MATERIALS AND METHODS FOR IDENIFYING COMPOUNDS THAT MODULATE THE CELL CYCLE

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of priority to U.S. Provisional Patent Applications Nos. 60/615,558, filed October 2, 2004; 60/628,677, filed November 16, 2004; and 60/633,849, filed December 7, 2004, all of which are incorporated herein by reference in their entirety. FUNDING

Work described herein was at least partially funded by National Institute of Health, Grant No.: ROl HL75609. Accordingly, the US government has certain rights in the invention.

FEELD OF THE INVENTION

The present invention relates generally to methods, materials and systems for screening for compounds that modulate the cell cycle, particular aspects relate methods, materials and systems involving cell cycle regulatory proteins known as the D-type cyclins. ^•

BACKGROUND OF THE INVENTION

Adult mammalian cardiomyocytes are currently understood to exhibit limited proliferative potential. As a result, the mammalian myocardium lacks significant capacity for regenerative growth. Regenerative myocardial growth has enormous therapeutic potential, for example to address many forms of cardiovascular disease characterized by cardiomyocyte death with an ensuing loss of myocardial function.

Consequently, efforts have been made to develop strategies to induce cardiomyocyte proliferation. A number of factors have been shown to augment cardiomyocyte DNA synthesis in vitro (Oberpriller, J. O., et al., The Development and Regenerative

Potential of Cardiac Muscle, Hardwood Academic Publishers, Chur, Switzerland/New

York (1991)).

The onset of gene transfer techniques has spurred various studies to test the ability of a specific gene product to augment myocardial proliferation in vitro or in vivo. For example, such studies have been carried out involving the forced expression of v-myc (Saule, S. et al., Proc. Natl. Acad. Sci. USA 84:7982-7986 (1987);

Engelmann, G. L. et al., J. MoI. Cell. Cardiol. 25: 197-213 (1993)), c-myc (Jackson, T. et al., MoL Cell. Biol. 10:3709-3716 (1990); Jackson, T. et al., MoI. Cell. Biochem.

104:15-19 (1991)), IGF-IB (Reiss, K. et al., Proc. Natl. Acad. Sci. USA 93:8630-8635 (1996)), ElA (Kirshenbaum, L. A., and M. D. Schneider, J. Biol. Chem. 270:7791-

7794 (1995)), and SV40 T antigen (Field, L. J., Science 239:1029-1033 (1988); Katz,

E., et al., Am. J. Physiol. 262:H1867-H1876 (1992)).

Although these research efforts have demonstrated that forced expression of cellular protooncogenes or transforming oncogenes from DNA tumor viruses can promote cardiomyocyte DNA synthesis, and in some cases proliferation, progress on the identification of genes which might be useful to induce regenerative myocardial growth has been difficult and slow.

The mammalian cell cycle has been an area of considerable research interest for many years. This cycle includes a first phase of growth known as the Gl phase, and proceeds then to the S phase, in which DNA replication occurs. The S phase is followed by a second phase of growth known as the G2 phase where cells increase in mass. The cycle terminates in the M phase, which involves nuclear division and

cytokinesis. Passage through this cell cycle is regulated at several checkpoints. A highly orchestrated cascade ensures that all requisite activities (genome reduplication, DNA repair, chromosome segregation, etc.) are completed before the initiation of the next step of the cell cycle. The presence of multiple checkpoints can also provide mechanisms for identifying and eliminating of aberrantly growing or genetically compromised cells.

Transition through the cell cycle checkpoints is regulated in part by the activity of a family of protein kinases, the cyclin dependent kinases (CDKs), and their activating partners, the cyclins. In most instances, the initiation of DNA synthesis requires transit through the so-called restriction point, which is at the Gi/S boundary of the cell cycle. Transit through this restriction point is to a large extent regulated by CDK4 and the D-type cyclins (See, Hunter, T. and J. Pines, Cell 79:573-582 (1994); Grana, X. and E. P. Reddy, Oncogene 11:211-219 (1995)). In mammals, there are three D-type cyclins, designated cyclin Dl, cyclin D2 and cyclin D3. For additional discussion of the interaction between specific cyclins and kinases and their effect on the cell cycle, see for example, Brooks, A. R., et al., J. B. C, Vol. 271 No. 15, 9090- 9099 (1996). While some level of understanding of the roles of these individual D- type cyclins has developed, many aspects of their function remain unknown.

In view of this background, there remains a need for additional strategies for investigating the roles of these D-type cyclins, and for identifying and developing compounds that may affect the proliferative capacity of cells by affecting the intracellular regulation of one or more of these D-type cyclins. The present invention, in several aspects, is addressed to these needs.

SUMMARY OF THE INVENTION

In certain embodiments, the present invention provides screening methods for identifying therapeutic molecules capable of altering D-type cyclin expression. In certain forms of the invention, cardiomyocytes are used to monitor the expression of endogenous D-type cyclins. For example, primary or stem cell-derived cardiomyocytes can be plated on suitably formatted tissue culture plates, and contacted with candidate molecules, for example including chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. After this contacting, the cultures can be processed for anti-cyclin D immune cytochemistry. In doing so, certain aspects of the invention involve monitoring multiple D-type cyclins using fluorescent secondary antibodies with different fluorophores (e.g., FITC for cyclin Dl, rhodamine for cyclin D2, etc.). Using such fluorophores the level of D- type cyclin expression can be quantitated, and/or the subcellular location of expressed D-type cyclins (e.g. nuclear or cytoplasmic) can be assessed. Molecules that alter expression of the D-type cyclin or cyclins in a desired manner can be processed through additional screens, for example, to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo.

In other inventive embodiments, screens for identifying molecules capable of altering D-type cyclin expression utilize reporter transgenes that include transcriptional regulatory elements of the D-type cyclin genes, combined with a suitable expressed molecule for monitoring the transcription of the D-type cyclin genes. In such methods, cardiomyocytes with the reporter transgenes can be plated onto suitably formatted tissue culture plates and contacted with candidate molecules for example including chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures are then processed to monitor for the expression of the reporter gene product. In various modes of practicing this embodiment, the cardiomyocytes may be derived from transgenic animals which include cardiomyocytes having the reporter transgenes, by transfection of cardiomyocytes with appropriate viral vectors, or by differentiating stem cells carrying the reporter transgenes and optionally isolating cardiomyocytes derived therefrom. In certain embodiments of the invention, the activity of multiple cyclin transcriptional regulatory elements is monitored simultaneously, e.g. using differing reporters, for

example by using a reporter gene wherein the cyclin D 1 transcriptional regulatory elements target expression of sequences encoding enhanced green fluorescent protein, in combination with a reporter gene wherein the cyclin D2 transcriptional regulatory elements target expression of sequences encoding enhanced yellow fluorescent protein. Alternatively, flag-tagged, talon-tagged or other reporters, as well as sequences encoding unmodified cyclin molecules, can be employed to monitor the transcription of the D-type cyclin genes. The level of expression of the transgenes is then quantitated. Molecules that alter expression of the transgenes in a desired way can be processed through one or more additional screens, for example to determine their efficacy in inducing regenerative cardiac growth in vitro and in vivo.

In additional embodiments of the invention, non-cardiomyocyte cells are used in screens to identify molecules capable of altering D-type cyclin expression. These cells may be capable of expressing their endogenous D-type cyclins, and/or can be genetically altered to express transgenes comprising the transcriptional regulatory elements of the cyclin D genes, and a suitable reporter gene, so that D-type cyclin transcriptional activity can be monitored. These cells can be plated on suitably formatted tissue culture plates and contacted with candidate molecules, for example including chemical libraries, RNAi libraries or candidates, or dominant negative protein libraries. The cultures can then processed to monitor the expression of the endogenous D-type cyclins and/or the reporter gene product, and the level of expression is quantitated. Compounds that alter expression in a desired way can then be processed through an additional screen using cardiomyocytes, for example, a cardiomyocyte-based screen such as any described herein. Thereafter, compounds that alter expression in the cardiomyocyte-based screen in a desired fashion can be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo.

In other embodiments of the invention, screening methods are provided for identifying molecules capable of altering the sub-cellular localization of one or more D-type cyclins. In certain forms, these screening methods utilize cardiomyocytes to monitor the sub-cellular localization of endogenous D-type cyclins. In such screens, primary or stem cell-derived cardiomyocytes can be plated onto suitably formatted tissue culture plates. The cultured cardiomyocytes can be contacted with candidate

molecules, including for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures can then be processed for anti-cyclin D immune cytochemistry or other similar techniques to identify the sub-cellular localization of the D-type cyclin or cyclins. In certain embodiments, multiple D-type cyclins are simultaneously monitored using fluorescent secondary antibodies with different fluorophores (e.g. FTTC for cyclin Dl, and rhodomine for cyclin D2). Molecules that alter the sub-cellular localization of one or more D type cyclins in a desired fashion can then be processed through additional screen, for example to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo.

In other embodiments of the invention, screening methods utilize reporter transgenes including a transcriptional regulatory element operably associated and driving the expression of a sequence encoding and intact or generically modified D- type cyclin. The reporter transgenes are suitable and used to monitor the sub-cellular localization of the expressed D-type cyclin or cyclins. In such screening methods, cardiomyocytes can be plated onto suitably formatted tissue culture plates. The cardiomyocytes may, for example, be obtained from transgenic animals harboring cardiomyocyte cells containing the reporter transgenes, by direct transfection of cardiomyocytes with viral vectors, or by differentiation of stem cells carrying the reporter transgenes to obtain cardiomyocytes and optionally isolating a population of cardiomyocytes. In a further step of the screening method, the cultured cells are contacted with candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. After contact with the candidate molecule or molecules, the cultures can be processed to monitor the sub- cellular localization of the native or modified D-type cyclin. In certain embodiments, multiple D-type cyclins are monitored simultaneously, e.g. using differing reporters, for example by using a reporter transgene wherein a transcriptional regulatory element targets expression of a cyclin D I/enhanced green fluorescent protein fusion protein in combination with a reporter transgene in which a transcriptional regulatory element targets expression of a cyclin D2/enchanced yellow fluorescent protein fusion protein. Alternatively, flag-tagged, talon-tagged or other reporters, as well as unmodified cyclin molecules, can also be employed. The sub-cellular localization of the D-type

cyclin is thereby determined, and compounds that alter the sub-cellular localization in the desired fashion can be processed through additional screens, for instance to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In other embodiments of the invention, non-cardiomyocyte cells are used in screening to identify molecules capable of altering the sub-cellular localization of one or more D-type cyclins. These cells may be in their native form or may be genetically modified to express a transgene comprising a transcriptional regulatory element operably associated with a nucleotide sequence encoding and intact or genetically modified D-type cyclin, suitable for monitoring the sub-cellular localization of the D- type cyclin. The cells are plated onto suitably formatted tissue culture plates. Candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries, are then contacted with the cultured cells. The cell cultures can then be processed to monitor the sub-cellular localization of the endogenous D-type cyclin or the transgene-coated D-type cyclin. Such monitoring can be facilitated by the expression of a D-type cyclin fusion protein with a fluorescent molecule, such as enhanced green fluorescent protein or enhanced yellow fluorescent protein. In certain modes of the invention, multiple D-type cyclins are monitored simultaneously, e.g. using differing reporters, for example by using a cyclin Dl /enhanced green fluorescent protein fusion protein in combination with a cyclin D2/enhanced yellow fluorescent protein fusion protein. Alternatively, flag- tagged, talon-tagged or other reporters, as well as unmodified cyclin molecules, can be employed. Molecules that alter the sub-cellular localization of the D-type cyclin or cyclins in a desired fashion can then be processed through an additional screen using cardiomyocytes, for example one designed to determine the efficacy of the molecule in inducing regenerative cardiac growth in vitro and/or in vivo. Candidate molecules that successfully alter the sub-cellular localization of the D-type cyclin or cyclins in the cardiomyocyte-based screens in a desired fashion can then be processed through still further screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo.

Still further embodiments of the invention provide screening methods for identifying molecules capable of altering D-type cyclin stability. In certain

embodiments, such screening methods utilize cardiomyocytes to monitor stability of endogenous D-type cyclin or cyclins. In a first step, primary or stem cell-derived cardiomyocytes are plated on suitably formatted tissue culture plates. The cultured cells are then contacted with one or more candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures are then processed for anti-cyclin D immune cytochemistry to determine the stability of the D-type cyclin or cyclins. In certain embodiments, multiple cyclins are simultaneously monitored using fluorescent secondary antibodies with different fluorphores (e.g. FTTC for cyclin Dl, rhodamine for cyclin D2, etc.). Molecules that alter the stability of the D-type cyclin in a desired fashion can be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo.

In other embodiments of the invention, screening methods are provided using reporter transgenes including a transcriptional regulatory element operatively associated and driving expression of sequences encoding an intact or genetically modified D-type cyclin suitable for monitoring the stability of the D-type cyclin. In such methods, cardiomyocytes are plated upon suitably formatted tissue culture plates. These cardiomyocytes may be obtained from transgenic animals harboring cardiomyocyte cells including the reporter transgenes, by direct transfection of cardiomyocytes with viral vectors, or by the differentiation of stem cells carrying the reporter transgenes to obtain cardiomyocytes, and optionally isolating the cardiomyocytes from other cell types resultant of the differentiation. Candidate molecules are then contacted with the cultured cells. Candidate molecules may for example include chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cell cultures are then processed to monitor the transgene product and determine the stability of the D-type cyclin. In some embodiments of the invention, the stability of multiple D-type cyclins is monitored simultaneously, e.g. using differing reporters, for example using a reporter transgene wherein a transcriptional regulatory element targets expression of a cyclin Dl/green fluorescent protein fusion protein in combination with a reporter transgene in which a transcriptional regulatory element targets expression of a cyclin D2/enhanced yellow fluorescent protein fusion protein. Alternatively, flag-tagged, talon-tagged or other

reporters, or unmodified cyclin molecules, can also be employed. Molecules that alter the stability of the D-type cyclin or cyclins in a desired fashion can then be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In other embodiments of the invention, non-cardiomyocyte cells are used in screens for identifying molecules capable of altering stability of one or more D-type cyclins. The cells can be non-genetically altered or genetically altered generally as discussed in the embodiments above to express a transgene comprising a transcriptional regulatory element operably associated to a sequence encoding an intact or genetically modified D-type cyclin, so that the D-type cyclin stability can be monitored. The cells are plated onto suitably formatted tissue culture plates and contacted with candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures are processed to monitor the stability of either the endogenous D-type cyclin or the reporter gene product as described above. Compounds that alter the stability of the D- type cyclin or cyclins in a desired fashion can be processed through an additional screen using cardiomyocytes, for example a cardiomyocyte-based screen as described herein. Molecules that alter the stability of D-type cyclins in cardiomyocytes in a desired fashion can then be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo.

In each of the embodiments of the invention described above, and especially in conjunction with screening methods employing cardiomyocyte cells, in addition to contact with the candidate compound under study, the cells can be subjected to at least one other stimulus. For example, in the case of cardiomyocyte cells, the cells may be subjected to a hypertrophic agent or other similar injurious stimulus. This hypertrophic agent may be applied before, simultaneously with, or after the candidate compound under study, or any combination thereof.

These and other objects and advantages of the invention will be apparent from the following description.

BRIEF DESCRIPTION OF THE FIGURES

Fig. 1. A schematic diagram illustrating key steps in a model of cardiomyocyte hyperplasia including the effects of cycDl, D2 and D3 and their sub-cellular localization on the cell cycle.

Fig. 2 A schematic diagram illustrating key steps in a model for cardiomyocyte hyperplasia including the effects of cycDl, D2 and D3 and their sub-cellular localization on the cell cycle. This diagram highlights possible intervention sites for controlling the cell cycle. Fig. 3. Panel (a) schematic diagram of the MHC-cycD transgenes. Panel (b)

Northern blot analyses for the transgene-derived D-type cyclins using a common sequence probe from SV40 poly A region. Panel (c) Western blot analyses for various cell cycle regulatory proteins in the control (non-txg) and MHC-cycD transgenic hearts. Left panel: samples from non-transgenic embryonic (E 15), neonatal (N 1.5) and adult hearts. Right panel: samples from non-transgenic and transgenic adult hearts.

Fig. 4. Panels (a) and (b) immune histologic analyses for D-type cyclins and CDK4, respectively, in sections obtained from non-transgenic, MHC-cycD 1, MHC-cycD2 and MHC-cycD3 hearts. Panel (c) examples of DNA synthesis in fibroblasts and cardiomyocytes in sections from MHC-nLAC or MHC- nLAC/MHC-cycD transgenic hearts. Bar = 50 microns in panels a and b, 10 uM in panel c.

Fig. 5. Ventricular cardiomyocyte DNA synthesis in panels (a) normal, (b) isoproterenol treated and (c) cautery injured hearts from the MHC-nLAC or MHC- nLAC/MHC-cycD transgenic animals. Error bars indicate SEM.

Fig. 6. Panel (a) Western blot analyses for the expression of D-type cyclins and CDK4 in non-transgenic and MHC-cycD transgenic hearts treated with or without isoproterenol (ISO). Panel (b) sub-cellular localization of D-type cyclins in the control and transgenic hearts treated with (+) or without (-) ISO. Bar = 10 μM. Panel (c) Sub-cellular localization of D-type cyclins at the injury border zone of an MHC-cycDl and MHC-cycD2 heart at 7 days post cauterization.

Fig. 7. Panel (a) examples of infarct border zone cardiomyocyte DNA synthesis in an X-GAL stained section from an MHC-nLAC / MHC-cycD2 heart. Bar = 50 μM. Panel (b) measurement of ventricular cardiomyocyte DNA synthesis in the infarct border zone of the non-transgenic and MHC-cycD2 hearts subjected to myocardial infarction (MI). Error bars indicate SEM.

Fig. 8. Panel (a) measurement of infarct size in non-transgenic and MHC- cycD2 hearts subjected to MI. Error bars indicate SEM (n = 8 to 10 mice per group). Panel (b) images of thin sections prepared from the control (non-txg) or MHC-cycD2 hearts subjected to myocardial infarction. The sections were stained with sirius red and fast green. Bar = 0.2 mm.

Fig. 9. Panel (a) phosphorylated histone H3 immune reactivity (black signal, horseradish peroxidase-conjugated secondary antibody) in cardiomyocyte nuclei (blue signal, X-GAL staining) at the infarct border zone of MHC-cycD2 / MHC-nLAC double transgenic mice at 150 days post injury. Bar = 10 μM. Panel (b) cardiomyocyte number in coronal sections prepared at 1.2 mm intervals from the apex of infarcted non-transgenic and MHC-cycD2 hearts analyzed at 7 days and at 150 days following permanent coronary artery occlusion. Cardiomyocyte number was quantitated by direct counting of cardiomyocytes in silver nitrate stained sections. Asterisks indicate significance between cardiomyocyte number in the MHC-cycD2 hearts at 150 days post-injury vs. 7 days post-injury (4 mice per group).

Fig. 10. Characterization of myocardial infarcts in MHC-cycD2 mice. Panel (a) representative azan staining of coronal sections of a nontransgenic heart (i; infarct size 60%) and a MHC-cycD2 heart (ii; infarct size 58%) 7 days after myocardial infarction and those of a nontransgenic heart (iii; infarct size 54%) and a MHC-cycD2 heart (iv; infarct size 37%) 180 days after myocardial infarction. At 7 or 180 days post myocardial infarction, hearts were harvested, fixed and sectioned from apex to base (left to right in the picture). Azan stains viable myocardium red and collagen blue. MhC-cycD2 hearts showed significant smaller infarcts as compared with hearts from nontransgenic mice. Scale bars, 2mm.

Panel (b) infarct sizes after myocardial infarction (MI) in nontransgenic and MHC-

cycD2 mice. The infarct size in MHC-cycD2 mice decreased significantly between day 7, 60 and 180 post myocardial infarction (p<0.05) while no significant change was observed in the nontransgenic mice between these time points. On day 7 after MI, the infarct size did not differ between transgenic and nontransgenic mice while at 60 and 180 days after infarction hearts of MHC- cycD2 mice had significant smaller infarcts than hearts of nontransgenic mice (p<0.05).

Fig. 11. Panel (a) upper azan and panel (a) lower connexin-43 (lower panel) staining of an apically-located region of newly formed myocardium at the infarct border zone of a mHC-cycD2 mouse at 180 days after myocardial infarction. Azan stains viable myocardium red and collagen blue. Panel (b) full- frame TPME image of the newly formed myocardium at the infarct border zone of an MHC-cycD2 heart. The white bar demarks the position of line-scan mode data acquisition. Panel (c) stacked line-scan image acquired during spontaneous depolarizations from the heart depicted in panel (b). Panel (d) spatially integrated traces of the changes in rhod-2 (red) fluorescence during spontaneous depolarizations from the heart depicted in panel (b).

Fig. 12. Left ventricular performance assessed by pressure- volume measurements. Panel (a) left ventricular peak positive developed pressures (dP/dt _max ) in nontransgenic and MHC-cycD2 mice at 7, 60 and 180 days after myocardial infarction. Panel (b) representative pressure-volume loops from a nontransgenic mouse during transient inferior vena cava occlusion 7 days following myocardial infarction. The solid line is the ESPVR slope (slope = 26.8 mmHg/μl), while the dotted line shows a representative ESPVR slope in a MHC- cycD2 mouse during vena cava occlusion (slope = 27.6 mmHg/μl; NS). Panel (c) ESPVR slopes of a nontransgenic mouse (solid line; slope = 12.4 mmHg/μl) and MHC-cycD2 mouse (dotted line; slope = 29.9 mmHg/μl; p<0.05) at 180 days after myocardial infarction. Panel (d) The stroke work versus end-diastolic volume (or PRSW) slopes of a nontransgenic mouse (solid line; slope = 20 mmhg) and a MHC-cycD2 mouse (dotted line; slope = 34 mmHG; p<0.05).

Fig. 13. Loading control for Western blot analyses. After electrophoretic transfer, all Western blot membranes were stained with Napthol Blue to ensure that similar levels of protein were analyzed. The image shows a Nathol Blue stained membrane prior to reaction with primary antibody.

BRIEF DESCRIPTION OF THE TABLES

Table 1. Attributes of cardiomyocyte in normal and injured MHC-cvcD hearts. In each case, the ISO HW/BW values were normalized to those of the non- isoproternol treated animlas with the same genotype. Pooled data from all animals was analyzed. Abbreviations used in the table include: HW/BW, Heart weight body weight ratio; ISO, isoproterenol infusion; VENT CM, ventricular cardiomyocytes; SYN, synthesis; nuc, nuclei; N.D., not determined.

Table 2a. Hemodynamic parameters in sham operated mice at 7, 60 and 180 days after operation. Non-Tgx, indicates nontransgenic; HR, heart rate; Pes, left ventricular end-systolic pressure; Ped, left ventricular end-diastolic pressure; dPdt _max , left ventricular peak positive developed pressure; dPdt ^ _n , left ventricular peak negative developed pressure; Tau, left ventricular isovolumic relaxation time constant; ESPVR, end-systolic pressure-volume relation; PRSW, stroke work/end diastolic volume relation; dPdt _max /EDV, slope of the left ventricular peak positive developed pressure with respect to time. No statistical difference in any parameter, nontransgenic vs. MHC-cycD2.

Table 2b. Hemodynamic parameters in mice at 7, 60 and 180 days after myocardial infarction. Non-Tgx, indicates nontransgenic; HR, heart rate; Pes, left ventricular end-systolic pressure; Ped, left ventricular end-diastolic pressure; dPdt _max , left ventricular peak positive developed pressure; dPdt _mm , left ventricular peak negative developed pressure; Tau, left ventricular isovolumic relaxation time constant; ESPVR, end-systolic pressure-volume relation; PRSW, stroke work/end diastolic volume relation; dPdt _max /EDV, slope of the left ventricular peak positive developed pressure with respect to time. *p<0.05, nontransgenic vs MHC-cycD2.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

For the purpose of promoting an understanding of the principles of the invention, reference will now be made to certain preferred embodiments thereof and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations, further modifications and applications of the principles of the invention as described herein being contemplated as would normally occur to one skilled in the art to which the invention relates.

As discussed and explained herein including data presented in the examples, the position of cardiomyocyte cells in the cell cycle is dependent at least in part on the absolute and relative levels of cell cyclins Dl, D2 and D3 and on the sub-cellular distribution of these molecules especially between the nucleus and cytoplasm. Referring now to Fig. 1, a schematic diagram of a cardiomyocyte hyperplasia model. This diagram illustrates the effect of the various cyclins on the growth of cardiomyocytes cells. Normal adult cardiomyocyte cells exposed to hypertonic stimuli undergo an induction resulting in a change in the level and sub-cellular distribution of the D-type cyclins. The relative levels of eye Dl, CycD3 and cycle D2 and their distribution within the cells helps to determine the fate of these cells. The accumulation of cycD2, especially in the nucleus may lead to cardiomyocyte (CM) DNA synthesis and cytokinesis. While a competing process, dictated by the levels of cycDl and cycD3 and the shuttling of these cyclins between the nucleus and the cytoplasm, may also effect the position of the cardiomyocyte cells in the cell cycle.

In general a decrease in cyclin nuclear activity results in the withdrawal of the cells from the cell cycle. While inhibiting cycDl and D3 cytoplatic translocation from the nucleus to the cytoplasm may help to increase the level cell proliferation. At the same time the accumulation of cycDl and D3 in the cytoplasm as opposed to the nucleus may contribute to cell cycle arrest. Decreasing cycDl and D3 expression or the stability of cyclins Dl and D3 in the cytoplasm as cycD2 accumulates in the nucleus may enable cycD2 to an increase in cardiomyocyte cell proliferation. Cell cycle arrest may occur in response to the inappropriate accumulation of cycDl and or the sub-cellular accumulation of D3.

Referring now to Fig. 2, as illustrated in Figs.l and 2, normal adult cardiomyocyte cells exposed to hypertonic stimuli under go an induction of production of endogenous D-type cyclins production. The level and distribution of the three D cyclins between the nucleus and cytoplasm influences the fate of the cardiomyocyte cells. The accumulation of cyclin D2, especially in the nucleus correlates with an increase in DNA synthesis and the process of cytokinesis. Accordingly, increasing cycD2 expression and or the stability of cyclin D2 may enhance the proliferation of cardiomyocytes.

Still referring to Fig. 2, a competing end point for the accumulation of cycD2 is the accumulation of cycDl and cycD3. Subject to a nuclear- cytoplasm shuttle the sub-cellar distribution of Dl, D2 and D2 cyclins can also be exploited to effect the position of cardiomyocyte cells within the cell cycle. For example, inhibiting of the translocation of cyclin Dl and D3 to the cytoplasm may increase cardiomyocyte proliferation. And increasing the level of cyclin D2 in the nucleus may increase cardiomyocyte cell proliferation.

One aspect of the present invention provides screening methods, materials, and systems that can be used to test candidate molecules for their impact upon the presence, amount, persistence or sub-cellular location of cyclin D protein(s) in the cell, and thus for their potential use in modifying the cell cycle (e.g. in enhancing the proliferative capacity of cells). As discussed herein and in the above, in certain aspects the present invention features materials, methods and systems for identifying molecules that may affect the proliferative capacity of cells, such as mammalian (including human) cardiomyocytes, through processes involving the expression, stability and sub-cellular location, of the D-type cyclins Dl, D2 and D3. In these regards, certain features of the invention involve the notation that differential proliferative response observed upon expression of cyclin D2 versus cyclins Dl and D3 in cardiomyocytes is due to differential subcellular shuttling of the molecules. Cyclin D2 accumulates in the nucleus under baseline and injury conditions, whereas cyclins Dl and D3 accumulate in the nucleus under baseline conditions and in the cytoplasm under injury conditions. When in the cytoplasm, cyclins Dl and D3 lose their ability to drive cell cycle activity.

Several lines of evidence presented herein including the data in the examples suggested that the activities encoded by the D-type cyclins are very similar. For example, genetic ablation of individual D-type cyclin genes is not lethal, cellular defects can be rescued by ectopic expression of other family members. The observation here that cyclin Dl, D2, or D3 expression each resulted in a similar effect on heart weight and cardiomyocyte DNA synthesis is consistent with the notion of D-type cyclin functional redundancy (at least under baseline conditions). Other studies, however, suggest that some activities of the D-type cyclins are unique. For example, ectopic expression of cyclins Dl, D2, and D3 result in distinct proliferative responses in the thymic epithelia of transgenic mice and in cultured cells. The sustained cardiomyocyte cell cycle activity, and the retention of nuclear cyclin D immune reactivity, observed after multiple forms of cardiac injury in MHC-cycD2, but not in MHC-cycDl and -cycD3 mice, further underscored the notion that at least some aspects of D-type cyclin activity are not functionally redundant.

Again, as detailed by the data in the examples, the strict correlation between nuclear cyclin immune reactivity and cardiomyocyte DNA synthesis suggest that differential subcellular trafficking underlies the phenotypic differences in the MHC- cycD transgenic mice after myocardial injury. This could occur as a consequence of differences in the rates of nuclear import and/or nuclear export between cyclins D 1 , D2, and D3. Altered cyclin stability is not likely to have been a factor, as no overt decrease in steady state protein levels were detected in isoproterenol-treated transgenic hearts (Fig. 6a). Regulation of the subcellular localization of the D-type cyclins is complex. It has been shown that D-type cyclins must first associate with CDK4 before nuclear translocation. It has been suggested that p21 and p27 antagonize cyclin D nuclear export, which in turn results in enhanced nuclear accumulation. Other studies demonstrated that nuclear export of cyclin D was regulated by glycogen synthase kinase 3β (GSK-3B)-mediated phosphorylation. For example, phosphorylation of cyclin Dl at threonine residue 286 promoted cyclin Dl association with CRMl (a nuclear exportin molecule), which in turn result in nuclear export of cyclin Dl .

Referring now to Figs. 6a and 6b, all three D-type cyclins and CDK4 accumulated in the nucleus of uninjured adult hearts, these data illustrate that the requisite nuclear localization mechanisms remain at least partially intact in adult transgenic cardiomyocytes. However, these processes appear to be selectively altered during cardiac injury such that only cyclin Dl and D3 nuclear localization was compromised. Intrinsic differences in the susceptibility of the individual D- type cyclins to posttranslational modification could underlie their differential subcellular localization after injury. The potential impact of cytoplasmic D-type accumulation on the propensity for cell cycle progression in adult cardiomyocytes may also contribute to the observed phenotypes. In other systems, failure to degrade cell cycle regulatory proteins resulted in cell cycle block. If cytoplasmic accumulation of cyclin Dl and/or D3 impart a cell cycle block, this process could contribute to the exceedingly low rates of cardiomyocyte DNA synthesis observed in genetically naϊve, injured adult hearts. The nuclear cyclin D localization and cell cycle activity reported herein in uninjured hearts are at odds with recent results from Ikedaand colleagues. See Tamamori-Adachi, M. et al., Cir. Res., 2003; 92:el2-el9 (2003). Ikeda, used adenoviral vectors to deliver cyclin Dl and CDK4 to cultured neonatal cardiomyocytes and adult rat hearts. Those investigators demonstrated that cardiomyocyte terminal differentiation was accompanied by cytoplasmic accumulation of cyclin Dl. Furthermore, in the absence of a heterologous nuclear localization signal, ectopic cyclin Dl expression in postmitotic cardiomyocytes resulted in cytoplasmic accumulation and no cell cycle activation. Differences in the methods used between Ikeda and the example reported herein for gene delivery could explain the discrepancies between these results. The adenoviral delivery taught by Ikeda used a multiplicity of infection of 100; other studies have demonstrated that infection at this MOI resulted in hypertrophic growth of neonatal cardiomyocytes. This phenomenon is thought to have been triggered by integrin clustering during viral attachment to the cell surface (Allen Samarel, unpublished data, 2004). Thus, in the Ikeda study, adenoviral-induced cardiomyocyte hypertrophy may have resulted in the cytoplasmic accumulation of ectopic cyclin

Dl, similar to what was observed after injury in theMHC-cycDl and MHC-cycD3 mice (Fig. 6b).

Referring now to Fig. 8, as reported herein, sustained cardiomyocyte DNA synthesis in injured MHC-cycD2 hearts is associated with infarct size regression, suggesting that cyclin D2 expression leads to regenerative myocardial growth after infarction. As illustrated in Fig. 9a this view is supported by the presence of cardiomyocyte phosphorylated histone H3 immune reactivity and the increased cardiomyocyte cell number in the infarcted MHC-cycD2 hearts at 150 days after injury (Fig. 9b). Moreover, the absence of detectable levels of cardiomyocyte apoptosis in MHC-cycD2 hearts (0 TUNEL positive cardiomyocyte nuclei per 25 000 screened) in the presence of high rates of cardiomyocyte DNA synthesis indicates that cardiomyocyte cell cycle re-entry does not result in abortive mitosis and apoptosis in these animals. The importance of cell cycle activity in this process is underscored by the absence of overt infarct regression in MHC-cycDl transgenic hearts after permanent coronary artery occlusion (Kishore B.S. Pasumarthi, unpublished data, 2004). Although the data presented here is mostly consistent with transgene-mediated cell cycle activation in fully differentiated cardiomyocytes, the experiments do not rule out the possibility that the reparative capacity of putative cardiomyogenic progenitor cells was also enhanced by transgene expression. If so, the differentiated phenotype and morphological appearance of the cardiomyocytes at the infarct border zone are most similar to the progenitor-derived cardiomyocytes reported by Schneider and colleagues.

Data presented herein indicate that targeting the expression of D-type cyclins is sufficient to promote cardiomyocyte cell cycle activation in adult mouse hearts. Cardiomyocyte DNA synthesis persists in the MHC-cycD2 mice after injury, but not in the MHC-cycDl or MHC-cycD3 mice. Cell cycle activation in injured MHC-cycD2 hearts correlate with the retention of nuclear cyclin D localization. Expression of the MHC-cycD2 transgene resulted in a progressive reduction of myocardial infarct size that is consistent with regenerative cardiac growth. See, Pasumarthi, K. B.S. et al., Cir. Res.2005; 96;110-118 (2005). One embodiment includes modulating of D-type cyclin activity (as for example via pharmacological interventions aimed at altering subcellular localization or

enhancing expression of specific D-type cyclin subtypes) to promote myocardial repair in injured hearts.

Further, the retention of cyclin D2-induced cell cycle activity results in regenerative growth of the myocardium after experimentally induced myocardial infarction. Cardiomyocyte cell cycle activity results in a marked regression of infarct size by 180 days post injury, infarct reduction results as a consequence of cardiomyocyte proliferation, as nascent myocardial cells are functionally coupled to the heart. Consequently, post-injury cardiac function is also markedly improved.

Cyclin D proteins of mammalian origin, including for example the mouse and human proteins, are known. U.S. Pat. Nos. 5,869,640, 5,998,582, 6,066,501, and 6,156,876 disclose amino acid and nucleotide sequences for D-type cyclins and regulatory elements therefor, including cyclins Dl, D2 and D3 proteins, as well as characterizing data, these patents are hereby incorporated by reference in their entirety. These D-type cyclins bind to and activate CDK4 and CDK6. This protein complex then phosphorylates members of the retinoblastoma family, thereby releasing E2F family members (which are normally bound to and thereby inhibited by hypophosphorylated RB family members). Released E2F initiates cell cycle progression by promoting the transcription of a variety of gene products needed for DNA synthesis. Sequences encoding Dl type cyclins that can be used to practice various embodiments include, but are not limited to, the cyclin Dl gene (SEQ. ID. No. 8) from the human LPl cells line. Sequences encoding D2 type cyclins that can be used to practice various embodiments include, but are not limited to, SEQ. ID. No. 2 and SEQ. ID No. 3, which encodes CCND2, both of these sequences have been identified in Homo sapiens. Sequences encoding D3 type cyclins that can be used to practice various embodiments include, but are not limited to SEQ. ID No. 6, which encodes CCND2 identified in Homo sapiens.

In this regard, the term "nucleotide sequence," as used herein, is intended to refer to a natural or synthetic sequential array of nucleotides and/or nucleosides, and derivatives thereof. The term amino acid sequence is intended to refer to a natural or synthetic sequential array of amino acids and/or derivatives thereof. The terms "encoding" and "coding" refer to the process by which a nucleotide sequence, through

the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce a polypeptide.

It will be understood that the present invention also encompasses the use of nucleotide sequences and amino acid sequences which differ from the specific cyclin D sequences disclosed herein, but which have substantial identity thereto and thereby exhibit the characteristic cyclin D activity of the native protein. Such sequences will be considered to provide cyclin D nucleic acid and cyclin D proteins for use in the various aspects of the present invention. For example, nucleic acid sequences encoding variant amino acid sequences are within the scope of the invention.

Modifications to a sequence, such as deletions, insertions, or substitutions in the sequence, which produce "silent" changes that do not substantially affect the functional properties of the resulting polypeptide molecule are expressly contemplated by the present invention. For example, it is understood that alterations in a nucleotide sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product.

Also, phosphomimetic mutations such as substitution of serine for aspartic acid in a serine-specific protein kinase consensus sequence can be expected to produce a product mimicking a constitutively phosphorylated Cyclin D product.

Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the encoded polypeptide molecule would also not generally be expected to alter the activity of the polypeptide. In some cases, it may in fact be desirable to make mutations in the sequence in order to study the effect of alteration on the biological activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art.

In one manner of defining the invention, nucleic acid (e.g. DNA) may be used such that a sequence (e.g. coding and/or regulatory) that differs from that set forth in the materials identified herein, wherein the nucleic acid will bind to nucleic acid having the nucleotides of a specific sequence identified herein (e.g. a native nucleotide sequence) under stringent conditions, and which nucleic acid encodes a polypeptide having the activity of the corresponding native cyclin D, or in the case of regulatory sequences which retains the activity of the native regulatory sequence. "Stringent conditions" are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5°C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically, stringent conditions will be those in which the salt concentration is at least about 0.02 molar at pH 7 and the temperature is at least about 60°C. In another manner of defining nucleotide sequences that may be used in the invention, nucleic acid may be used that encodes a polypeptide that has an amino acid sequence which has at least about 70% identity, more preferably at least about 80% identity, most preferably a least about 90% identity, with an amino acid sequence disclosed in the materials herein (e.g. a native cyclin D amino acid sequence), or with at least one significant length (i.e. at least 40 amino acid residues) segment thereof, and which polypeptide possesses the activity of the corresponding native cyclin D protein. Percent identity, as used herein, can be determined as percent identity as determined by comparing sequence information using the advanced BLAST computer program, version 2.0.8, available from the National Institutes of Health, USA. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-68 (1990) and as discussed in Altschul, et al., J. MoI. Biol. 215:403-10 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-7 (1993); and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Briefly, the BLAST program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the

entire length of the proteins being compared. Preferred default parameters for the BLAST program, blastp, include: (1) description of 500; (2) Expect value of 10; (3) Karlin-Altschul parameter .lambda.=0.270; (4) Karlin-Altschul parameter K=0.0470; (5) gap penalties: Existence 11, Extension 1; (6) H value=4.94 ^"324 ; (6) scores for matched and mismatched amino acids found in the BLOSUM62 matrix as described in Henikoff, S. and Henikoff, J. G., Proc. Natl. Acad. Sci. USA 89: 10915-10919 (1992); Pearson, W. R., Prot. Sci. 4: 1145-1160 (1995); and Henikoff, S. and Henikoff, J. G., Proteins 17:49-61 (1993). The program also uses an SEG filter to mask-off segments of the query sequence as determined by the SEG program of Wootton and Federhen Computers and Chemistry 17:149-163, (1993).

In another form, nucleic acid may be used that includes a coding (and/or transcriptional regulatory) sequence that has at least about 70% identity with the corresponding portion of a nucleotide sequence set forth in the cyclin D sequence materials identified herein, or with at least one significant length (i.e. at least 100 nucleotides) segment thereof, and which nucleic acid encodes a polypeptide possessing characteristic cyclin D activity or cyclin D regulatory activity.

A cyclin D coding nucleotide sequence may be operably linked to a promoter sequence as known in the art to provide recombinant nucleic acid, for example, in the provision of vehicles such as vectors for functionally introducing the nucleic acid in to mammalian or other eukaryotic cells. As defined herein, a coding nucleotide sequence is "operably linked" to another nucleotide sequence (e.g. a regulatory element such as a promoter) when it is placed into a functional relationship with the other nucleotide sequence. For example, if a coding nucleotide sequence is operably linked to a regulatory sequence such as a promoter, this generally means that the nucleotide sequence is contiguous with the promoter and the promoter exhibits the capacity to promote transcription of the gene. A wide variety of promoters are known in the art, including cell-specific promoters, inducible promoters and constitutive promoters. The promoters may be selected so that the desired product produced from the nucleotide sequence template is produced constitutively in the target cells. Alternately, promoters such as inducible promoters may be selected that require activation by activating elements known in the art, so that production of the desired product may be regulated as desired. Still further, promoters may be chosen that

promote transcription of the gene in one or more selected cell types, e.g. the so-called cell-specific promoters, or the native cyclin D promoters may be used in conjunction with their corresponding cyclin D coding sequences, or with other cyclin D coding sequences. In certain aspects of the invention, a cyclin D coding nucleotide sequence is operably linked to a cardiomyocyte cell-specific promoter, for example, providing for constitutive expression of the nucleotide sequence in cardiomyocytes. Illustrative candidates for such promoters include the alpha-myosin heavy chain (alpha-MHC) promoter, the beta-myosin heavy chain (beta-MHC) promoter, the myosin light chain- 2 V (MLC-2V) promoter, the atrial natriuretic factor (ANF) promoter, and the like. Such constructs enable the expression of the cyclin D nucleic acid selectively in cardiomyocyte cells.

In other aspects, recombinant nucleic acid can be used that includes a cyclin D coding nucleotide sequence operably linked to an inducible promoter, such that cyclin D expression can be upregulated in response to an inducing agent. Illustrative candidate inducible promoter systems include, for example, the metallothionein (MT) promoter system, wherein the MT promoter is induced by heavy metals such as copper sulfate; the tetracycline regulatable system, which is a binary system wherein expression is dependent upon the presence or absence of tetracycline; a glucocorticoid responsive promoter, which uses a synthetic sequence derived from the glucocorticoid response element and is inducible in vivo by administering dexamethasome (cells having the appropriate receptor); a muristerone-responsive promoter, which uses the gonadotropin-releasing hormone promoter and is inducible with muristerone (cells having the appropriate receptor); and TNF responsive promoters. Additional inducible promoters which may be used include the ecdysone promoter system, which is inducible using an insect hormone (ecdysone) and provides complete ligand- dependent expression in mammals; the beta-GAL system, which is a binary system utilizing an E. coli lac operon operator and the I gene product in trans, and a gratuitous inducer (IPTG) is used to regulate expression; and, the RU486 inducible system, which uses the CYP3A5 promoter and is inducible by RU486, a well defined pharmaceutical agent. These and other similar inducible promoter systems are known, and their use in the present invention is within the purview of those skilled in the area.

The present invention may also make use of vectors which incorporate a cyclin D nucleotide sequence (promoter and/or coding sequence) and which are useful in the genetic transduction of myocardial or other cells in vitro or in vivo. A variety of vector systems are suitable for these purposes. These include, for example, viral vectors such as adenovirus vectors as disclosed for example in Franz et al., Cardiovasc. Res. 35(3):560-566 (1997); Inesi et al., Am. J. Physiol. 274 (3 Pt. l):C645-653 (1998); Kohout et al., Circ. Res. 78(6):971-977 (1996); Leor et al., J. MoI. Cell Cardiol. 28(10):2057-2067 (1996); March et al., Clin. Cardiol. 22(1 Suppl. 1): 123-29 (1999); and Rothman et al., Gene Ther. 3(10):919-926 (1996). Adeno- Associated Virus (AAV) vectors are also suitable, and are illustratively disclosed in Kaptlitt et al., Ann. Thora. Surg. 62(6): 1669-1676 (1996); and Svensson et al., Circulation 99(2) :201-205 (1999). Additional viral vectors which may be used include retroviral vectors (see e.g. Prentice et al., J. MoI. Cell Cardiol. 28(1): 133-140 (1996); and Petropoulos et al., J. Virol. 66(6):3391-3397 (1992)), and Lenti (HIV-I) viral vectors as disclosed in Rebolledo et al., Circ. Res. 83(7):738-742 (1998). A preferred class of expression vectors will incorporate the cyclin D nucleic acid (regulatory and/or coding sequences) operably linked to a cardiomyocyte-specific promoter, such as one of those identified above.

In accordance with the invention, cardiomyocytes or other cells to be used in the invention can also be genetically transduced with cyclin D nucleic acid in vitro or in vivo using liposome-based transduction systems. A variety of liposomal transduction systems are known, and have been reported to successfully deliver recombinant expression vectors to cardiomyocytes and other cells. Illustrative teachings may be found for example in R. W. Zajdel, et al., Developmental Dynamics. 213(4):412-20 (1998); Y. Sawa, et al., Gene Therapy.5(ll): 1472-80 (1998); Y. Kawahira, et al., Circulation 98(19 Suppl) :II262-7; discussion H267-8 (1998); G. Yamada, et al., Cellular & Molecular Biology 43(8): 1165-9 (1997); M. Aoki, et al., Journal of Molecular & Cellular Cardiology 29(3):949-59 (1997); Y. Sawa, et al., Journal of Thoracic & Cardiovascular Surgery 113(3):512-8; discussion 518-9 (1997); and I. Aleksic, et al., Thoracic & Cardiovascular Surgeon 44(2):81-5 (1996). Thus, liposomal recombinant expression vectors including cyclin D DNA can also be

utilized to tranduce cardiomyocytes or other cells in vitro and in vivo for the purposes described herein.

The present invention makes available methods which can be applied in vitro or in vivo for research, screening or other purposes. Methods for the in vitro culture of cardiomyocytes other cells expressing introduced cyclin D DNA (including regulatory and/or coding sequences) can be used, for example, in the study and understanding of the cell cycle, in screening for chemical or physical agents which modulate cyclin D activity (including, for example, expression, stability and/or subcellular location) or other related aspects of the cell cycle. Cardiomyocyte or other mammalian or other animal cells to be used in accordance with the invention can be derived from a variety of sources. For example, they may be harvested from a mammal for culture. The cells may also be derived from the differentiation of stem cells such as embryonic stem cells, adult stem cells, neural stem cells, hematopoietic stem cells, mesenchymal stem cells, peripheral blood stem cells and cardiac stem cells. Preferably, the stem cell is human. The quintessential stem cell is the embryonal stem cell (ES), as it has unlimited self- renewal and multipotent and/or pluripotent differentiation potential, thus possessing the capability of developing into any organ, tissue type or cell type. These cells can be derived from the inner cell mass of the blastocyst, or can be derived from the primordial germ cells from a post-implantation embryo (embryonal germ cells or EG cells). ES and EG cells have been derived from mice, and more recently also from non-human primates and humans. Evans et al. (1981) Nature 292: 154-156; Matsui et al. (1991) Nature 353: 750-2; Thomson et al. (1995) Proc. Natl. Acad. Sci. USA. 92: 7844-8; Thomson et al. (1998) Science 282: 1145-1147; and Shamblott et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13726-31. Another stem cell source is embryonal carcinoma cells (EC cells) which are derived from teratocarcinomas. Donovan and Gearhart (2001) Nature 414: 92-97; Thomson and Odorico (2000) TIBTECH 18: 53- 57. General methodology for the derivation of a desired cell population from a stem cell is disclosed in U.S. Pat. Nos. 5,602,301 and 5,733,727 to Field et al. In this regard, when so derived, the genetic modification to incorporate the cyclin D nucleic acid (including regulatory and/or coding sequences) may take place at the stem cell level, for instance utilizing one or more vectors to introduce a cyclin D coding nucleic

acid sequence operably linked to a cell-type-specific (e.g. cardiomyocyte-specific) promoter, and nucleic acid enabling the selection of such cell type (e.g. cardiomyocyte) from other cells differentiating from the stem cell, and/or at a differentiated level e.g., including a selectable marker gene operably linked to a cell- type-specific (e.g. cardiomyocyte-specific) promoter. Nucleic acid enabling selection of transformed from non-transformed stem cells may also be used in such strategies. Such selection of the stem and/or specific differentiated cells (e.g. cardiomyocyte cells) may be achieved, illustratively, utilizing a gene conferring resistance to an antibiotic (e.g. neomycin or hygromycin) or other chemical agent operably linked to an appropriate promoter or by using a reporter operably linked to an appropriate promoter allowing for selection of cells by fluroescense activated cells sorting (FACS), for example the known GFP reporter.

Using stem-cell derived cells, such as cardiomyocytes, the genetic modification to incorporate the cyclin D (including coding and/or regulatory) and potentially other nucleic acid may also occur after differentiation of the stem cells. For example, a differentiated cell population enriched in a specific cell type, e.g. cardiomyocytes, for instance containing 90% or more of such specific cell type, may be transformed with a vector having cyclin D coding nucleic acid operably linked to a promoter (optionally cell-type-specific), as described above, or may be transformed with a vector including a reporter construct including a cyclin D transcriptional regulatory sequence.

In this regard, screens of the invention for compounds which transcriptionally regulate one or more of the cyclin D genes can employ cardiomyocyte or other cells incorporating introduced nucleic acid having a cyclin D promoter operably linked to a reporter gene. D-type cyclin promoters that that may be used in various embodiments include for example cyclin Dl promoter sequences.

Cyclin Dl promoters that can be used in various embodiments include, but are not limited to, the cyclin Dl gene promoter region SEQ. ID. No. 1 and cyclin Dl gene promoter SEQ. ID. No. 7. both of which have been identified in Homo sapiens. Other embodiments may include the use of cyclin D2 promoters. Suitable cyclin D2 promoters that may be used in various embodiments include, but not limited

to, cyclin D2 gene promoter region SEQ. ID. No. 4 which has been identified in Homo sapiens.

Still other embodiments may include the use of cyclin D3 promoters. Suitable cyclin D3 promoters that may be used in various embodiments include, but not limited to, cyclin D3 gene promoter region SEQ. ID. No. 5 identified in Homo sapiens. In this fashion, any alterations in the activity of the cyclin D promoter in response to the candidate compounds can be monitored by observation of the activity of the reporter molecule. Suitable reporters include, but are not limited to, reporter genes the activity of which can be monitored directly or indirectly by measurement of radioactivity, luminescence, fluorescence or absorption, including but not limited to chloramphenicol acetyltransferase (CAT), beta-galactosidase, luciferase, fluorescent proteins such as green fluorescence protein (GFP), red fluorescence protein (RFP), blue fluorescence protein (BFP) and derivatives thereof. In certain inventive approaches, two independent promoters of two independent cyclin D genes (e.g. cyclin Dl in combination with cyclin D2 or D3, or cyclin D2 in combination with cyclin D3) are coupled to different reporter genes and introduced into the host cell to be used for screening or into a progenitor or parent cell of a cell to be used for screening. In other approaches, promoters from all three of these cyclin D proteins are coupled to different reporter genes and introduced into the host cell to be used for screening or into a progenitor or parent of the cell to be used for screening. Such settings would allow the simultaneous screening for drugs affecting one or multiple of the cyclin D genes based on the activity of the two or three reporter genes.

As alternatives to introducing nucleic acid(s) including one or more cyclin D promoters coupled to one or more reporter genes, cardiomyocyte or other cells to be used in the invention can have one or more reporter genes such as those identified herein specifically introduced or "knocked in" in operable association with one or more native cyclin D promoters of the cell.

In certain modes of carrying out the invention, left ventricular, right ventricular, left atrial, or right atrial cardiomyocytes, or a mixture of some or all of these, may be genetically modified in vitro to incorporate functional cyclin D nucleic acid (including regulatory and/or coding sequences) using a suitable vector as disclosed above. Cells to be genetically transduced in such protocols may be obtained

for instance from animals at different developmental stages, for example fetal, neonatal and adult stages. Suitable animal sources include mammals such as bovine, porcine, equine, ovine and murine animals. Human cells may be obtained from human donors or from a patient to be treated. The modified cardiomyocytes may thereafter be used in screening processes and systems as described herein.

Cardiomyocyte or other cell types for use in the invention may also be obtained from tissues of a transgenic animal (especially mammal) expressing introduced cyclin D nucleic acid (including coding and/or regulatory nucleic acid sequences). Using known techniques, transgenic animals which harbor introduced cyclin D nucleic acid in essentially all of their cells can be raised, and used either as a source for harvesting culturable cells (including cardiomyocyte cells) or as animal models for research or screening purposes. For instance, transgenic bovine, porcine, equine, ovine or murine animals may be used as sources for the cells or as animal models for study. In certain aspects of the invention, cardiomyocytes having introduced cyclin D nucleic acid (including coding and/or regulatory sequences) will be subjected to an injurious stimulus, such as contact with a chemical agent, that induces a hypertrophic response in the cardiomyocytes. In this regard, illustrative candidate agents for these purposes include pharmacologic agents, for example alpha-adrenergic and/or beta- adrenergic receptor agonists which are hypertrophic agents, such as isoproterenol, epinephrine, norepinephrine, and phenylephrine, or cyclic AMP inducing agents, such as forskolin. Also, other injurious stimuli may be used on the cardiomyocyte cells, including mechanical injury or infarct injury, especially in the case of in vivo methods. The present invention provides access to methods for screening the activity of compounds such as biologic, pharmacologic or other agents upon cyclin D characteristics such as expression, stability (survival), and/or subcellular location. For example, access is provided to screening for compounds which increase cardiomyocyte proliferative potential as a baseline or in response to treatment with an agent. The identity of the compounds can be established, for example, based on a differential pattern of expression, survival, or subcellular location of one, two or all three of the known cyclin D proteins.

In accordance with certain aspects of the invention, a stem or multipotent cell will be caused to differentiate to provide a desired population of cells that will be used for screening methods and systems of the present invention. For example, such desired cells may be of mesodermal cell lineage, ectodermal cell lineage, or endodermal cell lineage. Specific mesodermal cell types include for example cells of connective tissue, bone, cartilage, muscle (including e.g. skeletal myocytes and cardiomyocytes), blood and blood vessel, lymphatic, notochord, pleura, pericardium, peritoneum, kidney, and gonad cells. Ectodermal cells include for example epidermal cells, glands of the skin, the nervous system, the external sense organs such as eyes and ears, mucus membranes such as the mouth and anus, and others. Endodermal cells include epithelial cells such as those of the pharynx, respiratory tract, digestive tract, bladder and urethra.

The specific, isolated cell lineage to be used in or for the invention can include monopotent, multipotent or pluripotent progenitor cells, lineage-committed precursor cells or terminally-differentiated cells. Illustrative stem or progenitor cells include, but are not limited to, CD34+hematopoietic cells, mesenchymal stem cells, marrow- derived stem cells, hematopoietic stem cells, pdx-expressing pancreatic precursor cells, oval liver cells and satellite cells. Illustrative terminally-differentiated cells include, but are not limited to, cardiomyocytes, neuronal cells, and pancreatic cells, in particular P-cells, and liver cells.

In certain methods of the invention, cells of the desired cellular lineage or other cell population will be capable of isolation from their mixture with other cells. For example, as disclosed above, desired cells may have a positive selectable marker and expression of the marker can be used to facilitate isolation of the desired cells from other cells. Alternatively, cells other than those which are desired for use in the screening method may include a negative selectable marker which is expressed in those cells but not in cells of the desired cell population. This negative selectable marker can then be used to selectively deplete a mixture of the cells of the undesired cell types. A selectable marker when utilized in the present invention may for example be a foreign gene, a cellular gene or a gene conferring resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, hygromycin, puromycin or methotrexate. The

selectable marker may alternatively be a growth promoting gene or a gene encoding a growth factor or growth factor receptor or signal-transducing molecule, or a molecule that blocks cell death. Such selection markers may complement auxotrophic deficiencies, or supply critical nutrients not available from complex media. These and other selectable marker mechanisms which provide to selected cells a relative survival advantage or disadvantage are contemplated within the present invention. In other embodiments the selectable marker may be a cell surface antigen or other gene product allowing purification or depleting of expressing cells by physical separation means, for example by panning or fluorescence-activated cell sorting (FACS) or magnetic cell sorting (including but not limited to MACS, Dynabeads).

As disclosed above, as an alternative to genetic modification of stem cells or progeny thereof to incorporate selectable markers, the stem or multipotent cells may be obtained from transgenic animals or tissues thereof having the selectable marker introduced into their genetic complement. Both founder transgenic animals and progeny thereof carrying the selectable marker are considered useful in the present invention.

In addition to or as an alternative to the above-discussed cell isolation methods involving the use of selection markers, chemical or biological agents may be added to a differentiating population of stem-cell-derived cells, in order to enrich the population in cells of certain type(s) relative to other type(s). For example, cardiomyocyte yield increases by addition of 10 ^~9 retinoid acid (Wobus et al. (1997) J. MoI. Cell. Cardiol. 29: 1525-1539), DMSO (Monge et al. (1995) J. Biol. Chem. 270: 15385-15390) or a combination of TGF-.beta.2 and retinoic acid (Slager et al. (1993) Dev. Gen. 14: 212-224). Induction of beta-like insulin-producing cells is enhanced upon addition of nicotinamide and bFGF (Lumelsky et al. (2001) Science 292: 1389- 1394). Differentiation of neural cells increases when 10 ^"7 retinoid acid (Rohwedel et al. (1999) Cells Tissues Organs 165: 190-202) or EGF and FGF-2 (Reubinoff et al. (2001) Nat. Biotech. 19: 1134-1140) are added. Endothelial differentiation is enhanced by a combination of VEGF, bFGF, EPO and EL-6 (Balconi et al. (2000) Arterioskler. Thromb. Vase. Biol. 20: 1443-1451), whereas hepatocyte formation increases upon addition of aFGF, HGF, oncostatin M and dexamethasone (Hamazaki et al. (2001) FEBS Lett. 497: 15-19). PDGF-BB induces formation of smooth muscle

cells (Yamashita et al. (2000) Nature 408: 92-96). Macrophage are induced by IL-3 (Wiles and Keller (1991) Development 111: 259-267), and cells of the erythroid lineage increase in number when adding JL-6 (Biesecker and Emerson (1993) Exp. Hematol. 21: 774-778). Osteoclast differentiation can be increased by l-alpha,25- dihydroxyvitamine D3 and dexamethasone (Yamane et al. (1997) Blood 90: 3516- 3523) or a combination of osteoprotegerin-ligand and MCSF (Hayashi et al. (1998) Biochem. Cell. Biol. 76: 911-922). Osteoblast yield increases after addition of BMP-2 and compactin (Phillips et al. (2001) Biochem. Biophys. Res. Commun. 8: 478-484) or a mixture of ascorbic acid, beta-glycerophosphate, dexamethasone and retinoic acid (Buttery et al. (2001) Tissue Eng. 7: 89-99). Yield of other cell types may be influenced by addition of chemical or biological substances accordingly.

In general, genetically-modified cell populations as described hereinabove including cells having introduced cyclin Dl, D2, and/or D3 nucleotide sequences (including in each case regulatory and/or coding sequences), can be used in screening methods and systems of the invention. In at least some instances, the genetically modified cell populations are also novel materials and constitute additional aspects of the invention.

Thus, in certain embodiments, the present invention provides screening methods for identifying therapeutic molecules capable of altering D-type cyclin expression. In certain forms of the invention, cardiomyocyte cells or non- cardiomyocyte cells are used to monitor the expression of endogenous D-type cyclins. For example, primary or stem cell-derived cardiomyocytes or other cells can be plated on suitably formatted tissue culture plates, and contacted with candidate molecules, for example including chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. After this contacting, the cultures can be processed for anti-cyclin D immune cytochemistry. In doing so, certain aspects of the invention involve monitoring multiple D-type cyclins using fluorescent secondary antibodies with different fluorophores (e.g., FITC for cyclin Dl, rhodamine for cyclin D2, etc.). Using such fluorophores, the level of D-type cyclin expression can be quantitated. Individual ones or combinations of two or more candidate molecules that alter expression of the D-type cyclin or cyclins in a desired manner can be processed through additional screens, for example, to determine their efficacy in inducing

regenerative cardiac growth in vitro and/or in vivo. Illustratively, candidate molecule(s) can be assessed for their ability to differentially affect the expression of the D-type cyclins, for example their ability to increase the expression of one or more of the D-type cyclins while having no effect, decreasing, or increasing to a lesser extent the expression of one or more other of the D-type cyclins; or their ability to decrease the expression of one or more of the D-type cyclins while having no effect, increasing or decreasing to a lesser extent the expression of one or more other of the D-type cyclins. For example, candidate molecules can be assessed for their ability to result in a higher expressed ratio of cyclin D2 to cyclin Dl and/or cyclin D3, e.g. by increasing the expression of cyclin D2 while decreasing or having no effect upon the expression of one or both of cyclin Dl and D3, by having no effect upon the expression of cyclin D2 while decreasing the expression of cyclin Dl and/or cyclin D3, or by preferentially decreasing the expression of cyclin Dl and/or cyclin D3 as compared to cyclin D2 or preferentially increasing the expression of cyclin D2 as compared to the expression of cyclin Dl and/or D3.

In other inventive embodiments, screens for identifying molecules capable of altering D-type cyclin expression utilize reporter transgenes that include transcriptional regulatory elements of the D-type cyclin genes, e.g. as discussed above, combined with a suitable expressed molecule for monitoring the transcription of the D-type cyclin genes. In such methods, cardiomyocyte cells or non-cardiomyocyte cells with the reporter transgene(s) can be plated onto suitably formatted tissue culture plates and contacted with candidate molecules for example including chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures are then processed to monitor for the expression of the reporter gene product(s). Illustratively, candidate molecule(s) can be assessed for their ability to differentially affect the expression driven by the D-type cyclin promoters, for example their ability to increase the expression driven by one or more of the D-type cyclin promoters while having no effect, decreasing, or increasing to a lesser extent the expression driven by one or more other of the D-type cyclin promoters; or their ability to decrease the expression driven by one or more of the D-type cyclin promoters while having no effect, increasing or decreasing to a lesser extent the expression driven by one or more other of the D-type cyclin promoters. For example,

candidate molecules can be assessed for their ability to result in a higher ratio of cyclin D2 promoter driven expression relative to cyclin D 1 and/or cyclin D3 promoter driven expression, e.g. by increasing the expression driven by a cyclin D2 promoter while decreasing or having no effect upon the expression driven by one or both of cyclin Dl and D3 promoters, by having no effect upon the expression driven by a cyclin D2 promoter while decreasing the expression driven by a cyclin D 1 and/or cyclin D3 promoter, or by preferentially decreasing (i.e. decreasing to a larger extent) the expression driven by a cyclin Dl promoter and/or a cyclin D3 promoter as compared to a cyclin D2 promoter. In various modes of practicing this embodiment, the cardiomyocytes may be derived as discussed above from transgenic animals which include cardiomyocytes or other having the reporter transgenes, by transfection of cardiomyocytes with appropriate viral vectors, or by differentiating stem cells carrying the reporter transgenes and optionally isolating cardiomyocytes derived therefrom. In certain embodiments, the activity of multiple cyclin transcriptional regulatory elements is monitored simultaneously, e.g. using differing reporters, for example by using a reporter gene wherein the cyclin Dl transcriptional regulatory elements target expression of sequences encoding enhanced green fluorescent protein, in combination with a reporter gene wherein the cyclin D2 transcriptional regulatory elements target expression of sequences encoding enhanced yellow fluorescent protein. Alternatively, flag-tagged, talon-tagged or other reporters, as well as sequences encoding unmodified cyclin molecules, can be employed to monitor the transcription of the D-type cyclin genes. The level of expression of the transgenes is then quantitated. Molecules that alter expression of the transgenes in a desired way can be processed through one or more additional screens, for example to determine their efficacy in inducing regenerative cardiac growth in vitro and in vivo.

In additional embodiments of the invention, non-cardiomyocyte cells are used in screens to identify molecules capable of altering D-type cyclin expression. Suitable cells for these purposes include for example cells of the lineages described hereinabove. These cells may be capable of expressing their endogenous D-type cyclins, and/or can be genetically altered to express transgenes comprising the transcriptional regulatory elements of the cyclin D genes, and a suitable reporter gene, so that D-type cyclin transcriptional activity can be monitored. These cells are plated

on suitable formatted tissue culture plates and contacted with candidate molecules, for example including chemical libraries, RNAi libraries or candidates, or dominant negative protein libraries. The cultures are then processed to monitor the expression of the endogenous D-type cyclin(s) and/or a reporter gene product, and the level of expression is quantitated. Compounds that alter expression in a desired way can then be processed through an additional screen using cardiomyocytes, for example, a cardiomyocyte-based screen such as any described herein. Thereafter, compounds that alter expression in the cardiomyocyte-based screen in a desired fashion can be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. Illustratively, in such screens, candidate molecule(s) can be assessed for their ability to provide an increased ratio of expression of one or more of the D-type cyclins relative to one or more other of the D- type cyclins. For example, molecule(s) can be assessed for their ability to increase the expression of one or more of the D-type cyclins or driven by one or more of the D- type cyclin promoters while decreasing or having no affect upon the expression of one or more other of the D-type cyclins or driven by one or more other of the D-type cyclin promoters; or to have no effect upon the expression of one or more of the D- type cyclins while decreasing the expression of one or more other of the D-type cyclins; or to preferentially increase or decrease the expressed ratio of one or more of the D-type cyclins relative to one or more other of the D-type cyclins. For example, candidate molecules can be assessed for their ability to provide an increased ratio of expressed cyclin D2 relative to cyclin Dl and/or cyclin D3 or an increased ratio of transcription driven by a cyclin D2 promoter relative to that driven by a cyclin Dl and/or cyclin D3 promoter. This may be accomplished, for example, by decreasing or having no effect upon the expression of one or both of cyclin Dl and D3 while increasing the expression of cyclin D2, by decreasing or having no effect upon the expression driven by one or both of the cyclin Dl and D3 promoters while increasing the expression driven by the cyclin D2 promoter, by preferentially increasing the expression of cyclin D2 relative to that of cyclin Dl and/or D3 (or having a corresponding effect upon the transcriptional activity of the corresponding D-type cyclin promoters, or by preferentially decreasing the expression of cyclin Dl and/or

cyclin D3 relative to that of cyclin D2 (or having a corresponding effect upon the transcriptional activity of the corresponding D-type cyclin promoters).

In other embodiments of the invention, screening methods are provided for identifying molecules capable of altering the sub-cellular localization of one or more D-type cyclins. In certain forms, these screening methods utilize cardiomyocytes to monitor the sub-cellular localization of endogenous D-type cyclins. In such screens, primary or stem cell-derived cardiomyocytes can be plated onto suitably formatted tissue culture plates. The cultured cardiomyocytes can be contacted with candidate molecules, including for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures can then be processed for anti-cyclin D immune cytochemistry or other similar techniques to identify the sub-cellular localization of the D-type cyclin or cyclins. In certain embodiments, multiple D-type cyclins (e.g. two or three) are simultaneously monitored using fluorescent secondary antibodies with different fluorophores (e.g. FITC for cyclin Dl, and rhodomine for cyclin D2). Molecules that alter the sub-cellular localization of one or more D type cyclins in a desired fashion can then be processed through additional screens, for example to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In certain embodiments, such desired fashion may involve altering the shuttling of one or D type cyclins into and/or out of the nucleus, thus affecting the amounts of the cyclin(s) in the nucleus and the cytoplasm. In specific embodiments, candidate molecules can be assessed for their ability to inhibit nuclear-to-cytoplasmic shuttling or transfer of one or more cyclin D proteins, especially cyclin Dl and D3 proteins.

In other embodiments of the invention, screening methods utilize reporter transgenes including a transcriptional regulatory element operably associated and driving the expression of a sequence encoding and intact or genetically modified D- type cyclin. The reporter transgenes are suitable and used to monitor the sub-cellular localization of the expressed D-type cyclin or cyclins. In such screening methods, cardiomyocytes can be plated onto suitably formatted tissue culture plates. The cardiomyocytes may, for example, be obtained from transgenic animals harboring cardiomyocyte cells containing the reporter transgenes, by direct transfection of cardiomyocytes with viral vectors, or by differentiation of stem cells carrying the

reporter transgenes to obtain cardiomyocytes and optionally isolating a population of cardiomyocytes. In a further step of the screening method, the cultured cells are contacted with candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. After contact with the candidate molecule or molecules, the cultures are processed to monitor the sub¬ cellular localization of the native or modified D-type cyclin. In certain embodiments, multiple D-type cyclins are monitored simultaneously, e.g. using differing reporters, for example by using a reporter transgene wherein a transcriptional regulatory element targets expression of a cyclin D I/enhanced green fluorescent protein fusion protein in combination with a reporter transgene in which a transcriptional regulatory element targets expression of a cyclin D2/enchanced yellow fluorescent protein fusion protein. Alternatively, flag-tagged, talon-tagged or other reporters, as well as unmodified cyclin molecules, can also be employed. The sub-cellular localization of the D-type cyclin is thereby determined, and compounds that alter the sub-cellular localization in the desired fashion can be processed through additional screens, for instance to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In certain embodiments, such desired fashion involves altering the shuttling of one or D type cyclins into and/or out of the nucleus, thus affecting the amounts of the cyclin(s) in the nucleus and the cytoplasm. In specific embodiments, candidate molecules can be assessed for their ability to inhibit nuclear-to-cytoplasmic shuttling or transfer of one or more cyclin D proteins, especially cyclin Dl and D3 proteins. In other embodiments of the invention, non-cardiomyocyte cells are used in screening to identify molecules capable of altering the sub-cellular localization of one or more D-type cyclins. Suitable cell types for these purposes include for example cells of the lineages described hereinabove. These cells may be in their native form or may be genetically modified to express a transgene comprising a transcriptional regulatory element operably associated with a nucleotide sequence encoding and intact or genetically modified D-type cyclin, suitable for monitoring the sub-cellular localization of the D-type cyclin. The cells are plated onto suitably formatted tissue culture plates. Candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries, are then contacted with the cultured cells. The cell cultures are then processed to monitor the sub-cellular

localization of the endogenous D-type cyclin or the transgene-coated D-type cyclin. Such monitoring can be facilitated by the expression of a D-type cyclin fusion protein with a fluorescent molecule, such as enhanced green fluorescent protein or enhanced yellow fluorescent protein. In certain modes of the invention, multiple D-type cyclins are monitored simultaneously, e.g. using differing reporters, for example by using a cyclin D I/enhanced green fluorescent protein fusion protein in combination with a cyclin D2/enhanced yellow fluorescent protein fusion protein. Alternatively, flag- tagged, talon-tagged or other reporters, as well as unmodified cyclin molecules, can be employed. Molecules that alter the sub-cellular localization of the D-type cyclin or cyclins in a desired fashion can then be processed through an additional screen using cardiomyocytes, for example one designed to determine the efficacy of the molecule in inducing regenerative cardiac growth in vitro and/or in vivo. Candidate molecules that successfully alter the sub-cellular localization of the D-type cyclin or cyclins in the cardiomyocyte-based screens in a desired fashion can then be processed through still further screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In certain embodiments, such desired fashion involves altering the shuttling of one or D type cyclins into and/or out of the nucleus, thus affecting the amounts of the cyclin(s) in the nucleus and the cytoplasm. In specific embodiments, candidate molecules can be assessed for their ability to inhibit nuclear-to-cytoplasmic shuttling or transfer of one or more cyclin D proteins, especially cyclin Dl and D3 proteins.

Still further embodiments of the invention provide screening methods for identifying molecules capable of altering D-type cyclin stability or persistence of activity. In certain embodiments, such screening methods utilize cardiomyocytes to monitor stability of endogenous D-type cyclin or cyclins. In a first step, primary or stem cell-derived cardiomyocytes are plated on suitably formatted tissue culture plates. The cultured cells are then contacted with one or more candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures can then be processed for anti-cyclin D immune cytochemistry to determine the stability of the D-type cyclin or cyclins. In certain embodiments, multiple cyclins are simultaneously monitored using fluorescent secondary antibodies with different fluorphores (e.g. FITC for cyclin Dl, rhodamine

for cyclin D2, etc.). Molecules that alter the stability of the D-type cyclin in a desired fashion can be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In certain embodiments, candidate molecule(s) can be assessed for their ability to increase or decrease the stability of one or more of the D-type cyclins while not affecting, oppositely affecting, or having a similar but lesser affect upon, the stability of one or more other of the D- type cyclins. In specific embodiments, candidate molecule(s) are assessed for their ability to decrease the stability of one or both of cyclins Dl and D3 while not affecting or increasing the stability of cyclin D2 in the cells, to preferentially increase the stability of cyclin D2 as compared to that of cyclin Dl and/or D3, or to preferentially decrease the stability of cyclin Dl and/or D3 as compared to that of cyclin D2.

In other embodiments of the invention, screening methods are provided using reporter transgenes including a transcriptional regulatory element operatively associated and driving expression of sequences encoding an intact or genetically modified D-type cyclin suitable for monitoring the stability of the D-type cyclin. In such methods, cardiomyocytes can be plated upon suitably formatted tissue culture plates. These cardiomyocytes may be obtained from transgenic animals harboring cardiomyocyte cells including the reporter transgenes, by direct transfection of cardiomyocytes with viral vectors, or by the differentiation of stem cells carrying the reporter transgenes to obtain cardiomyocytes, and optionally isolating the cardiomyocytes from other cell types resultant of the differentiation. Candidate molecule(s) are then contacted with the cultured cells. Candidate molecule(s) may for example include chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cell cultures are then processed to monitor the transgene product and determine the stability of the D-type cyclin. In some embodiments of the invention, the stability of multiple D-type cyclins is monitored simultaneously, e.g. using differing reporters, for example using a reporter transgene wherein a transcriptional regulatory element targets expression of a cyclin Dl/green fluorescent protein fusion protein in combination with a reporter transgene in which a transcriptional regulatory element targets expression of a cyclin D2/enhanced yellow fluorescent protein fusion protein. Alternatively, flag-tagged, talon-tagged or other reporters, or unmodified cyclin molecules, can also be employed. Molecules that alter

the stability of the D-type cyclin or cyclins in a desired fashion can then be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In certain embodiments, candidate molecule(s) can be assessed for their ability to increase or decrease the stability of one or more of the D- type cyclins while not affecting, oppositely affecting, or having a similar but lesser affect upon, the stability of one or more other of the D-type cyclins. In specific embodiments, candidate molecule(s) are assessed for their ability to decrease the stability of one or both of cyclins Dl and D3 while not affecting or increasing the stability of cyclin D2 in the cells, to preferentially increase the stability of cyclin D2 as compared to that of cyclin Dl and/or D3, or to preferentially decrease the stability of cyclin Dl and/or D3 as compared to that of cyclin D2.

In other embodiments of the invention, non-cardiomyocyte cells are used in screens for identifying molecules capable of altering stability of one or more D-type cyclins. Suitable cell types for these purposes include for example cells of the lineages described hereinabove. The cells can be non-genetically altered or genetically altered generally as discussed in the embodiments above to express a transgene comprising a transcriptional regulatory element operably associated to a sequence encoding an intact or genetically modified D-type cyclin, so that the D-type cyclin stability can be monitored. The cells are plated onto suitably formatted tissue culture plates and contacted with candidate molecules, for example chemical libraries, RNAi libraries or individual candidates, or dominant negative protein libraries. The cultures are processed to monitor the stability of either the endogenous D-type cyclin or the reporter gene product as described above. Compounds that alter the stability of the D-type cyclin or cyclins in a desired fashion can be processed through an additional screen using cardiomyocytes, for example a cardiomyocyte-based screen as described herein. Molecules that alter the stability of D-type cyclins in cardiomyocytes in a desired fashion can then be processed through additional screens to determine their efficacy in inducing regenerative cardiac growth in vitro and/or in vivo. In certain embodiments, candidate molecule(s) can be assessed for their ability to increase or decrease the stability of one or more of the D-type cyclins while not affecting, oppositely affecting, or having a similar but lesser affect upon, the stability of one or more other of the D-type cyclins. In specific embodiments, candidate

molecule(s) are assessed for their ability to decrease the stability of one or both of cyclins D 1 and D3 while not affecting or increasing the stability of cyclin D2 in the cells, to preferentially increase the stability of cyclin D2 as compared to that of cyclin Dl and/or D3, or to preferentially decrease the stability of cyclin Dl and/or D3 as compared to that of cyclin D2.

In each of the screening methods described herein, and especially in conjunction with screening methods employing cardiomyocyte cells, in addition to contact with the candidate compound under study, the cells can be subjected to at least one other stimulus. For example, in the case of cardiomyocyte cells, the cells may be subjected to a hypertrophic agent or other injurious stimulus such as one described hereinabove. This injurious stimulus may be applied to the cells before, simultaneously with, and/or after the candidate compound under study.

In one aspect candidate compounds are compounds that can increase the rate of growth of various cell types such as cardiomyocytes. In still another aspect candidates are compounds such that can inhibit the proliferation of smooth muscle cells. These candidates may have particular utility in the preventing restenosis the thickening of the arterial wall as sometimes occurs after a stent is placed in a blood vessel in order to treat a blockage in the vessel. Compounds that can be used to treat medical conditions characterized by excess smooth muscle growth by interfering with the cell cycle of smooth muscle cells include flavopiridol and 4-H-l benzyopyran-4- one derivatives. See US Patent No. 6,399,633, which is hereby incorporated by reference in its entirety.

Aspects of the present invention can employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al. 1989); "Oligonucleotide Synthesis" (Gait ed. 1984); "Animal Cell Culture" (Freshney ed. 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (Wei & C. C. Blackwell eds.); "Gene Transfer Vectors for Mammalian Cells" (Miller & OCalos, eds. 1987); "Current Protocols in Molecular Biology" (Ausubel et al. eds. 1987); "PCR: The Polymerase Chain Reaction" (Mullis et al. eds.

1994); "Current Protocols in Immunology" (Coligan et al. eds. 1991). These techniques are applicable to the production of the nucleic acid molecules of the invention, and, as such, may be considered in making and practicing the invention.

Examples In this study, the capacity of the three mammalian D-type cyclins to drive cardiomyocyte cell cycle activity was directly compared. The MHC promoter was used to target expression of cyclin Dl, D2, or D3 to the myocardium in transgenic mice (MHC-cycDl, MHC-cycD2, and MHC-cycD3 mice, respectively). In each case, transgene expression resulted in nuclear accumulation of cyclin D and CDK4 immune reactivity. Similar rates of cardiomyocyte DNA synthesis were detected in uninjured adult hearts in all three transgenic models. Myocardial injury resulted in cytoplasmic accumulation of transgene-encoded cyclin protein in MHC-cycDl and MHC-cycD3 mice, with a concomitant reduction in cardiomyocyte DNA synthesis levels. In contrast, myocardial injury in MHC-cycD2 mice had no impact on the subcellular localization of transgene encoded cyclin protein, and in some cases, injury enhanced cardiomyocyte DNA synthesis levels. Cardiomyocyte cell cycle activity in MHC-cycD2 hearts was associated with a marked regression of infarct size after permanent coronary artery occlusion. These data indicated that the D-type cyclins are not functionally redundant, and furthermore suggested that modulation of D-type cyclins could be exploited to promote myocardial repair in injured hearts.

Materials and Methods

Referring now to Fig. 3, cDNAs encoding cyclin Dl, cyclin D2 and cyclin D3 were generated using RT-PCR. The mouse alpha-cardiac myosin heavy chain (MHC) promoter was used to target expression of each cyclin cDNA (Fig. 3 a). The SV40 transcription terminator/poly-adenylation site was inserted downstream from the cyclin D sequences. Transgenic mice were generated using standard methodologies and maintained in a DBA/2J background (The Jackson Laboratory). All animal protocols were approved by the Institutional Animal Care and Use

Committee. All analyses of transgenic mice were initiated at 11-13 weeks of age.

Antibodies used for the Western blot analyses were as follows: anti-cyclin Dl (sc-450), anti-cyclin D2 (sc-593), anti-cyclin D3 (sc-182), anti-CDK4 (sc-260), anti-CDK6 (sc-177), anti-cyclin D2 antibody (CC07). Secondary antibodies were conjugated with horseradish peroxidase. Signal was visualized by the ECL method.

The SV40 early region transcription terminator/poly-adenylation site (nucleotide residues 2586-2452) ⁶ was inserted downstream from the cyclin D sequences. The three resulting transgenes (MHC-cycD 1, MHC-cycD2, and MHC- cycD3, respectively) were each independently microinjected into inbred C3HeB/FeJ (The Jackson Laboratory, Bar Harbor, ME) zygotes, and transgenic animals were generated using standard methodologies. The resulting transgenic lineages were maintained in a DBA/2J background (The Jackson Laboratory). All animal protocols were reviewed and approved by the Institutional Animal Care and Use Committee. All analyses of transgenic mice were initiated at 11-13 weeks of age.

Hearts were homogenized in a NP-40 buffer, and samples were isolated, separated on acrylamide gels and electroblotted to nitrocellulose as described . See Harlow, E., and lane, D., Antibodies a Laboratory Manual, Cold Spring Harbor Lab. Press, Plainview, NY (1988). The antibodies used were: anti-cyclin Dl (sc- 450), anticyclin D2 (sc-593), anti-cyclin D3 (sc-182), anti-CDK4 (sc-260), anti- CDK6 (sc-177), anti-CDK2 (sc-163), anti-cdc2 (sc-954) and anti-PCNA (sc-56); all from Santa Cruz Biotechnology, Santa Cruz, CA) and anti-cyclin D2 antibody (0007; Oncogene, Cambridge, MA). Secondary antibodies were conjugated with horseradish peroxidase, and signal was visualized by the ECL method according to the manufacturer's protocol (Amersham, Arlington Heights, IL)

Heart RNA was isolated and hybridized with a radio-labeled oligonucleotide probe (5'-

CCATGGCGGCCAAGCTATCGCATGCCTGCAGAGCTCTAGAGTCGACGG GCCCGGTACC-3' SEQ. ID NO. 9; was specific for the SV40 transcription termination/poly adenylation site, it was used to monitor transgene expression. Ten micron cryosections were reacted with anti-cyclin Dl (sc-450), anti- cyclin D2 (sc-593), anti-cyclin D3 (sc-182), anti-CDK4 (sc-260) or anti-

phosphorylated histone H3 (Upstate, Lake Placid, NY) antibodies and signals were visualized with a Vector M.O.M. kit or Vectastain ABC kit from Vector Laboratories.

Myocardial hypertrophy was induced by isoproterenol. Cautery injury was performed as described previously. To induce myocardial infarction, an 8-0 Prolene ligature was placed around the left coronary artery close to the inferior border of the left auricle and tied off as described previously. In mice, the interventricular septum is spared following ligation of the left coronary artery. The MHC-nLAC reporter transgene was used to monitor cardiomyocyte DNA synthesis as described previously. Cardiomyocyte DNA synthesis was scored by the co-localization of blue nuclear beta-galactosidase activity and silver grains. The border zone was defined as myocardial tissue within 0.5 mm of the fibrous scar tissue.

Hearts were perfusion-fixed in 1 % paraformaldehyde, 1 % cacodylic acid, 1 xPBS at room temperature as described previously. Hearts were then sectioned coronally on a vibratome at 1.2 mm intervals from apex to base, and representative thin cryo-sections (10 microns) were prepared from each vibratome section and stained with Sirius Red-Fast Green. Digital images were captured and infarct sizes were calculated according to the formula developed by Pfeffer and colleagues: ¹⁶ [coronal infarct perimeter (epicardial + endocardial)/ total coronal perimeter

(epicardial + endocardial)] x 100. To quantitate cardiomyocyte number, coronal sections were stained with silver nitrate ¹⁷ the total number of cardiomyocytes was determined.

All data are presented as mean ± SEM. Between-group comparisons were analyzed by the non-parametric Mann- Whitney test (MI DNA synthesis), ANOVA and Bonferroni multiple comparison test (baseline HW/BW, baseline, isoproterenol and cautery DNA synthesis) or Student t test (isoproterenol HW/BW and MI size analysis). Significance was assumed at P<0.05.

Example 1

Generation and initial analysis of the MHC-cycD 1 , MHC-cycD2 and MHC- cycD3 transgenic mice. The alpha cardiac MHC promoter has been used previously to target expression of a cyclin Dl cDNA to the heart. A similar strategy was used here to target expression of cyclin D2 and cyclin D3 cDNAs (Fig. 3a). The MHC promoter comprised 4.5 kb of 5' flanking sequence and 1 kb of the MHC 5' untranslated region encompassing exons 1-3 up to (but not including) the MHC initiation codon. Thus the first ATG encountered in transgene-derived transcripts resided in the cyclin D cDNA. To ensure appropriate processing of transgene transcripts, the SV40 early region transcription terminator was inserted after the cyclin cDNA sequences. A total of 9 MHC-cycD 1, 8 MHC- cycD2 and 12 MHC-cycD3 lineages were established. Northern blot analyses were used to compare the relative level of transgene expression between MHC- cycD transgenic lines (Fig. 3b). Hybridization with an oligonucleotide probe corresponding to the common SV40 terminator sequences revealed roughly similar levels of transgene rnRNA expression in the MHC-cycD 1, MHC-cycD2 and MHC-cycD3 lines used in this study.

Western blot analyses of non-transgenic hearts demonstrated that all three endogenous D-type cyclins were expressed at high levels in embryonic stage (day 15), and were barely detectable in adult non-transgenic hearts (Fig. 3c). The level of cyclin Dl in adult MHC-cycD 1 hearts was somewhat higher than that seen in non-transgenic hearts at embryonic day 15. Similarly, the level of cyclin D2 in adult MHC-cycD2 hearts and the level of cyclin D3 in adult MHC-cycD3 hearts were higher than that for the corresponding endogenous cyclin in non-transgenic hearts at embryonic day 15 (Fig. 3c). High levels of transgene expression in adult MHC-cycD 1 hearts had no detectable effect on expression of the endogenous cyclin D2 and cyclin D3. Similarly, transgene expression did not affect the levels of the endogenous D-type cyclins in the MHC-cycD2 or MHC-cycD3 adult hearts. The expression of several additional cell cycle regulatory proteins was also monitored (Fig. 3c). CDK4 levels (the obligate D-type cyclin binding partner) were elevated in the MHC-cycD transgenic animals, approaching those seen during cardiac development in non-transgenic hearts. PCNA levels were also

observed to be increased, but to a much lesser degree. In contrast, transgene expression had no obvious effects on the levels of CDK6, CDK2 and cdc2. In all cases, equivalent sample loading was confirmed via Napthal Blue staining of the membranes prior to Western blot analyses (Fig. 13). Transgene expression was accompanied by a moderate increase in cardiac mass, a 37%, 20% and 31 % increase in the heart weight/body weight ratio was observed for the MHC-cycDl, MHC-cycD2, and MHC-cycD3 mice, respectively, as compared to their non- transgenic littermates (n=8-15 mice per group, p<0.05 vs. non-transgenic littermates for each group; see also Table 1).

Example 2

It has recently been reported that cell cycle withdrawal in neonatal cardiomyocytes was due in part to a relocalization of cyclin Dl from the nucleus to the cytoplasm. Immune histologic analyses were therefore performed to ascertain the subcellular localization of transgene-encoded cyclin D. No overt D-type cyclin expression was noted in non-transgenic adult hearts reacted with anti-cyclin Dl (Fig. 4a), anti-cyclin D2 or anti-cyclin D3 antibodies (not shown). In contrast, robust nuclear cyclin Dl immune reactivity was detected in hearts from adult MHC-cycDl mice (Fig. 4a). Similarly, nuclear cyclin D2 and cyclin D3 immune reactivity was detected in hearts from adult MHC-cycD2 and MHC-cycD3 mice, respectively. CDK4 immune reactivity was also monitored. No overt CDK4 immune reactivity was detected in adult non-transgenic hearts (Fig. 4b). In contrast, robust nuclear CDK4 immune reactivity was present in the ventricles of each of the MHC-cycD transgenic hearts. Given the sub-cellular localization of D-type cyclin and CDK4, and given the induction of PCNA expression, experiments were initiated to monitor cardiomyocyte DNA synthesis in the MHC-cycD mice. Accordingly, each transgenic lineage was crossed with MHC-nLAC mice, and the resulting MHC- nLAC / MHC-cycD and MHC-nLAC / (-) animals were sequestered. Cardiomyocyte nuclei in mice carrying the MHC-nLAC reporter transgene were readily identified in X-GAL stained histologic sections. To monitor cardiomyocyte DNA synthesis, the mice were given a single injection of tritiated

thymidine and sacrificed 4 hours later. The hearts were harvested and sectioned, and the sections were stained with X-GAL and processed for autoradiography. The presence of silver grains over blue nuclei was indicative of cardiomyocyte DNA synthesis. No cardiomyocyte DNA synthesis was detected in mice that inherited the

MHC-nLAC reporter gene only, although cardiac fibroblast DNA synthesis was readily detected (as evidenced by the presence of silver grains over nuclei lacking X-GAL staining, Fig. 4c). In contrast, cardiomyocyte DNA synthesis was readily detected in the hearts of the adult D-type transgenic mice (as evidenced by the presence of silver grains over nuclei with blue X-GAL staining, Fig. 4c). Elevated levels of cardiomyocyte DNA synthesis was detected in all three transgenic lineages, suggesting that the activities of the D-types cyclins were functionally redundant under baseline conditions (although levels were somewhat greater in MHC-cycD2 and -cycD3 hearts; Fig. 5a; see also Table 1). These data indicate that D-type cyclins are nuclear localized and promote ventricular cardiomyocyte DNA synthesis in uninjured adult transgenic hearts.

Example 3

To determine if cardiomyocyte DNA synthesis persisted during myocardial hypertrophy, MHC-nLAC / (-) and MHC-nLAC / MHC-cycD double transgenic mice were subjected to 7 days of isoproterenol infusion. This treatment resulted in a marked increase in heart weight/body weight ratio (see Table 1). The isoproterenol-treated mice were given an injection of tritiated thymidine 4 hrs. prior to sacrifice, and the hearts were processed as described above. Surprisingly, isoproterenol induced hypertrophy markedly reduced the levels of ventricular cardiomyocyte DNA synthesis in mice inheriting the MHC-cycDl or the MHC- cycD3 transgenene (Fig. 5b; see also Table 1). In contrast, isoproterenol infusion had no impact on cardiomyocyte DNA synthesis in the hearts of adult MHC-cycD2 mice; the level of DNA synthesis in the treated animals was not significantly different from that seen under baseline conditions. In agreement with previous studies, no cardiomyocyte DNA synthesis was detected in the ventricles of

isoproterenol-treated mice inheriting only the MHC-nLAC transgene (Fig. 5b, see also Table 1).

Cardiomyocyte DNA synthesis was also monitored in MHC-nLAC / (-) and MHC-nLAC / MHC-cycD mice following cautery injury (an open chest protocol that induces a focal necrotic injury, with concomitant cardiomyocyte hypertrophy in the bordering myocardium). Mice received an injection of tritiated thymidine 7 days following cautery injury, and the hearts were processed as described above. Cardiomyocyte DNA synthesis was markedly reduced in the injury border zone in hearts from mice inheriting the MHC-cycD 1 or MHC-cycD3 transgene (Fig. 5). Li contrast, a two-fold induction in border zone cardiomyocyte DNA synthesis was observed in cautery-injured MHC-cycD2 mice. Collectively, these data suggested that myocardial injury antagonized cell cycle activity in MHC-cycD 1 and MHC- cycD3 mice, but not in MHC-cycD2 mice. These data illustrate that myocardial injury attenuates ventricular cardiomyocyte DNA synthesis in MHC-cycDl and MHC-cycD3 mice, but not MHC-cycD2 mice.

Example 4

Western blot analyses of samples prepared from isoproterenol-treated transgenic hearts revealed a slight reduction in steady state cyclin levels in the MHC-cycD 1 and MHC-cycD2 hearts, as compared to non-treated transgenic littermates (Fig. 6a). Isoproterenol did not affect steady state cyclin levels in MHC-cycD3 mice. Moreover, isoproterenol infusion had no effect on CDK4 levels in any of the transgenic lineages. Thus, reduced cardiomyocyte DNA synthesis following isoproterenol treatment in MHC-cycD 1 and MHC-cycD3 hearts was not due to decreased accumulation of cyclin and/or CDK4 proteins.

Immune histologic analyses were performed to monitor cyclin sub-cellular localization. Robust nuclear cyclin expression was observed in the ventricles of hearts from both un -treated and isoproterenol-treated MHC-cycD2 mice (Fig. 6b). In contrast, isoproterenol treatment resulted in a marked redistribution of cyclin immune reactivity in the MHC-cycD 1 and MHC-cycD3 mice, with the preponderance of the signal present in the cardiomyocyte cytoplasm. Cyclin D subcellular localization was also examined following cautery injury. No nuclear

cyclin D immune reactivity was detected in the injury border zone of MHC-cycDl mice at 7 days post cauterization (Fig. 6c). Similar results were observed with MHC-cycD3 mice (not shown). In contrast, cyclin D nuclear immune reactivity persisted in the injury border zone in MHC-cycD2 transgenic mice at 7 days post cauterization (Fig. 6c). Thus the reduced cardiomyocyte DNA synthesis in isoproterenol-treated or cautery-injured MHC-cycDl and MHC-cycD3 hearts correlated with the loss of nuclear cyclin immune reactivity, and cyclin D2 was largely resistant to the signals that underlie this sub-cellular trafficking; indicating that injury alters D-type cyclin sub-cellular localization in MHC-cycDl and MHC- cycD3 mice, but not MHC-cycD2 mice.

Example 5

Given the sustained cardiomyocyte cell cycle activity in MHC-cycD2 mice following isoproterenol infusion and cautery damage, we reasoned that these animals might exhibit regenerative growth following a more clinically relevant form of myocardial injury. Accordingly, MHC-nLAC / (-) and MHC-nLAC / MHC-cycD2 transgenic mice were anesthetized, intubated, and subjected to permanent coronary artery occlusion. The mice received tritiated thymidine injections at 7 or 150 days post injury, and hearts were harvested 4 hours later and were processed for X-GAL staining and autoradiography. Cardiomyocyte DNA synthesis was detected at the infarct border zone and in the inter- ventricular septum of hearts from MHC-nLAC / MHC-cycD2 mice at 7 days post injury (Fig. 7a). These high levels of cardiomyocyte DNA synthesis persisted for as long as 150 days post injury, the latest date analyzed thus far (Fig. 7b; see also Table 1). In contrast, only very low levels of cardiomyocyte DNA synthesis were detected at the infarct border zone in MHC-nLAC / (-) hearts at 7 days post injury, and no cardiomyocyte DNA synthesis was detected in the inter-ventricular septum. Moreover, no cardiomyocyte DNA synthesis was detected at either site in the MHC-nLAC / (-) hearts at 150 days post injury (Fig. 7b; see also Table 1) Histological analyses were performed to monitor infarct size in the MHC- nLAC / (-) and MHC-nLAC / MHC-cycD2 hearts (n=10 mice/group/time point). Hearts were harvested at 7 days or 150 days post injury, fixed under physiologic

pressure, and coronal sections sampled at 1.2 mm intervals were stained with Sirius red (which stained collagen red) and fast green (which stained viable myocardium green). Digital images were acquired and the percentage of the myocardium that was infarcted was determined at each 1.2 mm interval using the quantitation approach described by Pfeffer and colleagues. The value from each 1.2 mm interval was then averaged to calculate infarct size for each individual heart, and subsequently for each genotype (Fig. 8a). No significant difference in infarct size was apparent between the MHC-nLAC / (-) and MHC-nLAC / MHC- cycD2 hearts at 7 days post injury, indicating that expression of cyclin D2 was not cardioprotective during the acute stages of myocardial infarction. At 150 days post injury, a slight trend toward increased infarct size was observed in the MHC- nLAC / (-) hearts as compared to the earlier time point (Fig. 8a), consistent with scar expansion. In contrast, infarct size in the MHC-nLAC / MHC-cycD2 hearts was significantly reduced at 150 days post injury, as compared to hearts at 7 days post injury. Infarct size reduction was observed in both male and female transgenic mice (Fig. 8a), and was readily apparent when comparing representative sections from infarcted non-transgenic vs. MHC-cycD2 hearts at 150 days post injury (Fig. 8b).

The observed cardiomyocyte DNA synthesis at the infarct border zone, as well as the regression in infarct size, suggested that cell cycle activation resulted in regeneration of myocardial tissue following permanent coronary artery occlusion. To further explore this possibility, infarcted MHC-cycD2 hearts were screened for the presence of cardiomyocyte phosphorylated histone H3 immune reactivity (a marker of mitotic cells). Co-localization of X-GAL activity and histone H3 immune reactivity was readily detected (Fig. 9a), suggesting that these cells are able to undergo cytokinesis. In contrast, no co-localization of X-GAL and histone H3 signal was detected in injured non-transgenic hearts. To further document the presence of regenerative growth, cardiomyocyte number was determined in coronal sections harvested at 1.2 mm intervals from the apex to the base of the heart in non-transgenic and MHC-cycD2 hearts at 7 days and at 150 days after permanent coronary artery ligation. A similar number of cardiomyocytes were seen in sections sampled from non-transgenic hearts at 7 days and 150 days post

injury, as well as from MHC-cycD2 hearts at 7 days post injury. In contrast, a marked and significant increase in cardiomyocyte number was observed in sections from the MHC-cycD2 hearts at 150 days post injury (Fig. 9b). Collectively, these data strongly support the notion that expression of cyclin D2 can promote cardiac regeneration following injury. These results illustrate that Cardiomyocyte DNA synthesis and infarct regression in MHC-cycD2 mice with permanent coronary artery occlusion.

Example 6

Here we use transgenic mice with cardiomyocyte-restricted cyclin D2 expression to examine the effects of cell cycle activation on cardiac function following myocardial infarction. Although a similar effect on cardiac function and structure was observed in the transgenic and non-transgenic mice at 7 days after infarction, the transgenic animals exhibited a progressive and marked reduction in infarct size with a concomitant increase in cardiac function at subsequent time points. These findings indicate that cardiomyocyte cell cycle activation represent an important clinical strategy to promote myocardial repair.

Materials and Methods for Example 6

The generation of the MHC-cycD2 transgenic line was described previously. These animals expressed a mouse cyclin D2 cDNA under the transcriptional regulation of the mouse α-cardiac myosin heavy chain (MHC) promoter (See Glick, J., et al., J. Biol. Chem. 266:9180-9185 (1991). These mice were maintained in a DBA/2J inbred background.

Myocardial infarction (MI) was induced by ligation of the left coronary artery. Briefly, the animals were intubated and ventilated with 2% isoflurane and supplemental oxygen. Via left thoracotomy, the left coronary artery was tied off with an 8-0 Prolene ligature close to the inferior border of the left auricle. The intercostal space and the skin incision were then closed with interrupted sutures, the endotracheal tube was removed, and the animal placed on a 37° Celsius heating pad (Cole Partner, Vernon Hills IL) under an oxygen cover for recovery until 24

hours post surgery. Sham-operated animals underwent the same procedure without ligation of the coronary artery.

Pressure-volume measurements were obtained as described before (See Geogakopoulus, D., et al., Am. J. Physiol. Heart Circ. Physiol. 279:H443-H450 (2000). At 7, 60 or 180 days after MI or sham-operation, mice were anesthetized with 2% isoflurane supplemented with 100% oxygen, intubated with an endotracheal tube and ventilated with a rodent ventilator (Minivent 845; HugoSachs Elektronik, March-Hugstetten, Germany) at 125 breaths/min and a tidal volume of 6-7 μl/g. Mice were placed in supine position under a dissection microscope and connected to a feedback heating lamp via a rectal temperature sensor for maintenance of stable body temperature at 37° Celsius. A precalibrated four-electrode 1.4F pressure-volume (P-V) catheter (Model SPR 839; Millar Instruments, Houston, TX) was inserted into the right common carotid artery and advanced into the left ventricle (LV). The catheter was connected to a pressure- conductance unit (Sigma SA; CD Leycom, Zoetermeer, The Netherlands). The continuous pressure and volume signals were monitored in real time and digitized at a sample rate of 500/s, using specialized software (Conduct NT; CD Leycom, Zoetermeer, The Netherlands) on a notebook computer. The display of the on-line pressure- volume signals allowed for optimal positioning of the catheter within the left ventricle.

After a short period of stabilization, LV pressure- volume loops were recorded at baseline and the signals were acquired 3 times for 5 seconds with the ventilator stopped. This yielded 3 times 40-50 cardiac cycles from which the following parameters were determined using specialized Circlab analysis software (Leiden University Medical Center, Leiden, The Netherlands): heart rate (HR), LV end-systolic pressure (Pes), LV end-diastolic pressure (Pod), LV peak positive and negative developed pressures (dP/df _max and dP/dϊ _πύn respectively) and LV isovolumic relaxation time constant (T au). After the steady state measurements, pressure-volume relations were measured 3 times by transiently occluding the inferior vena cava.

From the acquired 10 to 20 successive cardiac cycles the following parameters were derived: the end-systolic pressure-volume relation (ESPVR; or

end-systolic elastance: E _es ) slope, stroke work (SW) end-diastolic volume (EDV) relation (preload recruitable stroke work; PRSW) and the slope of the dP/dr _max with respect to time (dP/dt _max /EDV).

After functional analysis, hearts were harvested, fixed with formalin, and embedded in paraffin using standard protocols (See Bullock, G. r., and Petrusz, P., Techniques in Immunocytochemistry, Academic Press, New York, NY (1982)). Coronal sections were sampled from apex to base at 1.0mm intervals and stained with Azan (Sigma) according to the manufacturer's protocol. Digital photographs were made and infarct size was calculated using the following formula: [length of coronal infarct perimeter {epicardial + endocardial}/ total left ventricle coronal perimeter {epicardial + endocardial}] x 100.

Other sections were stained for connexin-43 to determine the presence of connexin-43 containing gap junctions in cardiomyocytes in the peri-infarct zone. Sections were deparafnized, blocked for endogenous peroxidase, hydrated and incubated with the connexin-43 rabbit polyclonal antibody (Zymed; used at 1:500) at RT for lhr. Antigen retrieval was done by boiling heart sections for 20 min in 0.1 M citric acid and 0.1 M sodium citrate. Staining was visualized using diaminobenzidine tetrahydrochloride.

Preparation of the hearts carrying skeletal myoblast grafts and TPME imaging were performed as described previously. See, Rubart, M., et al., Amer. Jour, of Physiol., 284:C1645-C-1688 (2003). Two-photon molecular excitation images of peri-infarct myocardium were recorded with aBio-Rad MRC 1024 Laser Scanning microscope modified for TPME. Illumination for 2-photon excitation was provided by a mode-locked Ti:Sapphire laser (Spectraphysics, Mountain View, CA); the excitation wavelength was 810 nm. Hearts were imaged through a Nikon 6Ox 1.2 numerical aperture water-immersion lens with a working distance of 200 microns. Images were collected at a resolution of 0.43 μm/pixel along the xy-axis. For full-frame mode analyses (512 x 512 pixels), hearts were scanned at 1.46 and 0.73 frames per second on horizontal (X, Y) planes and the resulting images digitized at 8-bit resolution and stored directly on the hard disc. For line-scan mode analyses, hearts were scanned repetitively along a line spanning at least 2 juxtaposed cardiomyocytes (scan speed was 110 microns/ms). Line-scan images

were then constructed by stacking all lines vertically. Post-acquisition analysis was performed using MetaMorph software version 4.6r (Universal Imaging Incorporation, Downingtown, PA).

During TPME imaging, hearts were perfused with oxygenated normal Tyrode's solution containing 50 micromol/L cytochalasin D to eliminate contraction-induced movement. If the spontaneous heart rate was < 2 Hz, hearts were point stimulated at a site remote from the graft at 2 Hz. Electrical field stimulation of Langendorff-perfused hearts was performed by positioning the heart between a pair of loop-shaped platinum wires placed ~1 cm apart, with the current flowing roughly perpendicular to the longitudinal axis of the heart. The hearts were stimulated with 60- to 100- V pulses of 1- to 2-ms duration using a Grass model SD9 stimulator. The fluorescent profiles of [Ca ²⁺ Ji transients were obtained by averaging the line-plot data of sequential line-scans.

AU data are presented as mean ± SEM. Between-group comparisons were analyzed by unpaired t test. Significance was assumed at P<0.05

Results

We utilized a transgenic mouse line that expresses cyclin D2 under the regulation of the cardiomyocyte-restricted alpha-cardiac myosin heavy chain promoter. Previous studies have shown that these mice (designated MHC-cycD2) exhibited cardiomyocyte cell cycle activity following myocardial injury. See Pasumarthi, K. B. S., et al., Cir. Res.96: 110-118 (2005). Cell cycle activation resulted in a decrease in infarct size at 150 days post-injury. This is in contrast to transgenic mice expressing cyclin Dl or D3, which exhibited cardiomyocyte cell cycle activity only in the absence of injury _. The phenotypic differences in these animals appeared to be secondary to differential subcellular shuttling of the D-type cyclins in cardiomyocytes subjected to injury. Here, adult male MHC-cycD2 transgenic mice and their non-transgenic siblings were subjected to permanent coronary artery occlusion, a process that resulted in severe myocardial infarction. The animals were sacrificed at 7, 60 and 180 following myocardial infarction, and subjected to a number of analyses to monitor the structural and functional consequences of cell cycle activation following cardiac injury.

Histological analyses were performed to determine the time course of infarct reduction in the transgenic mice. Hearts were fixed under physiologic pressure, and coronal sections sampled at 1 mm intervals were stained with Asan. Examination of representative sections revealed no overt differences in infarct size between MHC-cycD2 and nontransgenic mice at 7 days after MI. In contrast, a marked reduction of infarct scar size was apparent in hearts from the transgenic mice at 180 days following MI, as compared to the non-transgenic controls (Fig. 10a). The presence of newly formed myocardium was apparent in the more apically-located sections prepared from the transgenic heart, while scar tissue was largely resolved in sections located near the base of the heart. New myocardial growth was not detected in hearts from the non-transgenic mice at 180 days post MI, and transmural scar tissue was apparent from the apex to the base of the heart.

Statistical analyses of sections prepared at 7, 60 and 180 days post MI confirmed and expanded these gross observations. No statistically significant differences in infarct size were observed between the MHC-cycD2 mice and their non-transgenic siblings at 7 days following MI Fig. 10b, indicating that transgene expression did not exert an acute cardioprotective effect following permanent coronary artery occlusion. Infarct size remained largely unchanged in the non- transgenic mice over the course of the study, although a slight trend towards expansion was noted. In contrast a marked and significant reduction was already apparent at 60 days following MI in the MHC-cycD2 mice. This processes was progressive, as an even greater reduction in infarct size was apparent at 180 days following injury. In agreement with our previous analyses of the MHC-cycD2 mice, cardiomyocyte DNA synthesis was readily apparent at the infarct border zone at 7, 60 and 180 days following MI (not shown), indicating that the improved cardiac structure was due to on-going cardiomyocyte cell cycle activity.

Histologic examination of the apically-located newly formed myocardium in MHC-cycD2 mice at 180 days following injury revealed the presence of relatively normal appearing cardiomyocytes that contained well-organized sarcomers (Figure 11a, upper panel). These border zone cardiomyocytes were indistinguishable from cells in the remote, noninfarcted myocardium. The presence of anti-connexin 43 immune reactivity at junctional complexes between adjacent

cardiomyocytes (Fig. 11a, lower panel) raised the possibility that the newly formed myocardium might be functionally active. To directly test this, hearts from MHC- cycD2 mice harvested at 180 days following MI were place on a Langendorff apparatus, perfused with the calcium sensing dye rhod-2, and the apically-located newly formed myocardium was imaged using two photon molecular excitation (TPME) laser scanning microscopy. This assay permitted direct monitoring of intracellular calcium ([Ca ⁺² ];) transients within the newly formed myocardium in intact hearts.

The scar tissue and border zone cardiomyocytes were identified by their morphologic appearance in images obtained in full-frame mode (Fig. 1 Ib).

Periodic increases in rhod-2 fluorescence, due to spontaneous action potential- evoked increases in cytosolic calcium concentration, were visible as ripple-like wavefronts in the border zone cardiomyocytes but not in the scar. To better monitor temporal changes in [Ca ⁺² ]j, fluorescence signals were also recorded in line-scan mode during normal sinus rhythm.. The scan line (Fig. 12b, white bar) traversed three border zone cardiomyocytes in the newly formed myocardium at a speed of 110 μm/ms. This line was repeatedly scanned at a rate of 32 Hz, and the resulting line-scans were stacked vertically (Fig. 12c). Averaged traces of the red fluorescence from the cardiomyocytes were then generated from the stacked line- scan data (Fig. 12d). These traces demonstrated that the border zone cardiomyocytes exhibited transient increases in rhod-2 fluorescence, corresponding to spontaneous action potential-evoked increases in [Ca ⁺² Jj in synchrony with one another as well as with the remote myocardium.

The data presented above suggested that cardiomyocyte in the newly formed myocardium appeared to have the capacity to participate in a functional scyncitium with the surviving myocardium. Left ventricular pressure-volume measurements were performed to determine if this process had a positive impact on cardiac function following MI. In preliminary experiments, cardiac function was monitored in MHC-cycD2 mice and their non transgenic sibs at 7, 60 and 150 days following sham-operation. No statistically significant differences were noted between the MHC-cycD2 mice and their non-transgenic littermates in any of the 9 physiologic parameters analyzed (Table 2a), indicating that expression of the cyclin

D2 transgene had no effect on cardiac function. Cardiac function was then monitored in MHC-cycD2 mice and their non-transgenic sibs at 7, 60 and 150 days following MI. As expected, MI resulted in a marked alteration in many of the physiologic parameters analyzed in the non-transgenic mice at all time points following injury, with, a tendency towards worse cardiac function at the later time points (Table 2b). Cardiac function was also markedly depressed in the MHC- cycD2 hearts at 7 days following MI. Indeed, there were no statistical differences in the cardiac function parameters analyzed in the infarcted MHC-cycD2 and non- transgenic hearts at this time point, consistent with the similar infarct size observed in 7 days post-MI.

However, MHC-cycD2 mice showed markedly improved cardiac performance at 60 days following MI. Transgene expression and the concomitant generation of new myocardium resulted in statistically significant improvement in the ventricular isovolumic relaxation time constant (tau), the end-systolic pressure- volume relation (ESPVR), the preload recruitable stroke work (PRSW) and the slope of the dP/dr _max -end diastolic volume relation (dP/dr _max /EDV). Even greater improvement in these parameters was apparent by 180 post-MI, and the left ventricular peak positive developed pressure (dP/dt _max ) was also significantly improved at this time (Table 2b, Fig. 12a). For all other parameters measured (Pes, Ped, dP/dt _max ), marked trends towards improved function were observed in the MHC-cycD2 transgenic mice at 60 and 180 days post MI, as compared to the values at 7 days post MI (as well as compared to the values for the infarcted non- transgenic mice at any time point).

The data presented here demonstrated that targeted expression of cyclin D2 resulted in a progressive regression of infarct size in transgenic mice. This regression was accompanied by the appearance of newly formed myocardium comprised of well-differentiated, coupled cardiomyocytes. The presence of newly formed myocardium was positively correlated with improved left ventricular systolic and diastolic function. The improvement in PRSW and dP/dt _max /EDV were particularly noteworthy, as these parameters provide highly reproducible and load-independent indices of contractility. Importantly, heart rate (which can

influence global cardiac function) was not altered significantly between infarcted transgenic and nontransgenic animals.

Collectively these data support the notion that cardiomyocyte cell cycle activation can reverse structural myocardial damage, with a concomitant improvement in global cardiac function. This is in agreement with several other recent studies. For example, targeted expression of a dominant interfering version of p 193 (an E3 ubiquitin ligase molecule originally identified as an SV40 Large T antigen binding protein) resulted in cell cycle reactivation in the interventricular septum following MI. Cell cycle activity in the interventricular septum correlated with improved cardiac function following MI in this model . Similarly, transgenic mice expressing of IGF-I exhibited cell cycle activation and improved function following MI, although it was not clear if the beneficial effect of IGF-I in this model resulted from cardio-protection (as opposed to regenerative growth).

The magnitude of functional restoration observed in infarcted MHC-cycD2 mice was markedly greater that in these previous studies. This was presumably related to the volume of newly formed myocardium, which was also greater in the MHC-cycD2 model as compared to the others.

Thus, induction of cyclin D2 expression in cardiomyocytes after myocardial injury may have clinical implications for cardiac regeneration. Cyclin D2 gene transfer in human myocardium could possibly lead to a gene-based regenerative mechanism in patients. More realistically, development of pharmacological agents capable of modulating cyclin D2 expression in cardiomyocytes might prove to be a useful approach to engender regenerative cardiac growth. Importantly, such strategies would not give rise to immunological problems, which exist when transplanting allogeneic cells such as fetal or embryonic cardiomyocyte precursors for cardiac regeneration. In summary, cell cycle induction may represent an important therapeutic tool for cardiac regeneration and enhancement of cardiac function after myocardial infarction.

While the invention has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the

spirit of the invention are desired to be protected. In addition, all publications cited herein and all materials attached as a part of this application are hereby incorporated by reference herein in their entirety. An abstract is included for searching purposes only, it is not intended that the abstract be used to interpret any other part of this document including the claims.