VOLKMANN KORI SHALLYN (US)
BRUMM DUANE (US)
STILES CARYN BESS (US)
PATTERSON JOHN BRUCE (US)
VOLKMANN KORI SHALLYN (US)
BRUMM DUANE (US)
STILES CARYN BESS (US)
LEE ET AL.: "IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response", GENES DEV., vol. 16, no. 4, 15 February 2002 (2002-02-15), pages 452 - 466, XP002458271
NIWA ET AL.: "Genome-scale approaches for discovering novel nonconventional splicing substrates of the Ire1 nuclease", GENOME BIOL. 2005, vol. 6, no. 1, 22 December 2004 (2004-12-22), pages R3, XP021012935
GONZALEZ ET AL.: "Mechanism of non-spliceosomal mRNA splicing in the unfolded protein response pathway", EMBO J., vol. 18, no. 11, 1 June 1999 (1999-06-01), pages 3119 - 3132, XP003018798
RIZZO ET AL.: "Chimeric RNA-DNA molecular beacon assay for ribonuclease H activity", MOL. CELL PROBES, vol. 16, no. 4, August 2002 (2002-08-01), pages 277 - 283, XP002436558
TIRASOPHON ET AL.: "The endoribonuclease activity of mammalian IRE1 autoregulates its mRNA and is required for the unfolded protein response", GENES DEV., vol. 14, no. 21, 1 November 2000 (2000-11-01), pages 2725 - 2736, XP003018799
LI ET AL.: "Targeting degradation of RNA by RNase H using DNA hairpins", BIOCHEMISTRY, vol. 42, no. 37, 23 September 2003 (2003-09-23), pages 10945 - 10954, XP003018800
See also references of EP 1943262A4
CLAIMS
1. A substrate for IRE-lα, comprising an oligonucleotide molecule which consists of (i) an RNA loop comprising a cleavage site for IRE-lα; and (ii) a nucleotide stem consisting of 4, 5, 6, 7, 8, 9, or 10 nucleotide base pairs.
2. The substrate of claim 1 further comprising a donor moiety and an acceptor moiety which exhibit a detectable resonance energy transfer when the donor moiety is excited, wherein the donor moiety is conjugated to one of the 5 ' or 3' ends of the oligonucleotide molecule and the acceptor moiety is conjugated to the other of the 5' or 3' ends of the oligonucleotide molecule.
3. The substrate of claim 1 further comprising a detectable label.
4. The substrate of claim 1 wherein the RNA loop comprises the nucleotide sequence 5'-CCGCAGC-3'.
5. The substrate of claim 1 which comprises SEQ ID NO: 1 or SEQ ID NO:3.
6. The substrate of claim 1 wherein the nucleotide stem comprises DNA.
7. The substrate of claim 1 wherein the nucleotide stem comprises RNA.
8. The substrate of claim 1 wherein the nucleotide stem comprises a nucleotide analog.
9. The substrate of claim 2 wherein at least one of the donor and acceptor moieties is a fluorescent protein.
10. The substrate of claim 2 wherein each of the donor and the acceptor moieties is a fluorescent protein.
11. The substrate of claim 2 wherein the acceptor moiety is a luminescent moiety.
12. The substrate of claim 11 wherein the luminescent moiety is selected from the group consisting of a luminescent protein and a lanthanide chelate.
13. The substrate of claim 2 wherein the acceptor moiety is selected from the group consisting of a coumarin, a xanthene, a fluorescein, a fluorescent protein, a circularly permuted fluorescent protein, a rhodol, a rhodamine, a resorafin, a cyanine, a difluoroboradiazaindacene, a phthalocyanine, an indigo, a benzoquinone, an anthraquinone, an azo compound, a nitro compound, an indoaniline, a diphenylmethane, a triphenylmethane, and a zwitterionic azopyridinium compound.
14. The substrate of claim 2 wherein the donor moiety is selected from the group consisting of a coumarin, a xanthene, a rhodol, a rhodamines, a resorufin, a cyanine dye, a bimane, an acridine, an isoindole, a dansyl dye, an aminophthalic hydrazide, an aminophthalimide, an aminonaphthalimide, an aminobenzofuran, an aminoquinoline, a
■ dicyanohydroquinone, a semiconductor fluorescent nanocrystal, a fluorescent protein, a circularly permuted fluorescent protein, and a fluorescent lanthanide chelate.
15. The substrate of claim 2 wherein the donor moiety is a fluorescent protein selected from the group consisting of a green fluorescent protein (GFP), a red fluorescent protein (RFP), a yellow fluorescent protein (YFP), a blue fluorescent protein (BFP), and a cyan fluorescent protein (CFP).
16. The substrate of claim 2 wherein the acceptor moiety is a luminescent protein.
17. The substrate of claim 16 wherein the luminescent protein is selected from the group consisting of an aequorin, an obelin, a lux protein, a luciferase protein, a phycobiliprotein, a pholasin, and a green fluorescent protein.
18. A mutant substrate for IRE-lα comprising an oligonucleotide molecule which consists of (i) an RNA loop with a mutant cleavage site for IRE-lα; and (ii) a nucleotide stem consisting of 4, 5, 6, 7, 8, 9, or 10 nucleotide base pairs.
19. The mutant substrate of claim 18 wherein the RNA loop comprises the nucleotide sequence 5'-CCCCAGC-3'.
20. The mutant substrate of claim 18 further comprising a donor moiety and an acceptor moiety which exhibit a detectable resonance energy transfer when the donor moiety is excited, wherein the donor moiety is conjugated to one of the 5' or 3' ends of the oligonucleotide molecule and the acceptor moiety is conjugated to the other of the 5' or 3' ends of the oligonucleotide molecule.
21. The mutant substrate of claim 18 further comprising a detectable label.
22. A method for detecting RNase activity of an IRE- 1 α polypeptide, comprising:
(1) contacting the IRE-lα polypeptide with a substrate, wherein the substrate comprises:
(a) an oligonucleotide molecule consisting of
(i) an RNA loop comprising a cleavage site for IRE-lα; (ii) a nucleotide stem consisting of 4, 5, 6, 7, 8, 9, or 10 ribonucleotide base pairs; and
(b) a donor moiety and an acceptor moiety which exhibit a detectable resonance energy transfer when the donor moiety is excited, wherein the donor moiety is conjugated to one of the 5' or 3' ends of the oligonucleotide molecule and the acceptor moiety is conjugated to the other of the 5' or 3' ends of the oligonucleotide molecule; and
(2) detecting resonance energy transfer between the donor and acceptor moieties, whereby a change in the resonance energy transfer indicates RNase activity of the IRE-lα polypeptide.
23. The method of claim 22 further comprising detecting the resonance energy transfer in the presence of a test compound.
24. The method of claim 22 wherein the IRE-lα polypeptide and the substrate are in a cell-free system.
25. The method of claim 22 wherein the change in resonance energy is detected by determining a property selected from the group consisting of a molar extinction coefficient at an excitation wavelength, a quantum efficiency, an excitation spectrum, an emission spectrum, an excitation wavelength maximum, an emission wavelength maximum, a ratio of excitation amplitudes at two wavelengths, a ratio of emission amplitudes at two wavelengths, an excited state lifetime, anisotropy, a polarization of emitted light, resonance energy transfer, and a quenching of emission at a wavelength.
26. The method of claim 22 wherein the IRE-lα polypeptide is a full-length IRE-lα protein.
27. The method of claim 22 wherein the IRE-lα polypeptide comprises a kinase domain. |
IRE-lα SUBSTRATES
FIELD OF THE INVENTION
[01] The invention relates to substrates for IRE-lα.
BACKGROUND OF THE INVENTION
[02] The unfolded protein response (UPR) is an intracellular signaling pathway which responds to the accumulation of misfolded proteins in the endoplasmic reticulum (ER) lumen. The UPR is increasingly recognized as a significant factor in many human diseases. Up-regulation of the UPR is thought to be important for tumor survival and B- cell autoimmunity, whereas UPR suppression is implicated in diseases such as Alzheimer's disease and type II diabetes.
[03] IRE-lα is a transmembrane signaling molecule with an N-terminal luminal domain inside the ER and a C-terminal kinase and RNase domain in the cytosol. The N-terminal luminal domain complexes with GRP78. IRE-lα is an ER stress sensor. When activated, IRE-lα induces transcription of endoplasmic reticulum stress response genes, such as GRP78 and GRP94, by activating the transcription factor XBP-I via specific RNA splicing.
[04] Antagonists of IRE-lα are useful for treating B-cell autoimmune diseases and cancer. Agonists of IRE-lα are useful for treating Alzheimer's disease and type II diabetes. It would, therefore, be useful to have methods of screening for IRE-lα agonist and antagonist molecules.
BRIEF DESCRIPTION OF THE FIGURES
[05] FIG. 1. Spyro ruby-stained polyacrylamide gel showing a purified preparation of IRE-I α monomers and dimers.
[06] FIG. 2. Drawings of IRE-lα substrates. 33 base wild-type substrate, 5'- GGGUCUGCUGAGUCC-GCAGCACUCAGAAGGCCC-3' (SEQ ID NO:1); 33 base mutant substrate 5'-GGGUCUGCUGAGUCCCCAGCACUCAGAAG-GCCC-S' (SEQ ID NO:2); 15 base wild-type substrate with 5' FAM and 3' BHQ-1™ moieties (5'- C AGUCCGC AGCACUG-3', SEQ ID NO:3); 15 base mutant substrate with 5' FAM and 3' BHQ-1™ moieties (5'-CAGUCCCCAGCACUG-S', SEQ ID NO:4).
[07] FIGS. 3A-C. Photographs of polyacrylamide gels showing cleavage of an IRE-lα substrate. FIG. 3A, radiant red stain; FIG. 3B, signal from cleaved 15 base FAM substrate. FIG. 3C, radiant red stain.
[08] FIG. 4. Graph showing time course of IRE- lα RNase activity at 3 O 0 C.
[09] , FIG. 5. Bar graph showing results of a competition assay to determine the activity of a 15 base substrate (SEQ ID NO:3) in the presence of a 33 base substrate (SEQ ID NO:1).
[10] FIG. 6. Graph showing results of a high-throughput assay of IRE- 1 α RNase activity
DETAILED DESCRIPTION OF THE INVENTION
[11] The invention provides, inter alia, minimal substrates for IRE-lα which can be used in screening assays of the invention to identify agonists and antagonists of IRE-lα RNase activity, particularly human IRE-lα RNase activity. The invention also provides mutant substrates which IRE-lα does not cleave and which can be used as controls in the screening assays.
[12] IRE-lα substrates according to the invention are oligonucleotide molecules having an RNA loop and a nucleotide stem. The RNA loop contains a cleavage site for IRE-lα, preferably human IRE-lα. In one embodiment, the RNA loop comprises the sequence 5'- CCGCAGC-3' (wild-type). Other useful RNA loops are those in which one or more nucleotides is altered with respect to the wild-type sequence, e.g., 5'-CCGAAGC-S', 5'- GCGAAGC-3', 5'-ACGAAGC-3', 5'-UCGAAGC-3', 5'-CCGAAGC-3', 5'-CGGAAGC- 3', 5'-CAGAAGC-3', 5'-CUGAAGC-3', 5'-CCGAAGC-3', 5'-CCAAAGC-3', 5'- CCUAAGC-3', 5'-CCGAAGC-3', 5'-CCGGAGC-3', 5'-CCGUAGC-3', 5'-CCGCAGC- 3', 5'-CCGAAGC-3', 5'-CCGAGGC-3', 5'-CCGAUGC-3' 5 5'-CCGACGC-3', 5'- CCGAAGC-3', 5'-CCGAAAC-S', 5'-CCGAAGC-3', 5'-CCGAAGA-3', and 5'- CCGAAGU-3'. The RNA loop can contain one or more altered nucleotides with respect to the wild-type sequence. If desired, a mutation can be introduced into the RNA loop to form a mutant substrate which IRE-lα cannot cleave. In one embodiment, the RNA loop of the mutant substrate comprises the sequence 5'-CCCCAGC-3'.
[13] Nucleotides in the nucleotide stem can be deoxyribonucleotides, ribonucleotides, and/or nucleotide analogs, such as DNA or phosphorothioates. The nucleotide stem comprises at least 4 and as many as 30 or more nucleotide base pairs. Preferably the nucleotide stem consists of 4, 5, 6, 7, 8, 9, or 10 nucleotide base pairs. The nucleotide stem can have one or more mismatches (bulges) and can have an overhang. The particular nucleotides in the stem are not important as long as at least 4 nucleotide base pairs are formed to stabilize the RNA loop. The basepairs need not be consecutive and may contain one,
two, or more mismatches, as long as a stem is formed and one, two, or three basepairs are formed next to the loop.
[14] IRE-lα substrates of the invention can comprise a donor moiety and an acceptor moiety, which permits IRE-lα RNase activity to be detected using resonance energy transfer. The donor moiety is conjugated to one of the 5' or 3' ends of the oligonucleotide molecule, and the acceptor moiety is conjugated to the other of the 5' or 3' ends of the oligonucleotide molecule. In the absence of RNase activity, the donor moiety and the acceptor moiety are in sufficient proximity to each other to exhibit a detectable resonance energy transfer when the donor is excited. The RNase activity of IRE-lα cleaves the substrate, which changes the distance or relative orientation between the donor and acceptor moieties and alters the resonance energy transfer between the moieties. The degree of alteration reflects RNase activity and can be detected qualitatively or quantitatively.
Donor and acceptor moieties
[15] As used here, a "donor moiety" is a fluorophore or a luminescent moiety. The absorption spectrum of the "acceptor moiety" overlaps the emission spectrum of the donor moiety. The acceptor moiety does not need to be fluorescent and can be a fluorophore, chromophore, or quencher. In some embodiments both the donor and acceptor moieties are fluorescent proteins. In other embodiments both the donor and acceptor moieties are luminescent moieties. In yet other embodiments, either one of the donor or acceptor moieties can be a fluorescent protein while the other moiety is a luminescent moiety. In other embodiments, the acceptor moiety is a "quencher moiety."
[16] When both the donor and acceptor moieties are fluorophores, resonance energy transfer is detected as "fluorescence resonance energy transfer" (FRET). If a luminescent moiety is involved, resonance energy transfer is detected as "luminescent resonance energy transfer" (LRET) or "bioluminescent resonance energy transfer" (BRET). See Boute et al, Trends Pharmacol. Sci. 25, 351-54, 2002; Ayoub et al., J. Biol. Chem. 277, 21522-
28, 2002); US 20050176926; Lakowicz, Principles of Fluorescence Spectroscopy, Plenum Press, New York pp. 303-339, 1983; Forster, Annals of Physics (Leipzig) 2, 55- 75, 1948; US 20050191718. Methods of binding donor and acceptor moieties to oligonucleotide molecules are well known in the art. See, e.g., Marras et al., Nucleic Acids Res. 2002 November 1; 30(21): el22; Loeffler et al, J Clin Microbiol. 2000 February; 38(2): 586-590; Rajendran & Ellington, Nucleic Acids Res. 2003 October 1; 31(19): 5700-5713; and Tyagi & Kramer, Nat. Biotechnol., 14, 303-308, 1996.
[17] Suitable acceptor moieties include, for example, a coumarin, a xanthene, a fluorescein, a fluorescent protein, a circularly permuted fluorescent protein, a rhodol, a rhodamine, a resorufin, a cyanine, a difluoroboradiazaindacene, a phthalocyanine, an indigo, a benzoquinone, an anthraquinone, an azo compound, a nitro compound, an indoaniline, a diphenylmethane, a triphenylmethane, and a zwitterionic azopyridinium compound.
[18] Suitable donor moieties include, but are not limited to, a coumarin, a xanthene, a rhodol, a rhodamine, a resorufin, a cyanine, a bimane, an acridine, an isoindole, a dansyl dye, an aminophthalic hydrazide " an aminophthalimide, an aminonaphthalimide, an aminobenzofuran, an aminoquinoline, a dicyanohydroquinone, a semiconductor fluorescent nanocrystal, a fluorescent protein, a circularly permuted fluorescent protein, and fluorescent lanthanide chelate.
Fluorescent proteins
[19] In some preferred embodiments either or both of the donor and acceptor moieties is a fluorescent protein. Suitable fluorescent proteins include green fluorescent proteins (GFP), red fluorescent proteins (RFP), yellow fluorescent proteins (YFP), and cyan fluorescent proteins (CFP). Useful fluorescent proteins also include mutants and spectral variants of these proteins which retain the ability to fluoresce.
[20] RFPs include Discosoma RFPs, such Discosoma DsRed (SEQ ID NO:9) or a mutant thereof which includes an Ilel25Arg mutation, or a non-oligomerizing tandem DsRed
containing, for example, two RJFP monomers linked by a peptide linker. For example, a non-oligomerizing tandem RFP can contain two DsRed monomers or two mutant DsRed- I125R monomers linked by a peptide (having, for example, the amino acid sequence shown in SEQ ID NO: 10).
[21] Useful GFPs include an Aequorea GFP (e.g., SEQ ID NO: 11), a Renilla GFP, a Phialidium GFP, and related fluorescent proteins for example, a cyan fluorescent protein (CFP), a yellow fluorescent protein (YFP), or a spectral variant of the CFP or YFP. CFP (cyan) and YFP (yellow) are color variants of GFP. CFP and YFP contain 6 and 4 mutations, respectively. They are Tyr66Try, Phe66Leu, Ser65Thr, Asnl45Ile, Metl53Thr, and Vall63Ala in CFP and Ser65Gly, Vall68Leu, Ser72Ala, and Thr203Tyr. Spectral variants include an enhanced GFP (EGFP; SEQ ID NO: 12), an enhanced CFP (ECFP; SEQ ID NO: 13), an enhanced YFP (EYFP; SEQ ID NO: 14), and an EYFP with V68L and Q69K mutations. Other examples of fluorescent proteins comprising mutations are Aequorea GFP with one or more mutations at amino acid residues A206, L221 or F223 of SEQ ID NO:11 (e.g., mutations A206K, L221K, F223R, Q80R); mutations L221K and F223R of ECFP (SEQ ID NO:13), and EYFP-V68L/Q69K of SEQ ID NO:14. See also US 2004/0180378; U.S. Patents 6,150,176; 6,124,128; 6,077,707; 6,066,476; 5,998,204; and 5,777,079; Chalfie et al, Science 255:802-805, 1994.
[22] Other useful GFP-related fluorescent proteins include those having one or more folding mutations, and fragments of the proteins that are fluorescent, for example, an A. victoria GFP from which the two N-terminal amino acid residues have been removed. Several of these fluorescent proteins contain different aromatic amino acids within the . central chromophore and fluoresce at a distinctly shorter wavelength than the wild type GFP species. For example, the engineered GFP proteins designated P4 and P4-3 contain, in addition to other mutations, the substitution Y66H; and the engineered GFP proteins designated W2 and W7 contain, in addition to other mutations, Y66W.
[23] Folding mutations in Aequorea GFP-related fluorescent proteins improve the ability of the fluorescent proteins to fold at higher temperatures and to be more fluorescent when expressed in mammalian cells, but have little or no effect on the peak wavelengths of excitation and emission. If desired, these mutations can be combined with additional mutations that influence the spectral properties of GFP to produce proteins with altered spectral and folding properties, and, particularly, with mutations that reduce or eliminate the propensity of the fluorescent proteins to oligomerize. Folding mutations, with respect to SEQ ID NO.ll, include the substitutions F64L, V68L, S72A, T44A, F99S, Y145F, N1461, M153T, M153A, V163A, 1167T 5 S175G, S205T, and N212K.
Luminescent moieties
[24] Luminescent moieties useful in an IRE-lα substrate include lanthanides, which can be in the form of a chelate, including a lanthanide complex containing the chelate (e.g, β- diketone chelates of cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, or ytterbium). Lanthanide chelates are well known in the art. See Soini and Kojola, Clin. Chem. 29, 65, 1983; Hemmila et al., Anal. Biochem. 137, 335 1984; Lovgren et at., In: Collins & Hoh, eds., Alternative Immunoassays, Wiley, Chichester, U.K., p. 203, 1985; Hemmila, Scand. J. Clin. Lab. Invest. 48, 389, 1988; Mikola et al, Bioconjngate Chem. 6, 235, 1995; Peruski et al., J. Immunol. Methods 263, 35-41, 2002; U.S. Patent 4,374,120; and U.S. Patent 6,037,185. Suitable β-diketones are, for example, 2-naphthoyltrifluoroacetone (2- NTA), 1-naphthoyltrifluoroacetone (1-NTA), p-methoxybenzoyltrifluoroacetone (MO- BTA), ρ-fluorobenzoyltrifiuoroacetone (F-BTA), benzoyltrifluoroacetone (BTA), furoyltrifluoroacetone (FTA), naphthoylfuroylmethane (NFM), dithenoylmethane (DTM), and dibenzoylmethane (DBM). See also US 20040146895.
[25] Luminescent proteins include, but are not limited to, lux proteins (e.g., luxCDABE from Vibrio βscherii), luciferase proteins (e.g., firefly luciferase, Gaussia luciferase, Pleuromamma luciferase, and luciferase proteins of other beetles, Dinoflagellates
(Gonylaulax; Pyrocystis;), Annelids (Dipocardia), Molluscs (Lativa), and Crustacea (Vargula; Cypridina), and green fluorescent proteins of bioluminescent coelenterates (e.g., Aequorea Victoria, Renilla mullerei, Renilla reniformis; see Prendergast et al, Biochemistry 17, 3448-53, 1978; Ward et al, Photochem. Photobiol 27, 389-96, 1978; Ward et al, J. Biol. Chem. 254, 781-88, 1979; Ward et al, Photochem. Photobiol. Rev 4, 1-57, 1979; Ward et al, Biochemistry 21, 4535-40, 1982). Many of these proteins are commercially available. Firefly luciferase is available from Sigma, St. Louis, MO, and Boehringer Mannheim Biochemicals, Indianapolis, IN. Recombinant^ produced firefly luciferase is available from Promega Corporation, Madison, WI. Jellyfish aequorin and luciferase from Renilla are commercially available from Sealite Sciences, Bogart, GA.
[26] The DNA sequences of the aequorin and other luciferases employed for preparation of some substrates of the invention can be derived from a variety of sources. For example, cDNA can be prepared from mRNA isolated from the species disclosed above. See Faust, et al, Biochem. 18, 1106-19, 1979; De Wet et al, Proc. Natl. Acad. ScL USA 82, 7870-73, 1985.
[27] Luciferase substrates (luciferins) are well known and include coelenterazine (available from Molecular Probes, Eugene, OR) and ENDUREN™. These cell-permeable reagents can be directly administered to cells, as is known in the art. Luciferin compounds " can be prepared according to the methods disclosed by Hori et al, Biochemistry 14, 2371-76, 1975; Hori et al, Proc. Natl Acad. ScI USA 74, 4285-87, 1977).
Dark quenchers
[28] In some embodiments the acceptor moiety is a quencher moiety, preferably a "dark quencher" (or "black hole quencher") as is known in the art. In this case, the change in conformation which occurs with RNase activity eliminates quenching, resulting in an increase in energy emission from the donor moiety. "Dark quenchers" themselves do not emit photons. Use of a "dark quencher" reduces or eliminates background fluorescence or luminescence which would otherwise occur as a result of energy transfer from the
donor moiety. Suitable quencher moieties include BLACK HOLE QUENCHER™ dyes (e.g., BHQ-0™, BHQ- 1™, BHQ-2™, BHQ-3™), which are available from Biosearch Technologies, Inc., and QSY™ dyes available from Invitrogen. Suitable quencher moieties are disclosed, for example, in US 2005/0118619; US 2005/0112673; and US 2004/0146959.
[29] Any suitable fluorophore may be used as the donor moiety provided its spectral properties are favorable for use with the chosen dark quencher. The donor moiety can be, for example, a Cy-dye, Texas Red, a BODIPY™ dye, or an Alexa dye. Typically, the fluorophore is an aromatic or heteroaromatic compound and can be a pyrene, anthracene, naphthalene, acridine, stilbene, indole, benzindole, oxazole, thiazole, benzothiazole, cyanine, carbocyanine, salicylate, anthranilate, coumarin, a fluorescein (e.g., fluorescein, tetrachlorofiuorescein, hexachlorofiuorescein), rhodamine, tetramethyl-rhodamine, or other like compound. Suitable fluorescent moieties for use with dark quenchers include xanthene dyes, such as fluorescein or rhodamine dyes, including 6-carboxyfluorescein (FAM), 27'-dimethoxy-4 l 5'-dichloro-6-carboxyfluorescein (JOE), tetrachlorofluorescein (TET), 6-carboxyrhodamme (R6G), N,N,N;N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX). Suitable fluorescent reporters also include the naphthylamine dyes that have an amino group in the alpha or beta position. For example, naphthylamino compounds include l-dimethylaminonaphthyl-5-sulfonate, 1- anilino-8-naphthalene sulfonate and 2-p-toluidinyl-6-naphthalene sulfonate, 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS).
[30] Other suitable fluorescent moieties include coumarins, such as 3-phenyl-7- isocyanatocoumarin; acridines, such as 9-isothiocyanatoacridin- e and acridine orange; N-(p-(2-benzoxazolyl)phenyl)maleimide; cyanines, such as indodicarbocyanine 3 (Cy3), indodicarbocyanine 5 (Cy5), indodicarbocyanine 5.5 (Cy5.5), 3-l-carboxy-pentyl)-3'- ethyl-5,5'-dimethy- loxacarbocyanine (CyA); lH,5H,lH,15H-Xantheno[2,3,4-ij:5,6,7- i'j'jdiquinol- izin-18-ium, 9-[2(or 4)-[[[6-[2,5-dioxo-l-pyrrolidinyl)oxy]-6-
oxohexyl]amino]sulfonyl]-4(or 2)-sulfophenyl]-2,3,6,7,12,13,16,17-octahyd~ ro-inner salt (TR or Texas Red); BODIPY™ dyes; benzoxaazoles; stilbenes; pyrenes; and the like.
Screening methods
[31] IRE-lα substrates of the invention can be used in a variety of systems to detect, monitor, and quantitate IRE-lα RNase activity. Such assays can be used, for example, to monitor RNase activity or to identify a test compound as an agonist or antagonist of IRE-lα activity. A test compound which increases IRE-lα RNase activity {i.e., an agonist) is a potential therapeutic agent (or lead compound for developing a therapeutic agent) for treating Alzheimer's disease and type II diabetes. A test compound which decreases IRE-lα RNase activity (i.e., an antagonist) is a potential therapeutic agent (or lead compound for developing a therapeutic agent) for treating B-cell autoimmune disease, lupus, and cancer.
[32] Assays can be carried out quantitatively or qualitatively, using either full-length IRE-lα or a portion of IRE-lα comprising the active site for RNase activity, including the cytoplasmic domain and the kinase and RNAse domains. The structure and functional domains of IRE-lα are well understood. See, e.g., Sidrauski & Walter, Cell 90, 1-20, 1997; Tirasophon et al., Genes & Devel. 14, 2725-2736, 2000; Dong et al, RNA 7, 361- 73, 2001; Calfon et al., Nature 415, 92-202, 2002 Liu et al., J. Biol. Chem. 277, 18346- 56, 2002; Lee et al, MoI. Cell. Biol. 23, 7448-59, 2003; Niwa et al, Genome Biology 6, Article R3, 2004; Back et al, Methods 35, 395-416, 2005.
[33] In preferred embodiments, changes in resonance energy transfer are used to indicate RNase activity. A change in resonance energy transfer can readily be detected using methods well known in the art. See, e.g., US 2005/0118619; US 2002/0137115; US 2003/0165920; US 2003/0186229; US 2004/0137479; US 2005/0026234; US 2005/0054573; US 2005/0118619; U.S. Patent 6,773,885; U.S. Patent 6,803,201; U.S. Patent 6,818,420; Ayoub et al, 2002; Boute et al, 2002; Domin et al, Prog. Biomed. Optics and Imaging, Proc. SPIE, vol 5139, 2003, pρ238-242; Evellin et al, Methods MoI
biol 284, 259-70, 2004; Honda et al., Proc. Natl. Acad. ScI USA 98, 431-42, February 27, 2001; Honda et al, Methods MoI. Biol. 3, 27-44, 1005; Mongillo et al, Cir. Res. 95, 67-75, July 9, 2004; Mongillo et al, Methods MoI Biol. 307, 1-14, 2005; Nagai et al, Proc. Natl. Acad. ScI USA 101, 10554-59, July 20, 2004; Nikolaev et al, J. Biol. Chem. 279, 37215-18, 2004; Polit et al, Eur. J. Biochem. 270, 1413-23, 2003; Ponsioen et al, EMBO Rep. 5, 1176-80, 2004; Santangelo et al, Nucl Acids Res. 32, 1-9, e-published April 14, 2004; and Warrier et al, Am. J. Physiol. Cell Physiol. 289, C455-61, August 2005. Properties which can be detected as resonance energy transfer (RET) measurements include a molar extinction coefficient at an excitation wavelength, a quantum efficiency, an excitation spectrum, an emission spectrum, an excitation wavelength maximum, an emission wavelength maximum, a ratio of excitation amplitudes at two wavelengths, a ratio of emission amplitudes at two wavelengths, an excited state lifetime, anisotropy, a polarization of emitted light, resonance energy transfer, and a quenching of emission at a wavelength.
[34] Other methods can also be used to detect RNase activity. For example, in some embodiments the relative mass of cleaved and uncleaved products is detected, for example, using mass spectroscopy. See, e.g., U.S. Patent 5,506,348. In other embodiments, a detectable label, such as a fluorescent compound, is linked to either the 3' or 5' end of the substrate, and cleavage of the substrate is detected using relative size, such as by capillary electrophoresis. Such methods are well known in the art. See, e.g., Camilleri, ed., Capillary Electrophoresis: Theory and Practice (New Directions in Organic and Biological Chemistry Series), 1997; Heller, Analysis of Nucleic Acids By Capillary Electrophoresis, Chromatographia CE Series Volume 1, 1997; Altria, ed., Capillary Electrophoresis Guidebook: Principles, Operation, and Applications (Methods in Molecular Biology, volume 52), 1996; Guttman et al., Anal. Chem. 62, 137-146, 1990; and U.S. Patents 5,571,680, 5,110,424, and 5,567,292.
Test compounds
[35] Test compounds can be pharmacologic agents already known in the art or . can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection.
[36] Methods for the synthesis of molecular libraries are well known in the art {see, for example, DeWitt et al, Proc. Natl Acad. ScL U.S.A. 90, 6909, 1993; Erb et al Proc. Natl Acad. ScI U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2678, 1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl 33, 2061; Gallop et al, J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Set U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al, Proc. Natl Acad. Sci. 97, 6378-6382, 1990; Felici, J MoI Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409).
High through-put screening
[37] Screening methods of the invention can be used in high through-put screening formats. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely
established techniques utilize 96- well microtiter plates, however 384- or 1536- plates also can be used. As is known in the art, a variety of instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available.
[38] All patents, patent applications, and references cited in this disclosure are expressly incorporated herein by reference in their entireties. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
IRE-Ia protein
[39] A fusion protein comprising glutathione S transferase (GST) and human IRE-lα (GST- IRE- lα) was obtained from a 500 ml baculovirus-infected insect cell culture. The insect cells were lysed by suspending the cells in Buffer A (25 mM Tris-HCl pH7.5, 50 mM KCl, 5 mM MgCl 2 , 1 mM EDTA, 2.5 mM DTT, 0.1 mM ATP, 10% sterile glycerol, 0.005% NP-40, 1 μg/mL leupeptin, 100 mM NaF, 100 mM NaVO 4 , 100 mM PMSF; 30 mLs per 500 mL culture), transferring the suspension to a high speed centrifuge tube, and sonicating the suspension on ice. The sonicated preparation was spun at 13000 x g for 30 minutes at 4°C.
[40] The supernatant was combined with glutathione Sepharose beads in a tube and gently mixed on a rotator for 1-2 hours at 4°C. After binding, the bead mixture was transferred to an Amersham PD-10 column. The column was washed five times with Buffer A followed by two washes with Buffer B (25 mM Tris-HCl ρH7.5, 50 mM KCl, 2.5 mM MgCl 2 , ImM EDTA, 2.5 mM DTT, 10% sterile glycerol, 0.0025% NP-402).
[41] The GST tag was removed using PRESCISSION™ PROTEASE cleavage. Cleavage buffer (825 μL Buffer B, 350 μl sterile glycerol, and 35μl PRESCISSION™ PROTEASE
per mL of beads) was added to the column and incubated for 4 hours at 4 0 C with tumbling. The final product was collected by collecting flow-thru from the column. As shown in FIG. 1, this method provides a high yield and a highly pure preparation of IRE- lα protein.
[42] The IRE-lα monomer used in the assays described below (SEQ ID NO: 15) comprises amino acids 462-977 of IRE-lα (linker, kinase, and RNAse domains) with GPLGSPEF (amino acids 1-8 of SEQ ID NO: 15) at the end terminus from the linker region of the GST vector.
EXAMPLE 2
Assay of IRE-Ia activity
[43] An IRE-lα protein preparation obtained as described in Example 1 was tested at various dilutions for RNase activity using four substrates: a 33 base wild-type substrate 5'- GGGUCUGCUGAGUCCGCAGC ACUC AGAAGGCCC-3' (SEQ ID NO:1), a 15 base wild-type substrate 5'-C AGUCCGC AGC ACUG-3' (SEQ ID NO:3) labeled with FAM (5') and BHQ-1™ (3'), a 33 base mutant substrate 5'-GGGUCUGCUGAGUCCCCAG- CACUCAGAAGGCCC-3' (SEQ ID NO:2), and a 15 base mutant substrate 5'- C AGUCCCC AGC ACUG-3' (SEQ ID NO:4) labeled with FAM (5 r ) and BHQ (3').
[44] Five μl of a reaction mixture comprising IX reaction buffer (5X reaction buffer is 100 mM Hepes pH 7.5, 250 mM KOAc, 2.5 mM MgCl 2 ), 3mM DTT, and 0.4% polyethylene glycol water were added to each well of 384 well plates. Twenty-five nanoliters of a 1 mM test compound solution were added to test wells. Three μl of a 128 ng/ml IRE-lα preparation were added to each test well and to positive control wells (final concentration 5.82 ng/well). Negative control wells contained only reaction mixture and test compound.
[45] After spinning the plates at 1200 rpm for 30 seconds, 3 μl of a 63 nM wild-type IRE-lα substrate or 3 μl of a 63 nM mutant IRE-lα substrate diluted to 48 nM were added to each well of a control plate. The plates were again spun at 1200 rpm for 30 seconds. Final concentrations for the assay were: 63 nM wild-type IRE-lα substrate (or 48 nM mutant IRE-α substrate), 5.82 ng IRE-lα protein, and 2.5 μM test compound.
[46] The plates were covered with lids and incubated for one hour at 30 0 C. The plates were then transferred to an ACQUEST™ microplate reader. Data was analyzed using data analysis software. The percent activity of IRE-lα was calculated using the following equation:
(compound - mean positive control * ) x 100%
(mean negative control - mean positive control)
[47] Reaction products were separated on a 20% polyacrylamide urea denaturing gel, which is shown in FIG. 3. From left to right, the lanes are: 1, wild-type 33 base, no IRE-lα; 2, mutant 33 base, no IRE-lα; 3, wild-type 33pb with IRE-Iq (cuts); 4, mutant 33 base with IRE-lα (does not cut); 5, control for adding polyethylene glycol (PEG) to reaction: wild- type 33 base, no IRE-lα; 6, control for adding polyethylene glycol (PEG) to reaction: mutant 33 base; 7, wild-type 33pb with IRE-lα (cuts) with PEG; 8, mutant 33 base with IRE-lα (does not cut) with PEG; 9, wild-type 33ρb with IRE-lα diluted 1:3 (cuts) with PEG; 10, wild-type 33ρb with IRE-lα diluted 1:12 (cuts) with PEG; 11, wild-type 15 base FAM-BHQl labeled substrate no IRE-lα ( no signal); 12, mutant 15 base FAM- BHQl labeled substrate no IRE-lα ( no signal); 13, wild-type 15 base FAM-BHQl labeled substrate with IRE-lα added (signal); 14, mutant 15 base FAM-BHQl labeled substrate no IRE-lα ( no signal); and 15, wild-type 15 base FAM-BHQl labeled substrate with IRE-lα added diluted to 1:3 (signal).
[48] The assays demonstrated that IRE-lα cleaves both wild-type substrates with high specific activity, but does not cleave either of the mutant substrates. The enzyme retains activity at a 1 :20 dilution, and the activity appears to be dose dependent.
[49] Specific human IRE-lα activity was confirmed using additional 33 base stem-loop substrates with single point mutations in the loop, as shown in FIG. 3C. The structure on the right designates the wild type stem-loop substrate, which also is shown in FIG. 2. Circled residues show wild type residues which were changed to single point mutations (boxed). Mutants are labeled with numbers on the corresponding gel on the left. The experiment was performed in identical fashion as that in FIG. 3A with the exception of using all 5 mutant substrates with or with out the presence of recombinant purified human IRE-lα.
[SO] As shown in FIG. 3C, IRE-lα digested the wild type substrate with little if any digestion of the other substrates, indicated by the lack of a lower molecular weight band. From left to right, the lanes are: 1, wild type substrate in reaction buffer, no IRE-lα; 2, mutant substrate #1 in reaction buffer, no IRE-lα; 3, mutant substrate #2 in reaction buffer, no IRE-lα; 4, mutant substrate #3 in reaction buffer, no IRE-lα; 5, mutant substrate #4 in reaction buffer, no IRE-lα; 6, mutant substrate #5 in reaction buffer, no IRE-lα; 7, wild type substrate in reaction buffer, with IRE-lα; 8, mutant substrate #1 in reaction buffer, with IRE-lα; 9, mutant substrate #2 in reaction buffer, with IRE-lα; 10, mutant substrate #3 in reaction buffer, with IRE-lα; 11, mutant substrate #4 in reaction buffer, with IRE- lα; and 12, mutant substrate #5 in reaction buffer, with IRE-lα.
EXAMPLE 3
Determination of minimal substrate length
[51] Using the assay described above, minimal substrate length was determined using a 15 base substrate (wild-type, SEQ ID NO:3; mutant, SEQ ID NO:4) and an 11 base substrate (wild-type 5'-CUCCCCAGCAG-3', SEQ ID NO:5; mutant 5'- CUCCGCAGCAG-3', SEQ ID NO:6). ATP and ADP are not required for enzyme activity in this assay. GST-IRE-I α is purified in high concentrations of ATP but ultimately this is washed and diluted away to negligible levels.
EXAMPLE 4
Kinetics of IRE- la-mediated substrate cleavage
[52] Kinetics of IRE-lα-mediated substrate cleavage were measured in an assay as described above using purified active IRE- lα and the wild-type 15pb FAM-BHQ- l™-labeled substrate. The plate was incubated at 30 0 C and read every 5 minutes.
[S3] The results are shown in FIG. 4. These data identified useful conditions for a high- throughput assay: 20 nM purified IRE-lα and 63 nM substrate in a 10 μl reaction volume and a 60 minute incubation time. These conditions result in a signal of 60,000 units, which is approximately 75% of the full 80,000 unit signal.
EXAMPLE 5
Substrate Specificity
[54] This example demonstrates a competition assay using a 15 base wild-type dual-labeled substrate (SEQ ID NO:3) as the readout. Increasing amounts of either unlabeled wild- type (SEQ ID NO:1) or mutant 33 base substrate (SEQ ID NO:2) were incubated in the standard reaction as described in Example 2 for 1 hour at 30 0 C.
[55] The results are shown in FIG. 5. X-axis, fluorescence intensity; columns of Y axis, from left to right: 1, wild-type 15 base FAM BHQ-1™ substrate, no IRE-lα, and no competitor (background signal); 2, wild-type 15 base FAM BHQ-1™ substrate, no IRE- lα (background signal) plus 50 fold molar excess of unlabeled wild-type 33 base substrate (control for possible quenching of fiuorophore with excess and possible hybridizing to the longer 33 base substrate); 3, wild-type 15 base FAM BHQ-1™ substrate with IRE-lα and an equivalent amount of wild-type 33 base substrate; 4, same as 3 with 2x wild-type 33 base substrate; 5, same as 3 with 5x wild-type 33 base substrate; 6, same as 3 with 10x wild-type 33 base substrate; 7, same as 3 with 2Ox wild- type 33 base substrate; 8, same as 3 with 5Ox wild-type 33 base substrate; 9, wild-type 15
base FAM BHQ- 1™ substrate no IRE-lα (background signal) plus 50 fold molar excess of unlabeled mutant 33 base substrate (control for possible quenching of fluorophore with excess and possible hybridizing to the longer 33 base substrate (essentially the same as 2); 10, wild-type 15 base FAM BHQ-1™ substrate with IRE-lα and an equivalent amount of mutant 33 base substrate; 11, same as 3 with 2x 33 base mutant substrate; 12, same as 3 with 5x 33 base mutant substrate; 13, same as 3 with 10x 33 base mutant substrate; 14, same as 3 with 2Ox 33 base mutant substrate; 15, same as 3 with 50x 33 base mutant substrate; 16, wild-type 15 base FAM BHQ-1™ substrate with IRE,-lα (positive control).
[56] The results show that a ten-fold molar excess of wild-type 33 base substrate begins to compete with the IRE-lα substrate and inhibit fluorescence intensity, with 50-fold excess having greater than 50% inhibitory activity. Similar concentrations of unlabeled 33 base mutant substrate, however, have no inhibitory activity, indicating that IRE-lα does not recognize or bind to the mutant substrate even with a single mutation which preserves its secondary structure. Thus, while the length of the stem has little or no impact on cleavage of the loop, sequence-specific recognition likely is a factor in the catalytic activity of IRE- 1 α.
EXAMPLE 6
High-throughput screening assay
[57] A Beckman Biomek FX robot was used to load all components of the reaction into 384- well plates in the following order: buffer with test compound, IRE-lα, and substrate into 384-well plates. The results of the assay and are shown in Table 1 and FIG. 6. Controls with substrate alone and substrate with IRE-lα were used to calibrate signal to noise ratio and variability between wells (first two left hand rows respectively, in FIG. 6). The two far right lanes in FIG. 6 contain the mutant 15 base dual-labeled substrate with and without IRE-lα as a quality control check for RNase contamination.
[58] This example demonstrates that the assay has an acceptable signal increase over background and low variability from well to well and from plate to plate.
Table 1