METHOD FOR ENHANCING CELLOBIOSE UTILIZATION

BACKGROUND OF THE INVENTION

Field of the Invention

[0001] The present relates to a method for enhancing cellobiose utilization ability of yeast, and in particular, for enhancing intracellular cellobiose utilization of Saccharomyces cerevisiae.

Background Art

[0002] The potential of plant biomass as a cheap and renewable substrate for the production of fuel and chemicals has gained considerable interest in recent years. The biological saccharification of cellulose, the main component of plant biomass, is of particular interest in the field of fuel ethanol production. Four, biologically mediated process steps are involved in the current cellulose-to-ethanol technology: (i) cellulase enzyme production; (ii) enzymatic saccharification of cellulose; (iii) fermentation of hexose sugars (end-products of cellulose hydrolysis); and (iv) fermentation of pentose sugars (end-products of hemicellulose hydrolysis) to ethanol (Lynd, L. R., et al, Microbiol. MoI. Biol. Rev. 66:506-571 (2002)). Combining all four process steps into a one-step conversion of cellulose to fuel ethanol (called consolidated bioprocessing (CBP)) would result in a considerable reduction in processing costs (Lynd, L. R., et al, Microbiol. MoI. Biol. Rev. 66:506-511 (2002)).

[0003] Saccharomyces cerevisiae has superior ethanol formation properties, but is non- cellulolytic. The expression of cellulases in S. cerevisiae would be a prerequisite for cellulose conversion via CBP. S. cerevisiae has received a great deal of interest regarding heterologous protein expression as well as the production of ethanol and other commodity products (Lynd, L.R., et al, Microbiol. MoI Biol. Rev. 66:506-517 (2002)); (Romanos, M. S, et al, Yeast 5:423-88 (1992)). Expression of a functional cellulase system in S. cerevisiae would require the co-expression of at least three groups of enzymes, namely endoglucanases (EC 3.2.1.4); exoglucanases (EC 3.2.1.91) and β-glucosidases (EC 3.2.1.21). These enzymes act synergistically to efficiently degrade cellulose (Mansfield and Meder; 2003). β-Glucosidases catalyze the hydrolysis of soluble cellodextrins and cellobiose to glucose, β-glucosidases from various origins, e.g. Aspergillus niger (Dan,

S., et al. J Biol Chem 275:4973-4980 (2000)), Aspergillus kawachii (Van Rooyen, R., et al, J Biotechnol. 720:284-295 (2005); Iwashita, K. T. Nagahara, et al., Appl Environ Microbiol 65:5546-5553 (1999)) Candida pelliculosa var. acetaetherius (Kohchi C. and A. Toh-e, MoI Gen Genet 203:89-94 (1986)), Candida wickerhamii (Van Rooyen, R., et al, J Biotechnol. 120:284-295 (2005)), Saccharomycopsis fibuligera and Trichoderma reesei (Van Rooyen, R., et al, J Biotechnol 120:284-295 (2005)) have been successfully expressed in S. cerevisiae. This previous work focused on secreted β- glucosidases. Raynal A. and M. Guerineau, et al, MoI Gen Genet 795:108-115 (1984) have genetically engineered S. cerevisiae to produce the Kluyveromyces lactis β-glucosidase intracellularly, but the recombinant strain was unable to grow on cellobiose.

[0004] Previous work of the applicant describes the construction of cellobiose-fermenting strains of S. cerevisiae by introduction of secreted β-glucosidases from various fungal origins (Van Rooyen, R., et al, J Biotechnol. 720:284-295 (2005)). The accumulation of extracellular cellobiose has two major disadvantages: (i) it causes feedback inhibition of endoglucanases and cellobiohydrolases and therefore limits the rate and extent of cellulose hydrolysis (Yan, T., et al, J. Agric. Food. Chem. 46:421-431 (1998)); and (ii) the action of β-glucosidases releases glucose in the external environment that increases the risk of contamination.

[0005] There is therefore a need for a method for enhancing intracellular cellobiose utilization by a host cell such as S. cerevisiae, which does not have the problems described above.

BRIEF SUMMARY OF THE INVENTION

[0006] According to one embodiment of the invention, there is provided a method of modifying a yeast so as to increase intracellular cellobiose utilisation by the yeast, the method including the steps of transforming the yeast with a DNA sequence encoding mature β-glucosidase and causing the yeast to express the mature β-glucosidase wherein the β-glucosidase is maintained in the cell.

[0007] According to some embodiments of the invention, a host cell transformed as above is provided. In some embodiments, the host cell is a yeast.

[0008] According to another embodiment of the invention, there is provided a method of modifying a yeast so as to increase intracellular cellobiose utilisation by the yeast, the method including the steps of transforming the yeast with a DNA sequence encoding mature Saccaromycospis βbuligera β-glucosidase (BGLl) and causing the yeast to express the mature Saccaromycospis fibuligera β-glucosidase (BGLl). [0009] The yeast may be selected, for example, from the genera Saccharomyces,

Klnyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera,

Schwanniomyces, and Yarrowia. Yeast species as host cells include, for example, S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianns and K. fragilis. [0010] Native disaccharide (α-glucoside) transporter(s) of the yeast may be adapted, and/or heterologous disaccharide (α-glucoside) transporter(s) may be introduced into the yeast. [0011] In some embodiments, other cellulase genes of fungal origin may be co-expressed with S. βbuligera β-glucosidase. [0012] In other embodiments, other cellulase genes of fungal origin may be co-expressed with the polypeptide having β-glucosidase activity (E. C. 3.2.1.21). [0013] According to another embodiment of the invention, there is provided an expression cassette containing a constitutive promoter and a DNA sequence encoding mature S. βbuligera β-glucosidase (BGLl). [0014] The promoter may be, for example, a S. cerevisiae phosphoglycerate kinase 1

(PGKl) gene promoter or any other suitable promoter which can drive gene expression in the host cell of the invention. [0015] According to a further embodiment of the invention there is provided a vector including the expression cassette. [0016] The vector may be transformed into a yeast, such as S. cerevisiae SIGMA, and maintained episomally. The vector may be a plasmid, and in particular, a multicopy, episomal plasmid such as ySSFI. The vector may also be a CEN plasmid. [0017] According to another embodiment of the invention, there is provided a yeast strain transformed with the expression vector described above. [0018] The yeast strain may be, for example, S. cerevisiae SIGMA into which the expression vector has been chromosomally integrated.

[0019] The transformed yeast strain may have an increased capacity for transporting extracellular cellobiose into the intracellular space of the yeast compared to an untransformed yeast cell. Further, the transformed yeast cell may be able to hydrolyse more cellobiose than an untransformed yeast cell.

[0020] Cellobiose transport by the transformed yeast may involve adaptation of its native disaccharide (α-glucoside) transporter(s). More specifically, the AGTl (also known as MALI l) transporter or maltose permeases (for example MAL21 , MAL31, MAL41, MAL51, and MAL61) may serendipitously transport cellobiose, and elevated levels of these transporters in the presence of maltose may enhance cellobiose transport.

[0021] Cellobiose transport by the transformed host cell, such as S. cerevisiae, may be further enhanced by introducing heterologous disaccharide (α-glucoside) transporter(s). Examples of such transporters are di- and tri-saccharide transporters, including maltose, maltotriose and lactose transporters from other microbial hosts.

[0022] In other embodiments, lactose permease, such as from K. lactis, can be co- expressed with the polypeptide containing the β-glucosidase activity, and the permease can facilitate cellobiose transport into the host cell of the invention.

[0023] Further improvement of cellobiose transport, using either over-expressed natively or heterologously expressed transporters, may be facilitated in selection studies for enhanced growth (elevated growth rate) of recombinant yeasts producing β-glucosidase intracellularly on cellobiose as sole carbon source.

[0024] The transformed yeast strain may also display phenotypic characteristics such as flocculation, pseudohyphal growth and biofilm-formation.

[0025] The transformed yeast strain may also be able to adhere to cellulose.

[0026] According to a further embodiment of the invention, there is provided a method of up-regulating the α-glucoside transporter of a yeast, such as S. cerevisiae, the method including the step of transforming the yeast with a DNA sequence encoding mature S. fώuligera β-glucosidase (BGLl).

[0027] In other embodiments of the invention, methods of culturing a host cell transformed with a polynucleotide encoding a polypeptide with β-glucosidase activity is provided. In some embodiments, these methods comprise contacting the host cell with a cellobiose-containing substrate under suitable conditions to allow fermentation of the cellobiose.

[0028] In other embodiments of the invention, methods for selecting for increased utilization of cellobiose by a transformed host cell according to the invention are provided.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 depicts a 2583-kb DNA fragment (SEQ ID NO: 1), containing the open reading frame that encodes for the mature Saccharomycospis fibuligera BGLl enzyme protein sequence (SEQ ID NO: 2). The EcoRI and Xhol sites were used to introduce the DNA fragment into plasmid yAZ4 to yield plasmid ySSF (Figure 2).

[0030] Figure 2 is a schematic representation of plasmid ySSFI used in the invention. A

Saccharomycopsis fibuligera BGLl fragment encoding the mature BGL β-glucosidase was inserted between the PGKIp, and PGKIj, representing the S. cerevisiae phosphoglycerate kinase 1 gene promoter and terminator sequences. The S. cerevisiae 2- micron autonomous replicating sequence (ARS2) is responsible for episomal replication of the plasmid and the S. cerevisiae orotidine-5'-phosphate decarboxylase (URA3) is used as selectable marker.

[0031] Figure 3 depicts: (A) Wrinkled colony morphology of the enhanced cellobiose- utilizing strain after a 3 month selection procedure; and (B) the smooth colony morphology of the other is indicated at the right.

[0032] Figure 4 depicts the stereochemistry of the disaccharides, cellobiose (A) and maltose (B).

[0033] Figure 5 depicts the RNA Bio-dot analysis of the SIGMA(SSFI) strain grown in

YP-medium containing (i) glucose, (ii) maltose and (iii) cellobiose as sole carbon sources, respectively. 15 μg Total RNA from individual cultivations were loaded in each lane. DIG-labeled probes for the different transporters are indicated in the left corner of each blot.

[0034] Figure 6 depicts growth (filled symbols) and substrate consumption (open symbols) of SIGMA(SSFI) during aerobic batch cultivation in minimal medium containing (i) 10 g.L ^"1 cellobiose (δ) and (ii) 7 g.L ^"1 cellobiose + 3 g.L ^"1 maltose (O).

[0035] Figure 7 depicts cell morphology of S. cerevisiae SIGMA(SSFI) grown in medium containing (A) glucose, (B) maltose and (C) cellobiose.

[0036] Figure 8 depicts biofilm formation observed during growth of S. cerevisiae

SIGMA(SSFI) after 2 days in minimal medium containing (A) maltose and (B) cellobiose. (C) is the control grown in glucose where no biofilm development took place. The surface area of the flow cell channel is highlighted with a black line in each of the photos.

DETAILED DESCRIPTION OF THE INVENTION

[0037] Cellulose is the most abundant biopolymer and is found almost exclusively in plant cell walls. Plants synthesize about 30 x 10 ⁹ tons of cellulose annually (Cox, P.M., et al., Nature 408: \ 84-\S7 (2001)). From a biotechnological point of view, it is an attractive source for the production of fermentable sugars. However, low cost technology for overcoming the recalcitrance of cellulosic biomass has not yet been established. A promising approach to conquer this barrier involves the production of cellulolytic enzymes, hydrolysis of biomass, and fermentation of resulting sugars in a single step process via a cellulolytic microorganism (Lynd, L.R., et al, Microbiol. MoI. Biol. Rev. 66:506-577 (2002)).

[0038] The disaccharide cellobiose (Figure 4a) is the end product of the breakdown of cellulose by cellulolytic enzymes such as endoglucanases, cellobiohydrolases, and exoglucanases. Despite the utility of certain yeast for efficient ethanol production on glucose substrates, these yeast are not readily able to utilize cellobiose in an industrially applicable setting to conduct fermentation.

[0039] It is widely recognized that S. cerevisiae does not produce a dedicated cellobiose permease/transporter. Therefore one strategy would be to produce a secretable β-glucosidase that catalyzes the hydrolysis of cellobiose to glucose extracellularly. However, extracellular cellobiose hydrolysis has disadvantages, such as feedback inhibition on cellulase activity, diffusion of the enzyme away from the cell, and high risk of microbial contamination upon hydrolysis to glucose. Engineering yeasts for efficient cellobiose utilization would be a significant step towards the development of a recombinant host that will be able to hydrolyse cellulose.

[0040] The applicants have now found that host cells, such as S. cerevisiae, when transformed with a DNA sequence encoding mature β-glucosidase so that it can produce functional β-glucosidase intracellularly, is better able to utilise cellobiose intracellularly.

Other cellulase genes of fungal origin may be co-expressed with the β-glucosidase, such as cellulase (endoglucanase, cellobiohydrolase, and/or exoglucanase) activities. These transformed yeast strains represent a step towards the efficient degradation and utilisation of cellulosic materials by recombinant host cells, such as S. cerevisiae, producing a consortium of cellulolytic enzymes.

Definitions

[0041] A "vector," e.g., a "plasmid" or "YAC" (yeast artificial chromosome) refers to an extrachromosomal element often carrying one or more genes that are not part of the central metabolism of the cell, and is usually in the form of a circular double-stranded DNA molecule. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear, circular, or supercoiled, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell. Preferably, the plasmids or vectors of the present invention are stable and self-replicating.

[0042] An "expression vector" is a vector that is capable of directing the expression of genes to which it is operably associated.

[0043] The term "heterologous" as used herein refers to an element of a vector, plasmid or host cell that is derived from a source other than the endogenous source. Thus, for example, a heterologous sequence could be a sequence that is derived from a different gene or plasmid from the same host, from a different strain of host cell, or from an organism of a different taxonomic group (e.g., different kingdom, phylum, class, order, family genus, or species, or any subgroup within one of these classifications). The term "heterologous" is also used synonymously herein with the term "exogenous."

[0044] The term "domain" as used herein refers to a part of a molecule or structure that shares common physical or chemical features, for example hydrophobic, polar, globular, helical domains or properties, e.g., a DNA binding domain or an ATP binding domain. Domains can be identified by their homology to conserved structural or functional motifs.

[0045] A "nucleic acid," "polynucleotide," or "nucleic acid molecule" is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of

which may be single-stranded or double-stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA.

[0046] An "isolated nucleic acid molecule" or "isolated nucleic acid fragment" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, undine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any phosphoester anologs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5 ¹ to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).

[0047] A "gene" refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids. "Gene" also refers to a nucleic acid fragment that expresses a specific protein, including intervening sequences (introns) between individual coding segments (exons), as well as regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences.

[0048] A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified, e.g., in Sambrook, J., Fritsch, E. F. and Maniatis, T. MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 1 1 and Table 1 1.1 therein (hereinafter "Maniatis", entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. Stringency conditions can be adjusted to screen for moderately similar

fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions. One set of conditions uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2X SSC, 0.5% SDS at 45 ⁰ C for 30 min, and then repeated twice with 0.2X SSC, 0.5% SDS at 5O ⁰ C for 30 min. For more stringent conditions, washes are performed at higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS are increased to 60 ⁰ C. Another set of highly stringent conditions uses two final washes in 0.1 X SSC, 0.1% SDS at 65 ⁰ C. An additional set of highly stringent conditions are defined by hybridization at 0.1 X SSC, 0.1% SDS, 65 ⁰ C and washed with 2X SSC, 0.1% SDS followed by 0.1 X SSC, 0.1% SDS.

[0049] Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see, e.g., Maniatis at 9.50-9.51). For hybridizations with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see, e.g., Maniatis, at 1 1.7-11.8). In one embodiment the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; more preferably at least about 20 nucleotides; and most preferably the length is at least 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe.

[0050] The term "percent identity", as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by

comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.

[0051] As known in the art, "similarity" between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.

[0052] "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, NY (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences disclosed herein were performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5: 151-153) with the default parameters (GAP PENALTY=IO, GAP LENGTH PENALTY=IO). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WIND0W=5 and DIAGONALS SAVED=5.

[0053] Suitable nucleic acid sequences or fragments thereof (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% to at least about 75% identical to the amino acid sequences reported herein, at least about 80%, at least about 85%, or at least about 90% identical to the amino acid sequences reported herein, or at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the amino acid sequences reported herein. Suitable nucleic acid fragments are at least about 70%, at least about 75%, or at least about 80% identical to the nucleic acid sequences reported herein, at least about 80%, at least about 85%, or at least about 90% identical to the nucleic acid sequences reported herein, or at

least about 95%, at least about 96%, at least about 97%, at least 98%, at least about 99%, or 100% identical to the nucleic acid sequences reported herein. Suitable nucleic acid fragments not only have the above identities/similarities but typically encode a polypeptide having at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, or at least 250 amino acids.

[0054] The term "probe" refers to a single-stranded nucleic acid molecule that can base pair with a complementary single stranded target nucleic acid to form a double-stranded molecule.

[0055] The term "complementary" is used to describe the relationship between nucleotide bases that are capable to hybridizing to one another. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the instant invention also includes isolated nucleic acid fragments that are complementary to the complete sequences as reported in the accompanying Sequence Listing as well as those substantially similar nucleic acid sequences.

[0056] As used herein, the term "oligonucleotide" refers to a nucleic acid, generally of about 18 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule. Oligonucleotides can be labeled, e.g., with 32P- nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. An oligonucleotide can be used as a probe to detect the presence of a nucleic acid according to the invention. Similarly, oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of a nucleic acid of the invention, or to detect the presence of nucleic acids according to the invention. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.

[0057] A DNA or RNA "coding region" is a DNA or RNA molecule which is transcribed and/or translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. "Suitable regulatory regions" refer to nucleic acid regions located upstream (5 ¹ non-coding sequences), within, or downstream (3' non- coding sequences) of a coding region, and which influence the transcription, RNA processing or stability, or translation of the associated coding region. Regulatory regions may include promoters, translation leader sequences, RNA processing site, effector

binding site and stem-loop structure. The boundaries of the coding region are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding region can include, but is not limited to, prokaryotic regions, cDNA from mRNA, genomic DNA molecules, synthetic DNA molecules, or RNA molecules. If the coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding region.

[0058] "Open reading frame" is abbreviated ORP and means a length of nucleic acid, either DNA, cDNA or RNA, that comprises a translation start signal or initiation codon, such as an ATG or AUG, and a termination codon and can be potentially translated into a polypeptide sequence.

[0059] "Promoter" refers to a DNA fragment capable of controlling the expression of a coding sequence or functional RNA. In general, a coding region is located 3' to a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity. A promoter is generally bounded at its 3' terminus by the transcription initiation site and extends upstream (5* direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease Sl), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.

[0060] A coding region is "under the control" of transcriptional and translational control elements in a cell when RNA polymerase transcribes the coding region into mRNA, which is then trans-RNA spliced (if the coding region contains introns) and translated into the protein encoded by the coding region.

[0061] "Transcriptional and translational control regions" are DNA regulatory regions, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding region in a host cell, hi eukaryotic cells, polyadenylation signals are control regions.

[0062] The term "operably associated" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably associated with a coding region when it is capable of affecting the expression of that coding region (i.e., that the coding region is under the transcriptional control of the promoter). Coding regions can be operably associated to regulatory regions in sense or antisense orientation.

[0063] The term "expression," as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.

[0064] The functional expression of S. fώuligera β-glucosidase (BGLl) in the intracellular space of yeast is described herein. Additionally, any suitable enzyme with β-glucosidase activity (EC 3.2.1.21) can be used in the host cells of the present invention. Suitable enzymes with β-glucosidase activity (EC 3.2.1.21) include the enzymes listed in Table 1.

[0065] "Substantially retained in the cytoplasm" or " Substantially retained in the cell" as used herein refers to expression by a host cell of a polypeptide having a particular enzymatic activity, which is not moved into the extracellular space, for example, by secretion. Therefore, this enzymatic activity is not functionally detected in the extracellular space, for instance in the culture media in which the cells are grown. Rather, the enzyme activity is maintained internally in the cell. Assays for detecting enzymatic activities are known in the art. hi some embodiments, the assay for enzymatic activity may comprise measuring β-glucosidase activity, hi some embodiments, β-glucosidase activity is measured by incubating appropriately diluted cells or cell extracts with 5 mM of p-nitrophenyl-β-D-glucopyranoside (pNPG) in 50 mM citrate buffer at optimal pH and temperature for the specific enzyme according to the method previously described (Van Rooyen, R., et ah, J Biotechnol. 720:284-295 (2005)).

[0066] "Mature" as used herein in reference to a polypeptide, amino acid sequence or protein, refers to the completely processed and expressed form of the polypeptide, amino

acid sequence or protein. Mature proteins lack a functional leader sequence, such as a secretion signal. In some embodiments, the mature proteins of the invention completely lack a leader sequence. In some embodiments of the invention, the mature protein is encoded by genes disclosed in Table 1. These polynucleotides may be modified according to the invention to lack a secretion signal, retain β-glucosidase activity, and therefore have the protein which they encode be expressed substantially only in the cytoplasm of the cell. In some embodiments of the invention the mature protein is S. fibuligera β-glucosidase (BGLl) which lacks a secretion signal.

[0067] Lack of a functional secretion signal prevents co-translational import into the secretory pathway and thus allows the nascent polypeptide to be released in the cytoplasm of the cell. The secretory signal hypothesis has been well characterized in a large range of cell types and although secretion signals vary in sequence, each has eight or more non- polar amino acids at its center (Alberts et al. Molecular Biology of the Cell. 2002. p. 667 and 694).

[0068] The "catalytic domain" is also referred to as the "active site." The structure and chemical properties of the active site allow the recognition and binding of the substrate. The active site is usually a small pocket at the surface of the enzyme that contains residues responsible for the substrate specificity (charge, hydrophobicity, steric hindrance) and catalytic residues which often act as proton donors or acceptors or are responsible for binding a cofactor such as PLP, TPP or NAD. The active site is also the site of inhibition of enzymes. In the case of β-glucosidase, the catalytic domain contains residues that allow the recognition, binding, and chemical action of the polypeptide on the cellobiose substrate.

[0069] Suitable enzymes with β-glucosidase activity (EC 3.2.1.21) can be found encoded by the genomes of the organisms listed in Table 1.

[0070] "β-glucosidase activity" or "(EC 3.2.1.21) activity" (using the IUBMB Enzyme

Nomenclature) as defined herein includes the hydrolysis of terminal, non-reducing β-D- glucose residues with release of β-D-glucose. Other names for this enzyme activity include: gentiobiase; cellobiase; emulsin; elaterase; aryl-β-glucosidase; β-D-glucosidase; β-glucoside glucohydrolase; arbutinase; amygdalinase; p-nitrophenyl β-glucosidase; primeverosidase; amygdalase; limarase; salicilinase; and β-l,6-glucosidase. Suitable substrates include cellobiose and other β-D-glucosides. Some enzymes with (EC 3.2.1.21)

activity also hydrolyse one or more of the following: β-D-galactosides, α-L-arabinosides, β-D-xylosides, and β-D-fucosides.

[0071] In some embodiments, the β-glucosidase is a β-glucosidase I. In other embodiments, the β-glucosidase is a β-glucosidase II.

Table 1. Suitable β-glucosidases.

[0072] Polypeptides which have β-glucosidase activity also include fragments of the mature polypeptide, provided the fragments retain the activity. The polypeptide fragment from about amino acid 278 to about 309 of SEQ ID NO: 2 comprises the active site of the enzyme. In some embodiments, polypeptides of the invention can be defined to include the β-glucosidase activity (EC 3.2.1.21) found in polypeptides with at least 70, at least 80, at least 90, at least 95, at least 96, at least 97, at least 98, at least 99, or 100% homology with the polypeptide comprising amino acid residues 278 to 309 of SEQ ED NO: 2.

[0073] Suitable host cells of the present invention include, for example, the genera

Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces , Hansenula, Kloeckera, Schwanniomyces, and Yarrowia, and yeast species as host cells can include, for example, S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus, and K. fragilis.

[0074] A constitutive promoter, such as a S. cerevisiae phosphoglycerate kinase 1

(PGKl) gene promoter, can be used to express the S. fibuligera (BGLl) enzyme. However, any suitable promoter able to drive gene expression can be used in embodiments of the present invention.

[0075] The native disaccharide (α-glucoside) transporter(s) of the yeast can be adapted, and/or heterologous disaccharide (α-glucoside) transporter(s) can be introduced into the yeast to facilitate better cellobiose transport. For example, the S. cerevisiae AGTl transporter (also known as Mall l) or maltose permeases (for example Mal61) may

serendipitously transport cellobiose, and elevated levels of these transporters in the presence of maltose may enhance cellobiose transport. In some embodiments, the transformed host cell has an increased capacity for transporting extracellular cellobiose into the intracellular space of the host compared to an untransformed host cell. In some embodiments, the transformed host cell is further transformed with an exogenous permease which may facilitate uptake of cellobiose in the host cell. Examples of such useful transporters are di- and tri-saccharide transporters, including maltose, maltotriose and lactose transporters from other microbial hosts such as those listed in Table 2. In some embodiments, the host cell may be transformed with a lactose permease from K. lactis LACl 2. Other permeases suitable for various embodiments of the present invention are disclosed in Table 2.

Table 2. Suitable permeases.

*Does not have a specific name

[0077] Further improvement of cellobiose transport, using over-expressed native or heterologous transporters can be facilitated in selection for enhanced growth (increased growth rate) of recombinant yeasts producing β-glucosidase retained intracellular^ grown on cellobiose as the sole carbon source. In some embodiments of the present invention, the mRNA of endogenous disaccharide transporters is expressed at least about 2 fold, at least about 4 fold, at least about 12 fold, at least about 50 fold, at least about 100 fold, at least about 1000 fold, or at least about 10,000 fold higher levels in selected cells of the invention relative to unselected cells. It is recognized in the art that higher mRNA levels often yield higher protein expression levels. mRNA levels can be measured by various known methods including quantitative Northern blotting, RNA Slot Blotting (Maniatis 4.9), and Reverse Transcriptase-PCR methods (Nolan T. et al., Nat. Protoc. 1 : 1559-1582 (2006)).

[0078] The transformed yeast cell is also able to hydrolyse more cellobiose than an untransformed yeast cell, and may be able to adhere to cellulose. Phenotypic characteristics such as flocculation, pseudohyphal growth and biofilm-formation are also displayed.

[0079] By a nucleic acid having a nucleotide sequence at least, for example, 95%

"identical" to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the β-glucosidase polypeptide. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence shown of SEQ ED NO: 1, the ORF (open reading frame) of the BGLl DNA.

[0080] As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a nucleotide sequence or polypeptide of the present invention can be determined conventionally using known computer programs. A method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.) In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the subject nucleotide sequence, whichever is shorter.

[0081] If the subject sequence is shorter than the query sequence because of 5' or 3' deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5' and 3' truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5' or 3' ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of

the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.

[0082] For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention.

[0083] Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large portion of the nucleic acid molecules having a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ED NO: 1 or fragments thereof, will encode polypeptides that have "β-glucosidase activity." In fact, since degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many instances, this will be clear to the skilled artisan even without performing the above described comparison assay. It will be further recognized in the art that, for such nucleic acid

molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having β-glucosidase functional activity.

[0084] Thus, the invention further includes β-glucosidase polypeptide "variants" which show substantial biological activity. Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.

[0085] The skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.

[0086] For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et ai, "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247: 1306-1310 (1990), wherein the authors indicate that there are two main strategies for studying the tolerance of an amino acid sequence to change.

[0087] The first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.

[0088] The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244: 1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.

[0089] As Cunningham and Wells state, these two strategies have revealed that proteins are often surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein. For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are

generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, VaI, Leu and He; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and GIu; replacement of the amide residues Asn and GIn, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Tip, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and GIy.

[0090] Derivatives of S. fibuligera BGLl polypeptides of the present invention are polypeptides which have been altered so as to exhibit additional features not found on the native polypeptide. Derivatives can be covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example, a detectable moiety such as an enzyme or radioisotope). Examples of derivatives include fusion proteins.

[0091] An analog is another form of a BGLl polypeptide of the present invention. An

"analog" also retains substantially the same biological function or activity as the polypeptide of interest, i.e., functions as a BGLl . An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

[0092] The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

[0093] The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

[0094] Polynucleotides of SEQ ID NO: 1 and SEQ ID NO: 1 1 and the translated amino acid sequences of SEQ ID NO:2 and SEQ ID NO: 12 are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described herein. Nevertheless, DNA sequences generated by sequencing reactions can contain sequencing errors. The errors exist as misidentified nucleotides, or as insertions or deletions of nucleotides in the generated DNA sequence. The erroneously inserted or deleted nucleotides cause frame shifts in the reading frames of the predicted amino acid sequence. In these cases, the predicted amino acid sequence diverges from the actual amino acid sequence, even though the generated DNA sequence may be greater than 99.9% identical

to the actual DNA sequence (for example, one base insertion or deletion in an open reading frame of over 1000 bases).

[0095] The polynucleotide encoding for the mature polypeptides of the invention many include only the coding sequence for the mature polypeptide; the coding sequence of any domain of the mature polypeptide; and the coding sequence for the mature polypeptide (or domain-encoding sequence) together with non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

[0096] Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only sequences encoding for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequences.

[0097] The present invention further encompasses polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the amino acid sequence shown in SEQ ED NO:2 and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein, or domains of SEQ ED NO:2).

[0098] By a polypeptide having an amino acid sequence at least, for example, 95%

"identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. Ln other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.

[0099] The present invention also encompasses polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% similar to the polypeptide of SEQ LD NO:2, and to portions of such polypeptide with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

[0100] As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.

Codon Optimization

[0101] As used herein the term "codon optimized coding region" means a nucleic acid coding region that has been adapted for expression in the cells of a given organism by replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism.

[0102] Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in the sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation). The "genetic code" which shows which codons encode which amino acids is reproduced herein as Table 3. As a result, many amino acids are designated by more than one codon. For example, the amino acids alanine and proline are coded for by four triplets, serine and arginine by six, whereas tryptophan and methionine are coded by just one triplet. This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.

Table 3: The Standard Genetic Code

[0103] Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.

[0104] Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage tables are readily available, for example, at the "Codon Usage Database" available at http://www.kazusa.or.jp/codon/ (visited March 20, 2008), and these tables can be adapted in a number of ways. See Nakamura, Y., et al. Nucl. Acids Res. 28:292 (2000). Codon usage tables for yeast, calculated from GenBank Release 128.0 [15 February 2002], are reproduced below as Table 4. This table uses mRNA nomenclature, and so instead of thymine (T) which is found in DNA, the tables use uracil (U) which is found in RNA. The Table has been adapted so that frequencies are calculated for each amino acid, rather than for all 64 codons.

Table 4: Codon Usage Table for Saccharomyces cerevisiae Genes

[0105] By utilizing this or similar tables, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species.

[0106] Randomly assigning codons at an optimized frequency to encode a given polypeptide sequence, can be done manually by calculating codon frequencies for each amino acid, and then assigning the codons to the polypeptide sequence randomly. Additionally, various algorithms and computer software programs are readily available to those of ordinary skill in the art. For example, the "EditSeq" function in the Lasergene Package, available from DNAstar, Inc., Madison, WI, the backtranslation function in the VectorNTI Suite, available from InforMax, Inc., Bethesda, MD, and the "backtranslate" function in the GCG- Wisconsin Package, available from Accelrys, Inc., San Diego, CA. In addition, various resources are publicly available to codon-optimize coding region sequences, e.g., the "backtranslation" function at http://www.entelechon.com/bioinformatics/backtranslation.php ?lang=eng (visited April 15, 2008) and the "backtranseq" function available at

http://bioinfo.pbi.nrc.ca:8090/EMBOSS/index.html (visited July 9, 2002). Constructing a rudimentary algorithm to assign codons based on a given frequency can also easily be accomplished with basic mathematical functions by one of ordinary skill in the art.

[0107] Codon-optimized coding regions can be designed by various methods known to those skilled in the art including software packages such as "synthetic gene designer" (http://phenotvpe.biosci.umbc.edu/codon/sgd/index.php).

[0108] Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

[0109] The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; and yeast plasmids. However, any other vector may be used as long as it is replicable and viable in the host.

[0110] The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

[0111] The DNA sequence in the expression vector is operatively associated with an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: ENOl, PGKl, TEFl, GPDl, ADHl and the E. coli, lac or trp, and other promoters known to control expression of genes in prokaryotic or lower eukaryotic cells. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression, or may include additional regulatory regions.

[0112] In addition, the expression vectors may contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as URA3, HIS3, LEU2, TRPl, LYS2 or ADE 2, dihydro folate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillih resistance in E. coli.

[0113] The vector containing the appropriate DNA sequence as herein, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

[0114] Thus, in certain aspects, the present invention relates to host cells containing the constructs described herein. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, e.g., Saccharomyces cerevisiae, or the host cell can be a prokaryotic cell, such as a bacterial cell.

[0115] Representative examples of appropriate hosts include: bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; thermophilic or mesophlic bacteria; fungal cells, such as yeast; and plant cells, etc. In some embodiments, the host may be selected from the group consisting of Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

[0116] In some embodiments, a method for selecting cells with improved ability to grow on cellobiose is disclosed. According to some embodiments, host cells transformed with a heterologous β-glucosidase may be cultured on cellobiose containing media and selected for ever increasing growth rate on the cellobiose containing media. In some embodiments, variant colonies displaying the fastest growth rate on the media may be selected. These "variant" colonies have undergone genetic or epigenetic changes which confer an increase in the cell's ability to grow on cellobiose relative to the average growth rate of the host cells on cellobiose. According to some embodiments, these variant colonies be selected and can be re-plated onto cellobiose containing media, allowed to grow up into colonies, and the fastest growing of these colonies can be selected and suspended in liquid and subsequently re-plated for further iterations of the method. In some embodiments, further iterations of the method can yield variants with many accumulated genetic or epigenetic changes which can contribute to the variant's ability to grow well on cellobiose- containing media.

[0117] In some embodiments of the invention, the fastest growing colonies will be easily visibly detectable by the ordinarily skilled artisan. The fastest growing colonies will have the largest diameter; therefore, these colonies will be the most useful for the next iteration of the method. In the selection process, the top 10, 5, 4, 3, 2, or 1% fastest growing of the colonies can be selected for propagation in the next iteration of the method. There may be at least 10 iterations of the method in some embodiments, but there may be as many as at least 20, at least 30, at least 50, at least 70, at least 100, or at least 1000 iterations in other embodiments. Iterations of the method will be useful until the strain produced by the method grows at least 10% faster than the original strain on cellobiose media. In other embodiments, iterations of the method can produce selected cells that are able to grow at least 20, at least 30, at least 50, at least 75, at least 100, at least 200, or at least 1000% faster than the original strain. Methods for determining the rate of growth will be apparent to the ordinarily skilled artisan and include, for example, measuring the optical density of cultures grown on the cellobiose-containing media as well as plating the cells on solid media containing cellobiose in order to observe the time required to view colonies upon incubation. The skilled artisan will be aware that the faster growing cells form visible colonies first and therefore larger colonies than other cells.

[0118] In some embodiments of the invention, methods for fermenting cellobiose are provided. In other embodiments, methods for fermenting cellobiose to ethanol are provided. In further embodiments, host cells of the invention are able to ferment cellobiose to ethanol.

[0119] In some embodiments, cells or cell cultures as described above are exposed to a lignocellulosic material. It will be appreciated that suitable lignocellulosic material may be any feedstock that contains soluble and/or insoluble cellulose, where the insoluble cellulose may be in a crystalline or non-crystalline form. In various embodiments, the lignocellulosic biomass comprises, for example, wood, corn, corn stover, sawdust, bark, leaves, agricultural and forestry residues, grasses such as switchgrass, ruminant digestion products, municipal wastes, paper mill effluent, newspaper, cardboard or combinations thereof.

[0120] The following embodiments of the invention will now be described in more detail by way of these non-limiting examples.

Examples

Example 1

Strains and Media

[0121] Table 5 summarises the genotypes and sources of the yeast and bacterial strains, as well as the plasmids that were constructed and used in the experiment.

Table 5: Microbial strains and plasmids

[0122] Recombinant plasmids were constructed and amplified in Escherichia coh XLl-

Blue cultivated at 37°C in Luria-Bertani liquid medium or on Luria-Bertani agar (Sambrook, J., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY (1989)). Ampicillin for selecting and proliferating resistant bacteria was added to a final concentration of 100 μg.mL ^"1 .

[0123] S. cerevisiae SIGMA was cultivated in either YPD (1% yeast extract, 2% peptone,

2% glucose) or synthetic complete (SC) medium (0.67% yeast nitrogen base (Difco) containing amino acid supplements, 2% glucose). Recombinant S. cerevisiae was grown on YP medium (1% yeast extract, 2% peptone) containing either lO g.L ^'1 glucose, cellobiose or maltose as sole carbon source.

DNA manipulations and vector construction

[0124] Standard protocols were followed for DNA manipulations (Sambrook, J., et al,

Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY (1989)). The enzymes for DNA cleavage and ligation were purchased from Roche and used as recommended by the supplier. Restriction endonuclease-digested DNA was eluted from agarose gels by the method of Benson (1984).

PCR amplification

[0125] PCR products were amplified from either plasmid DNA (15 ng) or S. cerevisiae genomic DNA (200 ng) with the aid of sequence specific primers (Table 6). The reaction mixture (50 μl) contained the following components: 10 x reaction buffer, 500 μM of each of the nucleotide triphosphates, 0.25 μM of each primer, DNA template and 2.5 U EXPAND polymerase (Roche). DIG-labelled probes were synthesized with the aid of the "PCR DIG Probe Synthesis Kit" (Roche).

Table 6: Summary of the PCR primers

Primer name Primer Sequence Tm (product Gene size) targeted

SSFI L: 5'- 64 (2583 bp) BGLl

TCGCGAATTCATGGTCCCAATTCAA 65

AACTATACC-3'

(SEQ ID NO: 3)

R: 5'-

CCGCTCGAGCGGTCAAATAGTAAA

CAGGACAGATG-3'

(SEQ ID NO: 4)

ACT L: 5'-ACTGAAGCTCCAATGAACC-S' 65 (549 bp) ACTl

(SEQ ID NO: 5) 65

R:5'-CATCGACATCACACTTCATG-3'

(SEQ ID NO: 6)

AGT L: 5 ¹ - 64 (486 bp) AGTl

ATGATTGCTGTGGGACAA-3' 64 (α-

(SEQ ID NO: 7) Glucoside

R: 5'-GTCTCGTTCTTCTTCCATTAA- transporter

3' (SEQ ID NO: 8) s)

MAL L: 5'-ATGATTGCTGTGGGACAA-S' 64 (499 bp) MAL6J,

(SEQ ID NO: 9) 65 MALI l

R: 5'- (Maltose

AGACAAGTAATTCTCGTTCTTCT-3' transporters)

(SEQ ID NO: 10)

Construction of vector for intracellular β-glucosidase production

[0126] A 2,583-kb DNA fragment containing the open reading frame (SEQ ID NO: 1) that encodes for the mature Saccharomycospis fibnligera BGLl enzyme protein sequence (SEQ ID NO: 2), was amplified with primers SSFI-L (SEQ ID NO: 3) and SSFI-R (SEQ ED NO: 4) from plasmid ySFI. The PCR product was digested with EcoRI and Xhol and ligated into the corresponding sites of plasmid yAZ4 to yield ySSFI (Figure 2).

DNA sequencing

[0127] The nucleotide sequences of the individual constructs were determined by amplifying DNA fragments with the Big Dye Terminator cycle-sequencing reader reaction with AmpliTaq DNA polymerase F5 (Applied Biosystems kit) using fluorescently labelled nucleotides, and the reaction mixtures were subjected to electrophoresis on an Applied Biosystems automatic DNA sequencer (model ABI Prism 377). Sequence data were analyzed by using the PC/GENE software package (IntelliGenetics, Inc., Mountain View, Calif.).

Yeast transformation

[0128] S. cerevisiae SIGMA was transformed with the recombinant plasmid by the dimethyl sulfoxide-lithium acetate method described by Hill, J., et al, Niicl Acids Res 19:5791 (1991) and the transformants were confirmed with PCR. Disruption of the uracil phosphoribosyltransferase (FURl) gene in the plasmid-containing S. cerevisiae transformants was performed to ensure auto-selection of the URA3-beaήng expression plasmids in non-selective medium (Kern, L., et al, Gene 55:149-157 (1990)). Autoselective (furl::LEU2) transformants were screened for on SC plates deficient in uracil and leucine. The resultant BGL 1 -expressing yeast strain was designated SIGMA(SSFI).

Selection for cellobiose utilization

[0129] S. cerevisiae transformants expressing the BGLl intracellularly were grown in rich medium (YPD) to mid-log phase. The cells were appropriately diluted and plated onto YPC-medium (1% yeast extract, 2 % peptone, 1% cellobiose). The plates were incubated at room temperature. After 10 days, colony- forming transformants were transferred to fresh YPC-plates. The fastest-growing transformants (based on colony

size) were selected, suspended in water, and subsequently plated to fresh cellobiose- containing medium and allowed to grow for 14 days. The cells from the fastest growing colonies where then selected, suspended in liquid, plated and allowed to grow as before. This procedure was repeated for 8 months.

Enzyme assay

[0130] β-Glucosidase activity was measured by incubating appropriately diluted cells or cell extracts with 5 mM of p-nitrophenyl-β-D-glucopyranoside (pNPG) in 50 mM citrate buffer at optimal pH and temperature for the specific enzyme according to the method previously described (Van Rooyen, R., et al, J Biotechnol. J 20:284-295 (2005)).

Total RNA isolation

[0131] RNA was isolated from shake flask cultures (YP-medium containing lO g.L ^" of either glucose, maltose or cellobiose) of S. cerevisiae SIGMA(SSFI) 48 h after inoculation. RNA isolations were performed as described by Sambrook et al. (1989).

Slot blot analysis

[0132] Slot blot hybridizations and autoradiography were performed according to

Sambrook, J., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY (1989), using the SCR072/0 Minifold II slot blotter (Schleicher and Schuell). The DNA probes were labeled using a random primed DIG- labeling kit (Roche) in accordance with the manufacturer's recommendations.

Medium and inoculum

[0133] Growth was measured as absorbance at 600 nm. Batch cultivation was conducted in YP-medium containing either 10 g.L ^'1 cellobiose or 7 g.L ^"1 cellobiose + 3 g.L ^' maltose. Approximately 2 ml of a stationary phase culture was used to inoculate the bioreactor to an OD600 of 0.05.

Fermentation

[0134] Batch cultivations were conducted in a 1.3 L computer-controlled glass bioreactor

(Bioflow 110 Non-Jacketed Vessels, New Brunswick Scientific Co.) with a total volume of 900 mL. Temperature and pH were controlled at 30 ⁰ C and pH 5.0 (by the addition of

1 M potassium hydroxide), respectively. The culture broth was mechanically agitated at

500 φm and aerated with 0.5 L.min ^'1 airflow for aerobic conditions. Dow-Corning antifoam (BDH) was added to control foaming. All cultivations were performed in duplicate.

Flow cell experiment

[0135] S. cerevisiae SIGMA(SSFI) grown in minimal medium (0.67% yeast nitrogen base (Difco) with amino acid supplements; 1% cellobiose) for 48 hours on a rotary shaker at 30 ⁰ C was used for inoculating the flow cell. With the peristaltic pump (Watson Marlow 205S) switched off, 200 μl of the yeast inoculum was injected into the multiple channel flow cell. The cells were allowed to establish themselves in the flow cell for 12 hours, after which the flow was resumed at 3 mL.tf ¹ . The yeast biofϊlms were maintained in minimal medium containing different carbon sources ((1%): (i) glucose, (ii) maltose and (iii) cellobiose) for 7 days at room temperature.

Analytical methods

[0136] Samples for determination of cell density, dry cell weight and substrate consumption were taken from the fermentor at 3-4 hour intervals. Cells were removed from the samples via filtration through 0.22 μm disposable filters as previously described (Gδrgens, J.F., et al., Biotechnol Bioeng 73:238-245 (2001)). The dry cell weight of each culture was determined according to the method described by Meinander, N., et al, Microbiology /42: 165-172 (1996).

Substrate consumption and product formation

[0137] Cellobiose, maltose, ethanol, glycerol and acetic acid concentrations were determined by high-performance liquid chromatography (FIPLC), with a Waters 717 injector (Milford, MA, USA) and Agilent 1 100 pump (Palo Alto, CA, USA). The compounds were separated on an Aminex FTPX87-H column (Biorad, Richmond, CA) at 45°C, with 5 mM H ₂ SO ₄ at 0.6 ml min ^"1 as mobile phase, and detected with a Waters 410 refractive index detector.

Calculations

[0138] Specific growth rates were calculated at individual points on the growth curve (In

OD600 vs. time) by using the four surrounding points (two on each side) on the curve to determine the slope at the specific point. The maximum of these specific growth rates for the individual fermentations was selected, and an average calculated for the strain's specific performance on each carbon source. The rates of substrate consumption were calculated from the slope of the (In (substrate concentration)/(Dry weight) vs. time) graph.

Results and discussion

[0139] A DNA fragment (SEQ ID NO: 1) containing the mature peptide sequence of

Saccharomycopsis fibuligera β-glucosidase (BGLl) (SEQ ID NO: 2) (Figure 1) was cloned in an episomal yeast expression vector (Figure 2) and transformed to S. cerevisiae SIGMA. Recombinant S. fibuligera β-glucosidase was produced in the intracellular space of the recombinant S. cerevisiae strain, designated SIGMA(SSFI). The SIGMA(SSFI) strain was selected on cellobiose-containing plates for uptake and subsequent utilization of cellobiose. The resulting recombinant strain was subjected to continuous selective pressure over a period of 3 months, aimed at adapting its native disaccharide transporter(s) for cellobiose uptake and subsequent hydrolysis by the intracellular β-glucosidase.

[0140] The selection was carried out by plating a dilution series of the transformed

SIGMA [SSFI] stain onto YP-medium containing cellobiose as sole carbon source (50 plates). After 10 days a total of 19 colonies appeared. These colonies were each diluted in water and plated to fresh plates (every 2 weeks). After 5 months, 3 colonies grew significantly faster than the rest - they appeared after 5 days whereas the other colonies routinely appeared after 7-10 days. Therefore, they also showed significantly larger colony sizes. These 3 colonies were kept under "selective pressure" on cellobiose media for an additional 3 months. Growth of the final 3 colonies was compared with regards to OD readings.

[0141] This selection resulted in a strain with a significantly improved growth rate of

0.09 h-1 in 10 g.L ^'1 cellobiose shake-flask culture relative to the pre-selected strain which grew at rates too slow to be measured effectively in this assay.

[0142] One of the 10 best cellobiose-utilizing SIGMA(SSFI) colonies displayed an unusual wrinkled colony morphology (Figure 3). Halme et al. (2004) described a similarly wrinkled colony morphology phenotype that resulted from loss-of-function mutations in either IRAl or IRA2, the genes encoding the yeast Ras GTPase-activating proteins. This particular cell surface alteration causes increased adhesion of S. cerevisiae to the agar.

[0143] In order to explain the mechanism by which the adapted SIGMA(SSFI) strain is able to transport and utilize cellobiose intracellular^, the inventors investigated the native disaccharide transporters of S. cerevisiae, Cellobiose and maltose are both disaccharides of glucose and differ only with regards to their 1,4-linkage (α- and β-linked in maltose and cellobiose, respectively). As a result, cellobiose and maltose display similar stereochemistry, as indicated in Figure 4. Subsequent RNA Bio-Dot analysis on the total RNA from the adapted strain when grown on cellobiose and maltose as sole carbon source confirmed the induction of RNA transcripts for the native β-glucoside and maltose transporters (Figure 5). The reference strain (before adaptation) grown in glucose- medium did not show induction of either of the transporters. These results suggest that the transport of cellobiose (presumably via the maltose permease and α-glucoside transporter) is the rate-limiting step in the utilization of cellobiose by SIGMA(SSFI). In addition, no β-glucosidase activity could be detected in the supernatant of the cellobiose- growing culture, but only in the intracellular space and therefore confirmed that the cellobiose has to be transported across the plasma membrane in order to be utilized.

[0144] The RNA Bio-Dot results obtained with the cellobiose-utilizing SIGMA(SSFI) showed that both the maltose permease and α-glucoside transporter were induced in the adapted strain (Figure 5). Presumably, these native transporters have different affinities for cellobiose and therefore co-facilitate sugar transport at different concentrations of cellobiose, suggesting that cellobiose transport in the adapted strain is in agreement with the multi-component model described for sugar transport in S. cerevisiae.

[0145] The adapted SIGMA(SSFI) strain was cultivated in high-performance bioreactors to determine if the rate of transport and subsequent utilization of cellobiose was sufficient to enable growth on cellobiose as sole carbon source. During aerobic cultivation, SIGMA(SSFI) was able to grow in YP-medium containing lO g.L ^"1 cellobiose at a maximum specific growth rate (μ _m ax) of 0.17 h ^"1 (Figure 6). Interestingly, when the

carbon source was changed to a mixture of cellobiose and maltose (7 g.L ^"1 cellobiose and 3 g.L ^"1 maltose), the μ _max increased to 0.3O h ^"1 . The addition of maltose significantly improved the uptake of cellobiose. It was therefore presumed that the transport of cellobiose (via the combined action of the maltose permease and α-glucosidase transporter) is the rate-limiting step in the utilization of cellobiose by SIGMA(SSFI). This argument is also supported by the significantly increased substrate consumption rate of 0.37 g.g DW'.h ^'1 when SIGMA(SSFI) was grown in the cellobiose/maltose-medium, compared to 0.25 g.g DW ^"1 . h ^"1 when grown in cellobiose medium.

[0146] The phenotypic characteristics displayed by the cellobiose-utilizing

SIGMA(SSFI) strain, namely pseudohyphal growth (Figure 7), flocculation (Figure 5) and biofilm formation (Figure 8), are typical adaptations that occur in S. cerevisiae in response to nutrient limitation (Gagiano, M., et al, FEMS Yeast Res 2:433-470 (2002)). A large number of genes, which are mostly involved in the signalling pathways that regulate the dimorphic switch from yeast to hyphal form, have been linked with these adaptations. It has been hypothesized that pseudohyphae grow invasively into the solid agar medium and away from the colony in order to search for nutrient-rich substrates (Bauer, F.F. and I. S. Pretorius, Focus Biotechnol - Appl Microbiol 2: 109-133 (2001); Pan, X., et al, Cur Opin Microbiol 3:567-572 (2000)). Industrial processes that require easy separation of yeast cells (by sedimentation) and subsequently immobilization of the cells onto biomass support particles derive major benefit from using flocculent yeast strains (Kondo, A., et al, Appl Microbiol Biotechnol 55:291-296 (2002); Liu Y., et al, Biochem E ng J 2:229-235 (1998); Furuta, H., J Ferment Bioeng #4:169-171 (1997)).

[0147] The invention describes the adaptation of native S. cerevisiae transporters to facilitate efficient transport of cellobiose across the yeast cell membrane. This novel cellobiose-utilizing S. cerevisiae strain is an important link in the construction of a cellulolytic yeast that resembles some of the properties associated with the highly efficient cellulase enzyme systems of cellulosome-producing anaerobes. SIGMA(SSFI)'s ability to efficiently remove cellobiose from the extracellular space together with its flocculating, pseudohyphae- and biofilm-forming properties could contribute significantly to the development of S. cerevisiae that degrades cellulose.

[0148] It will be apparent to persons skilled in the art that the invention is not intended to be limited to Saccharomyces cerevisiae, and that it could also be extended to other yeasts.

Example 2

Enhanced cellobiose transport into S. cerevisiae

[0149] To explore the ability of exogenous sugar transporters to facilitate cellobiose transport in S. cerevisiae, the Kllacl2 gene (encoding the of the lactose permease of K. lactis) was amplified from the K. lactis genome using primers of SEQ ID NO: 13 and SEQ ID NO:14, and cloned into pTZ57R (E, coli cloning vector), generating pTZ-Kllacl2. The DNA sequence of the K. lactis Kllacl2 gene was confirmed (SEQ ID NO: 1 1). The Kllacl2 was retrieved and cloned into expression vector YEpenoBBH, resulting in plasmid YEpenoBBH-Kllacl2. The ENO l^Kllacl 2-ENOl ₇ expression cassette was retrieved as a BamHl-BgHl (partials) fragment and cloned onto ySSFI (containing the mature BGL). The final construct, ySSFI-Lacl2, was transformed into S. cerevisiae Y294. Several transformants were tested by cultivation on cellobiose as sole carbon source. Three of the transformants were able to grow to an optical density of 2.0 to 2.4 on cellobiose medium, whereas the negative control was only able to grow to an OD of 0.4. The three transformants still displayed the his3 and trpl phenotype (as is to be expected) and the presence of the Lac 12 gene was confirmed by means of PCR.

[0150] These examples illustrate possible embodiments of the present invention. While the invention has been particularly shown and described with reference to some embodiments thereof, it will be understood by those skilled in the art that they have been presented by way of example only, and not limitation, and various changes in form and details can be made therein without departing from the spirit and scope of the invention. Thus, the breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0151] All documents cited herein, including journal articles or abstracts, published or corresponding U.S. or foreign patent applications, issued or foreign patents, or any other documents, are each entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited documents.