Technical field

[0001] The present disclosure relates to the use of a composition comprising an emulsion of paraffin wax and DNA as a DNA stabilizer in lignocellulosic material substrates. It has application in a number of emerging fields where the preservation of information integrity in DNA is required. These include the use of DNA in tag and trace applications, the development of DNA-based storage devices or the preservation of DNA samples in environmental studies.

Background Art

[0002] Deoxyribonucleic acid or DNA is known for its role as information carrier in living organisms. However, recent technological advancements in areas such as DNA synthesis, sequencing, and nanomaterials sciences, have opened new possibilities beyond its biological role. Due to its ability to store information at molecular level, DNA or DNA-based materials are now being used in a variety of applications such as product tagging and data storage.

[0003] The increase complexity and consequent vulnerability of supply chains has led to a demand for new technologies capable of protecting the entire supply chain. DNA- based molecular tags are integrated in a range of materials and products and, if needed, unequivocally used to identify the product origins. Technologies developed around this principle are currently being commercialized (e.g., Applied DNA Sciences and Haelixa).

[0004] Although still in development, another sector that uses the intrinsic characteristics of DNA is data storage. The rapid increase in digital information is raising problems related with data storage. Permanent archives of rarely accessed data currently rely on magnetic tapes. However, this approach is not sustainable in the long term. As an example, considering a data center holding an exabyte on tape drives, estimates suggest that it would be necessary approximately US$1 billion over 10 years to build and maintain such structure (Extance, Andy, 2016, Nature 5S7, 22-24). There is an urgent need of high density, long term storage solutions. The idea of using DNA as a data storage medium is slowly gaining momentum. Very recently, researchers from the University of Washington and Microsoft, have demonstrated an automated system for data storage, that included writing (DNA synthesis) and reading steps (DNA sequencing) (Takahashi et al., 2019, Nature Scientific Reports, 9:4998). The greatest advantage of using DNA is data-storage density. Currently, the largest magnetic drive has 14 terabytes, very close to the predicted limit of the technology of 1 TB in ² . In DNA, on the other hand, a maximum storage density of 455 exabytes (455 x 10 ⁶ TB) per gram can be achieved. This means that all the information produced in the world in 1 year could be stored in 4 g of DNA (Rutten et al., 2018, Nature Reviews Chemistry, 2, 365-381).

[0005] The widespread use of DNA in traceability, or as a credible data-storage alternative to current methods is still limited by three key steps/technologies: DNA synthesis, DNA recovery/sequencing, and DNA storage. The increase demand in various applications such as medicine and forensics has fostered the development of synthesis and sequencing technologies.

[0006] At present, technological developments in DNA storage, however, are still lacking. If stored at 4 °C in solution, DNA starts to decay within weeks. At -80 °C, in solid state, the lifespan extends to 3-5 years (Rutten et al., 2018, Nature Reviews Chemistry, 2, 365-381). However, storing DNA at -80 °C is logistically demanding. Furthermore, in case of natural disasters or other major events, the lack of electricity may hinder the successful preservation of the DNA integrity. New technologies and methods are necessary to store and maintain the integrity of DNA in the longer term at room temperature.

[0007] Some solutions have already been commercialized. Most of them are based on DNA encapsulation technologies. For example, the DNAshell technology, commercialized by the company Imagene, is based on the confinement of purified and desiccated DNA under an inert atmosphere inside airtight stainless steel minicapsules (http://www.imagene.eu). Although this technology can stabilize DNA for extended periods of time, its encapsulation involves a series of steps that require the involvement of specialized personnel and equipment.

[0008] As another example, it is referred the protocol for DNA protection and encapsulation in silica developed by Paunescu et al. (Paunescu et al., 2013 Nature Protocols, 8, 2440-2448). This technique allows the recovery of DNA after exposure to 70 °C for one week, which is equivalent to 2,000 years in central Europe (Grass, R. N., et al. 2015, Angew. Chemie - Int. Ed. 54, 2552-2555). However, after silica encapsulation, the recovery of DNA is not a trivial task. It involves a protocol that uses buffered hydrogen fluoride, an etching solution that requires a series of precautionary measures when handling.

General Description

[0009] The present disclosure relates to a process for stabilizing DNA at room temperature using paraffin wax emulsion as a vehicle and lignocellulosic materials as solid support.

[0010] For the scope and interpretation of the present disclosure it is defined that "room temperature" should be regarded as a temperature between 15-30 °C, preferably between 18-25 °C, more preferably between 20-22 °C.

[0011] The DNA is stabilized in a paraffin emulsion, increasing its lifespan considerably and without the need of additional conservational measures such as refrigeration. The chemical protection of paraffin wax is further maximized by impregnating or injecting the DNA/paraffin wax emulsion in lignocellulosic materials, thus providing additional physical protection and long-term stabilization.

[0012] The present disclosure relates to a process for stabilizing DNA. As mentioned above, DNA starts to decay within weeks if not properly stabilized, thus compromising its application as a tag or as an information storage medium. Current methodologies to stabilize DNA are either logistically demanding (storage at -80 °C) or work intensive (encapsulation and release from micro or nanoparticles).

[0013] The present disclosure describes a process to stabilize DNA fragments using paraffin wax emulsion as a vehicle and lignocellulosic materials as support. Once the DNA is stabilized in the paraffin emulsion, its lifespan is considerable extended without the need of additional conservational measures such as refrigeration.

[0014] The chemical protection of paraffin wax emulsion is further maximized if impregnated or injected in lignocellulosic materials, which provides additional physical protection. Therefore, the present disclosure falls within the field of DNA preservation and storage with obvious implications in emerging fields where the preservation of information integrity in DNA is necessary.

[0015] For example, but not limited to, the present disclosure could be the basis for the development of DNA tag and trace technologies for wood or data storage devices for cold storage (in this context cold storage refers to the storage of inactive data on a long-term or indefinite basis).

[0016] One of the main technical advantages of the present disclosure is its simplicity. The stabilization of DNA is simpler and more cost-effective when compared with stabilization/conservation technologies and protocols (e.g., encapsulation protocols). The formulation consists of combining DNA with the paraffin wax emulsion. The DNA/paraffin wax emulsion is then conserved for at least three months at room temperature without significant degradation. Encapsulation methods, on the contrary, usually require time-consuming protocols and laboratory equipment.

[0017] The DNA/paraffin wax emulsion is used to impregnate and tag lignocellulosic materials. Comparing with alternative track and trace technologies, DNA tagging of lignocellulosic materials has several advantages over competing "taggant technologies". The term "taggant" refers to invisible security features that are authenticated only by advanced reading systems or laboratory analysis (e.g., inert materials, aluminium, or rare particles). Most of these technologies and detection methods are based on the optical properties of the tags. Since its detection is not dependent on its optical properties, the DNA/paraffin wax tags can be applied to a wide range of lignocellulosic materials, including related object/products. The DNA can then be detected at extreme trace levels through polymerase chain reaction (PCR) based methods. Low levels of taggant enables more cost-effective applications where high amounts of materials need to be marked (e.g., raw wood materials). Finally, the intrinsic ability of DNA to carry information is used to design complex coding systems thus reinforcing the tag security.

[0018] In an embodiment of the present disclosure, the impregnation of lignocellulosic materials with DNA/paraffin wax emulsion is used to develop cold storage systems for DNA-based information storage. Cold storage refers to the storage of inactive data on a long-term or indefinite basis. By providing a physical barrier, lignocellulosic materials further complement the chemical protection provided by paraffin wax to DNA. Therefore, it has obvious implications in the development of cold storage systems. As an example, but not limited to, it is used to develop cold storage devices to store passwords and/or other sensitive data offline - protecting it from online security breaches. Besides data-storage density, an advantage of using DNA to store sensitive information is the fact that DNA is a universal information storage mechanism in biological systems. Contrary to other outdated data storage devices (e.g., compact, and floppy disks), DNA will not become obsolete.

[0019] For those skilled in molecular biology, other embodiments are obvious. For example, but not limited to, it is used to develop DNA preservation kits for preserving DNA samples in environmental studies. DNA-based studies have been increasingly used in medicine, biodiversity monitoring and conservation. A common challenge in these studies is the need of DNA preservation protocols. Furthermore, there is also the need of keeping the samples frozen in transit. In an embodiment, paraffin wax is used to stabilize DNA at room temperature during transportation.

[0020] The protection provided by the paraffin wax emulsion is further maximized by previous immobilization of the DNA in nanoparticles. DNA encapsulation or adsorption in nanoparticles provides the benefit of adding another layer of protection to DNA. As an example, but not limited to, it is used to increase the resistance of DNA to the harsh conditions of production lines (e.g., high temperatures and extreme pH ranges). It can also be used to protect the DNA from the detrimental effects of ultraviolet radiation (UV).

[0021] The present disclosure is based on the fact that paraffin wax emulsion stabilizes DNA, increasing its lifespan. It relates to a formulation based on paraffin wax that stabilizes DNA at room temperature and is impregnated or injected in lignocellulosic based materials. In an embodiment, the steps involved in the formulation and production of the DNA stabilized/paraffin wax emulsion are: (i) Performing the isolation of DNA; (ii) DNA immobilization; (iii) Performing the mixture of DNA with paraffin wax emulsion; (iv) Incorporating DNA/paraffin wax emulsion in lignocellulosic materials; (v) Extracting and detecting DNA after stabilization. i) Performing the isolation of DNA

[0022] The nucleic acid may be synthetically produced (DNA amplicons), amplified via polymerase chain reaction (PCR) or similar methods, or isolated from the environment or a biological source (genomic DNA). The DNA may be single or double stranded. In one embodiment of the present disclosure, alphanumeric information is converted into the four base DNA sequence for data storage. An example of an encoding information scheme into DNA is described in international patent WO 2013/178801 A2. The synthetic DNA sequence is then synthetized. In another embodiment of the present disclosure, PCR technique is used to amplify DNA fragments of natural origin to be used as DNA markers or tags, as previously described in international patent WO 2015/026254. In an additional embodiment of the present disclosure, DNA is extracted from biological samples and preserved in paraffin wax emulsion at room temperature until analysis. ii) DNA immobilization

[0023] In an embodiment, the DNA is added naked or immobilized (adsorbed, intercalated, or encapsulated) in nanoparticles prior to stabilization in paraffin wax emulsion. In some embodiments before adding paraffin wax emulsion, DNA can be encapsulated. Encapsulating the DNA has the benefit of further extending its lifespan, complementing the baseline protection/stabilization provided by paraffin. Several DNA encapsulating methods are known for those skilled in nanomaterial science/molecular Biology. iii) Performing the mixture of DNA with paraffin wax emulsion

[0024] In one embodiment of the present disclosure, the DNA molecules are solubilized in water and added to the paraffin wax emulsion. The DNA in the paraffin wax emulsion is stable at room temperature during at least three months. The concentration of DNA depends on its application. Variable concentrations can be used to compensate for different DNA degradation rates. A range of molecular methods are used to calibrate DNA concentrations by those skilled in molecular biology (e.g., spectrophotometric measurement and real-time quantitative PCR). iv) Incorporating DNA/paraffin wax emulsion in lignocellulosic materials

[0025] In one embodiment of the present disclosure, the DNA (naked or immobilized) and paraffin wax emulsion formulation is applied to a range of lignocellulosic materials. Paraffin wax emulsion is routinely used in lignocellulosic materials to increase its hydrophobicity and resistance against weather and water (Wiertelak and Czarnecki., 1935, Ind. Eng. Chem. 27, 5, 543-547). Therefore, paraffin wax emulsion is an ideal vehicle to impregnate and stabilize DNA in lignocellulosic materials. DNA/paraffin wax emulsion can then be used to tag these materials (e.g., wood and cork). Considering that these kinds of materials provide additional physical protection to the already chemically stabilized DNA, the present disclosure can also be used to develop devices for DNA data storage (e.g., cold storage). v) Extracting and detecting DNA after stabilization

[0026] In one embodiment of the present disclosure, after incorporation in lignocellulosic materials, the DNA needs to be retrieved and detected/read. In some embodiments, a sample of lignocellulosic material is collected for DNA extraction. After sample collection, DNA is extracted from the lignocellulosic material with a DNA extraction protocol. For those skill in molecular biology several DNA protocols and kits are known. For example, phenol-chloroform DNA extraction (D. N. Miller, J. E. Bryant, E. L. Madsen, and W. C. Ghiorse Appl. Environ. Microbiol. 65:4715-4724, 1999). Several molecular approaches are also well known for DNA detection and/or reading. For example, but not limited to, conventional PCR, real-time quantitative PCR to detect and quantify specific DNA fragments and DNA sequencing.

[0027] As aspect of the present disclosure relates to the use of a composition comprising an emulsion of paraffin wax as a DNA preservative or stabilizer. In an embodiment, the DNA is isolated and/or in solution.

[0028] In a further embodiment, the present disclosure also relates to the use of said composition wherein the composition further comprises a lignocellulosic material substrate. In a yet further embodiment, the paraffin wax emulsion is impregnated in the lignocellulosic material.

[0029] In an embodiment, DNA is stabilized from 4 to 40 °C, preferably 20 to 30 C, more preferably 20 to 22 °C.

[0030] In an embodiment, the present disclosure comprises the use of the composition as a DNA preservative or stabilizer at 15-30 °C, preferably 20 to 22 °C.

[0031] In an embodiment, the present disclosure comprises the use of the said composition for tag and/or trace an article, preferably for identification of product origin and production step in a supply chain. In a further embodiment, it is also encompassed the use of said composition for DNA data storage, namely for long-term and offline storage of information, preferably offline storage of passwords.

[0032] In an embodiment, the paraffin wax emulsion comprises at least 40 % (w/w) of hydrogenated paraffin; preferably 45% - 60% (w/w) of hydrogenated paraffin, more preferably 50% - 55% (w/w) of hydrogenated paraffin.

[0033] In an embodiment, the present disclosure comprises the use of said composition wherein the emulsion further comprises at least 0.0001 % (w/v) of DNA per volume of paraffin wax emulsion, more preferably, at least 0.0002 % (w/v). [0034] In an embodiment, the DNA sample is naked or linked to a nanoparticle. In a further embodiment, the DNA sample is encapsulated, intercalated, or adsorbed to the nanoparticle.

[0035] In an embodiment, the composition further comprises a tag for DNA detection. In a further embodiment, said tag can be an up-converting phosphor compound, preferably sodium yttrium fluoride, ytterbium and erbium doped; or sodium yttrium oxyfluoride, ytterbium and erbium doped.

[0036] An aspect of the present disclosure relates to a composition for DNA stabilization in lignocellulosic material substrate comprising paraffin and DNA.

[0037] Another aspect of the present disclosure relates to a substrate comprising the disclosed composition. In an embodiment, the substrate is a lignocellulosic material, preferably selected from: wood, wood derivatives, lignocellulosic fibres, sugar cane bagasse, orange peel waste, corn cobs, corn stover, rice straw, peanut shells, paper, newspaper, wheat straw, banana stalk, rice bran, wheat bran, apple pomace, oil palm empty fruit bunch fibre, beech tree leaves, eucalyptus residue, cork, or combinations thereof. Preferably the lignocellulosic material is selected from: wood, wood derivatives, cork, paper, or combinations thereof.

[0038] The present disclosure also relates to a method for obtaining the substrate comprising the composition described on the present disclosure, comprising the following steps: (i) amplifying or extracting a DNA sample; (ii) mixing said DNA sample with a paraffin wax emulsion; (iii) impregnating the previous mixture in a lignocellulosic material; wherein the DNA is preserved and stabilized due to a synergistic physico-chemical protection conferred by paraffin and lignocellulosic material.

[0039] In an embodiment, the said method further comprises the step of adding a taggant to the mixture for detection of the DNA.

[0040] In an embodiment, the paraffin wax emulsion mixed with DNA is impregnated in a lignocellulosic material by spraying or injection. [0041] An aspect of the present disclosure relates to a method for identification of DNA, the method comprising the following steps: (i) obtaining a composition comprising DNA and a paraffin wax emulsion supported into a lignocellulosic material; (ii) optionally, identifying the said composition into the support by means of a tag, preferably a light responsive tag; (iii) extracting the impregnated composition comprising DNA and a paraffin wax emulsion from the lignocellulosic material, preferably by scrapping a small portion of the impregnated solid support; (iv) processing the material with a DNA-extracting solution, preferably a Cetrimonium bromide (CTAB)-based extraction solution; and (v) detecting DNA by means of molecular biology methods, preferably polymerase chain reaction.

Brief Description of Drawings

[0042] The following figures provide preferred embodiments for illustrating the description and should not be seen as limiting the scope of invention.

[0043] Figure 1: Different phases in the process of DNA/paraffin wax emulsion.

[0044] Figure 2: Real-time PCR quantification of DNA in Paraffin wax emulsion immediately after mixing the DNA (control), after 30, 60 and 90 days at room temperature. Values are expressed as Ct (inversely proportional to the target DNA quantity). There was a clear stabilizing effect of paraffin wax emulsion in DNA.

[0045] Figure 3: Real-time PCR quantification of DNA in Paraffin wax emulsion after been sprayed in wood 1) immediately after application - Control; 2 after 30 days in the dark - Dark and 3) after 30 days of exposure to harsh environmental conditions - Atmospheric. Although a fraction of the DNA stabilized by paraffin in wood was degraded after 30 days of exposure to atmospheric conditions, it was still detectable in considerable high levels. Values are expressed as Ct (inversely proportional to the target DNA quantity).

[0046] Figure 4: Different phases in the development of a device for DNA data storage based on lignocellulosic materials. In this example, paraffin wax emulsion was use as vehicle for DNA and cork was used as a physical support. [0047] Figure 5: Real-time PCR quantification of DNA when applied in cork using paraffin wax emulsion as vehicle - DNA based data storage device prototype. Accelerate aging was simulated by exposing the prototype to 60°C during 30, 60 and 150 days. The DNA was stable up to 150 days at 60°C (equivalent to 5 years at room temperature).

Detailed Description of the Invention

[0048] The present disclosure relates to the use of a composition comprising an emulsion of paraffin wax and DNA as a DNA stabilizer in lignocellulosic material substrates. It is also disclosed the methods to use said composition. The method to identify a DNA sample previously stabilized in a paraffin wax emulsion that is further impregnated in lignocellulosic material substrates is also encompassed.

[0049] An aspect of the present disclosure comprises a formulation that stabilizes DNA at room temperature and can be used to impregnate and conserve DNA in lignocellulosic materials. The formulation includes mixing DNA, naked or immobilized in nanoparticles, with paraffin wax emulsion.

[0050] In one embodiment of the present disclosure, the stabilization of DNA in paraffin wax emulsion is carried out as follows: a) DNA amplification or extraction:

[0051] In one embodiment of the present disclosure, the first step in the formulation of the DNA/paraffin wax emulsion requires the production of DNA amplicons. This step depends on the application of the formulation and it is not required in all the possible embodiments. The PCR technique can be used to amplify the DNA fragments.

[0052] In one embodiment of the present disclosure the following primers were used to amplify a 237 bp double stranded DNA fragment from a bacterial isolate:

441 F-l I SEQ ID NO.l: - 5'- AGCACTTTAAGTTGGGAGGA -3' and,

678 R I SEQ ID NO.2: - 5'- CGCTACACAGGAAATTCCA -3' . [0053] PCR amplifications were performed in 50 microliters reactions. A master mix for the reaction was made using DreamTaq PCR Master Mix (2x) (Thermofisher Scientific). The final concentration of 441 F-l and 678 R primers was 0.4 mM. 2 pi of bacterial DNA previously extracted was added to the reaction. The PCR amplification cycling conditions were as followed: 95 °C for 2 minutes, followed by 30 cycles of 94 °C for 20 s, 55 °C for 20 s and 73 °C for 40 s. A final 1-minute elongation step was performed at 72 °C.

[0054] In another embodiment of the present disclosure, genomic DNA was extracted from environmental samples for stabilization. For those skilled in the art, several DNA extractions protocols or commercial kits are available from a range of different environmental samples (e.g., soil, water, plants, animal tissues). b) DNA/paraffin wax emulsion

[0055] In another embodiment of the present disclosure, genomic or amplified DNA PCR fragments obtained as described in the previous tasks (immobilized in nanoparticles or naked), were mixed in a paraffin wax emulsion.

[0056] In one embodiment of the present disclosure the paraffin wax emulsion formula includes approximately 50 % (w/w) of hydrogenated paraffins and 50 % (w/w) water.

[0057] In an additional embodiment of the present disclosure a taggant can be added to the DNA/paraffin wax emulsion for rapid detection or visualization in production lines. As an example, but not limited to, an up-converting phosphor compound that provides a visible sign when exposed to laser pens can be added to the formulation. c) Application of the DNA/paraffin wax emulsion to lignocellulosic materials

[0058] In one embodiment of the present disclosure, the DNA/paraffin wax emulsion can be used to mark/tag wood. The DNA/paraffin wax emulsion is applied in the wood to link the material to a specific geographic location or production step and, later on, if necessary, used to certify the wood origin or a specific treatment or production step in the supply chain (please see example 1). In one embodiment of the present disclosure, DNA/paraffin wax emulsion can be sprayed over the area to be marked.

[0059] In another embodiment of the present disclosure, DNA/paraffin wax emulsion can be injected inside the wood.

[0060] In another embodiment of the present disclosure, the chemical protection provided by the paraffin wax emulsion can be combined with the physical protection of lignocellulosic materials, and used to develop a DNA based information storage device. This can be used for long-term and offline storage of information, including offline storage of passwords. d) DNA extraction and detection

[0061] In one embodiment of the present disclosure, a DNA extraction protocol was further applied to extract the impregnated DNA from lignocellulosic materials. A sample of DNA was collected by scraping a small surface area (approximately 1 cm ² ). The sample was then placed in a 2 ml lysing matrix A tube (MP Biomedicals), submerged in a 700 pL CTAB based extraction solution (pH=8, 0.06 M CTAB, 0.1 M Tris- HCL, 0.02 M EDTA, 1.4 M NaCI and 0.5 % PVP) and mechanically lysed with a Fast Prep® instrument (MP Biomedicals). In the final step of the extraction, purified DNA was eluted in 30 pL deionized water. In another embodiment of the invention, the presence of specific DNA fragments was detected in the DNA samples by quantitative real-time PCR (qPCR). PCR amplifications were performed in 20 microliters reactions. A master mix for the reaction was made using HOT FIREPol EvaGreen qPCR Supermix (lx) (Solis BioDyne). The final concentration of 441 F-l and 678 R primers was 0.1 pM. 2.5 pL of DNA sample was added to the reaction. BSA 0.1 mg/mL was used as an additive to the reaction. The specific qPCR conditions were as follow: 95 °C for 12 minutes, followed by 35 cycles of 95 °C for 20 s, 55 °C for 30 s and 72 °C for 45 s. Fluorescence signal intensity was measured during an 80 °C step for 10 s to dissociate the primer dimers. Product specificity was confirmed by melting curve analysis. The melt curve data was obtained starting at 60 °C and increasing by 0.3 °C every 15 s to a maximum of 95 °C. During the melting stage a plate read was obtained at every 0.3 °C increment. Examples:

Example 1: Evaluation of the DNA/paraffin wax emulsion stability in wood for tag and trace applications

[0062] The present example shows the steps involved in the formulation and application of DNA/paraffin wax emulsion in wood. It was further intended to evaluate its stability before and after application in lignocellulosic materials by spraying over a determined area. It was observed that the DNA in the paraffin wax emulsion before application did not show signs of degradation after three months in the dark at room temperature, as detected by quantitative real-time PCR. After application of the DNA/paraffin wax emulsion in wood, it was possible to detect DNA at high levels after BO days of exposure to natural weather and climate events (sun light exposure, temperature variations, rainfall and wet-dry cycles). The unequivocal detection of the DNA tag allowed the successful authentication of the lignocellulosic material after exposure to harsh environmental conditions.

[0063] Figure 1 shows the steps needed to incorporate the DNA sample in a paraffin wax emulsion, described as follows:

[0064] DNA amplification: In this embodiment of the present disclosure, the DNA fragments used to tag the wood were amplified from a bacterial isolate. PCR was used with primers 441 F-l and 678 R to amplify a 237 bp double stranded DNA fragment (see "a) DNA amplification or extraction" of the detailed description of the present disclosure).

[0065] Formulation of DNA/paraffin wax emulsion: The DNA fragments were mixed with a paraffin wax emulsion (see topic "b) DNA/paraffin wax emulsion" of the detailed description of the present disclosure). The stability of the DNA when mixed with paraffin was evaluated by quantifying the DNA with real-time PCR at the beginning and after three months at room temperature in the dark. No significative degradation was detected during this period (Figure 2). An up-converting phosphor nanoparticle (0.1 % w/v Erbium sodium ytterbium yttrium fluoride, Sigma) was added to the solution to confirm the successful application of the taggant on the wood via laser light excitation at 980 nm.

[0066] Application of DNA/paraffin wax emulsion in wood: In this embodiment, the DNA/paraffin wax emulsion was sprayed in a determined area in the wood. The successful application of the paraffin wax emulsion was confirmed by using a 980 nm infrared 5 mw laser pen that excites the up-converting phosphor and generates a visible optical signal.

[0067] DNA extraction and detection: A sample of DNA was collected by scrapping a small wood area (1 cm ² ). The DNA was then extracted using a CTAB-based extraction solution. The DNA tag was detected using quantitative real-time PCR with specific primers 441 F -1 and 678 R (see topic "d) DNA extraction and detection" of the detailed description of the present disclosure) and the results compared with the respective controls without the paraffin wax emulsion. The DNA was quantified at three specific experimental conditions: immediately after application, after one month in the dark and after one month of exposure to harsh environmental conditions (sun light exposure, temperature variations, rainfall and wet-dry cycles). It was possible to detect DNA even after one month of exposure to harsh environmental conditions (Figure 3).

Example 2: Development of a device for DNA data storage based on lignocellulosic materials.

[0068] The present example shows the steps (Figure 4) involved in the development of a DNA data storage prototype using paraffin wax emulsion as a vehicle and a lignocellulosic material as support. Cork was chosen as the lignocellulosic material due to its sealing properties.

[0069] It was evaluated the ability of the prototype to maintain the DNA stable over time. It was demonstrated that the prototype maintains the DNA stable up to 5 months at 60 °C, which corresponds to 5 years at room temperature. It was concluded that the integration of cork material and paraffin wax emulsion can be used to stabilize DNA during long term storage at room temperature. [0070] The effect of the chemical protection of paraffin wax emulsion combined with the impermeable properties of cork to liquids and gases (physical protection) was used to develop DNA based data storage devices.

[0071] As showed in Figure 4, this embodiment can also be split into different steps, as follows:

[0072] DNA amplification: In this embodiment of the present disclosure, the DNA fragments to be stored were amplified from a bacterial isolate. PCR was used with primers 441 F-l and 678 R to amplify a 237 bp double stranded DNA fragment (see topic "a) DNA amplification or extraction" of the detailed description of the present document).

[0073] Formulation of DNA/paraffin wax emulsion: The DNA fragments were mixed with a paraffin wax emulsion. As mentioned in other embodiments of the present subject-matter, the paraffin wax emulsion formula includes approximately 50% (w/w) of hydrogenated paraffins and 50% (w/w) water (see topic "b)" of the detailed description of the present disclosure).

[0074] Application of DNA/paraffin wax emulsion in cork: The DNA/paraffin wax emulsion was applied in a small surface of a square cork piece with 10 cm width and 3 cm thickness. An equal cork piece was placed on the top to isolate the DNA/paraffin wax emulsion. The cork pieces were then kept at 60°C to simulate aging.

[0075] DNA extraction and detection: Cork samples were collected immediately after application of the DNA/paraffin wax emulsion, after 30 days at 60°C, after 60 days at 60 °C and after 150 days at 60 °C. The DNA was then extracted using a CTAB-based extraction solution. DNA was detected using quantitative real-time PCR with specific primers 441 F -1 and 678 R (see topic "d) DNA extraction and detection" of the detailed description of the present disclosure). Although there was a slight decrease in the quantity of detectable DNA in the first 30 days at 60 °C, the quantity of DNA did not show significant changes after this period and up to 150 days at 60 °C, which corresponds to approximately 5 years at room temperature (Figure 5). [0076] The term "comprising" whenever used in this document is intended to indicate the presence of stated features, integers, steps, components, but not to preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.

[0077] The disclosure is of course not in any way restricted to the embodiments described and a person with ordinary skill in the art will foresee many possibilities to modifications thereof without departing from the basic idea of the disclosure as defined in the appended claims.

[0078] The above described embodiments are obviously combinable.

[0079] The following dependent claims set out particular embodiments of the disclosure.