroxy- (l-trityl-lH- <BR> <BR> <BR> imidazol-4-vl)-methvll-benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> (4-Bromo-3-fluoro-phenyl)- (4-chloro-phenyl)- (l-trityl-lH- imidazol-4-yl)-methanol (0. 360 g, 0. 578 mmol) and Zn (CN) 2 (0. 045 g, 0. 405 mmol) was stirred in anhydrous DMF (8 mL). The solution was purged with Ar for 10 min, degassed under high vacuum for 5 min, then tetrakis (triphenylphosphine) palladium (0) (0. 067 mg, 0. 057 mmol) was added and the mixture stirred overnight at 80°C under Ar. Subsequent additions of Zn (CN) 2 and tetrakis (triphenylphosphine) palladium (0) were added to drive the reaction to completion. The reaction was diluted with EtOAc and extracted with satd. NaHC03 solution, water and brine, dried (MgSO4), concentrated and purified using SiO2 chromatography (0. 5% MeOH/CH2Cl2) to yield the title compound.
Step E : Preparation of 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)- hvdroxv-(1-tritvl-lH-imidazol-4-yl)-methvll-benzonitrile 4- [ (4-Chloro-phenyl)-hydroxy- (l-trityl-lH-imidazol-4-yl)- methyl]-2-fluoro-benzonitrile (0. 337 g, 0. 591 mmol), 3-chlorophenol (0. 074 mL, 0. 709 mmol), 40% KF on alumina (0. 182 g), and 18-Crown-6 ether (0. 018 g, 0. 068 mmol) were refluxed in CH3CN for 40 hr under Ar. The reaction mixture was concentrated in vacuo, diluted with EtOAc, washed with satd. NaHC03 solution, water, brine and dried (MgS04).
Filtration and concentration gave the title compound.
Step F : Preparation of 2- (3-chloro-phenoxy)-4- [ (4-chloro-phenyl)- <BR> <BR> <BR> hydroxy- (3H-imidazol-4-yl)-methyll-benzonitrile<BR> <BR> <BR> <BR> <BR> <BR> 2- (3-Chloro-phenoxy)-4- [ (4-chloro-phenyl)-hydroxy- (l-trityl- 1H-imidazol-4-yl)-methyl]-benzonitrile (0. 269 g, 0. 396 mmol), trifluoroacetic acid (5 mL), triethylsilane (0. 050 mL, 3. 17 mmol) was stirred in CH2Cl2 (5 mL) under Ar for 2hr. The reaction mixture was concentrated in vacuo, diluted with EtOAc, washed with satd. NaHC03 solution, water, brine, dried (MgS04), concentrated and purified using
Si02 chromatography (1-1. 5% MeOH/CH2Cl2 w NH40H) to give the title compound. FAB MS (M+1) = 436 Analysis calculated for C23H1sCl2N3o2 0. 35 H20 : C, 62. 41 ; H, 3. 58 ; N, 9. 49.
Found : C, 62. 38 ; H, 3. 68 ; N, 9. 28.
EXAMPLE 21 Preparation of 2- (2, 4-dichloro-phenylsulfanyl)-4- [5- (2-morpholin-4-yl- ethvl)-imidazol-1-vlmethyll-benzonitrile Step A : Preparation of {2- [3- (4-cyano-3-fluoro-benzyl)-3H-imidazol- 4-vll-ethvll-carbamic acid tert-butyl ester To a solution of Nr-pivaloyloxymethyl-N°C-phthaloyl- histamine (J. C. Emmett, F. H. Holloway, and J. L. Turner, J. Chem.
Soc., Perkin Trans. 1, 1341, (1979)) (4. 59 g, 0. 0124 mmol) in acetonitrile (40 mL) was added 2-fluoro-4-imidazol-1-ylmethyl-benzonitrile (as described in Example 9, Step D) (2. 8 g, 0. 013 mmol) and the mixture was heated to reflux for 18 hr. A white solid precipitate formed which after cooling to 0°C was collected by filtration to obtain the quaternary salt.
This intermediate was dissolved in EtOH (100 mL), hydrazine (1. 46 mL, 0. 046 mmol) was added, and the mixture was heated at reflux for 4 hr.
A white precipitate was observed and the reaction was cooled to 25°C.
Dimethylphthalate (11. 4 mL, 0. 0699 mmol) was added and the mixture was again refluxed for 18 hr. After cooling to 25°C the precipitate was removed by filtration and washed with EtOAc. The filtrate was evaporated iç vacuo and the residue was dissolved in THF (125 mL) and H20 (25 mL). To this solution was added solid Na2CO3 (4. 0 g, 0. 0377 mmol) and BOC2O (4. 47 g, 0. 020 mmol) and the reaction was stirred for 18 hr. The THF was removed in vacuo and the mixture was partitioned with EtOAc and saturated NaHCO3. The EtOAc layer was washed with brine, dried with MgS04, and evaporated in vacuo to obtain the title product after chromatography (silica gel, CH2CI2 : MeOH : NH40H/ 97 : 3 : 0. 3.
Step B : Preparation of 4- [5- (2-amino-ethyl)-imidazol-1-ylmethyl]-2- fluoro-benzonitrile dihydrochloride A solution of {2- [3- (4-cyano-3-fluoro-benzyl)-3H-imidazol-4- yl]-ethyl}-carbamic acid tert-butyl ester (1. 0 g, 0. 0029 mmol) in EtOAc (30 mL) was cooled to-20°C and saturated with HC1 gas. The cooling bath was removed and the reaction was stirred for 2 hr. The solvent was removed in vacuo to obtain the title compound which was used without further purification.
Step C : Preparation of 2-fluoro-4- [5- (2-morpholin-4-yl-ethyl)- imidazol-1-ylmethyll-benzonitrile To a solution of 4- [5- (2-amino-ethyl)-imidazol-1-ylmethyl]-2- fluoro-benzonitrile dihydrochloride (0. 92 g, 0. 0029 mmol) in acetonitrile (150 mL) and triethylamine (3. 2 mL) was added 2-bromoethyl ether (0. 839 mL, 0. 0067 mmol) and the mixture was refluxed for 48 hr. The solvents were removed in vacuo and the residue was dissolved in EtOAc which was washed twice with 1M HCl (100 mL). The HCl layers were combined and adjusted to pH = 9 with solid Na2CO3 and extraxcted 3 times with EtOAc. The EtOAc layers were combined and dried with brine and MgS04. Removal of the EtOAc in vacuo yielded the title compound which was used as is in the next step.
Step D : Preparation of 2- (2, 4-dichloro-phenylsulfanyl)-4- [5- (2- morpholin-4-yl-ethyl)-imidazol-1-ylmethyll-benzonitrile Following the procedure described in Example 11, Step A, the title compound was prepared using 2-fluoro-4- [5- (2-morpholin-4-yl- ethyl)-imidazbl-1-ylmethyl]-benzonitrile (0. 15 g, 0. 477 mmol) and 2, 4- dichlorothiophenol (0. 086 g, 0. 477 mmol).
FAB mass spectrum m/e 473 (M+1).
Analysis calculated for C23H22C12N4OS 0. 85 TFA 0. 3 H20 : C, 51. 52 ; H, 4. 11 ; N, 9. 73.
Found : C, 51. 51 ; H, 4. 29 ; N, 9. 36.
Following the above methods, the following compound was prepared :
2- (2, 4-dichloro-phenoxy)-4- [5- (2-morpholin-4-yl-ethyl)-imidazol-l- ylmethvll-benzonitrile FAB mass spectrum m/e 457 (M+1).
Analysis calculated for C23H22C12N402 0. 4 H2O : C, 59. 34 ; H, 4. 96 ; N, 12. 04.
Found : C, 59. 32 ; H, 4. 89 ; N, 11. 75.
EXAMPLE 22 Preparation of 4- [hydroxy- (3-methyl-3H-imidazol-4-yl)-methyl]-2- (naphthalen-2-yv)-benzonitrile hydrochloride Step A : Preparation of 2-Fluoro-4-formylbenzonitrile 2-Fluoro-4-hydroxymethylbenzonitrile (Example 9, Step C) 10 g, 0, 066 mol) and triethylamine (32. 3 mL, 0. 231 mol) were dissolved in CH2Cl2 (100 mL)-DMSO (20 mL) at < 5°C. with stirring and treated dropwise with a solution of pyridineSO3 complex (31. 5 g, 0. 198 mol) in DMSO (70 mL) maintaining the reaction mixture temperature at <10°C.
The reaction mixture was stirred at 5°C for 1 hr after the addition, then at 20°C. for 1 hr, then partitioned between CH2C12 and H20. The organic layer was separated, washed well with H20, brine, and dried (Na2SO4).
Filtration and concentration gave the title compound after purification by chromatography (silica gel, hexane : EtOAc, 3 : 1).
1H NMR (CDC13) 8 10. 06 (d, 1H, J = 2 Hz), 7. 86 (dd, 1H, J = 5, 8 Hz), 7. 798 (dd, 1H, J = 1, 8 Hz), 7. 728 (dd, 1H, J = 1, 8 Hz).
Step B : Preparation of 2-fluoro-4-[hydroxy-(1-trityl-lH-imidazol- 4-vl)-methyll-benzonitrile To a solution of 4-iodo-1-trityl-lH-imidazole (5. 00 g, 11. 5 mmol) in anhydrous CH2C12 (30 mL) was added a 3. 0M solution of ethylmagnesium bromide (6. 58 mL, 19. 7 mmol) with stirring under Ar.
After 3h, the reaction mixture was cooled to-78°C and a solution of 2- fluoro-4-formyl-benzonitrile (1. 70g, 11. 5 mmol) dissolved in CH2C12 (20 mL) was added dropwise. The reaction was allowed to warm to RT over 2h, quenched with saturated NH4Cl solution, diluted with satd. NaHC03
solution to pH=8. 5, and extracted with CH2Cl2 (3X). The combined organic layers were dried (MgSO4), concentrated and purified using SiO2 chromatography (0-1% MeOH/CH2Cl2) to yield the title compound.
Step C : Preparation of acetic acid (4-cyano-3-fluoro-phenyl)- (l-trityl- 1H-imidazol-4-yl)-methyl ester 2-Fluoro-4- [hydroxy- (l-trityl-lH-imidazol-4-yl)-methyl]- benzonitrile (4. 05 g, 8. 81 mmol), pyridine (2. 14 mL, 26. 4 mmol), and acetic anhydride (12. 5 mL, 132 mmol) were stirred in anhydrous DMF (60 mL) for 3h under Ar. The reaction was concentrated in vacuo, diluted with EtOAc (250 mL), washed with H2O (2X), brine, dried (MgSO4) and concentrated to give the title compound.
Step D : Preparation of acetic acid (4-cyano-3-fluoro-phenyl)- (3- methyl-3H-imidazol-4-vl)-methvl ester Acetic acid (4-cyano-3-fluoro-phenyl)- (l-trityl-lH-imidazol- 4-yl)-methyl ester (4. 60 g, 9. 17 mmol) and dimethyl sulfate (0. 83 mL, 8. 81 mmol) were dissolved in EtOAc (20 mL) and heated at 60°C overnight under Ar. The reaction was concentrated in vacuo, diluted with MeOH (30 mL), and refluxed for lh. Concentrated in vacuo and purified using SiO2 chromatography (0. 5-4% MeOH/CH2Cl2 with NH40H) to give the title compound. <BR> <BR> <BR> <BR> <BR> <BR> <P>Step E : Preparation of 2-fluoro-4-[hydroxy-(3-methyl-3H-imidazol-<BR> <BR> <BR> <BR> <BR> 4-yl)-methvll-benzonitrile Acetic acid (4-cyano-3-fluoro-phenyl)- (3-methyl-3H- imidazol-4-yl-methyl ester (1. 26 g, 4. 59 mmol) and NaOH (5. 5 mL, 5. 5 mmol) were dissolved in THF (15 mL) and H2O (25 mL). After lh, the reaction was diluted with satd. NaHCO3 solution, extracted with CH2Cl2 (3X), dried (MgSO4) and concentrated to give the title compound.
Step F : Preparation of 4- [hydroxy- (3-methyl-3H-imidazol-4-yl)- methyll-2- (naphthalen-2-yloxy)-benzonitrile hydrochloride 2-Fluoro-4- [hydroxy- (3-methyl-3H-imidazol-4-yl)-methyl]- benzonitrile (0. 099 g, 0. 428 mmol), 2-naphthol (0. 062 g, 0. 4287 mmol) and
Cs2CO3 (0. 279 g, 0. 856 mmol) were dissolved in anhydrous DMSO (5 mL) and heated at 80°C under Ar for 1. 5h. The reaction was diluted with EtOAc, washed with satd. NaHC03 solution, water, and brine. The organic layer was dried (MgSO4), concentrated and purified using SiO2 chromatography (1-2. 5% MeOH/CH2C12). The purified compound was dissolved in CH2Cl2 and treated with 1N HCl ethereal solution to give the title compound.
FAB MS (M+1) = 365.
Analysis calculated for C22Hl7N302 1. 00 HCl 1. 60 H2O : C, 62. 81 ; H, 5. 08 ; N, 9. 99 Found : C, 62. 81 ; H, 4. 98 ; N, 10. 20.
EXAMPLE 23 Preparation of 4- [amino- (3-methyl-3H-imidazol-4-yl)-methyl]-2- (naphthalen-2-yloxv)-benzonitrile 4- [Hydroxy- (3-methyl-3H-imidazol-4-yl)-methyl]-2- (naphthalen-2-yloxy)-benzonitrile (as described in Example 22) (0. 219 g, 0. 616 mmol) was dissolved in SOCl2 (5 mL) and stirred at RT for 2h under Ar2. The solution was concentrated in vacuo and azeotroped with CH2Cl2 (3X). The solid was dissolved in CHCl3 (20 mL) and cooled to- 78°C. NH3 (g, was bubbled through the solution, and the reaction was stirred for 4h while warming to RT under Ar. The solution was concentrated in vacuo and the title compound was obtained after purification (RPLC (95/5-5/95 H2O/CH3CN with 0. 1% TFA, flow = 65 mL/min).
EXAMPLE 24 Preparation of 4-[1-hydroxy-1-(3-methyl-3H-imidazol-4-yl)-ethyl]-2- (naphthalen-2-yloxv)-benzonitrile
Step A : Preparation of 4- (3-methyl-3H-imidazole-4-carbonyl)-2- (naphthalen-2-yloxy)-benzonitrile 2-Fluoro-4- [hydroxy- (3-methyl-3H-imidazol-4-yl)-methyl]- benzonitrile (as described in Example 22, Step E) (0. 172 g, 0. 743 mmol), 2- naphthol (0. 107 g, 0. 743 mmol) and Cs2CO3 (0. 727 g, 2. 23 mmol) were dissolved in anhydrous DMF (5 mL) and heated at 60°C under Ar for 2 days. The reaction was diluted with EtOAc, washed with satd. NaHCO3 solution, water, and brine. The organic layer was dried (MgSO4), concentrated and purified using Si02 chromatography (1-2% MeOH/CH2C12) to give the title compound.
Step B: Preparation of 4-[1-hydroxy-1-(3-methyl-3H-imidazol-4-yl)- eth l-2-naphthalen-2-ylox-benzonitrile 4- (3-Methyl-3H-imidazole-4-carbonyl)-2- (naphthalen-2- yloxy)-benzonitrile (0. 109 g, 0. 308 mmol) was dissolved in anhydrous THF (5 mL) and a 3. 0 M solution of MeMgBr (0. 35 mL, 1. 05 mmol) was added and stirred at RT. The reaction was quenched with NH4C1 after lh, concentrated, diluted with EtOAc, washed with satd. NaHC03 solution, water, brine, dried (MgS04) and concentrated to give the title compound. FT/ICR MS (M+1) = 370.
Analysis calculated for C23H19N3O2 # 0.40 EtOAc # 0.05 H2O: C, 72. 85 ; H, 5. 54 ; N, 10. 36 Found : C, 72. 87 ; H, 5. 31 ; N, 10. 29.
. q- EXAMPLE 25 Preparation of 4- [1-amino-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-2- (naphthalen-2-yloxy)-benzonitrile hydrochloride 4- [1-Hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-2- (naphthalen-2-yloxy)-benzonitrile (as described in Example 24) (0. 068 g, 0. 184 mmol) was dissolved in SOC12 (5 mL) and stirred at RT for 1. 5h.
The solution was concentrated in vacuo and azeotroped with anhydrous
CH2Cl2 (3X). The solid was dissolved in CHCl3 (5 mL) and cooled to-78°C.
NH3 (g) was bubbled through the solution and stirred for 4h while warming to RT under Ar. The solution was concentrated in vacuo and purified using reverse phase chromatography (95/5-5/95 H2O/CH3CN with 0. 1% TFA, flow = 65 mL/min). The compound was converted to its free base using saturated NaHCO3 solution, extracted with CH2Cl2 (3x), dried (MgS04), filtered and treated with 1N HCl ethereal solution to give the title compound. FT/ICR MS (M+1) = 369.
Using the method described above, but substituting 3- {2-cyano-5- [1- hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-phenoxy)-N-ethyl-N- phenyl-benzamide (as described in Example 26, Step C), the following compound was prepared : 3-{2-cyano-5-[1-maino-1-(3-methyl-3H-imidazol-4-yl)-ethyl]-p henoxy}-N- ethyl-N-phenYl-benzamide.
FT/ICR MS (M+1) = 466 Analysis calculated for C28H27NsO2 0. 15 H2O : C, 71. 81 ; H, 5. 88 ; N, 14. 96 ; Found : C, 71. 86 ; H, 5. 59 ; N, 14. 78.
EXAMPLE 26 Preparation of 3- {2-cyano-5- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)- ethyl]-phenoxy}-N-ethyl-N-phenyl-benzamide Step A : Preparation of 2-Fluoro-4- (3-methyl-3H-imidazole-4- carbonyl)-benzonitrile 2-Fluoro-4- [hydroxy- (3-methyl-3H-imidazol-4-yl)-methyl]- benzonitrile (as described in Example 22, Step E) (0. 655 g, 2. 83 mmol) and MnO2 (1. 23 g, 14. 2 mmol) were stirred in CH2Cl2 (50 mL) and CH3CN (5 mL) for 72 h. The solution was filtered and concentrated to yield the title compound.
Step B : Preparation of 2-fluoro-4- [l-hydroxy-1- (3-methyl-3H-<BR> <BR> <BR> <BR> <BR> imidazol-4-vl)-ethyll-benzonitrile<BR> <BR> <BR> <BR> <BR> 2-Fluoro-4- (3-methyl-3H-imidazole-4-carbonyl)-benzonitrile (0. 603 g, 2. 63 mmol) was dissolved in anhydrous THF (30 mL). A solution of 3. 0M MeMgBr in diethyl ether (2. 55 mL, 7. 65 mmol) was added and stirred for 15 min. The reaction was quenched with NH4Cl solution, diluted with CH2Cl2 and saturated NaHC03 solution and seperated. The aqueous layer was back extracted with CH2Cl2 (3X), the combined organic layers dried (MgSO4) and concentrated to give the title compound.
Step C : Preparation of 3- {2-cyano-5- [1-hydroxy-1- (3-methyl-3H- imidazol-4-yl-phenoxv}-N-ethyl-N-phenyl-benzamide 2-Fluoro-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]- benzonitrile (0. 054 g, 0. 220 mmol), N-ethyl-3-hydroxy-N-phenyl- benzamide (0. 053 g, 0. 220 mmol) and Cs2CO3 (0. 143 g, 0. 440 mmol) were dissolved in anhydrous DMF (5 mL) and heated at 60°C under Ar for 4 days. The reaction was diluted with EtOAc, washed with satd. NaHC03 solution, water, and brine. The organic layer was dried (MgSO4), concentrated and purified using SiO2 chromatography (1-3% MeOH/CH2Cl2) to give the title compound. FAB MS (M+1) = 467 Analysis calculated for C28H26N402 0. 65 H2O : C, 70. 31 ; H, 5. 75 ; N, 11. 72 Found : C, 70. 31 ; H, 5. 65 ; N, 11. 77.
Using the procedures described above but substituting the requisite phenol in Step C, the following compounds were prepared : 4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]-2- (3-phenylamino- <BR> <BR> <BR> phenoxy)-benzonitrile<BR> <BR> <BR> <BR> <BR> FAB MS (M+l) = 411
4- [1-hydroxy-1-(3-methyl-3H-imidazol-4-yl)-ethyl]-2-(3-phenoxy -phenoxy)- benzonitrile FAB MS (M+1) = 412 <BR> <BR> <BR> <BR> <BR> <BR> 2- (3-benzoyl-phenoxy)-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl]- benzonitrile FAB MS (M+1) = 424 <BR> <BR> <BR> <BR> <BR> <BR> 2- (3-tert-butyl-phenoxy)-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-ethyl] benzonitrile <BR> <BR> <BR> <BR> FAB MS (M+l) = 376<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 2- (3-diethylamino-phenoxy)-4- [1-hydroxy-1- (3-methyl-3H-imidazol-4-yl)-<BR> <BR> <BR> <BR> <BR> ethvll-benzonitrile FAB MS (M+1) = 391 EXAMPLE 27 Preparation of 2- (5-Chloro-2-oxo-2H- [1, 2'] bipyridinyl-5'-ylmethoxy)-4- imidazol-1-ylmethyl-benzonitrile Step A : Preparation of 5-Chloro-5'-methyl-fl. 2'1bipyridinyl-2-one 5-Chloro-2-pyridinol (2. 26 g, 17. 4 mmol), 2-bromo-5- methylpyridine (3. 00 g, 17. 4 mmol), copper (0. 022 g, 0. 35 mmol) and K2CO3 (2. 66 g, 19. 2 mmol) were heated at 180°C for 16 hrs. The brown reaction mixture was cooled, diluted with EtOAc and washed with saturated NaHC03. The aqueous layer was extracted with EtOAc (2x) and the combined organic extracts were washed with brine, dried (Na2SO4) and evaporated in vacuo. The residue was chromatographed (silica gel, EtOAc : CH2Cl2 20 : 80 to 50 : 50 gradient elution) to afford the title compound as a white solid.
1H NMR (400 MHz, CDCl3) 8 8. 37 (s, 1H), 7. 96 (d, J=3. 0Hz, 1H), 7. 83 (d, J=8. 4Hz, 1H), 7. 65 (dd, J=2. 4 and 8. 2Hz, 1H), 7. 32 (dd, J=2. 9 and 9. 7 Hz, 1H), 6. 61 (d, J=9. 7Hz, 1H) and 2. 39 (s, 3H) ppm.
Step B : Preparation of 5'-Bromomethyl-5-chloro- [1, 2'] bipyridinyl -2-one A solution of 5-chloro-5'-methyl- [1, 2'] bipyridinyl-2-one (as described in Step A above) (1. 00 g, 4. 53 mmol), N-bromosuccinimide (0. 81 g, 4. 53 mmol) and AIBN (0. 030 g, 0. 18 mmol) in CC14 (40mL) was heated at reflux for 2 hrs. The solids were filtered and the filtrate collected. The solvent was evaporated in vacuo and the residue chromatographed (silica gel, EtOAc : CH2Cl2 25 : 75 to 50 : 50 gradient elution) to afford the title bromide.
1H NMR (400 MHz, CDCl3) 8 8. 55 (s, 1H), 8. 04 ( d, J= 2. 9 Hz, 1H), 8. 01 (d, J=8. 4Hz, 1H), 7. 88 (dd, J=2. 4 and 8. 6Hz, 1H), 7. 34 (dd, J= 2. 9 and 9. 8Hz, 1H), 6. 61 (d, J=9. 9Hz, 1H) and 4. 51 (s, 2H) ppm.
Step C : Preparation of 2- (5-Chloro-2-oxo-2H- [1, 2'] bipyridinyl-5'- ylmethoxv)-4-imidazol-1-vlmethyl-benzonitrile Cesium carbonate (0. 123 g, 0. 376 mmol) was added to a solution of 2-hydroxy-4-imidazol-1-ylmethyl-benzonitrile (as described in Example 4, Step F) (0. 050 g, 0. 25 mmol) and 5'-bromomethyl-5-chloro- [1, 2'] bipyridinyl-2-one (Step H) (0. 079 g, 0. 263 mmol) in anhydrous DMF (5 mL) and stirred at ambient temperature overnight. The reaction mixture was partitioned between EtOAc and aqueous saturated NaHC03 solution, the organic layer separated, washed with H20, brine and dried (MgSO4). Filtration and concentration to dryness gave the title compound after chromatography (silica gel, 1-4% CH30H/CH2Cl2).
FAB MS 418 (M+1).
EXAMPLE 28 Preparation of 4-Imidazol-1-ylmethyl-2- [2- (2-oxo-2H-pyridin-1-yl)- phenoxvl-benzonitrile
Step A : Preparation of 2- (2-oxo-2H-pyridin-1-yl)-anisole 2-Iodoanisole (1. 30 mL, 0. 01 mol), 2-hydroxypyridine (0. 95 g, 0. 01 mol), anhydrous K2CO3 (2. 76 g, 0. 02 mol) and copper powder (0. 0636 g, 0. 001 mol) were combined and heated at 200°C. for 2 hr. The reaction mixture was cooled, EtOAc added, and filtered. The filtrate was washed with H20, aqueous saturated NaHC03 solution, brine, and dried (Na2SO4). Filtration and concentration gave the title compound after chromatography (silica gel, 2% CH30H, CH2Cl2).
1H NMR (CDC13) 8 7. 36-7. 44 (m, 2H), 7. 25-7. 29 (m, 1H), 7. 18-7. 22 (m, 1H), 7. 03-7. 08 (m, 2H), 6. 65 (d, 1H, J = 10 Hz), 6. 195 (td, 1H, J = 1, 7 Hz), 3. 82 (s, 3H).
Step B : Preparation of 2- (2-Oxo-2H-pyridin-1-yl)-phenol Sodium ethanethiol (0. 108 g, 1. 29 mmol) was added to a solution of 2- (2-oxo-2H-pyridin-1-yl)-anisole ( 0. 100 g, 0. 497 mmol) in DMF (2 mL), and the reaction mixture was heated at 100°C. for 3 hr. The reaction mixture was partitioned between CHC13 and saturated aqueous ammonium chloride and treated with 8N HCl (pH = 1). The organic layer was separated, washed with H20, brine, dried (Na2SO4), filtered, concentrated, and taken up in EtOAc, then extracted with 2% NaOH solution. The aqueous basic layer was acidified with 10% HCl solution, then extracted with EtOAc, the organic layer washed with brine, dried (Na2S04), filtered, and concentrated to give the desired product.
Step C : Preparation of 4-Imidazol-1-ylmethyl-2- [2- (2-oxo-2H- pyridin-1-yl)-phenoxyl-benzonitrile 2-Fluoro-4-imidazol-1-ylmethyl-benzonitrile (as described in Example 9, Step E) (0. 0276 g, 0. 137 mmol), 2- (2-oxo-2H-pyridin-1-yl)- phenol (0. 0257 g, 0. 137 mmol) and cesium carbonate (0. 089 g, 0. 274 mmol) were combined in DMF (1. 2 mL) and heated at 70°C. for 18 hr.
The title compound was obtained after RP HPLC on aWaters Prep Pak column eluting with a 0. 1% TFA/H2O : 0. 1% TFA/CH3CN gradient followed by conversion to the free base.
FAB MS 369 (M+1).
Analysis calculated for C22H16N402 0. 3 Et2O : C, 71. 33 ; H, 4. 90 ; N, 14. 34.
Found : C, 71. 36 ; H, 4. 83 ; N, 14. 31.
Using the procedures described above, but using the appropriate iodoanisole in Step C, the following compound is prepared : <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 4-Imidazol-1-ylmethYl-2-f3-(2-oxo-2H-pYridin-1-el)-phenoxYl- benzonitrile FAB MS 369 (M+1).
EXAMPLE 29 In vitro inhibition of ras farnesyl transferase Assays of farnesyl-protein transferase. Partially purified bovine FPTase and Ras peptides (Ras-CVLS, Ras-CVIM and Ras-CAIL (SEQ. ID. NO. : 12) were prepared as described by Schaber et al., J. Biol.
Chem. 265 : 14701-14704 (1990), Pompliano, et al., Biochemistrv 31 : 3800 (1992) and Gibbs et al., PNAS U. S. A. 86 : 6630-6634 (1989), respectively.
Bovine FPTase was assayed in a volume of 100 gl containing 100 mM N- (2-hydroxy ethyl) piperazine-N'- (2-ethane sulfonic acid) (HEPES), pH 7. 4, 5 mM MgCl2, 5 mM dithiothreitol (DTT), 100 mM [3H]-farnesyl diphosphate ( [3H]-FPP ; 740 CBq/mmol, New England Nuclear), 650 nM Ras-CVLS and 10, ug/ml FPTase at 31°C for 60 min. Reactions were initiated with FPTase and stopped with 1 ml of 1. 0 M HCL in ethanol.
Precipitates were collected onto filter-mats using a TomTec Mach II cell harvestor, washed with 100% ethanol, dried and counted in an LKB ß- plate countet. The assay was linear with respect to both substrates, FPTase levels and time ; less than 10% of the [3H]-FPP was utilized during the reaction period. Purified compounds were dissolved in 100% dimethyl sulfoxide (DMSO) and were diluted 20-fold into the assay.
Percentage inhibition is measured by the amount of incorporation of radioactivity in the presence of the test compound when compared to the amount of incorporation in the absence of the test compound.
Human FPTase was prepared as described by Omer et al., Biochemistrv 32 : 5167-5176 (1993). Human FPTase activity was assayed
as described above with the exception that 0. 1% (w/v) polyethylene glycol 20, 000, 10, uM ZnCl2 and 100 nM Ras-CVIM were added to the reaction mixture. Reactions were performed for 30 min., stopped with 100 gel of 30% (v/v) trichloroacetic acid (TCA) in ethanol and processed as described above for the bovine enzyme.
The compounds of the instant invention described in the above Examples were tested for inhibitory activity against human FPTase by the assay described above and were found to have IC50 of <50 RM.
EXAMPLE 30 ModifiedIn vitro GGTase inhibition asssav The modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature. A typical reaction contains (in a final volume of 50 RL) : [3H] geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7. 5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgC12, 10, ut ZnCl2, 0. 1% PEG (15-20, 000), 2 mM dithiothreitol, and geranylgeranyl- protein transferase type I (GGTase). The GGTase-type I enzyme employed in the assay is prepared as described in U. S. Pat. No.
5, 470, 832, incorporated by reference. The Ras peptide is derived from the K4B-Ras protein and has the following sequence : biotinyl- GKKKKKKSKTKCVIM (single amino acid code) (SEQ. ID. NO. : 13).
Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200, uL of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0. 2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0. 5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 25-fold into the enzyme assay mixture. IC5Q values are determined with Ras peptide near KM
concentrations. Enzyme and nonsaturating substrate conditions for inhibitor IC5p determinations are as follows : 75 pM GGTase-I, 1. 6 , Ras peptide, 100 nM geranylgeranyl diphosphate.
EXAMPLE 31 Cell-basedin vitro ras prenylation assay The cell lines used in this assay consist of either Ratl or NIH3T3 cells transformed by either viral H-ras ; an N-ras chimeric gene in which the C-terminal hypervariable region of viral-H-ras was substituted with the corresponding region from the N-ras gene ; or ras-CVLL, a viral-H-ras mutant in which the C-terminal exon encodes leucine instead of serine, making the encoded protein a substrate for geranylgeranylation by GGTase-I. The assay can also be performed using cell lines transformed with human H-ras, N-ras or K4B-ras. The assay is performed essentially as described in DeClue, J. E. et al., Cancer Research 51 : 712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (s) (final concentration of solvent, methanol or dimethyl sulfoxide, is 0. 1%). After 4 hours at 37°C, the cells are labelled in 3 ml methionine-free DMEM supplemented with 10% regular DMEM, 2% fetal bovine serum, 400, uni [35S] methionine (1000 Ci/mmol) and test compound (s). Cells treated with lovastatin, a compound that blocks Ras processing in cells by inhibiting the rate- limiting step in the isoprenoid biosynthetic pathway (Hancock, J. F. et al.
Cell, 57 : 1167 (1989) ; DeClue, J. E. et al. Cancer Res., 51 : 712 (1991) ; Sinensky, M. et al. J. Biol. Chem., 265 : 19937 (1990)), serve as a positive control in this assay. After an additional 20 hours, the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7. 5/5 mM MgCl2/1mM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0. 5 mM PMSF) and the lysates cleared by centrifugation at 100, 000 x g for 45 min.
Alternatively, four hours after the additon of the labelling media, the media is removed, the cells washed, and 3 ml of media containing the same or a different test compound added. Following an additional 16 hour incubation, the lysis is carried out as above. Aliquots of lysates containing equal numbers of acid-precipitable counts are bought to 1 ml
with IP buffer (lysis buffer lacking DTT) and immunoprecipitated with the ras-specific monoclonal antibody Y13-259 (Furth, M. E. et al., J.
Virol. 43 : 294-304, (1982)). Following a 2 hour antibody incubation at 4°C, 200 gel of a 25% suspension of protein A-Sepharose coated with rabbit anti rat IgG is added for 45 min. The immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7. 5/1 mM EDTA/1% Triton X- 100. 0. 5% deoxycholate/0. 1%/SDS/0. 1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to prenylated and nonprenylated Ras proteins are compared to determine the percent inhibition of prenyl transfer to protein.
EXAMPLE 32 Cell-basedin vitro anchorage independent growth assay (SALSA) SALSA (Soft Agar-Like Surrogate Assay) measures the inhibition of anchorage-independent growth by prenyl-transferase inhibitors. Only transformed cells are able to grow anchorage- independently in the SALSA format. Additionally, cells growing in the SALSA format grow in clumps, resembling the colonies formed in soft agar. SALSA may been used to measure the growth inhibition by prenyl-transferase inhibitors in a variety of transformed cell lines, including Ratl fibroblasts transformed with viral-H-ras (H-ras/ratl), as well as a panel of human tumor cell lines (HTL's).
SALSA is performed in 96-well plates that are coated with a thin film of the polymer, PolyHEMA (Poly (2-hydroxyethyl methacrylate)), which prevents cells from attaching to the plate. Ratl fibroblast cells transformed with v-Ha-ras (this cell line has been deposited in the ATCC on August 19, 1997 under the terms of the Budapest convention and has been given a-designation of ATCC CRL 12387) are seeded at 5000 cells/well, grown for 4 hr, then vehicle or half- log dilutions of test compound (in either an 8 or 12 point titration) are added. The cells are then grown for 6 days at 37 degrees, without changing the growth media or adding fresh compound. At day 6, cell
growth is assessed via a colorimetric assay that measures the cleavage of the tetrazolium dye, MTT, to an insoluble purple formazan, a reaction dependent upon mitochondrial dehydrogenases. At day 6, the cells are incubated for 4 hr with 0. 5 mg/ml MTT, and then SDS is added to 9% w/v to lyse the cells and solubilize the insoluble MTT-formazan. The amount of MTT metabolism is quantitated via spectrophotometric detection at 570 nM. Dose-inhibition curves and IC50's are determined.
EXAMPLE 33 Construction of SEAP reporter plasmid pDSE100 The SEAP reporter plasmid, pDSE100 was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI. The SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA). The plasmid pCMV- RE-AKI was constructed by Deborah Jones (Merck) and contains 5 sequential copies of the'dyad symmetry response element'cloned upstream of a'CAT-TATA'sequence derived from the cytomegalovirus immediate early promoter. The plasmid also contains a bovine growth hormone poly-A sequence.
The plasmid, pDSE100 was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and HpaI. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The'blunt ended'DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl- II and the ends filled in with Klenow DNA Polymerase I. The SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP
coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
Cloning of a Mvristylated viral-H-ras expression plasmid A DNA fragment containing viral-H-ras can be PCRed from plasmid "H-1" (Ellis R. et al. J. Virol. 36, 408, 1980) using the following oligos.
Sense strand : 5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAA<BR> GGACCCCAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTG G 3'. (SEQ. ID. NO. : 14) Antisense : 5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3'.
(SEQ. ID. NO. : 15) A sequence encoding the first 15 aminoacids of the v-src gene, containing a myristylation site, is incorporated into the sense strand oligo. The sense strand oligo also optimizes the'Kozak'translation initiation sequence immediately 5'to the ATG start site. To prevent prenylation at the viral-ras C-terminus, cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo. The PCR primer oligos introduce an XhoI site at the 5' end and a XbaI site at the 3'end. The XhoI-XbaI fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with XhoI and XbaI. This results in a plasmid in which the recombinant myr- viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of a viral-H-ras-CVLL expression plasmid A viral-H-ras clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid"H-1" (Ellis R. et al. J. Virol.
36, 408, 1980) by PCR using the following oligos.
Sense strand : 5'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3' (SEQ. ID. NO. : 16) Antisense strand : 5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ. ID. NO. : 17) The sense strand oligo optimizes the'Kozak'sequence and adds an XhoI site. The antisense strand mutates serine 189 to leucine and adds an XbaI site. The PCR fragment can be trimmed with XhoI and XbaI and ligated into the XhoI-XbaI cut vector pCI (Promega). This results in a plasmid in which the mutated viral-H-ras-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of c-H-ras-Leu61 expression plasmid The human c-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand : 5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3' (SEQ. ID. NO. : 18) Antisense strand : 5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3' (SEQ. ID. NO. : 19) The primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized'Kozak'translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
After trimming the ends of the PCR product with EcoRI and Sal I, the c- H-ras fragment can be ligated ligated into an EcoRI-Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide :
5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ. ID. NO. : 20) After selection and sequencing for the correct nucleotide substitution, the mutated c-H-ras-Leu61 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from the CMV promoter of the pCI vector.
Cloning of a c-N-ras-Val-12 expression plasmid The human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand : 5'-GAGAGAATTC GC CAC CATGACTGAGTACAAACTGGTGG-3' (SEQ. ID. NO. : 21) Antisense strand : 5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3' (SEQ. ID. NO. : 22) The primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized'Kozak'translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end. After trimm&g the ends of the PCR product with EcoRI and Sal I, the c- N-ras fragment can be ligated into an EcoRI-Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide : 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ. ID. NO. : 23)
After selection and sequencing for the correct nucleotide substitution, the mutated c-N-ras-Val-12 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c-N-ras-Val-12 from the CMV promoter of the pCI vector.
Cloning of a c-K-ras-Val-12 expression plasmid The human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand : 5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3' (SEQ. ID. NO. : 24) Antisense strand : 5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3' (SEQ. ID. NO. : 25) The primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized'Kozak'translation start sequence, a KpnI site at the N-terminus and a Sal I stite at the C-terminal end.
After trimming the ends of the PCR product with Kpn I and Sal I, the c-K-ras fragment can be ligated into a KpnI-Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of cysteine-12 to a valine can be accomplished* using the manufacturer's protocols and the following oligonucleotide : 5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ. ID. NO. : 26) After selection and sequencing for the correct nucleotide substitution, the mutated c-K-ras-Val-12 can be excised from the pAlter-1 vector, using KpnI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with KpnI and Sal I. The new
recombinant plasmid will constitutively transcribe c-K-ras-Val-12 from the CMV promoter of the pCI vector.
SEAP assay Human C33A cells (human epitheial carcenoma-ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf serum + 1X Pen/Strep + 1X glutamine + 1X NEAA. Cells are grown at 37°C in a 5% C02 atmosphere until they reach 50-80% of conflunecy.
The transient transfection is performed by the CaP04 method (Sambrook et al., 1989). Thus, expression plasmids for H-ras, N- ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE- SEAP reporter construct. For 10cm plates 600) il of CaCl2-DNA solution is added dropwise while vortexing to 600gui of 2X HBS buffer to give 1. 2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red ; Gibco cat. # 31053-028) + 0. 5% charcoal stripped calf serum + 1X (Pen/Strep, Glutamine and nonessential aminoacids). The CaP04-DNA precipitate is added dropwise to the cells and the plate rocked gently to distribute. DNA uptake is allowed to proceed for 5-6 hrs at 37°C under a 5% C02 atmosphere.
Following the DNA incubation period, the cells are washed with PBS and trypsinized with lml of 0. 05% trypsin. The 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM + 0. 2% charcoal stripped calf serum + 1X (Pen/Strep, Glutamine and NEAA).
Transfectedcells are plated in a 96 well microtiter plate (1001/well) to which drug, diluted in media, has already been added in a volume of 100111. The final volume per well is 200111 with each drug concentration repeated in triplicate over a range of half-log steps.
Incubation of cells and drugs is for 36 hrs at 37° under C02.
At the end of the incubation period, cells are examined microscopically for evidence of cell distress. Next, lOOfil of media containing the secreted alkaline phosphatase is removed from each well and transferred to a microtube array for heat treatment at 65°C for 1 hr to inactivate
endogenous alkaline phosphatases (but not the heat stable secreted phosphatase).
The heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD@ (Tropix, Bedford, Mass.). A volume of 50 gel media is combinRased with 200 gel of CSPD cocktail and incubated for 60 minutes at room temperature. Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter construct stimulated by the transiently expressed protein.
DNA-CaPOprecipitate for 10cm. plate of cells Ras expression plasmid (1µg/µl) 10µl DSE-SEAP Plasmid (1µg/µl) 2µl Sheared Calf Thymus DNA (1µg/µl) 8µl 2M CaCl2 X<BR> dH20 506ut 2X HBS Buffer 280mM NaCI lOmM KCl 1. 5mM Na2HP04 2H20 12mM dextrose 50mM HEPES Final pH = 7. 05 Luminesence Buffer (26ml) Assay Buffer 20ml Emerald ReagentTM (Tropix) 2. 5ml 100mM homoarginine 2. 5ml CSPD Reagent@ (Tropix) 1. Oml Assay Buffer
Add 0. 05M Na2CO3 to 0. 05M NaHC03 to obtain pH 9. 5. Make 1mM in MgCl2 EXAMPLE 34 In vivo tumor growth inhibition assay (nude mouse) In vivo efficacy as an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art. Examples of such in vivo efficacy studies are described by N. E. Kohl et al. (Nature Medicine, 1 : 792-797 (1995)) and N. E. Kohl et al. (Proc. Nat. Acad. Sci.
U. S. A., 91 : 9141-9145 (1994)).
Rodent fibroblasts transformed with oncogenically mutated <BR> <BR> human Ha-ras or Ki-ras (106 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0. The mice in each oncogene group are randomly assigned to a vehicle, compound or combination treatment group.
Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment. Alternatively, the farnesyl-protein transferase inhibitor may be administered by a continuous infusion pump. Compound, compound combination or vehicle is delivered in a total volume of 0. 1 ml. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0. 5-1. 0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.