MATERIALS AND METHODS FOR BREWING BEER

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the benefit of priority to U.S. Provisional Application No. 63/147,964, filed February 10, 2021 and U.S. Provisional Application No. 63/292,226, filed December 21, 2021, the disclosures of which are incorporated herein by reference in their entireties.

INCORPORATION BY REFERENCE OF INFORMATION SUBMITTED

ELECTRONICALLY

[0002] This application contains, as a separate part of the disclosure, a Sequence Listing in computer readable form (Filename: 56400_Seqlisting.txt; Size: 42,808 bytes; Created: February 9, 2022), which is incorporated by reference in its entirety.

BACKGROUND

[0003] Fruity and floral aromas are in high demand in the beverage industry, and there are continuous efforts to improve the aroma of beer by increasing or diversifying flavor profiles. Thiols, also known as mercaptans, are sulfur-containing organic compounds with a sulfur atom bound to a hydrogen atom. Winemakers identified thiols that contribute to the aroma of wine. One, 4-methyl-4-sulfanylpentan-2-one (4MSP; also known as 4-mercapto-4- methylpentant-2-one (4MMP)), smells and tastes of box tree, black currant, and ribes. Another, 3-sulfanyl-l-hexanol (3SH; also known as 3-mercaptohexanol-l-ol (3MH)) is often described as exotic, smelling of passion fruit, rhubarb and citrus. And the third, 3- sulfanylhexyl acetate (3SHA; also known as 3-mercaptohexyl acetate (3MHA), is reminiscent of passion fruit and guava. These compounds are all prominent in Sauvignon blanc, Riesling, and other wines, although they are not abundant as free form aromatic thiols in grapes. They are formed during fermentation from precursors present in grape must.

[0004] Some varieties of hops contain high amounts of the precursor forms of these thiols, but low amounts of the free, aromatic forms that contribute to aroma or flavor of a product. Thus, there remains a need in the art for a means to release these volatile, aromatic thiols from their precursor forms during the fermentation process to maximize the aromatic potential of beer.

SUMMARY [0005] The disclosure also provides a recombinant yeast comprising a polynucleotide encoding a yeast b-lyase enzyme Irc7 operably linked to a heterologous promoter, wherein the b-lyase enzyme comprises an amino acid sequence at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 1.

[0006] The disclosure provides a recombinant Saccharomyces spp comprising a polynucleotide encoding an yeast b-lyase enzyme IRC7 operably linked to a heterologous promoter, wherein the b-lyase enzyme comprises an amino acid sequence at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 1.

[0007] The disclosure also provides a recombinant yeast comprising a polynucleotide encoding a cysteine-thiol lyase operably linked to a heterologous promoter. In some embodiments, the cysteine-thiol lyase is PatB. In some embodiments, the PatB is from species of Staphylococcus. In some embodiments, the PatB is from S. lugdunensis , S. devriesei, S. hominis, S. haemolyticus , S. petrasii, or B. subtilis. In some embodiments, the PatB is from S, petrasii croceilyticus or S, petrasii petrasii. In some embodiments, the PatB comprises an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 8-14. In some embodiments, the PatB comprises an amino acid sequence set forth in any one of SEQ ID NOs: 8-14.

[0008] In some embodiments, the heterologous promoter is TDH3, TDH2, CCW12,

PGK1, ADH1, ADH2, CYC1, HHF1, HHF2, TEF1, TEF2, HTB2, PAB1, ALD6, RNR1, RNR2, POP6, RAD27, PSP2, REV1, MFA1, MFa2, GAL1, CUP1, MET25, ICL1, ICL2, GAL3, HXT1, HXT2, MAL11, MAL31, MAL32, MAL33, MRK1, or SUC2 promoter. In some embodiments, the recombinant Saccharomyces spp is S. cerevisiae or S. pastorianus. In some embodiments, the b-lyase enzyme comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the b-lyase enzyme does not comprise the amino acid sequence set forth in SEQ ID NO: 3.

[0009] The disclosure also provides a method of converting a non-volatile form of 3- sulfanyl-l-hexanol (3SH) to free 3SH during a brewing process, the method comprising contacting cooled wort with the recombinant Saccharomyces described herein under conditions and for a time sufficient to convert non-volatile form of 3SH to free 3SH. In some embodiments, the non-volatile form of 3SH is glutathione-bound 3SH or cysteine-bound-3SH or a combination thereof. In some embodiments, the method results in a 3 -fold increase in free 3SH in wort fermented with the recombinant Saccharomyces compared to wort fermented with non-modified Saccharomyces. In some embodiments, the wort comprises at least 60 ng/L free 3SH after the contacting step.

[0010] The method optionally comprises adding hops to cooled wort during the contacting step. Exemplary hops for use in the methods described herein include, but are not limited to, Cascade, Calypso, Hallertau Tradition, Hallertau Perle, Triple Pearl, Nugget, Saaz, Columbus/CTZ, Chinook, Nelson Sauvin, Hallertau Blanc or Simcoe. In some embodiments, the hops contain at least 400 pg/kg of cysteine-bound 3SH.

[0011] The disclosure also provides a method of converting a non-volatile form of 3- sulfanyl-l-hexanol (3SH) to free 3SH during a brewing process, the method comprising (a) a mash hopping step comprising adding a plant material comprising a non-volatile form of 3SH to grist to produce wort; (b) boiling the wort produced by (a); (c) cooling the wort; and (d) contacting the cooled wort with a recombinant yeast described herein for a time sufficient to convert a non-volatile form of 3SH to free 3SH. In some embodiments, the recombinant yeast is a recombinant Saccharomyces comprising a polynucleotide encoding a b-lyase enzyme Irc7 operably linked to a heterologous promoter. In some embodiments, the recombinant yeast is a recombinant Saccharomyces spp. comprising a polynucleotide encoding a cysteine- thiol lyase operably linked to a heterologous promoter. In some embodiments, the non volatile form of 3SH is glutathione-bound-3SH or cysteine-bound-3SH, or a combination thereof. In some embodiments, the method results in a 6-fold increase in free 3SH in wort fermented with the recombinant yeast compared to wort fermented with non-modified yeast. In some embodiments, the wort comprises at least 60 ng/L free 3SH after the contacting step.

[0012] In some embodiments, the plant material comprises a non-volatile form of 3SH is hops. In some embodiments, the hops contain at least 400 pg/kg of cysteine-bound 3SH. In some embodiments, the hops contain at least 5000 pg/kg glutathione-3SH. In some embodiments, the hops contain at least 400 pg/kg of cysteine-bound 3SH and at least 5000 pg/kg glutathione-3SH. In some embodiments, the hops are Cascade, Calypso, Hallertau Tradition, Hallertau Perle, Triple Pearl, Nugget, Saaz, Columbus/CTZ, Chinook, Nelson Sauvin, Hallertau Blanc or Simcoe hops.

[0013] In some embodiments, the plant material comprises a non-volatile form of 3SH is a grape-derived product. In some embodiments, the grape derived product is crushed grapes or grape flour. In some embodiments, the grape-derived product is obtained from a white grape, a red grape, or combinations thereof. Exemplary white grape varieties include, but are not limited to, Sauvignon Blanc, Chardonnay, Chenin Blanc, Colombard, Gewurztraminer, Gros Manseng, Koshu, Maccabeo, Muscat, Petit Manseng, Pinot Blanc, Pinot Gris, Riesling, Scheurebe, Semilion, Sylvaner, and Tokay. Exemplary red grape varieties include, but are not limited to, Cabernet Franc, Cabernet Sauvignon, Grenache, Merlot, and Pinot Noir.

[0014] In some embodiments, the mash hopping step comprises adding less than 100 grams of the plant material per 1 kg of grist.

[0015] In some embodiments, the mash hopping step comprises adding both hops and a grape-derived product to the grist.

[0016] In some embodiments, the b-lyase is a bacterial b-lyase or a fungal b-lyase. Exemplary bacterial b-lyases for use according to the disclosure are from bacteria including, but not limited to, Eschericia sp. ; Thermoanaerobacter sp. ; Symbiobacterium sp.; Photobacterium sp.; Haemophilus sp., Vibrio sp., Proteus sp., Halobacterium sp., Desulfitobacterium sp.; and Treponema sp. In some embodiments, the bacterial b-lyase is E. coli TNaA.

[0017] In some embodiments, the fungal b-lyase is a yeast b-lyase. Exemplary fungal b- lyases for use according to the disclosure are from Saccharomycotina, Taphrinomycotina, and Schizosaccharomycetes . In some embodiments, the yeast b-lyase is from Saccharomyces. In some embodiments, the yeast b-lyase is Irc7. In some embodiments, the Irc7 comprises an amino acid sequence at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99% or more) identical to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the Irc7 comprises the amino acid sequence set forth in SEQ ID NO: 1.

[0018] In some embodiments, the mash hopping step comprises a protein rest before the boiling step. In some embodiments, the protein rest comprises maintaining the mash at a temperature of less than 140°F for at least five minutes before the boiling step. In some embodiments, the protein rest comprises maintaining the mash at a temperature between 100°F and 140°F for at least one hour before the boiling step. In some embodiments, the mash hopping step further comprises a saccharification rest after the protein rest and before the boiling step.

[0019] In some embodiments, the method further comprises contacting the cooled wort with hops to produce an admixture and contacting the admixture with the recombinant yeast. In some embodiments, the recombinant yeast is S. cerevisiae or S. pastorianus. [0020] In some embodiments, the contacting step (d) occurs in a fermenter at a temperature ranging from 45°F-100°F.

BRIEF DESCRIPTION OF THE FIGURES

[0021] Figure 1 is an alignment of IRC7 alleles described in Example 1.

[0022] Figure 2 is a bar graph showing that free 3SH levels are increased in beer fermented with OYL-088-TDH3-IRC7 compared to the unmodified OYL-088 strain.

DETAILED DESCRIPTION

[0023] Many plant derived products contain volatile thiols bound as cysteine S-conjugate precursors, and conversion of the non-volatile precursor to a volatile thiol product contributes to the aroma of a food or drink product. Volatile thiols are responsible for imparting aromas such as box tree, passionfruit, grapefruit, gooseberry, and guava to a fermented beverage, such as beer.

[0024] The present disclosure is based, in part, on the discovery that yeast (e.g., Saccharomyces spp.) that have been modified to overexpress a yeast b-lyase enzyme (or a cysteine-thiol lyase) triggers the conversion of available non-volatile thiols (e.g., glutathione bound- or cysteine -bound thiols) in plant material to the more desirable aromatic (i.e., volatile or free) form during the fermentation step of a brewing process.

[0025] The present disclosure is also based, in part, on the discovery that modifying the conventional brewing method to include a mashing step comprising adding a plant material comprising a non-volatile thiol of interest to grist to produce wort, and subsequently contacting the wort with a modified Saccharomyces spp that overexpresses a b-lyase enzyme (or a cysteine-thiol lyase), results in higher rates of conversion of available non-volatile thiols to the volatile, aromatic form.

[0026] Recombinant Yeast.

[0027] In one aspect, described herein is a recombinant yeast comprising a polynucleotides encoding a b-lyase (or cysteine-thiol lyase) enzyme operably linked to a heterologous promoter. The term “heterologous promoter” as used herein refers to a promoter that is non native to the b-lyase (or cysteine-thiol lyase) enzyme.

[0028] In some embodiments, the yeast belongs to a non -Saccharomyces genus. In some embodiments, the yeast belongs to the genus Kloeckera, Candida, Starmerella, Hanseniaspora, Kluyveromyces/Lachance, Metschnikowia, Saccharomycodes, Zygosaccharomyce, Dekkera (also referred to as Brettanomyces), Wickerhamomyces , or Torulaspora. In some embodiments, the yeast is Hanseniaspora uvarum, Hanseniaspora guillermondii, Hanseniaspora vinae, Metschnikowia pulcherrima, Kluyveromyces/Lachancea thermotolerans, Starmerella bacillaris (previously referred to as Candida stellatal or Candida zemplinina), Saccharomy codes ludwigii, Zygosaccharomyces rouxii, Dekkera bruxellensis, Dekkera anomala, Brettanomyces custersianus, Brettanomyces naardenensis, Brettanomyces nanus, Wickerhamomyces anomalus, or Torulaspora delbrueckii.

[0029] In another aspect, described herein is a recombinant Saccharomyces spp. comprising a polynucleotide encoding a b-lyase (or a cysteine-thiol lyase) enzyme operably linked to a heterologous promoter.

[0030] In various aspects, the recombinant Saccharomyces is S. cerevisiae or S. pastorianus.

[0031] b-lyase is an enzyme responsible for the release of volatile sulfur compounds called polyfunctional thiols, or mercaptans, which are usually associated with tropical aroma. Exemplary b-lyase enzymes for use in accordance with the present disclosure include, but are not limited to, those described in International Publication No. WO 2007/095682, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the b-lyase is a bacterial b-lyase, such as a b-lyase from Eschericia sp., Thermoanaerobacter sp.; Symbiobacterium sp.; Photobacterium sp.; Haemophilus sp.; Vibrio sp.; Proteus sp; Halobacterium sp., Desulfitobacterium sp; or Treponema sp. In some embodiments, the b- lyase is tryptophanase ( E . coli ) (UniProt Accession No. P0A853).

[0032] In some embodiments, the b-lyase is a fungal b-lyase, such as a yeast b-lyase from Saccharomyces cerevisiae (all strains), Saccharomyces bayanus and species of Brettanomyces and Dekkera, Candida, Cryptococcus; Debaryomyces, Hanseniaspora, Kloeckera; Kluyveromyces; Metschnikowia; Pichia; Rhodotorula; Saccharomyces; Saccharomy codes; Schizosaccharomyces; or Zygosaccharomyces . In some embodiments, the b-lyase is IRC7. In some embodiments, b-lyase is comprises an amino acid sequence at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99% or more) identical to the amino acid sequence set forth in SEQ ID NO: 1.

[0033] In some embodiments, the cysteine-thiol lyase has a Kcat/Km for cystathionine of less than or equal to 0.7 xlO ² min ¹ mM ¹ (e.g., 0.7 xlO ² min ¹ mM ¹ , 0.6 xlO ² min ¹ mM ¹ , 0.5 xlO ² min ¹ mM ¹ , 0.4 xlO ² min ¹ mM ¹ , 0.3 xlO ² min ¹ mM ¹ , 0.2 xlO ² min ¹ mM ¹ , 0.1 xlO ² min ¹ mM ¹ or less). In some embodiments, the cysteine-thiol lyase Kcat/Km for Cys-3M3SH of greater than or equal to 3 xlO ² min ¹ mM ¹ (e.g., 3 xlO ² min ¹ mM ¹ , 3.5 xlO ² min ¹ mM ¹ , 4 xlO ² min ¹ mM ¹ , 4.5 xlO ² min ¹ mM ¹ , 5 xlO ² min ¹ mM ¹ , 5.5 xlO ² min ¹ mM ¹ , 6 xlO ² min ¹ mM ¹ , 6.5 xlO ² min ¹ mM ¹ , 7 xlO ² min ¹ mM ¹ , 7.5 xlO ² min ¹ mM ¹ , 8 xlO ² min ¹ mM \ 8.5 xlO ² min ¹ mM ¹ , 9 xlO ² min ¹ mM ¹ , 9.5 xlO ² min ¹ mM ¹ or higher).

[0034] In some embodiments, the cysteine-thiol lyase is PatB. In some embodiments, the PatB is from the Staphylococcus genus. In some embodiments, the PatB is from S. lugdunensis (SEQ ID NO: 9), S. devriesei (SEQ ID NO: 10), S. hominis (SEQ ID NO: 8), S. haemolyticus (SEQ ID NO: 13), S. petrasii (SEQ ID NO: 11 or SEQ ID NO: 12), or B. subtilis (SEQ ID NO: 14)

[0035] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 8.

[0036] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 9.

[0037] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 10.

[0038] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 11.

[0039] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 12.

[0040] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 13.

[0041] In another exemplary aspect, the disclosure provides a recombinant yeast comprising a polynucleotide encoding PatB operably linked to a heterologous promoter, wherein the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 14.

[0042] In some embodiments, the recombinant yeast comprising a polynucleotide encoding a cysteine-thiol lyase (e.g., PatB) promotes the release of 4-methyl-4-sulfanylpentan-2-one (4MSP) that is about 2-fold greater than a recombinant yeast comprising a polynucleotide encoding a TnaA enzyme.

[0043] The terms “operably-linked” or “functionally-linked” refer to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation. [0044] The term “promoter” refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition site for RNA polymerase and other factors required for proper transcription. “Promoter” includes a minimal promoter that is a short DNA sequence comprised, in some cases, of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for enhancement of expression. “Promoter” also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements and that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an “enhancer” is a DNA sequence, which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence- specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements, derived from different promoters found in nature, or even be comprised of synthetic DNA segments.

[0045] A promoter may also contain DNA sequences that are involved in the binding of protein factors, which control the effectiveness of transcription initiation in response to physiological or developmental conditions. The "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e., further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.

[0046] Exemplary promoters include, but are not limited to, TDH3, TDH2, CCW 12,

PGK1, ADH1, ADH2, CYC1, HHF1, HHF2, TEF1, TEF2, HTB2, PAB1, AFD6, RNR1, RNR2, POP6, RAD27, PSP2, REV1, MFA1, MFa2, GAF1, CUP1, MET25, ICF1, ICF2, GAF3, HXT1, HXT2, MAL11, MAF31, MAF32, MAF33, MRK1, and SUC2 promoters. In some embodiments, the promoter is the TDH3 promoter.

[0047] In an exemplary aspect, the disclosure provides a recombinant yeast (e.g., Saccharomyces spp.) comprising a polynucleotide encoding a yeast b-lyase enzyme Irc7 operably linked to a heterologous promoter, wherein the b-lyase enzyme comprises an amino acid sequence at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the b-lyase enzyme comprises an amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the b-lyase enzyme does not comprise the amino acid sequence set forth in SEQ ID NO: 3.

[0048] Techniques for the recombinant expression of enzymes in a cell and genetic modification of a recombinant yeast cell are well known to those skilled in the art. Typically such techniques involve transformation of a cell with nucleic acid construct comprising the relevant sequence. Such methods are, for example, known from standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et ak, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987). Methods for transformation and genetic modification of fungal host cells are described in, e.g., European Application No. EP-A-0635574, International Patent Publication No. WO 98/46772, International Patent Publication No. WO 99/60102, International Patent Publication No. WO 00/37671, International Patent Publication No. WO 90/14423, European Application No. EP-A-0481008, European Application No. EP-A-0635574 and U.S. Pat. No. 6,265,186, the disclosures of which are incorporated herein by reference in their entireties.

[0049] Methods

[0050] The disclosure provides a method of converting a non-volatile form of 3-sulfanyl-l- hexanol (3SH) to free 3SH during a brewing process. In one aspect, the method comprises contacting a fermentable sugar source (e.g., cooled wort) with the recombinant yeast described herein (e.g., a recombinant Saccharomyces spp. comprising a polynucleotide encoding a yeast b-lyase enzyme IRC7 comprising an amino acid sequence at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 1, operably linked to a heterologous promoter; (or a recombinant Saccharomyces spp. comprising a polynucleotide encoding a cysteine-thiol lyase PatB, operably linked to a heterologous promoter), under conditions and for a time sufficient to convert non-volatile form of 3SH to free 3SH.

[0051] In another aspect, the disclosure provides a method of converting a non-volatile form of 3-sulfanyl-l-hexanol (3SH) to free 3SH during a brewing process., the method comprising contacting a fermentable sugar source with a cysteine-thiol lyase, under conditions and for a time sufficient to convert non-volatile form of 3SH to free 3SH. In some embodiments, the cysteine-thiol lyase is purified before the contacting step. Purification of cysteine-thiol lyases can be performed as described in Rudden et ah, Scientific Reports, 10:12500, 2020, the disclosure of which is incorporated herein by reference.

[0052] In some embodiments, the fermentable sugar source is wort, grains/cereals, fruit juice (e.g., grape juice, apple juice/cider), honey, cane sugar, rice, or koji.

[0053] In some embodiments, the non-volatile form of 3SH is glutathione-bound 3SH or cysteine-bound-3SH, or a combination thereof. In some embodiments, the method results in a 3-fold increase in free 3SH in the fermentable sugar source (e.g., wort) fermented with the recombinant yeast (e.g., Saccharomyces) compared to the fermentable sugar source (e.g., wort) fermented with non-modified yeast (e.g., Saccharomyces).

[0054] In some embodiments, the method results in a 3-fold increase in free 3SH in the fermentable sugar source (e.g., wort) with the cysteine-thiol lyase compared to the fermentable sugar source (e.g., wort) without the cysteine-thiol lyase.

[0055] In some embodiments, the cysteine-thiol lyase is PatB. In some embodiments, the PatB is from species of Staphylococcus. In some embodiments, the PatB is from S. lugdunensis (SEQ ID NO: 9), S. devriesei (SEQ ID NO: 10), S. hominis (SEQ ID NO: 8), S. haemolyticus (SEQ ID NO: 13), S. petrasii (SEQ ID NO: 11 or SEQ ID NO: 12), or B. subtilis (SEQ ID NO: 14)

[0056] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 8.

[0057] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 9.

[0058] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 10.

[0059] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 11.

[0060] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 12.

[0061] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 13.

[0062] In some embodiments, the PatB comprises an amino acid sequence that is at least 80% identical (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 97%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical) to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the PatB comprises an amino acid sequence set forth in SEQ ID NO: 14.

[0063] The disclosure also provides a method of converting of a non-volatile form of 3- sulfanyl-l-hexanol (3SH) to free 3SH during a brewing process, wherein the method comprises (a) a mash hopping step comprising adding a plant material comprising a non volatile form of 3SH to grist to produce wort; (b) boiling the wort produced by (a); (c) cooling the wort; and (d) contacting the cooled wort with a recombinant Saccharomyces described herein under conditions and for a time sufficient to convert a non-volatile form of 3SH to free 3SH. In some embodiments, the non-volatile form of 3SH is glutathione-bound- 3SH or cysteine-bound-3SH, and combinations thereof.

[0064] In some embodiments, methods of converting a non-volatile form of 3-sulfanyl-l- hexanol (3SH) to free 3SH during a brewing process can be performed in the absence of a recombinant yeast comprising a polynucleotide a cysteine-thiol lyase operably linked to a heterologous promoter. In this regard, the disclosure also provides a method of converting of a non-volatile form of 3-sulfanyl-l-hexanol (3SH) to free 3SH during a brewing process, wherein the method comprises (a) a mash hopping step comprising adding a plant material comprising a non-volatile form of 3SH to grist to produce wort; (b) boiling the wort produced by (a); (c) cooling the wort; and (d) contacting the cooled wort with a purified cysteine-thyol lyase under conditions and for a time sufficient to convert a non-volatile form of 3SH to free 3SH. In some embodiments, the non-volatile form of 3SH is glutathione-bound- 3 SH or cysteine-bound-3SH, and combinations thereof.

[0065] The phrase “plant material comprising a non-volatile form of 3SH” refers to any plant (or plant part) containing glutathione-bound-3SH, cysteine-bound-3SH, or combinations thereof. The term “plant parts” encompasses all components of a plant including seeds, shoots, stems, leaves, roots, flowers, and plant tissues. In some embodiments, the plant material has been processed prior to being added to the grist. Exemplary methods of processing plant material include, but are not limited to, crushing, pressing, slicing, blending, juicing, rolling, pulverizing or grinding the plant material.

[0066] In some embodiments, the plant material comprising a non-volatile form of 3SH is hops. Hops suitable for use in the methods described herein include, but are not limited to, Amarillo, Apollo, Cascade, Centennial, Chinook, Citra, Cluster, Columbus, Crystal, Eroica, Galena, Glacier, Greenburg, Horizon, Liberty, Millenium, Mount Hood, Mount Rainier, Newport, Nugget, Palisade, Santiam, Simcoe, Sterling, Summit, Tomahawk, Ultra,

Vanguard, Warrior, Willamette, Zeus, Admiral, Brewer's Gold, Bullion, Challenger, First Gold, Fuggles, Goldings, Herald, Northdown, Northern Brewer, Phoenix, Pilot, Pioneer, Progress, Target, Whitbread Golding Variety (WGV), Hallertau, Hersbrucker, Saaz,

Tettnang, Spalt, Feux-Coeur Francais, Galaxy, Green Bullet, Motueka, Nelson Sauvin,

Pacific Gem, Pacific Jade, Pacifica, Pride of Ringwood, Riwaka, Southern Cross, Lublin, Magnum, Perle, Polnischer Lublin, Saphir, Satus, Select, Strisselspalt, Styrian Goldings, Tardif de Bourgogne, Tradition, Bravo, Calypso, Chelan, Comet, El Dorado, San Juan Ruby Red, Satus, Sonnet Golding, Super Galena, Tillicum, Bramling Cross, Pilgrim. Hallertauer Herkules, Hallertauer Magnum, Hallertauer Taurus, Merkur, Opal, Smaragd, Halleratau Aroma, Kohatu, Rakau, Stella, Sticklebract, Summer Saaz, Super Alpha, Super Pride, Topaz, Wai-iti, Bor, Junga, Marynka, Premiant, Sladek, Styrian Atlas, Styrian Aurora, Styrian Bobek, Styrian Celeia, Sybilla, and Sorachi Ace hops. In some embodiments, the hops are Cascade, Calypso, Hallertau Tradition, Hallertau Perle, Triple Pearl, Nugget, Saaz, Columbus/CTZ, Chinook, Nelson Sauvin, Hallertau Blanc, and/or Simcoe hops.

[0067] In some embodiments, the hops contain at least about 400 pg/kg of cysteine -bound 3SH. For example, in some embodiments, the hops contain at least about 400 pg/kg, at least about 450 pg/kg, at least about 500 pg/kg, at least about 550 pg/kg, at least about 600 pg/kg, at least about 650 pg/kg, at least about 700 pg/kg, at least about 750 pg/kg, at least about 800 pg/kg, at least about 850 pg/kg, at least about 900 pg/kg, at least about 950 pg/kg, or at least about 1000 pg/kg cysteine-bound-3SH. In some embodiments, the hops contain an amount of cysteine-bound-3SH ranging from about 400 pg/kg to about 1000 pg/kg, or from about 500 pg/kg to about 900 pg/kg, or from about 600 pg/kg to about 800 pg/kg, or from about 400 pg/kg to about 600 pg/kg.

[0068] In some embodiments, the hops contain at least about 5000 pg/kg glutathione-3SH. For example, in some embodiments, the hops contain at least about 5000 pg/kg, at least about 5500 pg/kg, at least about 6000 pg/kg, at least about 6500 pg/kg, at least about 7000 pg/kg, at least about 7500 pg/kg, at least about 5000 pg/kg, at least about 8500 pg/kg, at least about 9000 pg/kg, at least about 9500 pg/kg, or at least about 10,000 pg/kg, at least about 10,500 pg/kg, at least about 11,000 pg/kg, at least about 11,500 pg/kg, at least about 12,000 pg/kg, at least about 12,500 pg/kg, at least about 13,000 pg/kg, at least about 13,500 pg/kg, at least about 14,000 pg/kg, at least 14,500 pg/kg, at last about 15,000 pg/kg, at least about 15,500 pg/kg, at least about 16,000 pg/kg, at least about 16,500 pg/kg, at least about 17,000 pg/kg, at least about 17,500 pg/kg, at least about 18,000 pg/kg, at least about 18,500 pg/kg, at least about 19,000 pg/kg, at least about 19,500 pg/kg, or at least about 20,000 pg/kg glutathione- bound-3SH. In some embodiments, the hops contain an amount of glutathione-bound-3SH ranging from about 5000 pg/kg to about 1000 pg/kg, or from about 5500 pg/kg to about 9000 pg/kg, or from about 6000 pg/kg to about 8000 pg/kg, or from about 4000 pg/kg to about 6000 pg/kg, or from about 5000 pg/kg to about 8000 pg/kg, or from about 8000 pg/kg to about 12,000 pg/kg, or from about 10,000 pg/kg to about 20,000 pg/kg, or from about 15,000 pg/kg to about 20,000 pg/kg.

[0069] In some embodiments, plant material comprising a non-volatile form of 3SH is grape-derived product. Suitable grape derived products include, e.g., crushed grapes and grape flour. The grape-derived product may be obtained from a white grape, a red grape, or combinations thereof. Exemplary white grape varieties include, but are not limited to, Sauvignon Blanc, Chardonnay, Chenin Blanc, Colombard, Gewurztraminer, Gros Manseng, Koshu, Maccabeo, Muscat, Petit Manseng, Pinot Blanc, Pinot Gris, Riesling, Scheurebe, Semilion, Sylvaner, and Tokay. Exemplary red grape varieties include, but are not limited to, Cabernet Franc, Cabernet Sauvignon, Grenache, Merlot, and Pinot Noir.

[0070] In some embodiments, the grape-derived product contains at least about 400 pg/kg of cysteine-bound 3SH. For example, in some embodiments, the grape-derived product contains at least about 400 pg/kg, at least about 450 pg/kg, at least about 500 pg/kg, at least about 550 pg/kg, at least about 600 pg/kg, at least about 650 pg/kg, at least about 700 pg/kg, at least about 750 pg/kg, at least about 800 pg/kg, at least about 850 pg/kg, at least about 900 pg/kg, at least about 950 pg/kg, or at least about 1000 pg/kg, or at least about 1500 pg/kg, or at least about 2000 pg/kg, or at least about 2500 pg/kg, or at least about 3000 pg/kg, or at least 3500 pg/kg, or at least about 4000 pg/kg, or at least about 4500 pg/kg, or at least about 5000 pg/kg, at least about 5500 pg/kg, at least about 6000 pg/kg, at least about 6500 pg/kg, at least about 7000 pg/kg, at least about 7500 pg/kg, at least about 8000 pg/kg, at least about 8500 pg/kg, at least about 9000 pg/kg, at least about 9500 pg/kg, or at least about 10,000 pg/kg, at least about 10,500 pg/kg, at least about 11,000 pg/kg, at least about 11,500 pg/kg, at least about 12,000 pg/kg, at least about 12,500 pg/kg, at least about 13,000 pg/kg, at least about 13,500 pg/kg, at least about 14,000 pg/kg, at least 14,500 pg/kg, at last about 15,000 pg/kg, at least about 15,500 pg/kg, at least about 16,000 pg/kg, at least about 16,500 pg/kg, at least about 17,000 pg/kg, at least about 17,500 pg/kg, at least about 18,000 pg/kg, at least about 18,500 pg/kg, at least about 19,000 pg/kg, at least about 19,500 pg/kg, or at least about 20,000 pg/kg, or at least 20,500 pg/kg, or at least 21,000 pg/kg, or at least 21,500 pg/kg, or at least 22,000 pg/kg, or at least 22,500 pg/kg, or at least 23,000 pg/kg, or at least 23,500 pg/kg, or at least 24,000 pg/kg, or at least 24,500 pg/kg, or at least 25,000 pg/kg, or at least 25,500 pg/kg, or at least 26,000 pg/kg, or at least 26,500 pg/kg, or at least 27,000 pg/kg, or at least

27.500 pg/kg, or at least 28,000 pg/kg, or at least 28,500 pg/kg, or at least 29,000 pg/kg, or at least 29,500 pg/kg, or at least 30,000 pg/kg, or at least 30,500 pg/kg, or at least 31,000 pg/kg, or at least 31,500 pg/kg, or at least 32,000 pg/kg, or at least 33,000 pg/kg, or at least 33,500 pg/kg, or at least 34,000 pg/kg, or at least 34,500 pg/kg, or at least 35,000 pg/kg, or at least

35.500 pg/kg, or at least 36,000 pg/kg cysteine-bound-3SH. In some embodiments, the grape derived product contains an amount of cysteine -bound-3SH ranging from about 400 pg/kg to about 1000 pg/kg, or from about 500 pg/kg to about 900 pg/kg, or from about 600 pg/kg to about 800 pg/kg, or from about 400 pg/kg to about 600 pg/kg, or from about 400 pg/kg to about 36,000 pg/kg, or from about 20,000 pg/kg to about 36,000 pg/kg or from about 5000 mg/kg to about 8000 mg/kg, or from about 8000 mg/kg to about 12,000 mg/kg, or from about 10,000 mg/kg to about 20,000 mg/kg, or from about 15,000 mg/kg to about 20,000 mg/kg.

[0071] In some embodiments, the grape-derived product contains at least about 5000 pg/kg glutathione-3 SH. For example, in some embodiments, the grape-derived product contains at least about 5000 pg/kg, at least about 5500 pg/kg, at least about 6000 pg/kg, at least about 6500 pg/kg, at least about 7000 pg/kg, at least about 7500 pg/kg, at least about 8000 pg/kg, at least about 8500 pg/kg, at least about 9000 pg/kg, at least about 9500 pg/kg, at least about 10,000 pg/kg, at least about 10,500 pg/kg, at least about 11,000 pg/kg, at least about 11,500 pg/kg, at least about 12,000 pg/kg, at least about 12,500 pg/kg, at least about 13,000 pg/kg, at least about 13,500 pg/kg, at least about 14,000 pg/kg, at least 14,500 pg/kg, at last about 15,000 pg/kg, at least about 15,500 pg/kg, at least about 16,000 pg/kg, at least about 16,500 pg/kg, at least about 17,000 pg/kg, at least about 17,500 pg/kg, at least about 18,000 pg/kg, at least about 18,500 pg/kg, at least about 19,000 pg/kg, at least about 19,500 pg/kg, or at least about 20,000 pg/kg, or at least 30,000 pg/kg, or at least 35,00 pg/kg, or at least 40,000 pg/kg, or at least 45,000 pg/kg, or at least 50,000 pg/kg glutathione-bound-3SH. In some embodiments, the grape-derived product contains an amount of glutathione -bound-3SH ranging from about 5000 pg/kg to about 1000 pg/kg, or from about 5500 pg/kg to about 9000 pg/kg, or from about 6000 pg/kg to about 8000 pg/kg, or from about 4000 pg/kg to about 6000 pg/kg, or from about 400 pg/kg to about 36,000 pg/kg, or from about 20,000 pg/kg to about 50,000 pg/kg or from about 5000 pg/kg to about 8000 pg/kg, or from about 8000 pg/kg to about 12,000 pg/kg, or from about 10,000 pg/kg to about 20,000 pg/kg, or from about 15,000 pg/kg to about 20,000 pg/kg..

[0072] In some embodiments, the mash hopping step comprises adding less than 100 grams of the plant material per kg of grist (e.g., adding less than 75 grams of the plant material per kg of grist or less than 50 grams of the plant material per kg of grist). In some embodiments, the mash hopping step comprises adding between 75-100 grams of the plant material per 1 kg of grist. In some embodiments, the mash hopping step comprises adding between 50-75 grams of the plant material per 1 kg of grist. In some embodiments, the mash hopping step comprises adding between 25-50 grams of plant material per 1 kg of grist. In some embodiments, the mash hopping step comprises adding between 1-25 grams of plant material per 1 kg of grist. In some embodiments, the mash hopping step comprises adding both hops and a grape-derived product to the grist. [0073] Optionally, the mash hopping step comprises a protein rest before the boiling step. For example, in some embodiments, the protein rest comprises maintaining the mash at a temperature of less than 120°F (e.g., between 100°F and 120°F) for at least five minutes (e.g., at least about 5 minutes, or at least about 10 minutes, or at least about 15 minutes, or at least about 20 minutes, or at least about 25 minutes, or at least about 30 minutes, or at least about 5 minutes, or at least about 40 minutes, or at least about 45 minutes, or at least about 50 minutes, or about one hour before the boiling step. In some embodiments, the protein rest comprises maintaining the mash at a temperature of less than 120°F (e.g., between 100°F and 120°F) for no more than one hour before the boiling step. In some embodiments, the protein rest comprises maintaining the mash at a temperature of less than 120°F (e.g., between 100°F and 120°F) for a time ranging from 5 minutes to one hour (or from about 5 minutes to about 20 minutes, or about 5 minutes to about 10 minutes, or from about 10 minutes to about 30 minutes, or about 10 minutes to about one hour) before the boiling step.

[0074] In some embodiments, the mash hopping step further comprises a saccharification rest after the protein rest and before the boiling step. For example, in some embodiments, the saccharification rest comprises maintaining the mash at a temperature of less than 160°F (e.g., between 140°F and 160°F) for at least 15 minutes hour before the boiling step. In some embodiments, the saccharification rest comprises maintaining the mash at a temperature of less than 160°F (e.g., between 140°F and 160°F, or between 148°F and 158°F) for at least about 15 minutes, or at least about 20 minutes, or at least about 25 minutes, or at least about 30 minutes, or at least about 5 minutes, or at least about 40 minutes, or at least about 45 minutes, or at least about 50 minutes, or at least about 60 minutes, or about 65 minutes, or about 70 minutes, or about 75 minutes, or about 80 minutes, or about 85 minutes or about 90 minutes. In some embodiments, the saccharification rest comprises maintaining the mash at a temperature of less than 160°F (e.g., between 140°F and 160°F, or between 148°F and 158°F) for a time ranging from 15 minutes to 90 minutes (or from about 15 minutes to about 30 minutes, or about 20 minutes to about 60 minutes, or from about 20 minutes to about 40 minutes, or about 60 minutes to about 90 minutes) before the boiling step.

[0075] In various embodiments, the method further comprises contacting the cooled wort with hops to produce an admixture, and contacting the admixture with the recombinant Saccharomyces. In some embodiments, the recombinant Saccharomyces is S. cerevisiae or S. pastorianus. [0076] In some embodiments, the contacting step occurs in a fermenter at a temperature ranging from 45°F-100°F. In some embodiments, the contacting step occurs for a period of time ranging from 3 days to 14 days (e.g., about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 14 days.

[0077] Methods of converting other non-volatile thiols (e.g., glutathione-bound- or cysteine-bound-, non-3SH thiols) in a brewing process are also contemplated. For example, it is contemplated that the methods described herein are useful for converting glutathione bound- or cysteine bound-4MSP, glutathione bound- or cysteine bound-3SH or glutathione bound- or cysteine bound-3SHA) to their aromatic, free forms.

[0078] In any of the methods described herein, the wort optionally comprises at least 60 ng/L free 3SH after the contacting step. In some embodiments, the wort comprises about 60 ng/L (or about 65 ng/L, or about 70 ng/L, or about 75 ng/L, or about 80 ng/L, or about 85 ng/L, or about 90 ng/L, or about 95 ng/L, or about 100 ng/L, or about 110 ng/L, or about 120 ng/L, or about 130 ng/L, or about 140 ng/L, or about 150 ng/L, or about 160 ng/L, or about 170 ng/L, or about 180 ng/L, or about 190 ng/L, or about 200 ng/L, or about 250 ng/L, or about 300 ng/L, or about 350 ng/L, or about 400 ng/L, or about 450 ng/L, or about 500 ng/L, or about 550 ng/L, or about 600 ng/L, or about 650 ng/L, or about 700 ng/L, or about 750 ng/L, or about 800 ng/L, or about 850 ng/L, or about 900 ng/L, or about 950 ng/L, or about 1000 ng/L) free 3SH after the contacting step. Free thiol in the sample can be analyzed, for example, by stable isotope dilution assay and nano-liquid chromatography tandem mass spectrometry (Nano LC-MS/MS) (Roland et al., J. Chromatography A, 1468:154-163, 2016, the disclosure of which is incorporated herein by reference). Methods of quantifying an amount of free thiols in a sample can be performed, for example, by derivatization and high- performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) (Capone et al., Anal. Chem., 87:1226-1231, 2015, the disclosure of which is incorporated by reference).

[0079] In some embodiments, the method results in a 6-fold increase in free 3SH in wort fermented with the recombinant Saccharomyces compared to wort fermented with non- modified Saccharomyces.

EXAMPLES

Example 1 - Recombinant Saccharomyces [0080] An integration cassette containing the KANMX4 gene along with the TDH3 promoter element was amplified with primers containing 80 bp homology to the IRC7 promoter (SEQ ID NO: 5: 5’-

AAAAGGCTCCTGATGAAACTGGAGAGTCTCTTTGTTCTGAAATTTTTAAAGTTTA GCACACCATATAG-3’ (forward primer) and SEQ ID NO: 6: 5’-

TCCAATAACAGACAGTTGCGTAGTAATACCAAACTTCGATAACTCGGTACGATCA ATCATTTTGTTTGTTTATGTGTGTTTATTCGAAAC-3’ (reverse primer). This cassette was transformed into the respective S. cerevisiae parent strains OYL-088 (WGS of yeast strain A.US-05 (SRR8173067)) and OYL-011 (WGS of yeast strain YMD1872 (SRR8172941)) resulting in a targeted integration of the KANMX-TDH3pr sequence upstream IRC7. PCR confirmation of the resulting G418-resistant colonies verified the successful integration resulting in TDH3 promoter-driven overexpression of IRC7. The expressed IRC7 alleles were further sequenced and aligned to wildtype IRC7 sequence (Figure 1). SNPs and resulting amino acid substitutions are noted below in Table 1.

[0081] Table 1.

[0082] Results indicated that the modified OYL-088 strain expressed an active allele of IRC7 (amino acid sequence set forth in SEQ ID NO: 1, polynucleotide sequence set forth in SEQ ID NO: 2), whereas the SNPs present in the polynucleotide encoding IRC7 in the modified OYL-011 strain led to expression of an inactive allele of IRC7 (amino acid sequence set forth in SEQ ID NO: 3, polynucleotide sequence set forth in SEQ ID NO: 4).

Example 2 - Brewing methods

[0083] Using a small pilot brewing system, wort was prepared with a "brew in the bag" or BIAB method. For the mash hopped samples, 2-Row Brewer's Malt (Briess Malting) and Cascade hops (Hopsteiner) were steeped at 120°F for 15 minutes for a protein rest and then heated to 148°F for 15 minutes for a saccharification rest. The grain and hops were removed from the wort, and the volume was adjusted to target 10°P at the beginning of the boil. The wort was boiled for 30 minutes and then transferred into a whirlpool stand for an additional 15 before cooling into flasks. The resulting wort (12°P) was fermented with either OYL-088, OYL-011, OYL-088 TDH3-IRC7, or OYL-011 TDH3-IRC7. The same process was performed for the dry hopped samples, but hops were omitted from the mash and later added on the second day of fermentation at the same hopping rate of 8 g/L (~2 lb/bbl). Wort samples and beer samples were collected in 50 ml conical tubes, 1.5 mg/L of sodium metabisulfite was added to the samples and samples were immediately frozen. The samples were assessed by derivatization and HPLC-MS/MS as described in Capone et al. (Anal. Chem., 87:1226-1231, 2015) and also by stable isotope dilution assay and Nano LC-MS/MS as described by Roland et al. (J. Chromatography A, 1468:154-163, 2016).

[0084] As shown in Figure 2, in beer samples fermented with OYL-088 TDH3-IRC7, free 3SH levels increased nearly 3-fold compared to the non-modified strain (OYL-088). 3SH levels in the same beer made with OYL-011 and OYL-011 TDH3-IRC7 remained unchanged in comparison (due to its inactive allele of IRC7). Surprisingly, in the mash hopped beer samples fermented with OYL-088 TDH3-IRC7, free 3SH levels increased nearly 6-fold compared to the non-modified strain (OYL-088). 3SH levels in the same beer made with OYL-011 and OYL-011 TDH3-IRC7 remained unchanged in comparison (due to its inactive allele of IRC7).

[0085] The results described above were surprising, at least in part, in view of reports that b-lyase overexpression (specifically, IRC7 overexpression) in Saccharomyces does not produce free 3-SH (Denby et al., WBC Connect 2020, Poster 159). In the course of the experiments described herein, it was determined that previous studies utilized an inactive form of IRC7. In another study examining cell extracts for endogenous b-lyase activity (i.e., not an overexpression study), it was determined that Irc7 with the V348L substitution (same as in SEQ ID NO: 1) was inactive (Curtin et al., “Mutations in carbon-sulfur b-lyase encoding gene IRC7 affect the polyfunctional thiol-releasing capability of brewers yeast,” World Brewing Congress Connect 2020, Poster 157). Unexpectedly, and as shown herein, Irc7 comprising an amino acid sequence set forth in SEQ ID NO: 1 does efficiently convert non-volatile thiols available in plant matter into their free, aromatic forms. Additionally, use of active b-lyase in a mash hopping step results in a significant increase in the conversion of non-volatile thiols to their free forms.

Example 3 - Recombinant Yeast [0086] Gblocks were synthesized by IDT and cloned into a yeast shuttle vector with a HYGB selective marker. These Gblocks contained a polynucleotide encoding a PatB from S. hominis (SEQ ID NO. 8), IRC7 from S. cerevisiae (SEQ ID NO. 1), or IRC7 from S. pastorianus (SEQ ID NO. 7) under regulation by the PGK1 promoter and CYC1 terminator. The vectors were then transformed into a lager brewing strain (OYL-106) and isolates were grown on YPD-HYGB agar plates. These isolates were inoculated into YPD+HYGB to assay for sulfur production with lead acetate strips. The lead acetate strips showed significant darkening with the S. pastorianus IRC7 allele, less with the S. cerevisiae IRC7 allele and little to no darkening with the S. hominis PatB allele and empty vector control. The isolates were propagated in 250 ml of dried malt extract medium + HYGB for small flask fermentations. After 48 hours of growth, each propagation culture was centrifuged and 10 million cells/ml were used to inoculate 300 ml of 15°P Wort prepared from 2-row barley malt. The fermentation proceeded for 1 week at which time sensory was performed. The resulting sensory impact of the S. hominis PatB allele was significantly more pronounced than the cerevisiae IRC7 allele and empty vector control. The major aromatic descriptor for the S. hominis PatB fermentation was intense passionfmit, guava and grapefruit, all characteristic of the 3SH thiol.

[0087] Investigation into additional PatB alleles was performed in a similar manner described above. Plasmids with PatB alleles from S. anginosus, S. cohnii and B. subtilis (SEQ ID NO: 14) were transformed into the lager brewing strain (OYL-106) and compared to the S. hominis PatB allele. The resulting wort fermentations were assessed by sensory. The fermentation with overexpression of the B. subtilis PatB allele resulted in a comparable level of passionfmit and guava aromas as the S. hominis PatB allele, whereas the fermentations with overexpression of S. anginosus and S. cohnii PatB alleles showed little to no considerable enhancement of aroma relative to the control fermentation with no overexpression.

Example 4 - Comparison of the effect of PatB cysteine-thiol lyase and Irc7, and TnaA b -lyase Enzymes on Thiol Release

[0088] Trial fermentations were performed to evaluate the activity and specificity of the Irc7, PatB and TnaA b-lyase enzymes. Wort was prepared in a commercial brewhouse by mashing malted 2-row barley at 148°F for 30 minutes for saccharification followed by a 5 minute inactivation of enzyme activity at 180°F. The runoff of the mash was collected and boiled for 30 minutes. The malt extract was diluted to 15 °P and cooled to 70°F prior to inoculating with one of the following: OYL-011, OYL-011 + Irc7, OYL-011 + PatB or OYL- 011 + TnaA. Fermentation flasks were configured with a hydrogen sulphide detector tube (4H Gastec) to quantify the cumulative FhS released throughout fermentation. When fermentation was completed (after 11 days), FhS levels were recorded, and the resulting beer was analyzed for free thiols 3SH and 4MSP. The results are show below in Table 2.

[0089] Table 2. n.d. = not determined

[0090] As shown above, strains expressing the S. hominis PatB cysteine-thiol lyase have enhanced 3SH output and reduced FhS output relative to strains expressing the S. cerevisiae Irc7 b-lyase. The S. hominis PatB allele also shows enhanced 4MSP relative to another enzyme with known b-lyase activity, TnaA tryptophanase from C. amalonaticus .